Since January 2020 Elsevier has created a COVID-19 resource centre with free information in English and Mandarin on the novel coronavirus COVID- 19. The COVID-19 resource centre is hosted on Elsevier Connect, the company's public news and information website. Elsevier hereby grants permission to make all its COVID-19-related research that is available on the COVID-19 resource centre - including this research content - immediately available in PubMed Central and other publicly funded repositories, such as the WHO COVID database with rights for unrestricted research re-use and analyses in any form or by any means with acknowledgement of the original source. These permissions are granted for free by Elsevier for as long as the COVID-19 resource centre remains active. Diagnostic Microbiology and Infectious Disease 86 (2016) 153–159 Contents lists available at ScienceDirect Diagnostic Microbiology and Infectious Disease journal homepage: www.elsevier.com/locate/diagmicrobio Virology A molecular epidemiological study of human parainfluenza virus type 3 at a tertiary university hospital during 2013–2015 in Catalonia, Spain Cristina Godoy a, Paula Peremiquel-Trillas b, Cristina Andrés a, Laura Gimferrer a, Sonia María Uriona b, María Gema Codina a, Lluis Armadans b, María del Carmen Martín a, Francisco Fuentes a, Juliana Esperalba a, Magda Campins b, Tomàs Pumarola a, Andrés Antón a,⁎ a Respiratory Viruses Unit, Microbiology Department, Hospital Universitari Vall d'Hebron, Vall d'Hebron Research Institute, Universitat Autònoma de Barcelona, Passeig Vall d'Hebron 119-129, 08035, Barcelona, Spain b Preventive Medicine and Epidemiology Department, Hospital Universitari Vall d'Hebron, Vall d'Hebron Research Institute, Universitat Autònoma de Barcelona, Passeig Vall d'Hebron 119-129, 08035, Barcelona, Spain a r t i c l e i n f o a b s t r a c t Article history: Human parainfluenza virus type 3 (HPIV-3) is one of the most common respiratory viruses particularly Received 4 April 2016 among young children and immunocompromised patients. The seasonality, prevalence and genetic diversity of Received in revised form 20 July 2016 HPIV-3 at a Spanish tertiary-hospital from 2013 to 2015 are reported. HPIV-3 infection was laboratory- Accepted 21 July 2016 confirmed in 102 patients (76%, under 5 years of age). Among b5 years-old patients, 9 (11.5%) were under any Available online 27 July 2016 degree of immunosuppression, whereas this percentage was significantly higher (19; 79.2%) among patients Keywords: older than 5 years. HPIV-3 was detected at varying levels, but mainly during spring and summer. All characterized Human parainfluenza virus type 3 HN/F sequences fell within C1b, C5 and in other two closely C3a-related groups. Furthermore, a new genetic HPIV-3 lineage (C1c) was described. Genetic similarity and epidemiological data confirmed some nosocomial infections, Immunocompromised highlighting the importance of the HPIV-3 surveillance, particularly in high-risk patients. This study provides Children valuable information on HPIV-3 diversity due to the scarce information in Europe. Haemagglutinin-neuraminidase © 2016 Elsevier Inc. All rights reserved. Fusion protein Molecular characterization Phylogenetic analysis 1. Introduction (Cortez et al., 2001; Harvala et al., 2012; Jalal et al., 2007; Piralla et al., 2009; Ustun et al., 2012). Human parainfluenza viruses (HPIVs) are an important cause of To date, neither antiviral drugs nor vaccines are approved for clinical acute respiratory tract infections (ARI). Human parainfluenza virus use against HPIV-3 infection (Falsey, 2012; Guillon et al., 2014). In most type 3 (HPIV-3) is an enveloped non-segmented, negative, single- severe cases the administration of ribavirin has been reported, but its stranded RNA virus, which is classified as member of the genus efficacy and benefits have not still been demonstrated (Falsey, 2012). Respirovirus of the family Paramyxoviridae (Henrickson, 2003). HPIV-3 Regarding prophylaxis, two chimeric bovine/human PIV-3 vaccines infection in immunocompetent adults usually courses as mild and based on haemagglutinin-neuraminidase (HN) and fusion (F) proteins self-limited. However, HPIV-3 is the second cause of viral lower respira- were found to be well tolerated and immunogenic (Karron et al., tory tract infection (LRTI) in young children, only preceded by respirato- 2012; Schmidt et al., 2011), but remained under study in clinical trials. ry syncytial virus (RSV) (Counihan et al., 2001; Henrickson, 2003; Iwane HPIV-3, like other RNA viruses, has the capability to acquire random et al., 2004). Children under 5 years of age, immunocompromised indi- point mutations throughout its genome, mainly in the envelope glyco- viduals and the elderly are at high risk for severe or even fatal infection proteins (HN and F) that are under the selective pressure from human (Falsey, 2012; Henrickson, 2003; Liu et al., 2013; Reed et al., 1997). immune response. The rate of molecular evolution of HPIV-3 based on Unlike other HPIVs, HPIV-3 usually causes seasonal outbreaks during HN protein was estimated at 1.10 × 10 −3 substitutions per site per spring and summer months in community; as well, it has been year, similar to that of other virus genes such as the G gene of respiratory sometimes reported to cause nosocomial outbreaks, in particular syncytial virus (Mizuta et al., 2014). The pattern of HPIV-3 evolution, among hematopoietic stem cell transplantation (HSCT) recipients based on the analysis of F gene sequences, it is quite similar to influenza virus B (Prinoski et al., 1992). Since the rest of the genome remains ⁎ Corresponding author. Tel.: +34-665941722. highly conserved, the non-coding region of F gene and the coding region E-mail address: aanton@vhebron.net (A. Antón). of HN gene are often used to perform molecular epidemiological studies http://dx.doi.org/10.1016/j.diagmicrobio.2016.07.023 0732-8893/© 2016 Elsevier Inc. All rights reserved. 154 C. Godoy et al. / Diagnostic Microbiology and Infectious Disease 86 (2016) 153–159 Table 1 Primers and PCR amplification and sequencing protocols of complete HN protein-coding region and partial F gene sequences. The M13 primer binding sites used for sequencing are underlined. Gene (Fragment position⁎) Primer name Primer sequence (5′ - 3′) PCR amplification protocol HN⁎⁎ HN1-M13F TGTAAAACGACGGCCAGTAACTTAGGAGTAAAGTTACRCA (6708–7658) HN1-M13R CAGGAAACAGCTATGACCATCAAGTACAATTTCTTCTATGCC HN⁎⁎ HN2-M13F TGTAAAACGACGGCCAGTCTGTAAAYTCAGAYTTGGTACCTG (7474–8320) HN2-M13R CAGGAAACAGCTATGACCGCTGTTGAGTAAGTTATGACTGG HN⁎⁎ HN3-M13F TGTAAAACGACGGCCAGTCATAATGTGCTATCAAGACCAGG (8139–8572) HN3-M13R CAGGAAACAGCTATGACCCTGATTGCTGATTACTTATCATATACTTG F F-M13F TGTAAAACGACGGCCAGTACTTAGGACAAAAGARGTCA (4855–5243) F-M13R CAGGAAACAGCTATGACCACCACAAGAGTTAGARTCTTC Thermal profile: 50 °C × 30 min – 95 °C × 15 min – 45 cycles (95 °C × 15 sec – 52 °C × 20 sec – 72 °C × 1 min) – 72 °C × 10 sec Sequencing protocol M13 M13F TGTAAAACGACGGCCAGT M13R CAGGAAACAGCTATGACC PCR Thermal Profile 96 °C × 1 min – 30 cycles (96 °C × 10 sec – 50 °C × 5 sec – 60 °C × 4 min) ⁎ Nucleotide position relative to KF530250 sequence from GenBank. ⁎⁎ Primers as previously described [27], with minor modifications. (Almajhdi, 2015; Côté et al., 1987; Mao et al., 2012; Prinoski et al., 1992; review board approval (PR_AG_156/2015) was previously obtained Storey et al., 1987). from the HUVH Clinical Research Ethics Committee. The aim of this study was to describe the prevalence, the seasonality and the genetic diversity of HPIV-3 detected in respiratory specimens 2.2. Detection of HPIV-3 and RNA extraction from patients attended at the Hospital Universitari Vall d'Hebron (HUVH) in Barcelona (Spain) from the 2013–2014 season to the The detection of HPIV-3 and other respiratory viruses was routinely 2014–2015 season. performed either by direct immunofluorescence antigen detection (D 3Ultra 8™ DFA Respiratory Virus Screening & Identification Kit 2. Materials and Methods Diagnostic HYBRIDS, USA) or by a multiplex real-time PCR assay (Anyplex II RV16 Detection Kit, Seegene, Korea). Total nucleic acids 2.1. Sample collection (NA) were purified by using NucliSENS® EasyMag® (BioMérieux, Marcy l'Etoile, France) from 400 μl of respiratory specimens and eluted A descriptive observational study was conducted from upper and to 100 μl according to the manufacturer's instructions. Eluted NAs were lower respiratory tract specimens received to our laboratory for viral kept at −80 °C until use. diagnosis, which were collected from patients, children and adults, attended at the emergency care unit or hospitalized in HUVH, a tertiary 2.3. HN and F genes sequencing 1,200-bed university hospital, from week 40/2013 (2013–2014 season) to week 20/2015 (2014–2015 season), including the 2014 inter- From laboratory-confirmed HPIV-3 specimens, overlapping seasonal period. In addition, demographic and clinical data from these fragments that span the entire coding sequence of HN protein and par- patients were collected from the hospital clinical records. Institutional tial F gene sequence were amplified by using a one-step RT-PCR-based Fig. 1. Weekly distribution of laboratory-confirmed HPIV-3 cases detected from week 40/2013 (2013–2014 season) to week 20/2015 (2014–2015 season). C. Godoy et al. / Diagnostic Microbiology and Infectious Disease 86 (2016) 153–159 155 Fig. 2. Phylogenetic analysis based on the coding sequence of the HN protein (1719 nucleotides) from 94 HPIV-3 strains of the present study and other reference sequences. The evolutionary distances were computed using Tamura-Nei method and are in the units of the number of base substitutions per site. The rate variation among sites was modeled with a gamma distribution (0.28). Only bootstrap values higher than 70% are shown. Novel lineage described C1c (*) are also included. Strains associated with suspected nosocomial outbreaks are indicated as [N] followed by different letters relative to the affected hospital ward (H-hematology, O-oncohaematology, N-neonatology). Amino acid substitution within the antigenic epitopes (*) or the binding receptor site (**), are marked underlined. 156 C. Godoy et al. / Diagnostic Microbiology and Infectious Disease 86 (2016) 153–159 Fig. 3. Phylogenetic analysis based on the partial sequence of the F gene (390 nucleotides) from 97 HPIV-3 strains of the present study. The evolutionary distances were computed using Tamura-Nei method and are in the units of the number of base substitutions per site. The rate variation among sites was modeled with a gamma distribution (0,97). Only bootstrap values higher than 70% are shown. Novel lineage described C1c(*) are also included. Strains associated with suspected nosocomial outbreaks are indicated as [N] followed by different letters relative to the affected hospital ward (H-hematology, O-oncohaematology, N-neonatology). (F) Strains characterized only by the F protein. C. Godoy et al. / Diagnostic Microbiology and Infectious Disease 86 (2016) 153–159 157 assay with specific universal tailed primers (M13), as described in months – 4.8 years) were HPIV-3 laboratory-confirmed. Among the Table 1. PCR products were visualized as single bands by 1,5% agarose 102 patients, 78 (76%) were children under 5 years of age and 3 (3%) gel electrophoresis stained with SybrSafe® DNA Gel Stain (Invitrogen, were older than 65. Among patients younger than 5 years of age, 9 USA). PCR products were subsequently purified using Exo-SAP-IT PCR (11.5%) were under any degree of immunosuppression, whereas Clean-up Kit (Affymetrix, USA) and sequenced by the ABI Prism Big among patients over 5 years of age this percentage (19; 79.2%) was Dye Terminator Cycle Sequencing Kit v3.1 in an ABI PRISM 3130XL significantly higher (OR: 29.13; CI 95%: 8.73–97.25; Pb 0.0001), many sequencer (Applied Biosystems, USA), as shown in Table 1. Nucleotide of whom (8; 42.1%) were HSCT recipients. Four (3.92%) patients died. sequences were assembled and edited using SeqScape v2.5 software (Applied Biosystems, USA). 3.2. Co-detections with other respiratory viruses and seasonality 2.4. Phylogenetic analysis HPIV-3 co-detections were also found together with other respiratory viruses (7; 6,9%), such as rhinovirus (RV) (5; 71,4%), adenovirus (2; Phylogenetic analyses of HN and F sequences of the present study 28,6%) and enterovirus (2; 28,6%). were performed together with homologous sequences from previous HPIV-3 detection was quite variable throughout the study period, molecular epidemiological studies to be used as references, which but detection rates were higher during spring and summer months, were downloaded from NCBI GenBank database (Supplementary showing maximum peaks at week 15 (spring) in both seasons (Fig. 1). Table 1). Sequences were aligned using the MUSCLE program, imple- A large number of detections were therefore reported during the 2014 mented in MEGA v5.2 (Tamura et al., 2011). The molecular evolutionary inter-seasonal period. models of nucleotide substitutions were fitted to the multiple sequence alignments using evolutionary analyses conducted in MEGA v5.2 (Tamura et al., 2011). The phylogenetic trees were reconstructed 3.3. Phylogenetic analyses using neighbor-joining (NJ) distance method as implemented in MEGA v5.2 (Tamura et al., 2011) with the evolutionary model with Phylogenetic analyses of HN (Fig. 2) and F (Fig. 3) sequences from 97 the lowest Bayesian information criterion score. Reliability for the out of 102 confirmed cases revealed three phylogenetic groups (A, B and internal branch was assessed using the non-parametric bootstrap C), with subdivision of group C into different subgroups and lineages analysis with 1000 replicates. (C1a-b, C2, C3a-c, C4 and C5), as recently described by other authors (Almajhdi, 2015; Mao et al., 2012). All characterized HN (94/102) and 2.5. Statistical analysis F (97/102) sequences in the present study fell within C1b (11), C5 (3) and in other two closely C3a-related clusters (C3a1, 44; C3a2, 10), Statistical analysis was performed using SPSS v17 (SPSS Inc., USA). with bootstrap values higher than 80%. In addition, other 29 sequences Odd ratios (OR) and their 95% confidence intervals (CI) were calculated clustered together within subgroup C with a 100% bootstrap value and a to assess associations between categorical variables. Pb0.05 was consid- genetic distance (nucleotide differences per site) within group of 0.004. ered to be statistically significant. However, this genetic group showed a nucleotide divergence of 0.019 and 0.024 among C1a and C1b, respectively. According to Almajhdi 3. Results (2015) this might be considered a new lineage, and was named in the present study as C1c following the current nomenclature (Almajhdi, 3.1. Patient population 2015; Mao et al., 2012). A complete correspondence between the HN and F phylogenetic classifications was also observed. During the study From week 40/2013 (October 2013) to week 20/2015 (May 2015), a period, viral variants belonging to different lineages were cocirculating, total of 9,574 respiratory specimens from 5,888 patients (3,166 males, but showing variable rates among seasons (Supplementary Fig. 1). 54%; median age: 14.5 years; age range: b1 day – 97.8 years; interquar- Sequences from five laboratory-confirmed specimens were partial or tile range (IQR): 1.1–61.8 years) were received for respiratory virus de- could not be obtained, due to the non-availability of the clinical tection, of which 108 (1%) specimens from 102 (2%) patients (56 males, sample for the sequencing, the low quality of the extracted NA, or the 55%; median age: 1.5 years; age range: 13 days – 78.3 years; IQR: 5.1 low viral load in the respiratory specimen. Table 2 Predicted amino acid substitutions in antigenic epitopes of the HN glycoprotein previously characterized (Lawrence et al., 2004; Mizuta et al., 2014; van Wyke Coelingh et al., 1987). Strain (Group, Subgroup or Lineage) Amino acid substitutions⁎ K168 V289 N294 H295 A348 G354 V383 I391 T440 B Y V C1(a-c) R Y V C2 Y V C3a Y V NSVH2014–9-41318 (C3a1) R NSVH2015–6-62292 (C3a1) R NSVH2015–11-40367 (C3a1) R NSVH2015–15-99033 (C3a1) R NSVH2015–18-58875 (C3a1) R NSVH2015–17-56467 (C3a1) R I I NSVH2014–40-68658 (C3a1) R R NSVH2014–40-68798 (C3a1) R R NSVH2015–3-48320 (C3a1) R A NSVH2014–18-15565 (C3a2) S NSVH2014–24-28533 (C3a2) S C3c Y V C4 Y C5 Y V ⁎ Amino acid positions relative to prototype strain Wash/1957 (GenBank accession number M17641). 158 C. Godoy et al. / Diagnostic Microbiology and Infectious Disease 86 (2016) 153–159 3.4. Amino acid sequence analysis of the HN protein among HSCT recipients, is again highlighted (Cortez et al., 2001; Harvala et al., 2012; Jalal et al., 2007; Piralla et al., 2009). The comparison of the deduced HN amino acid sequences of the The HPIV-3 co-infection rate (6.9%) with other respiratory viruses strains relative to the prototype strain (Wash/1957, GenBank accession was similar to previous studies (5–27%) (Cilla et al., 2008; Pierangeli number M17641) revealed some amino acid substitutions that define et al., 2007). Some studies also identified RV, as well as human corona- the different phylogenetic subgroups (Fig. 2). Furthermore, some virus, as the most frequently detected viruses in co-detection with amino acid substitutions fell within the previously characterized anti- HPIV-3 (Mao et al., 2012). This finding is congruent because RV was genic epitopes of the HN protein (Lawrence et al., 2004; Mizuta et al., one of the most prevalent respiratory viruses with a prolonged excre- 2014; van Wyke Coelingh et al., 1987), as shown in Table 2. tion period within the period of study in our hospital (data not shown), together with RSV and influenza viruses, that are the cause of seasonal epidemics every year. However, the HPIV-3 co-detection 3.5. Epidemiologic investigation with RSV or with influenza viruses in the present study might not be surely well-represented, because these epidemic viruses are mostly The high similarity shown between some HN and F sequences (Figs. 2 detected by using point-of-care tests during the annual epidemics, and and 3) suggested the probable nosocomial transmission among patients no further microbiological studies are usually performed to detect addi- admitted in adult hematological, pediatric oncohaematological and neo- tional respiratory viruses. Nevertheless, a large number of co-detections natal intensive care units throughout the study period. Epidemiological should not be expected because, unlike RSV and influenza viruses that investigation demonstrated, as shown in Fig. 4, that all suspected pa- circulate during winter months, HPIV-3 usually did during the spring tients infected by C1c HPIV-3 and admitted in neonatal ICU, as well as, and summer months (inter-seasonal period), as previously described those infected by C3a HPIV-3 and admitted at the oncohaematological (Henrickson, 2003; Liu et al., 2013). These results also highlight the im- ward, coincided at some point in time and in space. However, nosocomi- portance of the surveillance or detection of other respiratory viruses dif- al transmission in some C1b and C1c cases admitted at onco-hematology ferent from RSV and influenza viruses during the inter-seasonal period, and hematology wards, respectively, could not be epidemiologically con- particularly in patients with high risk of severe HPIV-3 infection. firmed, but not discarded because of the lack of information. In this study we provide valuable information about the genetic di- All nucleotide sequences from the present study were submitted versity of current circulating HPIV-3 strains due to the lack of recent to GenBank database under accession numbers from KT796368 to knowledge in Europe. Different phylogenetic variants were simulta- KT796461 (complete HN sequences), and from KT796462 to KT796558 neously co-circulating, but showing variable prevalence among seasons. (partial F sequences). Phylogenetic group C remained as the most dynamic and widespread group worldwide (Almajhdi, 2015; Mao et al., 2012). Nucleotide se- 4. Discussion quences analyzed in comparison with different international strains demonstrated an association with some Chinese strains (C3a) (Mao Although HPIV-3 is one of the most common respiratory viruses in et al., 2012) and Saudi Arabia strains (C1b and C5) (Almajhdi, 2015; particular among hospitalized patients, little and no recent information Almajhdi et al., 2012), whereas no association with strains from regarding genetic diversity of circulating strains is available in Europe. America (Elango et al., 1986; van Wyke Coelingh et al., 1988), India (un- During the study period, HPIV-3 prevalence in patients attended in published) or Australia (Lawrence et al., 2004; van Wyke Coelingh et al., our hospital was 2%, similar to the prevalence reported in the Catalan 1988) was observed. In addition, a new lineage (C1c) was first described community (1–2%) through the PIDIRAC (Daily information on Acute in the present study. It might have been circulating in previous seasons Respiratory Illness Plan of Catalonia) Sentinel Surveillance Network, but the scarce molecular characterization of this virus in the European coordinated by the Health Public Agency of Catalan Government countries did not enable to discover it earlier. (http://grip.gencat.cat/ca/la_grip_professionals/documentacio). However, The classifications by phylogenetic analyses of HN and F sequences the studied cohorts of patients were different. The respiratory virus sur- showed a complete correspondence. Therefore, partial F gene sequenc- veillance network in Catalonia is based on the laboratory-confirmation ing might be used much more often for epidemiological studies than of respiratory specimens collected from outpatients with mild respirato- complete HN sequence, because the process by using a single PCR ry disease. Therefore, our results show a higher morbidity and mortality as- product is quite streamlined. Nevertheless, complete sequencing of sociated to this virus in our hospital, in particular in the youngest the HN coding region, instead of the partial F gene, would be preferable population or in patients with any degree of immunosuppression. to detect amino acid substitutions that might be related to changes in The results of this study showed that the population under 5 years of the functionality and antigenicity of the protein (Almajhdi, 2015; age has a greater susceptibility to HPIV-3 infection (Henrickson, 2003; Almajhdi et al., 2012; Mao et al., 2012). Some amino acid substitutions Kim et al., 2013; Liu et al., 2013). But, since the HPIV-3 disease in within characterized antigenic sites were found in some strains. immunocompetent adults usually courses as mild and self limited, non However, to acquire a better understanding of the importance of these requiring hospital care attendance in most of cases, the number of mutations, further studies on the catalytic activities and antigenicity of adult HPIV-3 cases in our study might be underestimated. However, in the HPIV-3 HN protein are needed. In addition, recent knowledge the present study, the real clinical importance of HPIV-3 among patients about the genetic and antigenic features of current circulating strains older than 5 years with any degree of immunosuppression, mainly should be relevant for vaccine development, and it is therefore Fig. 4. Chronological appearance of the suspected HPIV-3 nosocomial clusters by phylogenetic analyses with (dark gray) or without (light gray) epidemiological confirmation. With a plus (+) the date of HPIV-3 laboratory-confirmation. C. Godoy et al. / Diagnostic Microbiology and Infectious Disease 86 (2016) 153–159 159 advisable to carry out a continuous viral surveillance to have an Counihan ME, Shay DK, Holman RC, Lowther SA, Anderson LJ. Human parainfluenza virus-associated hospitalizations among children less than five years of age in the updated information. United States. Pediatr Infect Dis J 2001;20(7):646–53. Previous studies described nosocomial HPIV-3 outbreaks, especially Elango N, Coligan JE, Jambou RC, Venkatesan S. Human parainfluenza type 3 in onco-hematological wards (Jalal et al., 2007; Lee et al., 2011; Piralla virus hemagglutinin-neuraminidase glycoprotein: nucleotide sequence of mRNA and limited amino acid sequence of the purified protein. J Virol 1986;57(2): et al., 2009). In the present study phylogenetic analyses retrospectively 481–9. revealed the high similarity between HN and F sequences of viruses Falsey AR. Current management of parainfluenza pneumonitis in immunocompromised from patients hospitalized or attended in the same unit for a short peri- patients: a review. Infect Drug Resist 2012;5:121–7. Guillon P, Dirr L, El-Deeb IM, Winger M, Bailly B, Haselhorst T, et al. Structure-guided od of time, suggesting a possible nosocomial transmission, which was discovery of potent and dual-acting human parainfluenza virus haemagglutinin- later confirmed by epidemiological investigation in some cases. In addi- neuraminidase inhibitors. Nat Commun 2014;5:5268. tion to rapid HPIV-3 laboratory-confirmation, the prospective imple- Harvala H, Gaunt E, McIntyre C, Roddie H, Labonte S, Curran E, et al. Epidemiology and clinical characteristics of parainfluenza virus 3 outbreak in a Haemato-oncology mentation of molecular epidemiological analysis, especially in patients unit. J Infect 2012;65(3):246–54. at high risk of severe infection, might provide the prompt recognition Henrickson KJ. Parainfluenza viruses. Clin Microbiol Rev 2003;16(2):242–64. of nosocomial outbreaks, essential for the early implementation of Iwane MK, Edwards KM, Szilagyi PG, Walker FJ, Griffin MR, Weinberg GA, et al. spreading control measures (Berrueco et al., 2013; Lee et al., 2011). Population-based surveillance for hospitalizations associated with respiratory syncytial virus, influenza virus, and parainfluenza viruses among young children. Pediatrics In summary, valuable information about the genetic diversity of recent 2004;113(6):1758–64. circulating HPIV-3 viruses in Europe is here reported. Continuous surveil- Jalal H, Bibby DF, Bennett J, Sampson RE, Brink NS, MacKinnon S, et al. Molecular investi- lance studies of HPIV-3 are needed to detect novel viral variants that gations of an outbreak of parainfluenza virus type 3 and respiratory syncytial virus infections in a hematology unit. J Clin Microbiol 2007;45(6):1690–6. might acquire genetic mutations related to changes of antigenic or tro- Karron RA, Thumar B, Schappell E, Surman S, Murphy BR, Collins PL, et al. Evaluation of pism features, because they might become a challenge in the develop- two chimeric bovine-human parainfluenza virus type 3 vaccines in infants and ment and future use of vaccines. The suitability of sequencing to detect young children. Vaccine 2012;30(26):3975–81. Kim JK, Jeon JS, Kim JW, Rheem I. Epidemiology of respiratory viral infection using multi- and to monitor prospectively nosocomial outbreaks is also remarked. plex rt-PCR in Cheonan, Korea (2006-2010). J Microbiol Biotechnol 2013;23(2): 267–73. Lawrence MC, Borg NA, Streltsov VA, Pilling PA, Epa VC, Varghese JN, et al. Structure of the Ethical approval haemagglutinin-neuraminidase from human parainfluenza virus type III. J Mol Biol 2004;335(5):1343–57. Institutional review board approval (PR_AG_156/2015) was obtained from Lee AV, Bibby DF, Oakervee H, Rohatiner A, Ushiro-Lumb I, Clark DA, et al. Nosocomial transmission of parainfluenza 3 virus in hematological patients characterized by the Hospital Universitari Vall d'Hebron Clinical Research Ethics Committee. molecular epidemiology. Transpl Infect Dis 2011;13(4):433–7. Liu WK, Liu Q, Chen DH, Liang HX, Chen XK, Huang WB, et al. Epidemiology and clinical presentation of the four human parainfluenza virus types. BMC Infect Dis 2013;13:28. Conflict of Interest Mao N, Ji Y, Xie Z, Wang H, An J, Zhang X, et al. Human parainfluenza virus-associated respiratory tract infection among children and genetic analysis of HPIV-3 strains in None. Beijing, China. PLoS One 2012;7(8):e43893. Mizuta K, Tsukagoshi H, Ikeda T, Aoki Y, Abiko C, Itagaki T, et al. Molecular evolution of the Supplementary data to this article can be found online at http://dx. haemagglutinin-neuraminidase gene in human parainfluenza virus type 3 isolates doi.org/10.1016/j.diagmicrobio.2016.07.023. from children with acute respiratory illness in Yamagata prefecture, Japan. J Med Microbiol 2014;63(Pt 4):570–7. Pierangeli A, Gentile M, Di Marco P, Pagnotti P, Scagnolari C, Trombetti S, et al. Detection Acknowledgements and typing by molecular techniques of respiratory viruses in children hospitalized for acute respiratory infection in Rome, Italy. J Med Virol 2007;79(4):463–8. Piralla A, Percivalle E, Di Cesare-Merlone A, Locatelli F, Gerna G. Multicluster nosocomial This work was partially supported by Plan Nacional de I + D + I outbreak of parainfluenza virus type 3 infection in a pediatric oncohematology unit: 2008–2011 and by Instituto de Salud Carlos III, Subdirección General a phylogenetic study. Haematologica 2009;94(6):833–9. de Redes y Centros de Investigación Cooperativa, Ministerio Español Prinoski K, Côté MJ, Kang CY, Dimock K. Evolution of the fusion protein gene of human de Economía y Competitividad, Spanish Network for Research in Infec- parainfluenza virus 3. Virus Res 1992;22(1):55–69. Reed G, Jewett PH, Thompson J, Tollefson S, Wright PF. Epidemiology and clinical impact tious Diseases (REIPI RD12/0015/0003); and European Regional Devel- of parainfluenza virus infections in otherwise healthy infants and young children b5 opment Fund (ERDF). years old. J Infect Dis 1997;175(4):807–13. Schmidt AC, Schaap-Nutt A, Bartlett EJ, Schomacker H, Boonyaratanakornkit J, Karron RA, et al. Progress in the development of human parainfluenza virus vaccines. Expert Rev References Respir Med 2011;5(4):515–26. Storey DG, Côté MJ, Dimock K, Kang CY. Nucleotide sequence of the coding and flanking Almajhdi FN. Hemagglutinin-neuraminidase Gene sequence-based reclassification of regions of the human parainfluenza virus 3 hemagglutinin-neuraminidase gene: human parainfluenza virus 3 variants. Intervirology 2015;58(1):35–40. comparison with other paramyxoviruses. Intervirology 1987;27(2):69–80. Almajhdi FN, Alshaman MS, Amer HM. Molecular characterization and phylogenetic Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA5: molecular analysis of human parainfluenza virus type 3 isolated from Saudi Arabia. J Med Virol evolutionary genetics analysis using maximum likelihood, evolutionary distance, 2012;84(8):1304–11. and maximum parsimony methods. Mol Biol Evol 2011;28(10):2731–9. Berrueco R, Antón A, Rives S, Català A, Toll T, Ruiz A, et al. Multiplex real-time PCR for Ustun C, Slabý J, Shanley RM, Vydra J, Smith AR, Wagner JE, et al. Human parainfluenza prompt diagnosis of an outbreak of human parainfluenza 3 virus in children with virus infection after hematopoietic stem cell transplantation: risk factors, manage- acute leukemia. Infection 2013;41(6):1171–5. ment, mortality, and changes over time. Biol Blood Marrow Transplant 2012; Cilla G, Oñate E, Perez-Yarza EG, Montes M, Vicente D, Perez-Trallero E. Viruses in 18(10):1580–8. community-acquired pneumonia in children aged less than 3 years old: high rate van Wyke Coelingh KL, Winter CC, Jorgensen ED, Murphy BR. Antigenic and structural of viral coinfection. J Med Virol 2008;80(10):1843–9. properties of the hemagglutinin-neuraminidase glycoprotein of human parainfluenza Cortez KJ, Erdman DD, Peret TC, Gill VJ, Childs R, Barrett AJ, et al. Outbreak of human virus type 3: sequence analysis of variants selected with monoclonal antibodies parainfluenza virus 3 infections in a hematopoietic stem cell transplant population. which inhibit infectivity, hemagglutination, and neuraminidase activities. J Virol J Infect Dis 2001;184(9):1093–7. 1987;61(5):1473–7. Côté MJ, Storey DG, Kang CY, Dimock K. Nucleotide sequence of the coding and flanking van Wyke Coelingh KL, Winter CC, Murphy BR. Nucleotide and deduced amino acid regions of the human parainfluenza virus type 3 fusion glycoprotein gene. J Gen Virol sequence of hemagglutinin-neuraminidase genes of human type 3 parainfluenza 1987;68(Pt 4):1003–10. viruses isolated from 1957 to 1983. Virology 1988;162(1):137–43.