Impact of some environmental factors on growth and ochratoxin A production by Aspergillus niger and Aspergillus welwitschiae M.L. Abarca, M.R. Bragulat, G. Castellá*, F.J. Cabañes Veterinary Mycology Group, Department of Animal Health and Anatomy, Universitat Autònoma de Barcelona, Bellaterra, Spain. *Corresponding author: Gemma Castellá Grup de Micologia Veterinària Departament de Sanitat i d'Anatomia Animals Facultat de Veterinària, Universitat Autònoma de Barcelona 08193 Bellaterra (Barcelona), Spain. Tel: +34 93 5811089 Fax: +34 93 5812006 e-mail: Gemma.Castella@uab.cat 1 1 Abstract 2 Ochratoxin A (OTA) is a nephrotoxic mycotoxin which may contaminate various 3 foods and feed products worldwide. Aspergillus niger is one of the species responsible 4 for OTA contamination in grapes and derived products. This species has recently been 5 split into A. niger and Aspergillus welwitschiae. Both species can not be distinguished 6 by phenotypic or extrolite profiles and to date there is no ecophysiological information 7 of A.welwitschiae. 8 The aim of this study was to determine the effects of water activity (a w ) (0.90; 9 0.95 and 0.98-0.99), culture media (Yeast Extract Sucrose Broth (YESB); Synthetic 10 Grape Juice Medium (SGM); White grape juice (WGJ)) and temperature (15ºC, 25ºC 11 and 35ºC) on the growth and OTA production of four strains of A. niger and six strains 12 of A.welwitschiae. The assay was performed in microtiter plates, determining the 13 absorbance at 530 nm and the concentration of OTA at 1, 2, 4 and 10 days. 14 No significant differences were observed in absorbance and OTA values between 15 the two species under study. The highest absorbance values were recorded in YESB, 16 followed by SGM and WGJ. Absorbance values increased with increasing a w and 17 temperature. The highest OTA values were obtained at 0.98-0.99 a w and the best 18 culture media for OTA production was YESB, followed by WGJ and SGM. The studied 19 strains of A. niger produced the highest mean OTA level at 25ºC whereas A. 20 welwitschiae strains produced the highest mean OTA concentration at 15ºC, although 21 not differing significantly from concentration produced at 25ºC. 22 To our knowledge, this is the first report on the impact of some environmental 23 factors on growth and OTA production by A. welwitschiae. 24 2 25 Keywords: Aspergillus niger; Aspergillus welwitschiae; ecophysiology; grapes; 26 ochratoxin A; raisins 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 3 49 1. Introduction 50 51 Among the different mycotoxins which merit special concern for the hazard they 52 represent in food commodities, ochratoxin A (OTA) deserves particular attention. OTA 53 is nephrotoxic, hepatotoxic, neurotoxic, teratogenic and immunotoxic in various 54 animals in vitro, with renal toxicity and carcinogenesis being the key adverse effects 55 (Heussner and Bingle, 2015). Cereals, pulses, coffee, beer, wine and grape juice as well 56 as dried vine fruits, nuts, cacao products and spices have been found to be 57 contaminated frequently with OTA (EFSA, 2006). To date the European Union has 58 established maximum OTA levels for different food products (Commission of the 59 European Communities 2006, 2010, 2012, 2015). 60 OTA is produced by some Penicillium and Aspergillus spp. In Aspergillus section 61 Nigri, different studies have shown that Aspergillus carbonarius and Aspergillus niger 62 are an important source of OTA in food commodities such as wine, grapes and dried 63 vine fruits (Abarca et al., 2004; Cabañes and Bragulat 2018; Frisvad et al., 2007; 64 Visconti et al., 2012). The taxonomy of strains in the Aspergillus section Nigri has been 65 studied and debated for decades. Recently, the taxon Aspergillus niger sensu stricto 66 has been split into A. niger and A.welwitschiae (Hong et al., 2013; Perrone et al., 2011). 67 Both species can not be distinguished by phenotypic or ecological data including 68 extrolite profiles (Perrone et al., 2011). 69 Temperature and water activity (a w ) are the key environmental factors that 70 influence both the rate of fungal spoilage and the production of mycotoxins (Magan 71 and Aldred, 2007). To date, there is no ecophysiological information of A.welwitschiae 72 and there are only some studies on the impact of both environmental factors on the 4 73 growth and OTA production by A. niger isolates on semisynthetic media (Astoreca et 74 al., 2007; Barberis et al., 2009a,b; Lasram et al., 2016), on simulated grape juice 75 medium (Leong et al., 2006; Passamani et al., 2014; Selouane et al., 2009; Zouhair et 76 al., 2017) or on natural substrates (Alborch et al., 2011; Astoreca et al., 2009 a,b). In 77 most of those studies, only one or two A. niger strains were included. 78 In ecophysiological studies, growth is usually assessed by radial growth 79 measurement of fungal colonies developed at each culture media and incubation 80 conditions. The use of replicate plates for each condition studied and the subsequent 81 OTA extraction and quantification make these studies time-and labor intensive and not 82 suitable when a large number of isolates has to be evaluated. In our laboratory we 83 developed a new screening method to detect growth and OTA production by some 84 Aspergillus spp. and Penicillium spp. growing in a small quantity of culture media, using 85 microtiter plates (Abarca et al., 2014). The aim of this study was to adapt this method 86 to determine simultaneously the effects of three culture media at three water activity 87 levels and three incubation temperatures on the growth and OTA production by A. 88 niger and A.welwitschiae. 89 90 2. Materials and Methods 91 92 2.1. Strains and molecular identification 93 94 Four A. niger strains and six A.welwitschiae strains, mainly isolated from grapes 95 and raisins were studied (Table 1). All the strains were previously detected as OTA- 96 producers in our laboratory and had been initially identified as A. niger. 5 97 All the strains were confirmed for identity by sequencing of the calmodulin gene. 98 Briefly, DNA was extracted and purified from 48 h old cultures in malt extract broth 99 according to the FastDNA Spin kit protocol with the FastPrep FP-24 instrument (MP 100 Biomedicals, Biolink, Barcelona, Spain). The DNA was kept at -20 ºC until used as 101 template for PCR amplification. Following the DNA extraction, the calmodulin gene 102 was amplified and sequenced by using the fungal primers CL1/CL2A (O’Donnell et al., 103 2000). For the phylogenetic analyses, sequences obtained were aligned using Clustal X 104 v2.0.12 (Larkin et al., 2007) and analyzed to generate a phylogenetic tree in Mega 6 105 software (Tamura et al. , 2013). The Neighbor-Joining method based on the Tamura- 106 Nei model (Tamura and Nei, 1993) with 1,000 bootstrap replicates was used. 107 Aspergillus flavus CBS 569.65T was used as outgroup in this analysis. 108 109 2.2. Inoculum preparation and verification 110 111 Spore concentration was adjusted to around 106 conidia/ml. Briefly, the inoculum 112 suspensions were prepared in sterile saline (0.85%) containing 0.05% Tween 80 from 113 7-day-old cultures on malt extract agar at 25ºC. After heavy particles were allowed to 114 settle for 10-15 minutes, the upper homogenous suspensions were transferred to 115 sterile tubes and adjusted to 0.6 McFarland turbidity standard (Abarca et al., 2014) by 116 using a photometric method (Densimat, BioMérieux). The inoculum size was confirmed 117 by haemocytometer counting and quantitative colony counts. 118 119 2.3. Culture media and microtiter inoculation 120 6 121 Sterile 96-well flat-bottom microtiter plates were used. Three liquid culture media 122 were assayed: Yeast Extract Sucrose broth (YESB), used as a control, synthetic grape 123 juice medium (SGM) representative of grape composition at mid-veraison (Mitchell et 124 al., 2004), and white grape juice (WGJ). 125 YESB contained per liter: yeast extract, 20 g; sucrose, 150 g; FeSO4·7 H2O, 0.5 g; 126 pH adjusted to 6.5 (Samson et al., 2000). SGM consisted of D(+) glucose, 70g; D(-) 127 fructose, 30g; L(-) tartaric acid, 7g; L(-) malic acid, 10g; (NH4)2HPO4, 0.67g; KH2PO4, 128 0.67g; MgSO4·7 H2O, 1.5g; NaCl, 0.15g; CaCl2, 0.15g; CuCl2, 0.0015g; FeSO4 7 H2O, 129 0.021g; ZnSO4·7 H2O, 0.0075g; (+) Catechin hydrate, 0.05g; distilled water, 1 L; pH 130 adjusted with 10M NaOH to pH 4.0-4.2 (Mitchell et al., 2004). WGJ was prepared with 131 200ml of commercially sold white grape juice made from ecological grapes and 800 ml 132 of distilled water; pH adjusted at 4.0. 133 The initial a w was 0.98 for YESB and SGM media, and 0.99 for WGJ. These initial 134 values were modified to 0.95 a w and 0.90 a w by the addition of different amounts of 135 glycerol. Media were autoclaved and the final a w values were checked with 136 LabMASTER-a w (Novasina. Switzerland). 137 For each a w level, the adjusted fungal suspensions were diluted 1:100 in the 138 culture medium assayed (YESB, SGM, WGJ). In each microplate column, five wells were 139 inoculated with 200 µl of the diluted suspension of each strain and one well, used as a 140 blank, was filled with 200 µl of un-inoculated culture media (YESB, SGM ,WGJ). 141 Growth assessment and OTA production at each a w level were determined after 1, 142 2, 4, and 10 days of incubation at three different temperatures (15, 25, and 35ºC). 143 Thus, each strain-a w level-temperature combination was repeated in 4 microplates, 144 one for each reading day. For each sampling occasion and temperature assayed, 7 145 microtiter plates with the same water activity level were enclosed in sealed 146 polyethylene bags. The entire experiment was repeated twice on different days. 147 148 2.4. Growth measurement and OTA extraction procedure 149 150 For each culture media, a w level and temperature assayed, growth was monitored 151 by absorbance measurements at 530nm using the Multilabel-Reader Mithras LB 940 152 (Berthold Technologies, Bad Wildbad, Germany) after 1, 2, 4 and 10 days of incubation. 153 The absorbance of the corresponding uninoculated medium, used as blank was 154 subtracted to the absorbance values of the inoculated media. After each reading, 155 microplates were sealed and stored at -80ºC until they were analyzed for OTA content. 156 OTA production was detected using a previously described high-pressure liquid 157 chromatography (HPLC) screening method developed in our laboratory for fungi 158 growing in microtiter wells (Abarca et al., 2014). On each sampling occasion, one of the 159 five replicate wells inoculated for each strain, culture media, a w level and incubation 160 temperature, were randomly selected and their content was removed and extracted 161 with 0.5 ml of methanol. The extracts were filtered and injected into the HPLC. The 162 limit of quantification was 0.045 µg/ml for this mycotoxin. 163 164 2.5. Statistical Analysis 165 166 Data obtained from the different conditions tested were statistically analyzed by 167 means of one-way analysis of variance test and Student's test. The Pearson’s 168 coefficient (r) was used to quantify the relationship between haemocytometer counts 8 169 and colony counts of inocula. All statistical analyses were performed using Minitab 17 170 statistical software (Minitab Inc, State College, Pennsylvania, USA). 171 172 3. Results 173 174 3.1. Molecular species identification 175 176 Based on the calmodulin sequences, six strains were identified as A. welwitschiae 177 and four as A. niger. The phylogenetic tree was reconstructed showing that the isolates 178 split into two distinct clades: one grouping with A. niger CBS 554.65T and the other 179 with the sibling species A. welwitschiae CBS 139.54T (Fig. 1). The nucleotide sequences 180 of the calmodulin gene determined in this study have been deposited in the GenBank 181 and their accession numbers are given in Table 1. Sequence analysis revealed the 182 existence of 2 sequence types in A. niger and 3 sequence types in A. welwitschiae. 183 Sequence positions and differences of A. welwitschiae compared to A. niger JX500080 184 in calmodulin gene were: 146 (T), 169 (C), 190-191 (CT), 197-198 (TT), 221 (-), and 185 505 (T) (Fig. S1). 186 187 3.2. Inoculum standardization 188 189 Mean colony counts of A. niger and A. welwitschiae suspensions adjusted to 0.6 190 McFarland turbidity standard were 0.8 ± 0.2 x 106 cfu/ml and 0.7 ± 0.2 x 106 cfu/ml 191 respectively. The inocula enumerated with a cell-counting haemocytometer provided 192 suspensions of 1.8 ± 0.1 x 106 conidia/ml for A. niger, and 1.9 ± 0.2 x 106 conidia/ml for 9 193 A. welwitschiae. Pearson’s coefficient between both systems of measurements was 194 0.912. 195 196 3.3. Growth measurement 197 198 Results of one-way analysis of variance of absorbance values versus each of the 199 variables assayed are shown in Table 2. No significant differences were observed in 200 absorbance values neither between the species, nor between the assays, nor between 201 the replicates (p > 0.05). Temperature, culture media and water activity significantly 202 affected (p<0.01) growth of all the strains studied. The higher the a w and temperature, 203 the higher absorbance values. The highest significant absorbance values (p<0.001) 204 were obtained at 35ºC and 0.99 a w . Regarding culture media, the highest significant 205 absorbance values (p<0.001) were recorded in YESB, followed by SGM and WGJ. 206 Table 3 shows mean absorbance values of all the studied strains at each condition 207 assayed and incubation time. As no statistically significant differences were observed 208 between species, replicates or experiment, the results are expressed as a mean value. 209 The highest absorbance values were obtained at 35ºC in all culture media and a w . At 210 this high temperature a statistically significant growth increase was recorded after 2 211 days (0.98-0.99 a w and 0.95 a w ) or 4 days (0.90 a w ) of incubation, while at 25ºC this 212 increase was observed after 2-4 days (0.98-0.99 a w and 0.95 a w ) or 10 days (0.90 a w ) of 213 incubation. At 15ºC, none of the strains grew in any culture media adjusted at 0.90 a w 214 during the experimental period of this study. At this low temperature, a significant 215 increase in absorbance values was observed at 10 days of incubation at 0.95 a w and 216 0.98-0.99 a w , although a slight increase was observed after four days of incubation in 10 217 YESB and WGJ. In all culture media, initial growth in the microtiter wells could be 218 visually detected at the naked eye, when absorbance value was greater than 0.1. 219 220 3.4. OTA production 221 222 No significant differences were observed in OTA concentration neither between 223 the species, nor between the assays (p > 0.05) (Table 2). Temperature, culture media 224 and water activity significantly affected (p<0.01) OTA production of all the strains 225 studied. The highest significant OTA values (p<0.001) were obtained at 0.98-0.99 a w . 226 The best culture media (p<0.001) for OTA production was YESB, followed by WGJ and 227 SGM, although no statistically significant differences were observed between both last 228 culture media. 229 In order to see the individual behavior of strains, OTA concentration produced by 230 A. niger and A. welwitschiae at each condition assayed and incubation time are shown 231 in Tables 4 and 5 respectively. Results are expressed as mean value of both 232 experiments as no statistically significant differences were observed (p>0.05). Interval 233 Plot of OTA mean values in A. niger and A. welwitschiae strains at each a w and 234 temperature assayed is shown in Fig. 2. The studied strains of A. niger produced the 235 highest mean OTA level at 25ºC whereas A. welwitschiae strains produced the highest 236 mean OTA concentration at 15ºC, although not differing significantly from 237 concentration produced at 25ºC. For both species, YESB was in general the most 238 favorable medium for OTA production. In the remaining media, mean OTA levels were 239 higher in WGJ than in SGM, although this difference was not statistically significant. In 240 relation to the a w , the greatest production of OTA was observed at the highest a w . 11 241 None of the strains produced detectable levels of OTA in any culture media adjusted at 242 0.90 a w. 243 In A. niger strains, the highest OTA concentration was recorded after 4 days of 244 incubation at 25ºC in YESB-0.98a w (strains A-75, A-136 and A-1609) and in SGM-0.98a w 245 (strain A-3919). In three of the four strains studied, OTA production could be detected 246 after only two days in WGJ-0.99 a w -25ºC and in YESB-0.98 a w -35ºC. 247 In A. welwitschiae strains, the highest OTA concentration was recorded also after 4 248 or 10 days of incubation at 25ºC in YESB-0.98a w (strains A-942, A-943, A-3204 and A- 249 3694). Strains A-1899 and A-1944 instead, achieved their maximum OTA concentration 250 at 15ºC in YESB-0.98a w . Quantifiable levels of OTA were detected after only 2 days in 251 WGJ in some conditions. 252 253 4. Discussion 254 255 For each strain and reading day (1, 2, 4 and 10 days), the total number of 256 conditions studied were 27 (3 culture media at 3 water activities and 3 incubation 257 temperatures). Only few studies have examined the combined effect of temperature 258 and water activity on growth and OTA production by A. niger strains. These studies are 259 usually carried out in only one solid culture medium and with a reduced number of 260 strains. In previous studies on YES agar, the A. niger strains A-75 and A-136 produced 261 the highest OTA level at 20-25ºC and 0.98-0.99 a w (Esteban et al., 2004; 2006). So, 262 similar results have been obtained by using microtiter plates. 263 As no statistically significant differences were observed in absorbance and OTA 264 values between the experiments, our method are suitable to assess the impact of a 12 265 great number of environmental conditions on growth and OTA production of a large 266 number of isolates. 267 In spectrophotometric methods inoculum size is a critical variable. In this paper we 268 have used the initial inoculum size (106 conidia/ml) and final inoculum concentration in 269 the wells (104 conidia/ml) recommended in the in vitro antifungal susceptibility testing 270 of filamentous fungi (CLSI, 2008). Using conidial suspensions adjusted to 0.6 Mc 271 Farland units, good correlation between haemocytometer counting of conidia and 272 colony counts were obtained. So, the adjustment of suspensions using the 273 densitometer Densimat (BioMérieux) can be a good alternative to adjust turbidity of 274 suspensions of A. niger and A. welwitschiae as we have previously recommended for 275 some Aspergillus spp. and Penicillium spp. (Abarca et al., 2014; Cabañas et al., 2009). 276 Aspergillus welwitschiae and A. niger cannot be separated from each other using 277 either morphological or extrolite data and only molecular approaches can be used 278 reliably to distinguish them (Hong et al., 2013; Perrone et al., 2011; Varga et al., 2011). 279 We found the fixed nucleotide differences between them suggested for their 280 identification by Hong et al. (2013) in the calmodulin sequences. 281 Our results show that the effect of water activity, culture media and temperature 282 on growth and ochratoxin A production by A. niger and A. welwitschiae have been very 283 similar and no significant differences between both species were observed neither in 284 absorbance values nor in OTA concentration. As we have previously reported for A. 285 niger strains, the range of a w and temperature conditions for growth was wider than 286 that for OTA production and in some cases, the amounts of OTA detected decreased 287 when increasing incubation time (Esteban et al., 2004; 2006). Some authors suggested 288 that strains could remove and assimilate the phenylalanine moiety from the OTA 13 289 molecule, as other nitrogen sources of the culture medium become exhausted (Téren et 290 al., 1996). 291 Nevertheless, taking into account that A. niger and A. welwitschiae have been 292 distinguished only recently, the reported ecophysiological data are probably that of 293 both species. Perrone et al. (2011) reported that A. niger and A. welwistchiae had the 294 same ranges of growth rates in the culture media and temperatures recommended to 295 identify black aspergilli (Samson et al., 2007), but nothing is known about optimal 296 conditions for OTA production. To our knowledge, this is the first report on the impact 297 of some environmental factors on growth and OTA production by A. welwitschiae. 298 In an attempt to find other criteria to distinguish A. niger from A. welwitschiae, Varga 299 et al. (2011) reported some physiological differences in elastase activities and abilities 300 to utilize 2-deoxy-D-glucose as sole carbon source. In our study we found some 301 differences in the optimum temperature of OTA production: 25ºC for the studied A. 302 niger strains and 15-25ºC for A. welwitschiae, depending on the strains. 303 In view of the importance of these species in mycotoxin contamination of various 304 agricultural products, new studies including correctly identified strains are needed. The 305 method used here is simple, technically easy, and appropriate for ecophysiological 306 studies with a large number of isolates and conditions. 307 308 Aknowledgements 309 310 We thank C. Gómez for her valuable technical assistance, and P. Battilani and A. 311 Venancio for kindly providing us with some of the strains used in this study. 14 312 This research was supported by the Ministerio de Economía, Industria y 313 Competitividad of the Spanish Government (AGL2014-52516-R). 314 315 References 316 317 Abarca, M.L., Accensi, F., Cano, F., Cabañes, F.J., 2004. Taxonomy and significance of 318 black aspergilli. Antonie van Leeuwenhoek 86, 33-49. 319 Abarca, M.L., Bragulat, M.R., Cabañes, F.J., 2014. A new in vitro method to detect 320 growth and ochratoxin A-producing ability of multiple fungal species commonly 321 found in food. Food Microbiol. 44, 243-248. 322 Alborch, L., Bragulat, M.R., Abarca, M.L., Cabañes, F.J., 2011. Effect of water activity, 323 temperature and incubation time on growth and ochratoxin A production by 324 Aspergillus niger and Aspergillus carbonarius on maize kernels. Int. J. Food 325 Microbiol. 147, 53-57. 326 Astoreca, A., Magnoli, C., Barberis, C., Chiacchiera, S.M., Combina, M., Dalcero, A., 327 2007. Ochratoxin A production in relation to ecophysiological factors by 328 Aspergillus section Nigri strains isolated from different substrates in Argentina. Sci. 329 Total Environ. 388, 16-23. 330 Astoreca, A., Barberis, C., Magnoli, C., Combina, M., Dalcero, A., 2009a. 331 Ecophysiological factor effect on growth, lag phase and ochratoxin A production 332 by Aspergillus niger aggregate strains in irradiated peanut seeds. Int. J. Food 333 Microbiol. 129, 131-135. 334 Astoreca, A., Barberis, C., Magnoli, C., Combina, M., Dalcero, A., 2009b. Influence of 335 ecophysiological factors on growth, lag phase and ochratoxin A production by 15 336 Aspergillus niger aggregate strains in irradiated corn grains. Int. J. Food 337 Microbiol. 129, 174-179. 338 Barberis, C., Astoreca, A., Asili, R., Fernandez-Juri, G., Chulze, S., Magnoli, C., Dalcero, 339 A., 2009a. In vitro control of growth and ochratoxin A production by butylated 340 hydroxyanisole in Aspergillus section Nigri species. Food Control 20, 709-715. 341 Barberis, C., Astoreca, A., Fernandez-Juri, G., Chulze, S., Dalcero, A., Magnoli, C., 342 2009b. Use of propyl paraben to control growth and ochratoxin A production by 343 Aspergillus section Nigri species on peanut meal extract agar. Int. J. Food 344 Microbiol. 136, 133-136. 345 Cabañes, F.J., Bragulat, M.R., 2018. Black aspergilli and ochratoxin-producing species 346 in foods. Curr. Opin. Food Sci. 23, 1-10. 347 Cabañas, R., Abarca, M.L., Bragulat, M.R., Cabañes, F.J., 2009. In vitro activity of 348 Imazalil against Penicillium expansum: Comparison of the CLSI M38-A broth 349 microdilution method with traditional techniques. Int. J. Food Microbiol. 129, 350 26-29. 351 Clinical and Laboratory Standards Institute, 2008. Reference method for broth dilution 352 antifungal susceptibility testing of filamentous fungi. Approved Standard M38-A2. 353 Clinical and Laboratory Standards Institute, Wayne. 354 Commission of the European Communities, 2006. Commission regulation (EC) No 355 1881/2006 of 19 December 2006 setting maximum levels for certain 356 contaminants in foodstuffs. Off. J. Eur. Union L364, 5-24. 357 Commission of the European Communities, 2010. Commission regulation (EU) No 358 105/2010 of 5 February 2010 amending Regulation (EC) No 1881/2006 setting 16 359 maximum levels for certain contaminants in foodstuffs as regards ochratoxin A. 360 Off. J. Eur. Union L35, 7-8. 361 Commission of the European Communities, 2012. Commission regulation (EU) No 362 594/2012 of 5 July 2012 amending Regulation (EC) 1881/2006 as regards the 363 maximum levels of the contaminants ochratoxin A, non dioxin-like PCBs and 364 melamine in foodstuffs. Off. J. Eur. Union L176, 43-45. 365 Commission of the European Communities, 2015. Commission regulation (EU) 366 2015/1137 of 13 July 2015 amending Regulation (EC) No 1881/2006 as regards the 367 maximum level of Ochratoxin A in Capsicum spp. spices. Off. J. Eur. Union L185, 368 11-12. 369 EFSA (European Food Safety Authority), 2006. Opinion of the scientific panel on 370 contaminants in the food chain on a request from the commission related to 371 ochratoxin A in food. EFSA J. 365, 1-56. 372 Esteban, A., Abarca, M.L., Bragulat, M.R., Cabañes, F.J., 2004. Effects of temperature 373 and incubation time on production of ochratoxin A by black aspergilli. Res. 374 Microbiol. 155, 861-866. 375 Esteban, A., Abarca, M.L., Bragulat, M.R., Cabañes, F.J., 2006. Study of the effect of 376 water activity on ochratoxin A production by Aspergillus niger aggregate species. 377 Int. J. Food Microbiol. 108, 188–195. 378 Frisvad, F.J., Larsen, T.O., de Vries, R., Meijer, M., Houbraken, J., Cabañes, F.J., Ehrlich, 379 K., Samson, R.A., 2007. Secondary metabolite profiling, growth profiles and other 380 tools for species recognition and important Aspergillus mycotoxins. Stud. Mycol. 381 59: 31–37. 2007. 17 382 Hong, S-B., Lee, M., Kim, D-H., Varga, J., Frisvad, J.C., Perrone, G., Gomi, K., Yamada, O., 383 Machida, M., Houbraken, J., Samson, R.A., 2013. Aspergillus luchuensis, an 384 industrially important Black Aspergillus in East Asia. PLoS ONE 8(5):e63769. 385 Heussner, A. H. and Bingle, L. E. H., 2015. Comparative ochratoxin toxicity: A review 386 of the available data. Toxins 7, 4253-4282. 387 Larkin, M.A., Blackshields, G., Brown, N.P., Chenna, R., McGettigan, P.A., McWilliam, 388 H., Valentin, F., Wallace, I.M., Wilm, A., Lopez, R., Thompson J.D., Gibson, T.J., 389 Higgins D.G., 2007. ClustalWand Clustal X version 2.0. Bioinformatics 23, 2947- 390 2948. 391 Lasram, S., Hamdi, Z., Chenenaoui, S., Mliki, A., Ghorbel, A., 2016. Comparative study 392 of toxigenic potential of Aspergillus flavus and Aspergillus niger isolated from 393 Barley as affected by temperature, water activity and carbon source. J. Stored 394 Prod. Res. 69: 58-64. 395 Leong, S.L., Hocking, A.D., Scott, E.S., 2006. Effect of temperature and water activity on 396 growth and ochratoxin A production by Australian Aspergillus carbonarius and A. 397 niger isolates on a simulated grape juice medium. Int. J. Food Microbiol. 110: 209- 398 216. 399 Magan, N., Aldred, D., 2007. Post-harvest control strategies: Minimizing mycotoxins in 400 the food chain. Int. J. Food Microbiol. 119, 131-139. 401 Mitchell, D., Parra, R., Aldred, D., Magan, N., 2004. Water and temperature relations of 402 growth and ochratoxin A production by Aspergillus carbonarius strains from 403 grapes in Europe and Israel. J. Appl. Microbiol. 97, 439-445. 404 O’Donnell, K., Niremberg, H.I., Aoki, T., Cigelnik, E., 2000. A multigene phylogeny of 18 405 the Gibberella fujikuroi species complex: detection of additional phylogenetically 406 distinct species. Mycoscience 41, 61-78. 407 Passamani, F.R.F., Hernandes, T., Lopes, N.A., Bastos, S.C., Santiago, W.D., Cardoso, 408 M.G., Batista, L.R., 2014. Effect of temperature, water activity, and pH on growth 409 and production of ochratoxin A by Aspergillus niger and Aspergillus carbonarius 410 from Brazilian grapes. J. Food Prot. 77, 1947-1952. 411 Perrone, G., Stea, G., Epifani, F., Varga, J., Frisvad, J.C., Samson, R.A., 2011. Aspergillus 412 niger contains the cryptic phylogenetic species A. awamori. Fungal Biol. 115, 1138- 413 1150. 414 Samson, R.A., Hoekstra, E.S., Frisvad, J.C., Filtenborg, O., 2000. Introduction to food- 415 and airborne fungi. Centraalbureau voor Schimmelcultures, Utrech. 416 Samson, R.A., Noonim, P., Meijer, M., Houbraken, J., Frisvad, J.C., Varga, J., 2007. 417 Diagnostic tools to identify black aspergilli. Stud. Mycol. 59:129-145. 418 Selouane, A., Bouya, D., Lebrihi, A., Decock, C., Bouseta, A., 2009. Impact of some 419 environmental factors on growth and production of ochratoxin A of/by Aspergillus 420 tubingensis, A. niger, and A. carbonarius isolated from Moroccan grapes. J. 421 Microbiol. 47, 411-419. 422 Tamura, K., Nei, M., 1993. Estimation of the number of nucleotide substitutions in the 423 control region of mitochondrial DNA in humans and chimpanzees. Mol. Biol. Evol. 424 10, 512-526. 425 Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2013. MEGA6: molecular 426 evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 30, 2725-2729. 427 Téren, J., Varga, J., Hamari, Z., Rinyu, E., Kevei, F., 1996. Immunochemical detection of 428 ochratoxin A in black Aspergillus strains. Mycopathologia 134, 171-176. 19 429 Varga, J., Frisvad, J.C., Kocsubé, B., Tóth, B., Szigeti, G., Samson, R.A., 2011. New and 430 revisited species in Aspergillus section Nigri. Stud. Mycol. 69:1-17. 431 Visconti, A., Perrone, G., Cozzi, G., Solfrizzo, M., 2012. Managing ochratoxin A risk in 432 the grape-wine food chain. Food Add. Contam. 25, 193-202. 433 Zouhair, S., Laaziz, A., Qjidaa, S., Bouseta, A., 2017. Growth and ochratoxin A 434 production by Aspergillus carbonarius and Aspergillus niger in relation to culture 435 medium, water activity and temperature. Glo. Adv. Res. J. Agric. Sci. 6, 314-322. 436 20 Figure captions Fig. 1. Phylogenetic tree of Aspergillus section Nigri inferred from Neighbor-Joining analysis of partial calmodulin gene. Bootstrap values >70% in 1,000 replications are shown at nodes. Sequence of Aspergillus flavus CBS 569.65T was selected as outgroup for the tree construction. Fig. 2. Interval Plot of mean OTA production/values in A. niger (An) and A. welwitschiae (Aw) strains at each water activity (a w ) and temperature (T) values assayed. Fig. S1. Alignment of calmodulin sequences of A. welwitschiae and A. niger genetic types and A. niger JX500080 sequence. Identical nucleotides are indicated by dots. 21 Table 1. Strains, identification, source, location and calmodulin sequence type. Calmodulin sequence type Strain numbera Identification Source, location (GenBank acc. no.) A-75 A. niger Feedstuffs, Spain I (MH614646) A-136 A. niger Soya beans, Spain I A-942 A. welwitschiae Raisins, Spain III (MH614648) A-943 A. welwitschiae Grapes, Portugal IV (MH614649) A-1609 A. niger Grapes, Spain I A-1899 A. welwitschiae Grapes, Italy V(MH614650) A-1944 A. welwitschiae Grapes, Portugal IV A-3204 A. welwitschiae Popcorn kernel, Spain IV A-3694 A. welwitschiae Grapes, Spain IV A-3919 A. niger Raisins, Iran II (MH614647) a Culture Collection of the Veterinary Mycology Group, Universitat Autònoma de Barcelona, Spain. 22 Table 2. One-way analysis of variance of Absorbance (ABS) and Ochratoxin A (OTA) values versus (vs.) each of the variables assayed. p value Strains vs. EXP vs. a w vs. T (ºC) vs. culture media vs. spp. vs. strain All (n=10) ABS 0.463 0.000 (0.99a > 0.95b > 0.90c) 0.000 (35º a > 25º b >15º c) 0.000 ( YESBa>SGMb>WGJc) 0.373 0.974 OTA 0.422 0.000 (0.99a > 0.95b > 0.90b) 0.000 (25º a >15º a,b >35º b) 0.000 ( YESBa>WGJb>SGMb) 0.676 0.300 A. niger (n=4) ABS 0.779 0.04 (0.99a > 0.95a,b > 0.90b) 0.000 (35º a >25º b >15º c) 0.000 ( YESBa>SGMb>WGJc) - 0.787 OTA 0.468 0.018 (0.99a > 0.95b > 0.90b) 0.011 (25º a >15º b >35º b) 0.000 ( YESBa>WGJb>SGMb) - 0.634 A. welwitschiae (n=6) ABS 0.478 0.000 (0.99a > 0.95b > 0.90b) 0.000 (35º a >25º b >15º c) 0.000 ( YESBa>SGMb>WGJc) - 0.968 OTA 0.691 0.018 (0.99a > 0.95a,b > 0.90b) 0.010 (15º a >25º a >35º b) 0.000 ( YESBa>WGJb>SGMb) - 0.058 a,b,c values of variables with the same superscript are not significantly different (p>0.05). Abbreviations: EXP, experiment; a w , water activity; T, temperature; spp., species; YESB, Yeast extract sucrose broth; SGM, Synthetic grape juice medium; WGJ, White grape juice. 23 Table 3. Mean absorbance values recorded in both experiments by all the studied strains (A. niger and A. welwitschiae) at each condition and incubation time tested. Culture 15ºC 25ºC 35ºC media /days 0.98-0.99 0.95 0.90 0.98-0.99 0.95 0.90 0.98-0.99 0.95 0.90 YESB / 1 0.0080a 0.0068a 0.0113a 0.0276a 0.0023a 0.0044a 0.0545a 0.0298a 0.0111a /2 0.0081a 0.0057a 0.0041b 0.3862b 0.0242a 0.0066a 1.6657b 1.1940b 0.0289a /4 0.0662b 0.0089a 0.0040b 1.7813c 1.4915b 0.0310b 2.1753c 2.0634c 1.3995b / 10 1.7138c 0.3164b 0.0054b 2.4674d 2.3731c 1.7550c 2.8329d 2.6408d 2.3439c SGM / 1 0.0003a 0.0006a 0.0228a 0.0057a 0.0023a 0.0134a 0.0445a 0.0258a 0.0155a /2 0.0013a 0.0010a 0.0103b 0.0413a 0.0177a 0.0111a 0.6125b 0.2068b 0.0251a /4 0.0280a 0.0023a 0.0110b 0.8444b 0.3203b 0.0217a 1.1583c 0.5651c 0.2336b / 10 0.6844b 0.2215b 0.0084b 1.2521c 0.7638c 0.3105b 1.3923d 0.7060d 0.5238c WGJ / 1 - 0.0007a - 0.0005a 0.0074a 0.0358a 0.0060a 0.0051a 0.1386a 0.0494a 0.0202a /2 0.0093b - 0.0005a 0.0046a 0.1937b 0.0492b 0.0101a 0.4262b 0.3041b 0.0713b /4 0.1422c 0.0252b -0.0051b 0.3291c 0.2175c 0.0394b 0.5508c 0.3793c 0.1876c / 10 0.3365d 0.2447c 0.0191c 0.4302d 0.3152d 0.1472c 0.6890d 0.5209d 0.3166d a,b,c,d In columns, values with the same superscript within each culture medium are not significantly different (P>0.05). 24 Table 4. OTA concentration in µg/ml produced by A. niger strains at each condition assayed and incubation time. 15ºC 25ºC 35ºC ref. days 0.98-0.99 0.98-0.99 0.95 0.98 strain YESB WGJ YESB SGM WGJ YESB SGM WGJ YESB A-75 2 -a - - - 0.055 - - - 0.16 4 - - 4.68 0.057 0.05 0.18 - 0.052 0.14 10 0.73 0.052 2.59 - 0.068 0.14 - 0.052 - A-136 2 - - - - 0,1 - - - 0.12 4 - - 8.83 0.052 0.094 0.15 0,095 0.055 0.091 10 0.055 0.055 0.82 - 0.11 0.12 - 0.055 - A-1609 2 - - - - 0.06 - - - 0.14 4 - - 10.1 - 0.06 0.2 - 0.062 - 10 0.15 0.052 1.15 - 0.068 0.075 - 0.055 - A-3919 2 - - - - - - - - - 4 - - - 1.65 - - - - - 10 0.16 - 0.16 0.61 - - - - - a -, denotes not detected 25 Table 5. OTA concentration in µg/ml produced by A. welwitschiae strains at each condition assayed and incubation time. 15ºC 25ºC 35ºC ref. strain days 0.98-0.99 0.95 0.98-0.99 0.95 0.98 YESB SGM WGJ SGM WGJ YESB SGM WGJ YESB SGM WGJ YESB A-942 2 -a - - - - - - 0.11 - - 0.052 - 4 - - - - - 3.37 0.067 0.10 0.21 0.20 0.08 0.6 10 1.21 0.084 0.052 0.062 0.062 5.94 0.052 0.075 2.20 0.070 0.063 - A-943 2 - - - - - - - - - - - - 4 - - - - - 0.19 - 0.052 - - - - 10 0.067 0.060 0.052 - - 0.17 - 0.057 - - - - A-1899 2 - - - - - - - 0.062 - - - - 4 - - - - - 1.05 0.11 0.06 0.12 - 0.052 - 10 5.76 0.12 0.06 - - 0.68 - 0.06 1.47 - 0.052 - A-1944 2 - - - - - - - 0.06 - - - - 4 - - - - - 2.28 0.078 0.06 0.44 - 0.055 - 10 7.30 0.08 0.08 0.055 0.052 0.88 - 0.055 1.08 - - - A-3204 2 - - - - - - - 0.055 - - - - 4 - - - - - 1.61 0.080 0.06 0.10 - - - 10 0.37 0.07 0.055 - - 0.25 - 0.052 0.12 - - - A-3694 2 - - - - - - - 0.057 - - - 0.08 4 - - - - - 1.62 - 0.074 0.072 - - - 10 0.25 - 0.055 - - 0.51 - 0.055 0.065 - - - a -, denotes not detected 26 A. welwitschiae CBS 139.54T (KC480196) A3694 A942 98 A3204 A943 A1944 100 A1899 A. niger CBS 554.65T (JX500080) A3919 86 A. lacticoffeatus CBS 101883T (EU163270) A75 A1609 A136 A. tubingensis CBS 134.48T (AJ964876) T 81 A. piperis CBS 112811 (EU163267) 99 A. luchuensis CBS 205.80T (JX500071) A. neoniger CBS 115656T (FJ491700) A. costaricaensis CBS 115574 T (EU163268) 81 A. vadensis CBS 113365 T (EU163269) A. eucalypticola CBS 122712 T (EU482433) A. brasiliensis CBS 101740 T (AM295175) A. sclerotioniger CBS 115572T (EU163271) 89 A. carbonarius CBS 556.65 T (AJ964873) 90 A. sclerotiicarbonarius CBS 121057 T (EU159235) A. ibericus CBS 121593 T (AJ971805) A. ellipticus CBS 482.65 T (AM117809) 98 A. heteromorphus CBS 117.55 T (AM421461) A. homomorphus CBS 101889 T (AM887865) A. labruscus IBT 33586 T (KT986008) A. saccharolyticus CBS 127449 T (HM853554) 97 A. indologenus CBS 114.60 T (AM419750) 73 96 A. japonicus CBS 114.51 T (AJ964875) A. uvarum CBS 121591 T (AM745755) 100 A. aculeatinus CBS 121060 T (EU159241) A. aculeatus CBS 172.66 T (AJ964877) 82 A. floridensis IHEM 21069 (HE818083) A. trinidadensis NRRL 62480 (HE984425) A. fijensis CBS 313.89 T (FJ491695) 92 A. brunneoviolaceus CBS 621.78 T (EF661147) A. flavus CBS 569.65 T (FN594583) 0.05 Fig. 2. Interval Plot of mean OTA values in A. niger (An) and A. welwistchiae (Aw) strains at each water activity (a w ) and temperature (T) values assayed. Interval Plot of OTA (CI 95%) 1,2 1,0 0,8 OTA (ug/ml) 0,6 0,4 0,2 0,0 spp. An Aw An Aw An Aw An Aw An Aw An Aw An Aw An Aw An Aw aw 0.90 0.95 0.99 0.90 0.95 0.99 0.90 0.95 0.99 T (ºC) 15 25 35 . ɵ, denotes OTA not detected. Fig. S1. Alignment of calmodulin sequences of A. welwitschiae and A. niger genetic types and A. niger JX500080 sequence. Identical nucleotides are indicated by dots. 10 20 30 40 50 60 70 80 90 100 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| A942 TCTCCCTCTTTGTGAGTGCTCCCTGAATGACCCTCCGATCATCCTGATCGATGAGCTATCTTTACCGGAGCATAATGCTAATGTGTTTTCGGACTTAATA A1899 .................................................................................................... A943 .................................................................................................... A75 .................................................................................................... A3919 .................................................................................................... JX500080 .................................................................................................... 110 120 130 140 150 160 170 180 190 200 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| A942 GGACAAGGATGGCGATGGTGGGTGGAATTCTATCCCCTTCACATTTTACCTGTAGCGCTCGATCCGACCGCGGGATTTCGACAGCATTTCTCAGAATTAT A1899 .................................................................................................... A943 ............................C....................................................................... A75 .............................................A......................T....................TC.....CG.. A3919 .............................................A......................T....................TC.....CG.. JX500080 .............................................A......................T....................TC.....CG.. 210 220 230 240 250 260 270 280 290 300 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| A942 TTGGATCATAATACTAATT--AATCGGTGAATCAGGCCAGATCACCACCAAGGAGCTCGGCACTGTGATGCGCTCCCTTGGCCAGAACCCCTCCGAGTCT A1899 ...................T-............................................................................... A943 ...................T-............................................................................... A75 ..A................TA............................................................................... A3919 ...................TA............................................................................... JX500080 ...................TA............................................................................... 310 320 330 340 350 360 370 380 390 400 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| A942 GAGCTTCAGGACATGATCAACGAGGTTGACGCTGACAACAACGGAACGATCGACTTCCCCGGTATGTGTTAGATTTACGCCTGTAAGGCGGAAATGCGGG A1899 .................................................................................................... A943 .................................................................................................... A75 .................................................................................................... A3919 .................................................................................................... JX500080 .................................................................................................... 410 420 430 440 450 460 470 480 490 500 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| A942 CTGGATTGTGATTGACTTTTGCCGCCAGAATTCCTTACCATGATGGCTCGTAAGATGAAGGACACCGACTCCGAGGAGGAAATCCGCGAGGCTTTCAAGG A1899 .................................................................................................... A943 .................................................................................................... A75 .................................................................................................... A3919 .................................................................................................... JX500080 .................................................................................................... 510 520 530 540 550 560 570 580 590 600 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| A942 TCTTTGACCGCGACAACAATGGTTTTATCTCCGCCGCGGAGCTGCGCCACGTCATGACCTCCATTGGCGAGAAGCTCACCGACGACGAAGTCGATGAGAT A1899 .................................................................................................... A943 .................................................................................................... A75 ....C............................................................................................... A39191 ....C............................................................................................... JX500080 ....C............................................................................................... 610 620 630 640 650 660 670 680 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|.. A942 GATCCGTGAGGCGGACCAGGACGGTGATGGCCGCATCGACTGTATGTTTACCATGCCCGATTATACTCATATCATAACATAC A1899 ..............................................................T................... A943 .................................................................................. A75 .......................................................................A.......... A3919 .......................................................................A.......... JX500080 .......................................................................A..........