Rueda et al. Microb Cell Fact (2016) 15:59 DOI 10.1186/s12934-016-0457-z Microbial Cell Factories RESEARCH Open Access Structural and functional features of self‑assembling protein nanoparticles produced in endotoxin‑free Escherichia coli Fabián Rueda1,2,3, María Virtudes Céspedes3,4, Alejandro Sánchez‑Chardi5, Joaquin Seras‑Franzoso1,2,3,9, Mireia Pesarrodona1,2,3, Neus Ferrer‑Miralles1,2,3, Esther Vázquez1,2,3, Ursula Rinas6,7, Ugutz Unzueta3,4, Uwe Mamat8, Ramón Mangues3,4, Elena García‑Fruitós1,2,3,10 and Antonio Villaverde1,2,3* Abstract Background: Production of recombinant drugs in process-friendly endotoxin-free bacterial factories targets to a lessened complexity of the purification process combined with minimized biological hazards during product applica‑ tion. The development of nanostructured recombinant materials in innovative nanomedical activities expands such a need beyond plain functional polypeptides to complex protein assemblies. While Escherichia coli has been recently modified for the production of endotoxin-free proteins, no data has been so far recorded regarding how the system performs in the fabrication of smart nanostructured materials. Results: We have here explored the nanoarchitecture and in vitro and in vivo functionalities of CXCR4-targeted, self- assembling protein nanoparticles intended for intracellular delivery of drugs and imaging agents in colorectal cancer. Interestingly, endotoxin-free materials exhibit a distinguishable architecture and altered size and target cell penetra‑ bility than counterparts produced in conventional E. coli strains. These variant nanoparticles show an eventual proper biodistribution and highly specific and exclusive accumulation in tumor upon administration in colorectal cancer mice models, indicating a convenient display and function of the tumor homing peptides and high particle stability under physiological conditions. Discussion: The observations made here support the emerging endotoxin-free E. coli system as a robust protein material producer but are also indicative of a particular conformational status and organization of either building blocks or oligomers. This appears to be promoted by multifactorial stress-inducing conditions upon engineering of the E. coli cell envelope, which impacts on the protein quality control of the cell factory. Keywords: Protein engineering, Recombinant proteins, Nanoparticles, Nanomedicine, Biomaterials, Biodistribution, E. coli, Endotoxin-free strains Background versatile, environmentally friendly and fully scalable, The physiological diversity of microorganisms makes microbial fabrication is in many aspects more convenient them suitable platforms for the cost-effective fabrication than chemical synthesis [2–4]. Microbial cells, namely of a diversity of substances and macromolecules, includ- bacteria and yeast, have been exploited as factories for ing emerging nanostructured materials such as metal the production of many protein drugs that have been deposits, polymeric granules, functional amyloids and approved for use in humans. Historically, Escherichia viruses or virus-like protein assemblies [1]. Being highly coli was the pioneering cell factory for protein produc- tion because of the well-known genetics and metabolism. *Correspondence: antoni.villaverde@uab.cat However, the presence of endotoxins in the cell envelope 1 Institut de Biotecnologia i de Biomedicina, Universitat Autònoma de of Gram-negative bacteria poses an up to now unsolvable Barcelona, Bellaterra, Cerdanyola del Vallès, 08193 Barcelona, Spain obstacle in the use of this organism for drug production Full list of author information is available at the end of the article © 2016 Rueda et al. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/ publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Rueda et al. Microb Cell Fact (2016) 15:59 Page 2 of 12 [5]. Lipopolysaccharide (LPS) removal increases the diameter. These oligomers are fully stable in vivo upon complexity of protein purification processes, and it is tail vein administration in colorectal cancer mice mod- recognized that LPS, even in low amounts, is a common els [17] and accumulate intracellularly in primary tumor contaminant of complex protein complexes such as bac- and in metastatic foci [16]. T22-GFP-H6 protein nano- teriophages [6] and also of plain recombinant proteins particles were produced in the KPM22 L11-derivative [7]. In fact, contaminant LPS and other cell envelope [21], endotoxin-free strain KPM335 (msbA52, ΔgutQ, components are responsible for wrongly attributed bio- ΔkdsD, ΔlpxL, ΔlpxM, ΔpagP, ΔlpxP, ΔeptA, frr181) logical effects of recombinant proteins tested in biomedi- and its parental K-12 strain BW30270 (CGSC#7925– cal assays, and for poor biocompatibility (some examples MG1655; F−, rph+, fnr+) with a wild-type LPS. The can be found in [8–10]). In this context, Gram-positive design of KPM335, based on the incorporation of non- bacteria, yeast and mammalian cells are endotoxin-free reverting deletions of seven genes to disrupt Kdo biosyn- alternatives to E. coli, and their prevalence in protein thesis and modifications of lipid IVA, prevents the strain drug production has steadily increased [11, 12], although from regaining the potential to synthesize normal LPS or not absent of problems. endotoxically active lipid IVA derivatives through acquir- Very recently [13], endotoxin-free E. coli strains have ing mutations. Also, E. coli K-12 MC4100 ([araD139], been developed by fine multi-step mutagenesis as a way (argF-lac)169, λ—relA1, rpsL150, rbsR22, flb5301, deoC1, to merge the versatility of E. coli as an advantageous pro- pstF25 StrepR) and BL21 Origami B [F− ompT hsdSB(r− B R tein production platform in the absence of endotoxic m−B ) gal dcm lacY1 ahpC (DE3) gor522::Tn10 trxB (Kan , contaminants in its products. Those strains have been TetR)] (Novagen, Darmstadt, Germany) were used for proved efficient in the production of diverse soluble pro- protein production as controls. KPM335, BW30270 tein species [13] and also of inclusion bodies intended as and MC4100 were transformed with plasmid pTrc99a, smart topologies [14] or as functional amyloids for intra- whereas Origami B was transformed with a pET22b- cellular protein release [15]. We wanted here to explore derived plasmid. All expression plasmids contained the how the production, functionalities and nanoarchitecture T22-GFP-H6 DNA sequence optimized by the codon of a complex, virus-like protein nanoparticle (T22-GFP- usage of E. coli and have been described previously [20]. H6) designed as drug carrier [16] would be affected by Bacteria were always grown in Lysogeny Broth (LB) rich the use of this particular fabrication platform. These par- media [22]. Part of the protein was produced with the ticles are formed by a self-organizing, CXCR4-targeted assistance of the Protein Production Platform of CIBER- polypeptide that accumulates, in the assembled form, BBN/IBB, at the UAB (http://www.nanbiosis.es/unit/ in tumoral tissues of colorectal cancer animal mod- u1-protein-production-platform-ppp/). els [16, 17]. Accumulation in tumor is promoted by the N-terminal peptide T22, which is a potent ligand of the Competent cells and transformation cell surface cytokine receptor CXCR4 [16]. CXCR4 is Cultures were grown overnight at 37 °C with shaking at overexpressed in colorectal cancer cells and linked to 250 rpm and used as a 1/100 inoculum in 50 ml of LB. tumor aggressiveness [18]. The combination of the highly After reaching an optical density (OD550) between 0.2 cationic T22 peptide with the C-terminal histidine tail and 0.4, MC4100, BW30270 and Origami B cultures were in a modular protein promotes the self-assembly of the centrifuged (4000×g) at 4 °C for 15 min. Pellets were whole construct, favored by the bipolar charge distribu- resuspended in 12.5 ml of cold and sterile 50 mM CaCl2 tion of the building block surface [19]. Recently, we have and incubated for 45 min in an ice bath. Cells were cen- observed that strain-dependent genetic features of the trifuged again as described above and resuspended in producing bacteria impact on tumor targeting and on 1.25 ml of cold and sterile 50 mM CaCl2 in glycerol (15 % the whole-body biodistribution of the oligomeric con- v/v) to prepare aliquots of 200 µl and stored at −80 °C. To struct upon its systemic administration [20]. Then, we transform the cells, 40 ng of plasmid DNA were added to were interested in dissecting the structure and activities the competent cells. The mixtures were incubated on ice of these tumor-homing nanoparticles when produced in for 30–60 min, warmed up to 42 °C for 45 s and placed endotoxin-free E. coli cells, whose complex genetic devel- on ice for 30 s. After incubation, 800 µl of LB media were opment might have resulted in relevant physiological added, and transformed cells were incubated at 37 °C shifts. for 1 h. Finally, the cells were plated on LB-agar plates containing the corresponding antibiotic. In the case of Methods KMP335 strain, cells were grown to an OD550 between Strains, plasmids and media 0.2 and 0.4, placed on ice for 20 min and sedimented by T22-GFP-H6 is a tumor-targeted modular protein that centrifugation (3100×g, 4 °C, 20 min). The pellets were self-assembles as toroid nanoparticles of about 12 nm of centrifuged and resuspended successively in 40, 20 and Rueda et al. Microb Cell Fact (2016) 15:59 Page 3 of 12 10 ml of H2O (ice-cold and sterile), followed by a wash incubated with anti-GFP antibody (1:500, sc-8334, Santa with 5 ml of 10 % glycerol (ice-cold and sterile). The final Cruz Biotechnology, Santa Cruz, CA, USA), followed by pellet was resuspended in 1 ml of 10 % glycerol (ice- incubation with a secondary HRP-conjugated anti-rab- cold and sterile) to prepare 50-µl aliquots for storage at bit IgG (H + L) antibody (Bio-Rad, Hercules, CA, USA) −80 °C. Electrocompetent KPM335 cells were trans- at a dilution of 1:2000. Protein bands were visualized formed by electroporation in pre-chilled 0.2 cm elec- with a solution of 25 % cold methanol, 0.2 % H2O2 and troporation cuvettes using 50 µl of competent cells and 0.65 mg/ml of 4-chloronaftol in PBS, and images were 40 ng of plasmid DNA. Cells were pulsed using a Gene obtained using a GS800 Calibrated Densitometer scanner Pulser MX cell electroporator (Bio-Rad, Hercules, CA, (Bio-Rad). USA) at 25 µF, 200 Ω, 2500 V and 4.7–4.8 ms. Immedi- ately after the pulse, 800 µl of LB medium were added, Fluorescence intensity and the mixture was incubated at 37 °C for 1 h. Cells were Fluorescence intensity of T22-GFP-H6 was determined plated on LB-agar plates containing ampicillin (100 µg/ in a Varian Cary Eclipse fluorescence spectrometer (Agi- ml) and incubated at 37 °C overnight. lent Technologies, Mulgrave, Australia) at excitation and emission wavelengths of 450 and 510 nm, respectively. Protein production and purification Overnight cultures were inoculated in 500 ml of LB Particle size and zeta potential media with 100 µg/ml ampicillin in 2-L flasks. Strepto- Size distribution and zeta potential of nanoparticles were mycin (at 30 µg/ml) was also added to MC4100 cultures, measured by dynamic light scattering (DLS) at 633 nm and tetracycline (100 µg/ml) and kanamycin (33 µg/ml) (Zetasizer Nano ZS, Malvern Instruments Limited, Mal- to Origami B cultures. Each culture was grown at 37 °C vern, Worcestershire, UK). Samples were analyzed by and 250 rpm to an OD550 of about 0.5 before isopropyl- triplicate averaging of fifteen single measurements. β-d-thiogalactoside (IPTG) was added to 1 mM to induce recombinant gene expression. T22-GFP-H6 was pro- Mass spectrometry (MS) analysis duced overnight at 20 °C with shaking (250 rpm) in all Purified protein was diluted 1:2 with H2O MilliQ and cases. dialyzed against 50 mM of NH4HCO3 for 1.5 h. After After overnight production, cultures were centrifuged dialysis, protein was mixed with a matrix of 2.6 dihy- (3280×g, 4 °C, 40 min), and the cell pellets were resus- droxyacetophenone (1:1), and 1 µl of the mixture was pended in 20 mM Tris–HCl, pH 8.0, containing 500 mM deposited on a ground steel plate. Samples were analyzed NaCl, 20 mM imidazole (buffer A), and an EDTA-free using a lineal method in an UltrafleXtreme MALDI-TOF protease inhibitor cocktail (Complete EDTA-free, Roche instrument (Bruker Daltonics, Bremen, Germany) with Diagnostics, Indianapolis, IN, USA). Intra-cellular pro- ion acceleration of 25 kV. tein was extracted by cell disruption using a French press (Thermo FA-078A) at 1100 psi, and purified by His-tag Circular dichroism (CD) affinity chromatography using a 1-ml HiTrap Chelating CD measurements were carried out in a Jasco J-715 spec- HP column (GE Healthcare, Piscataway, NJ, USA) in an tropolarimeter at 25 °C and 10 µM protein in 160 mM ÄKTA purifier FPLC (GE Healthcare). Protein separa- NaHCO3, pH 7.4. CD and high-tension (HT) voltage tion was achieved with a linear imidazole gradient from spectra were obtained over a wavelength range of 200– 20 mM to 500 mM, by diluting 20 mM Tris–HCl, pH 250 nm at a scan rate of 50 nm/min, a response time of 8.0, plus 500 mM NaCl and 500 mM imidazole (buffer 0.5 s, and a bandwidth of 0.5 nm. B) in buffer A, and fractions were collected and dialyzed against 166 mM NaHCO3, pH 7.4. The amount of protein Electron microscopy was determined by Bradford’s assay [23], and the integ- To visualize the ultrastructure of protein nanoparticles rity of the protein was analyzed by sodium dodecylsulfate by transmission electron microscopy (TEM), 2 µl of puri- polyacrylamide gel electrophoresis (SDS-PAGE), fol- fied protein (0.2 mg/ml) were placed on carbon-coated lowed by Western blot analysis as described below. copper grids for 1 min. Excess of sample was bloated and 2 µl of 1 % w/v uranyl acetate were added for nega- Western blot analysis tive staining. Samples were immediately visualized in a Separated fractions were subjected to 10 % SDS-PAGE TEM Jeol JEM-1400 (Jeol Ltd., Tokyo, Japan) equipped according to Laemmli’s method [24]. Protein was trans- with a Gatan CCD Erlangshen ES1000 W camera (Gatan ferred to nitrocellulose membranes (GE Healthcare, Inc, Abingdon, UK) and operating at 80 kV. Ultrastruc- Piscataway, NJ, USA) that were blocked overnight with tural analyses of nanoparticle morphology were com- 5 % skim milk in PBS. After blocking, membranes were plemented with imaging in a nearly native state with a Rueda et al. Microb Cell Fact (2016) 15:59 Page 4 of 12 Field Emission Scanning Electron Microscope (FESEM). hours after the administration, we measured ex vivo the For that, protein samples were directly deposited over fluorescence emitted by the nanoparticles accumulated sues (kidney, lung, and heart, liver and brain) using IVIS® silicon wafers (Ted Pella, Reading, CA, USA), air dried in the whole and slice sectioned tumor and normal tis- and observed with a high resolution in-lens secondary electron detector through a FESEM Zeiss Merlin (Zeiss, Spectrum equipment (Perkin Elmer, Waltham, MA, Oberkochen, Germany), operating at 2 kV. USA). The fluorescence signal was digitalized, and after subtracting the autofluorescence, it was displayed as a Analysis of cell internalization pseudocolor overlay and expressed as Radiant efficiency. HeLa cells were cultured at 37 °C in a humidified atmos- Data were corrected by the specific fluorescence emitted phere with 5 % CO2 for 24 h and plated in treated 24 well by the different nanoparticles. Signal difference between plates (Nunclon surface, Nunc 150628) with MEM-α groups was determined by applying the non-parametric medium supplemented with 10 % fetal bovine serum (FBS) Mann–Whitney test. and 2 mM Glutamax (Gibco, Rockville, MD, USA). Later, medium was removed and the cells were washed with Dul- Histological and immunohistochemical evaluation becco’s phosphate-buffered saline (DPBS). Then, 25 nM At necropsy, tumors were fixed with 4 % formaldehyde in of T22-GFP-H6 in 250 µl Optipro supplemented with PBS for 24 h and embedded in paraffin for histological and 2 mM l-glutamine was added. After incubation at 37 °C immunohistochemical evaluation. 4 µm sections, were for 1 h, cells were treated with trypsin in DPBS (1 mg/ml) processed as previously described [16, 17] and haema- for 15 min, centrifuged at 300×g for 15 min, and pellets toxylin and eosin (H&E) stained for histological analysis, were resuspended in 300 µl DPBS. Samples were analyzed that was performed by two independent observers. We by flow cytometry using a FACSCanto system (Becton– assessed CXCR4 membrane expression and nanoparticle Dickinson, Franklin Lakes, NJ, USA) with a 15 W air- cell internalization in tumor and normal tissues by IHC cooled argon-ion laser at 488 nm excitation for GFP. using primary anti-CXCR4 (1:300; Abcam, Cambridge, UK) or anti-GFP (1:100; Santa Cruz Biotechnology, CA, Confocal microscopy USA), and secondary HRP conjugated antibody, followed HeLa cells were plated on a MatTek culture dish (Mat- by chromogenic detection. We quantified the percent- Tek Corporation, Ashland, MA, USA) at 150,000 cells/ age of CXCR4-expressing cells in relation to the total cell plate and incubated at 37 °C for 24 h. After incubation, number and their staining intensity, scoring each sample medium was removed to wash the cells twice with DPBS. from 0 to 3 (where 3 is the maximal intensity) and multi- Optipro medium supplemented with 2 mM l-glutamine plying both parameters to obtain its H-score. Representa- and 25 nM T22-GFP-H6 were added, and cells were tive pictures were taken using CellэB software (Olympus incubated at 37 °C for 1 h. To visualize the samples, Soft Imaging v3.3, Tokyo, Japan) at 400×. plasma membranes and the nucleus were labeled using 2.5 mg/ml CellMask Deep Red and 0.2 mg/ml Hoechst Quantitative real‑time PCR 33342 (Molecular Probes, Eugene, OR, USA), respec- For isolation of total RNA, triplicate cultures of E. coli tively. A confocal laser scanning microscope TCS-SP5 strains BW30270 and KPM335 were grown aerobically (Leica Microsystems, Heidelberg, Germany) was used with shaking (250 rpm) at 37 °C in LB medium to the to analyze the samples, and the images were processed mid-exponential growth phase at an OD600 of 0.6–0.7. through the Imaris Bitplane software (Bitplane, Zurich, The bacterial cells were harvested in the presence of Switzerland). RNAprotect Bacteria Reagent for immediate RNA stabi- lization prior to RNA isolation using the RNeasy Mini Kit Determination of in vivo biodistribution and on-column DNase treatment in accordance with the This study was approved by the Institutional Animal Eth- recommendations of the manufacturer (Qiagen). RNA ics Committee. We implanted CXCR4-overexpressing concentrations were determined using a NanoDrop 2000 SP5 human colorectal tumor line to generate subcuta- spectrophotometer (Thermo Scientific), and the integ- neous colorectal tumors in swiss nude mice (Charles rity of the RNAs was verified with RNA Nano Chips in River, France) as previously described [16, 17]. When an Agilent 2100 Bioanalyzer. The Maxima First Strand tumors reached ca. 500 mm3, mice were randomly allo- cDNA Synthesis Kit was used to generate cDNA from cated to Origami B, MC4100, KPM335, BW30270 or 0.3 µg RNA following the manufacturer´s instructions buffer-treated groups (N = 3–5/group). The experimen- (Thermo Scientific, Waltham, MA, USA). The cDNA lev- tal mice received a single intravenous bolus of the cor- els of chaperone genes were then analyzed by quantita- responding nanoparticle (500 μg in carbonate buffer, tive real-time PCR (RT-qPCR) using a LightCycler 480 pH 7.4), whereas control mice received only buffer. Five Instrument II with LightCycler 480 SYBR Green I Master Rueda et al. Microb Cell Fact (2016) 15:59 Page 5 of 12 reaction mixes according to the instructions of the manu- In all cases, T22-GFP-H6 appeared as a stable full-length facturer (Roche Diagnostics). RT-qPCR was performed product showing the expected molecular mass of about with an initial denaturation at 95 °C for 5 min, followed 30 kDa (Fig. 1b). The steadily observed double band was by 45 cycles of 10 s at 95 °C, 10 s at 60 °C, and 10 s at probably due to different conformational species of the 72 °C. Each sample was analyzed in duplicate using 1:15 protein. When purified by His affinity chromatography and 1:50 dilutions of the cDNAs and the gene-specific from bacterial cell extracts, T22-GFP-H6 was eluted primers listed in Table 1. The primer pairs (Table 1) were in two separated peaks (P1 and P2) irrespective of the designed following the rules of highest possible sensi- strain used for production (Fig. 1c). P2 has been previ- tivity and efficiency with the Primer3 2.3.4 plugin of the ously observed as the one containing protein materials Geneious v9.0.5 software (Biomatters, Auckland, New more efficient in cell penetration assays [20]. MS of these Zealand). Relative expression levels of the target genes P2 samples revealed the expected molecular masses of all were normalized to the internal reference gene ihfB for protein variants with minor signs of proteolytic instabil- the β-subunit of the integration host factor using the ity (more prevalent in MC4100 through the occurrence comparative 2−∆∆Ct method [25]. of a degradation fragment of 28.4 kDa; Fig. 1d), also con- firming that the double band observed in blots (Fig. 1b) Results and discussion was indeed due to conformational variability instead to The self-assembling protein T22-GFP-H6 (Fig. 1a) was significant occurrence of truncated forms. Both protein produced in the endotoxin-free strain KPM335 and its yield and emitted fluorescence were significantly lower parental BW30270, as well as in MC4100 and Origami in KPM335 than in other strains (Fig. 2a), as well as the B strains, used in previous studies for the routine fab- specific fluorescence emission of T22-GFP-H6 (Fig. 2b). rication of T22-GFP-H6 nanoparticles. While the gen- While a moderate protein yield in recombinant KPM335 eration time of KPM335 has increased by about 50 % in was not unexpected according to previous reports refer- comparison to the parental wild-type strain, no signs of ring to different produced protein species [13], a specific instability, lysis, foaming or cell death could be observed. fluorescence emission lower than that observed in its parental BW30270 (and in other reference strains) was indicative of a differential conformation of T22-GFP-H6 Table 1 Primers used for RT-qPCR monomers or an alternate configuration of the resulting Gene Primer Sequence Amplicon nanoparticles. length (bp) The formation of nanoparticles was firstly confirmed by DLS, revealing a regular size of the material rang- tig ECtig353F AGGGTCTGGAAGCGATCGAAG 301 ing between 10 and 15 nm, depending on the cell fac- ECtig653R GGGAAGGTCACGTCGATGGT tory (Fig. 3a). Interestingly, and according to the above ibpA ECibpA85F CAGAGTAATGGCGGCTACCCT 299 hypothesis of a particular organization of T22-GFP-H6 ECibpA383R GCTTCCGGAATCACGCGTTC as produced in KPM335, P1 nanoparticles produced hscB EChscB191F CGTTAATGCGCGCGGAATATTTG 301 in this strain were particularly large, reaching around EChscB491R AGTTGTTCGGCACTGCTTCG 75 nm in diameter (Fig. 3a). This variability did not result hchA EChchA398F TCGCGGATGTTGTTGCCAG 300 in appreciable modifications in the superficial charge of EChchA697R CGCCGAAGTACCAGGTGAGA protein nanoparticles (Fig. 3b). The observed deviations grpE ECgrpE278F ACGAATTGCTGCCGGTGATTG 301 in the size of protein materials were fully confirmed by ECgrpE578R GCTACAGTAACCATCGCCGC TEM and FESEM morphometric analyses (Fig. 4). groL ECgroL583F TTCGACCGTGGCTACCTGTC 301 When analyzing penetrability into CXCR4+ HeLa cells ECgroL883R GGGTTGCGATATCCTGCAGC in culture, a convenient in vitro model for T22-empow- dnaK ECdnaK504F CATCAACGAACCGACCGCAG 300 ered nanoparticles [16], P2 materials resulted generically ECdnaK803R TTTTCTGCCGCTTCTTTCAGGC more efficient than P1’s (Fig. 5a). The exception found in clpB ECclpB426F AATGCGTGGAGGTGAAAGCG 300 Origami B cells is in agreement with previous observa- ECclpB725R ATATCCAGCGCCAGTACCCG tions [20], and it might be related to the less reducing clpA ECclpA287F AGTCCTCCGGTCGCAATGAG 300 cytoplasm in this bacterial strain and caused by a bot- ECclpA586R CCAGCTCCTTCTCACGACCA tom-up impact of protein conformation on microscopic cbpA ECcbpA477F GCTGAATGTGAAGATCCCGGC 300 functioning of the particles in cell interfaces, associated ECcbpA776R ACCAGACCTTTGCCTTTAACGC to favored di-sulfide bridge formation in this factory. Cell ihfBa ECihfB9F GTCAGAATTGATAGAAAGACTTGCCACC 258 penetrability of P2 particles was comparatively screened ECihfB266R CGATCGCGCAGTTCTTTACCAG again by confocal microscopy and the enhanced perfor- a Used for normalization of gene expression mance of those produced in KPM335 fully confirmed Rueda et al. Microb Cell Fact (2016) 15:59 Page 6 of 12 Origami B BW30270 MC4100 KPM335 b MW a c mAU 1500 d Origami B 30649.940 MC4100 Origami B Irrelevant proein peak 1000 KPM335 BW30270 30637.916 Peak 1 MC4100 30 % buffer B 30640.853 500 Peak 2 20 % buffer B KPM335 30640.557 10 % buffer B BW30270 0 min 40.0 50.0 60.0 Fig. 1 Protein production and purification. a Scheme of the modular T22-GFP-H6 building block. Sizes of boxes are only approximate and do not precisely correspond to the length of primary aa sequence. b Western blot of crude cell extracts of T22-GFP-H6-producing strains. MW indicates the molecular weight of selected markers. c His-tag affinity chromatography of T22-GFP-H6 produced in the different E. coli strains. Purification was performed using an imidazole concentration gradient. Buffer B contains 500 mM imidazole. d Maldi-TOF identification of T22-GFP-H6 produced in different E. coli strains and purified by affinity chromatography (P2) a b 16000 ** ** 8 14000 Specific fluorescence (F.U/mg) Protein purification yield (mg) ** 12000 6 Origami B MC4100 10000 KPM335 ** BW30270 8000 4 * 6000 4000 2 2000 0 0 P1 P2 P1 P2 P1 P2 P1 P2 P1 P2 P1 P2 P1 P2 P1 P2 Peak Peak Fig. 2 Quantitative analyses of T22-GFP-H6 production levels and activity. a Yield of T22-GFP-H6 produced in E. coli strains Origami B, MC4100, KPM335 and BW30270, upon purification, from 500 ml of original protein producing cultures. P1 and P2 indicate the main elution peaks 1 and 2. b Specific fluorescence of T22-GFP-H6 calculated by using the above data. Symbols mean significant differences: **p < 0.001; *p < 0.05 Rueda et al. Microb Cell Fact (2016) 15:59 Page 7 of 12 a b 0 ** 70 -5 Origami B Zeta potential (mV) Particle size (nm) MC4100 KPM335 -10 BW30270 60 -15 -20 20 -25 10 -30 0 -35 P1 P2 P1 P2 P1 P2 P1 P2 P1 P2 P1 P2 P1 P2 P1 P2 Peak Peak Fig. 3 Physical properties of protein nanoparticles. a Size of the self-assembled nanoparticles purified in two elution peaks and measured by DLS. b Surface charge distribution of self-assembled nanoparticles measured as zeta potential. Symbols mean significant differences: **p < 0.001; *p < 0.05 Origami B MC4100 KPM335 BW30270 P1 P2 Fig. 4 Morphometric characterization of nanoparticles ultrastructure. Representative TEM and FESEM (insets) images of all strains and main elution peaks 1 and 2. Scale bars represent 50 nm (Fig. 5b). These nanoparticles accumulated intracellu- and accumulated in the primary tumor, albeit to dif- larly in the perinuclear region, showing moderate nuclear ferent extents (Fig. 6a–c), with materials produced in penetrability (Fig. 5c). MC4100 being the most efficient. Nanoparticles pro- The performance of P2 nanoparticles, those showing duced in KPM335 showed results similar in efficacy to higher cell penetrability in vitro, was evaluated in vivo those manufactured in Origami B, the paradigmatic cell through analyzing their biodistribution and accumula- factory for T22-GFP-H6 [17], and slightly better than tion in CXCR4-overexpressing tumor tissues, in a sub- the parental BW30270 (although differences were not cutaneous mouse model of colorectal cancer. Upon significant). In any case, the higher cell penetrability of systemic administration, all protein variants targeted these nanoparticles determined in cultured cell (Fig. 5a) Rueda et al. Microb Cell Fact (2016) 15:59 Page 8 of 12 ** a Internalization (relative protein amounts) 500 ** Origami B MC4100 400 KPM335 300 BW30270 200 ** ** 100 ** 0 P1 P2 P1 P2 P1 P2 P1 P2 Peak b Origami B MC4100 KPM335 BW30270 c Fig. 5 Cell penetrability of nanoparticles. a Internalization of self-assembling nanoparticles analyzed by intracellular fluorescence of HeLa cells incu‑ bated with 25 nM of T22-GFP-H6 for 1 h. Internalize fluorescence (determined by flow cytometry) is corrected by specific fluorescence (determined by fluorimetry). The quotient represents relative protein amounts. b Internalization of nanoparticles visualized by confocal microscopy. Nucleus (blue) of HeLa cells were labeled using Hoechst 33342, membranes (red) were labeled with CellMask Deep Red. Cells were incubated with 25 nM of T22-GFP-H6 (green) for 1 h. Bars indicate 15 µm. c Three dimensional 3D reconstruction of T22-GFP-H6 nanoparticles (P2) from KPM335 into HeLa cells. Images were obtained using 35 layers per image. Three different fields of confocal microscopy as well as three angles were viewed through Imaris Bitplane Software. Scale bars indicate 15 µm and symbols mean significant differences: **p < 0.001; *p < 0.05 was not reflected by an enhanced tumor targeting normal non-target organs (namely kidney, lung, heart, in vivo. As expected, accumulation of protein nanopar- liver, spleen and pancreas; Fig. 7a, b). The absence of a ticles was coincident with the overexpression of CXCR4 signal in kidney was indicative of a high stability in vivo in target tissues (Fig. 6d, e), and none of the protein of the nanoparticles that keep assembled in oligomers of materials was observed to accumulate in the evaluated size over the cut-off of renal clearance (~8 nm). Rueda et al. Microb Cell Fact (2016) 15:59 Page 9 of 12 FL a c GFP CXCR4 Buffer Buffer Tumors (sc.) Origami B MC4100 KPM335 Origami B BW30270 b MC4100 KPM335 d BW30270 Fig. 6 In vivo biodistribution of nanoparticles in tumor tissue. a Protein accumulation determined by ex vivo imaging of GFP-emitted fluorescence by representative subcutaneous colorectal cancer tumors grown in mice (measurements performed 5 h after the intravenous administration of a 500 μg nanoparticle dose). b Quantitation of GFP-emitted fluorescence in tumors of the compared groups, expressed as total radiant efficiency (photon/s/cm2/sr/μW/cm2). c Representative micrographs of nanoparticle internalization, as detected by IHC with an anti-GFP antibody, in the tumor cell cytosol and CXCR4 expression observed in tumor cells before nanoparticle injection in representative tumors. d Mean ± S.E. of CXCR4 expression H-score in tumor tissue (measured prior to nanoparticle administration) and GFP H-score (a measure of nanoparticle internalization in tumor cells) of mice belonging to the Origami B, MC4100, KPM335, BW30270 or buffer-treated groups. Note the similar level of CXCR4 expression in tumors among groups and the correlation between tumor-emitted fluorescence and the amount of nanoparticle internalized in tumor cells Although the final performance of KPM335 materials size observed in the P1 fraction (Figs. 3a, 4), and par- in vivo was excellent and indistinguishable from that of ticularly the higher cell penetrability of the P2 fraction Origami B-derived nanoparticles, the larger nanoparticle in vitro were indicative of either a different conformation Rueda et al. Microb Cell Fact (2016) 15:59 Page 10 of 12 a b brain liver brain liver kidney lung & heart 10 F l ( R a d ia n t e f f ic ie n c y ; x 1 0 ) 10 F l ( R a d ia n t e ffic ie n c y ; x 1 0 ) 9 9 8 Buffer 8 Buffer Origami B 6 MC4100 6 KPM335 4 4 Origami B BW30270 2 2 0 0 MC4100 kidney kidney lung & heart 10 10 F l ( R a d ia n t e f f ic ie n c y ; x 1 0 ) F l ( R a d ia n t e ffic ie n c y ; x 1 0 ) 9 9 Buffer KPM335 8 8 Origami B 6 MC4100 WT 6 KPM335 4 BW30270 4 BW30270 2 2 0 0 Fig. 7 Nanoparticle biodistribution in normal tissues. a Representative ex vivo images of T22-GFP-H6 nanoparticles uptake in mouse brain, liver, kidney, lung or heart tissue after injection as measured by GFP-emitted fluorescence. b Quantitation of GFP fluorescence expressed as radiant effi‑ ciency. Note the negligible level of detected fluorescence, being undistinguishable from the background fluorescence observed in vehicle-treated mice. This was in contrast to the high level of nanoparticle accumulation observed in tumor tissues in the same animals (see Fig. 6) of T22-GFP-H6 building blocks, a diversity in the archi- proteomics of wild-type bacteria at the end of the expo- tecture of nanoparticles produced in this particular nential growth phase (Fig. 8b). In particular, tig transcript strain, or both. Conformational protein variations were levels are lower being the production of trigger factor indeed identified by CD of P2 protein fractions (Fig. 8a), associated with ribosomal protein expression and growth distinguishing KPM335- and BW30270-derived materi- rate [26]. On the other hand, some heat shock protein als as the extremes of a conformational spectrum. Since genes are upregulated, in particular those involved in BW30270 is the endotoxin-containing, parental strain inclusion body disaggregation (clpB and ibpA) [27, 28] of the endotoxin-free KPM335 [13], the results suggest indicating enhanced aggregation in the endotoxin-free that genetic tailoring associated with LPS modification strain when comparing with the parental background. might have affected cell properties related to protein In this regard, the formation of inclusion bodies by metabolism. an aggregation-prone protein is slightly favoured in In a previous study [20], we have demonstrated that KPM335 when compared to BW30270, as measured by mutations in the E. coli genome that affect protein qual- the percentage of insoluble recombinant protein over the ity control activities (chaperones and proteases) impact total protein yield (86.7 ± 1.2 versus 81.649 ± 1.4 %; data on the architecture and function of produced pro- calculated from [15]). Also, ClpB and IbpA also respond, tein nanoparticles [20]. Also, the growth of cultured independently of protein production, to growth rate. KPM335 is slightly slower than that of the parental strain They are present in higher amounts in stationary phase at BW30270 [15]. Reduced bacterial growth, as promoted, least when cells are growing in complex medium and the for instance, by minimal defined media or by entering growth rate declines gradually [26]. On the other hand, into the stationary phase, results in the modification of some heat shock protein genes are downregulated (e.g. intracellular levels of chaperones such as increased levels grpE), that is again in agreement with the endotoxin-free of ClpB and IbpA and reduced levels of GrpE, HtpG and strain growing slower, as there is a slight tendency that Hsc [26]. In this context, we wondered if the LPS engi- these heat shock proteins do not change with growth rate neering of KPM335 might have resulted in a physiologi- or they are present in lower amounts when the cells grow cal, indirect impact on protein processing by a modified slower or approach stationary phase [26]. cell factory through modification of chaperone balance. Transcriptomic analysis of main folding-assistant genes Conclusions in KPM335 revealed significant differences regarding the In summary, the set of seven different mutations in LPS parental BW30270 (Fig. 8b), and in some cases a pattern biosynthesis genes of KPM335 promotes a reduction of expression that might be comparable to that found in of the cell growth rate that impact, intrinsically, on the Rueda et al. Microb Cell Fact (2016) 15:59 Page 11 of 12 affect the final quality (tumor-homing) and organization a6 (self-assembling) of complex smart materials such as 4 CXCR4-targeted protein nanoparticles, it indeed influ- 2 ences some of their relevant properties at the macro- 0 scopic level. -2 Authors’ contributions mDeg FR performed most of the experiments regarding protein production and -4 in vitro characterization. MVC performed the in vivo experiments and its -6 linked analysis while AS-C executed the electron microscopy observations, Origami B JS-F parts of confocal microscopy and flow cytometry, MP the CD analysis, UU MC4100 (WT) -8 protein purification and UM the quantitative PCR. NF-M and EV designed most KPM335 LPS free -10 BW30270 of the experimental set-up, UR analysed and discussed the proteomics and transcriptomics data, RM coordinated the in vivo experimental while EG-F and -12 AV conceived the whole study. All authors have participated in the prepara‑ 210 220 230 240 250 tion of the manuscript (text and figures), that has been mostly written by AV. Wavelength All authors read and approved the final manuscript. b Author details 1 Institut de Biotecnologia i de Biomedicina, Universitat Autònoma de Barce‑ lona, Bellaterra, Cerdanyola del Vallès, 08193 Barcelona, Spain. 2 Departament de Genètica i de Microbiologia, Universitat Autònoma de Barcelona, Bellaterra, Cerdanyola del Vallès, 08193 Barcelona, Spain. 3 CIBER de Bioingeniería, Biomateriales y Nanomedicina (CIBER-BBN), Bellaterra, Cerdanyola del Vallès, 08193 Barcelona, Spain. 4 Biomedical Research Institute Sant Pau (IIB‑SantPau) and Josep Carreras Leukemia Research Institute, Hospital de la Santa Creu i Sant Pau, 08025 Barcelona, Spain. 5 Servei de Microscòpia, Universitat Autònoma de Barcelona, Bellaterra, Cerdanyola del Vallès, 08193 Barcelona, Spain. 6 Leibniz University of Hannover, Technical Chemistry & Life Science, Hannover, Germany. 7 Helmholtz Centre for Infection Research, Inhoffenstraße 7, Brunswick, Germany. 8 Division of Structural Biochemistry, Priority Area Asthma and Allergy, Research Center Borstel, Airway Research Center North (ARCN), Member of the German Center for Lung Research (DZL), 23845 Borstel, Germany. 9 Present Address: Cibbim‑Nanomedicine, Hospital Vall d’Hebron, Fig. 8 Conformational protein status and activity of the cell’s quality Passeig de la Vall d’Hebron, 119‑129, 08035 Barcelona, Spain. 10 Present control. a Smoothed CD spectra from 250 to 205 nm of T22-GFP-H6 Address: Department of Ruminant Production, Institut de Recerca i Tecnologia produced by different E. coli strains and purified at higher imidazol Agroalimentàries (IRTA), Torre Marimon, Caldes de Montbui, 08140 Barcelona, concentration (P2). Beta sheet structure signal is detected at 218 nm. Spain. b Expression of chaperone genes in E. coli KPM335 compared to their Acknowledgements expression levels in E. coli BW30270. Relative changes in expression of Protein production has been partially performed by the ICTS “NANBIOSIS”, target genes as quantified by RT-qPCR using the comparative 2−∆∆Ct more specifically by the Protein Production Platform of CIBER in Bioengineer‑ method [25] and the ihfB gene for normalization were converted into ing, Biomaterials & Nanomedicine (CIBER-BBN)/IBB, at the UAB (http://www. log2 values to display the fold changes in log2 scale. The values repre‑ nanbiosis.es/unit/u1-protein-production-platform-ppp/). We are indebted to sent the means and standard deviations based on duplicate RT-qPCR MINECO BIO2013-41019-P, AGAUR (2014SGR-132) and CIBER de Bioingeniería, runs for each of the three independent biological replicates per strain. Biomateriales y Nanomedicina (project NANOPROTHER) to AV, Plan Estatal The statistical significance of the differential expression patterns was de I+D+I 2013-2016 del Instituto de Salud Carlos III (FEDER co-funding) analyzed using the paired t test. *P < 0.05; **P < 0.01; ***P < 0.001; ns, FIS PI12/00327 to EV, Marató TV3 416/C/2013-2030 to RM for funding our research. We thank the CIBER-BBN Nanotoxicology Unit for fluorescent in vivo not significant. Genes labelled with a dash are those whose expres‑ follow-up using the IVIS equipment. The authors thank Manuel Hein and sion change (either up- or down-regulation) is coincident with the Dörte Grella (Research Center Borstel) and also Fran Cortes the Cell Culture proteomic analysis of a conventional E. coli strain when entering into and Citometry Units of the Servei de Cultius Cel·lulars, Producció d’Anticossos the stationary phase (according to data from [26]). The tig, hscB, hchA i Citometria (SCAC), Servei de Proteómica and to the Servei de Microscòpia, for and cbpA gene products were not monitored in this previous study technical assistance, and the Soft Materials Service (ICMAB-CSIC/CIBER-BBN). FR and MP acknowledge financial support from “Francisco Jose de Caldas” Scholarship program of COLCIENCIAS (Colombia) and Universitat Autònoma expression of several among the main chaperones of the de Barcelona through pre-doctoral fellowships respectively. UU received a Sara Borrell postdoctoral fellowship from ISCIII. AV received an ICREA ACA‑ E. coli quality control network. This may have indirect DEMIA award. Strain KPM335 was kindly provided by Research Corporation influences on the conformational status of recombinant Technologies, Tucson, AZ. aggregation-prone protein materials and their building Competing interests blocks. Although a more complete systems level analy- UU, EV, MVC, AV, NF-M and RM are co-authors of a patent (WO2012095527) sis of KPM335 performance as a cell factory would be covering the use of T22 as an intracellular targeting agent. No other potential desirable, the set of data presented here indicates that competing interests have been identified. LPS engineering secondarily affects the arm of the cells’ Received: 21 January 2016 Accepted: 28 March 2016 biosynthetic and maintenance machineries dealing with protein conformation. While this fact does not negatively Rueda et al. Microb Cell Fact (2016) 15:59 Page 12 of 12 References 16. Unzueta U, Cespedes MV, Ferrer-Miralles N, Casanova I, Cedano J, 1. Rodriguez-Carmona E, Villaverde A. Nanostructured bacterial materials for Corchero JL, et al. Intracellular CXCR4(+) cell targeting with T22-empow‑ innovative medicines. Trends Microbiol. 2010;18:423–30. ered protein-only nanoparticles. Int J Nanomedicine. 2012;7:4533–44. 2. Villaverde A. Nanotechnology, bionanotechnology and microbial cell 17. Cespedes MV, Unzueta U, Tatkiewicz W, Sanchez-Chardi A, Conchillo-Sole factories. Microb Cell Fact. 2010;9:53. O, Alamo P, et al. In vivo architectonic stability of fully de novo designed 3. Chen GQ. New challenges and opportunities for industrial biotechnology. protein-only nanoparticles. ACS Nano. 2014;8:4166–76. Microb Cell Fact. 2012;11:111. 18. Kim J, Takeuchi H, Lam ST, Turner RR, Wang HJ, Kuo C, et al. Chemokine 4. Vazquez E, Villaverde A. Microbial biofabrication for nanomedicine: receptor CXCR4 expression in colorectal cancer patients increases the risk biomaterials, nanoparticles and beyond. Nanomedicine (Lond). for recurrence and for poor survival. J Clin Oncol. 2005;23:2744–53. 2013;8:1895–8. 19. Unzueta U, Ferrer-Miralles N, Cedano J, Zikung X, Pesarrodona M, Sac‑ 5. Taguchi S, Ooi T, Mizuno K, Matsusaki H. Advances and needs for cardo P, et al. Non-amyloidogenic peptide tags for the regulatable self- endotoxin-free production strains. Appl Microbiol Biotechnol. assembling of protein-only nanoparticles. Biomaterials. 2012;33:8714–22. 2015;99:9349–60. 20. Rueda F, Cespedes MV, Conchillo-Sole O, Sanchez-Chardi A, Seras- 6. Dor-On E, Solomon B. Targeting glioblastoma via intranasal administra‑ Franzoso J, Cubarsi R, et al. Bottom-up instructive quality control in the tion of Ff bacteriophages. Front Microbiol. 2015;6:530. biofabrication of smart protein materials. Adv Mater. 2015;27:7816–22. 7. Wakelin SJ, Sabroe I, Gregory CD, Poxton IR, Forsythe JL, Garden OJ, et al. 21. Mamat U, Meredith TC, Aggarwal P, Kuhl A, Kirchhoff P, Lindner B, et al. “Dirty little secrets”—endotoxin contamination of recombinant proteins. Single amino acid substitutions in either YhjD or MsbA confer viability Immunol Lett. 2006;106:1–7. to 3-deoxy-d-manno-oct-2-ulosonic acid-depleted Escherichia coli. Mol 8. Gao B, Tsan MF. Endotoxin contamination in recombinant human heat Microbiol. 2008;67:633–48. shock protein 70 (Hsp70) preparation is responsible for the induction of 22. Sambrook J, Fritsch E, Maniatis T. Molecular Cloning, A Laboratory Manual, tumor necrosis factor alpha release by murine macrophages. J Biol Chem. Cold Spring Harbor. New York: Cold Spring Harbor Laboratory Press; 1989. 2003;278:174–9. 23. Bradford MM. A rapid and sensitive method for the quantitation of micro‑ 9. Beenken-Rothkopf LN, Karfeld-Sulzer LS, Zhang X, Kissler H, Michie SA, gram quantities of protein utilizing the principle of protein-dye binding. Kaufman DB, et al. Protein polymer hydrogels: effects of endotoxin on Anal Biochem. 1976;72:248–54. biocompatibility. J Biomater Appl. 2013;28:395–406. 24. Laemmli UK. Cleavage of Structural Proteins During Assembly of Head of 10. Pepys MB, Hawkins PN, Kahan MC, Tennent GA, Gallimore JR, Graham D, Bacteriophage-T4. Nature. 1970;227:680. et al. Proinflammatory effects of bacterial recombinant human C-reactive 25. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using protein are caused by contamination with bacterial products, not by real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. C-reactive protein itself. Circ Res. 2005;97:e97–103. 2001;25:402–8. 11. Corchero JL, Gasser B, Resina D, Smith W, Parrilli E, Vazquez F, et al. 26. Li Z, Nimtz M, Rinas U. The metabolic potential of Escherichia coli BL21 in Unconventional microbial systems for the cost-efficient production of defined and rich medium. Microb Cell Fact. 2014;13:45. high-quality protein therapeutics. Biotechnol Adv. 2013;31:140–53. 27. Weibezahn J, Bukau B, Mogk A. Unscrambling an egg: protein disaggre‑ 12. Sanchez-Garcia L, Martin L, Mangues R, Ferrer-Miralles N, Vazquez E, gation by AAA + proteins. Microb Cell Fact. 2004;3:1. Villaverde A. Recombinant pharmaceuticals from microbial cells: a 2015 28. Rinas U, Hoffmann F, Betiku E, Estape D, Marten S. Inclusion body update. Microb Cell Fact. 2016;15:33. anatomy and functioning of chaperone-mediated in vivo inclusion 13. Mamat U, Wilke K, Bramhill D, Schromm AB, Lindner B, Kohl TA, et al. body disassembly during high-level recombinant protein production in Detoxifying Escherichia coli for endotoxin-free production of recombinant Escherichia coli. J Biotechnol. 2007;127:244–57. proteins. Microb Cell Fact. 2015;14:57. 14. Seras-Franzoso J, Tatkiewicz WI, Vazquez E, Garcia-Fruitos E, Ratera I, Veciana J, et al. Integrating mechanical and biological control of cell proliferation through bioinspired multieffector materials. Nanomedicine (Lond). 2015;10:873–91. 15. Rueda F, Cano-Garrido O, Mamat U, Wilke K, Seras-Franzoso J, Garcia-Frui‑ tos E, et al. Production of functional inclusion bodies in endotoxin-free Escherichia coli. Appl Microbiol Biotechnol. 2014;98:9229–38. Submit your next manuscript to BioMed Central and we will help you at every step: • We accept pre-submission inquiries • Our selector tool helps you to find the most relevant journal • We provide round the clock customer support • Convenient online submission • Thorough peer review • Inclusion in PubMed and all major indexing services • Maximum visibility for your research Submit your manuscript at www.biomedcentral.com/submit