Brain Research 1712 (2019) 101–108 Contents lists available at ScienceDirect Brain Research journal homepage: www.elsevier.com/locate/brainres Research report Altered expression of dopaminergic cell fate regulating genes prior to T manifestation of symptoms in a transgenic rat model of Huntington's disease Gemma Hugueta, Yasin Temelb, Elisabet Kádára, Sylvana Polb, Joao Casaca-Carreirab, ⁎ Pilar Segura-Torresc, Ali Jahanshahib, a Departament de Biologia, Universitat de Girona, Girona, Spain b Department of Neurosurgery, Maastricht University Medical Center, Maastricht, The Netherlands c Departament de Psicobiologia i de Metodologia de les Ciències de la Salut, Universitat Autònoma de Barcelona, Bellaterra, Barcelona, Spain H I GH L IG H T S • Dopaminergic cell fate related gene expression is altered in tgHD rats. • Zbtb16 may be a candidate to be regionally tuning dopaminergic cell fate. • Changes in dopaminergic system could precede the manifestation of HD symptoms. A R T I C LE I N FO A B S T R A C T Keywords: Hyperactivity of the dopaminergic pathway is thought to contribute to clinical symptoms in the early stages of Huntington’s disease Huntington’s disease (HD). It is suggested to be result of a reduced dopaminergic inhibition by degeneration of Hyperdopaminergic status medium spiny neurons in the striatum. Substantia nigra Previously, we have shown that the number of dopaminergic cells is increased in the dorsal raphe nucleus Ventral tegmental area (DRN) of HD patients and transgenic HD (tgHD) rats during the manifestation phase of the disease; as well as in Transgenic rat model the substantia nigra pars compacta (SNc) and ventral tegmental area (VTA) of tgHD rats. To address whether Neurotransmitter phenotype these changes are secondary to neurodegeneration or take place in the pre-manifest phase of the disease, we examined the expression of genes controlling neuronal cell fate and genes that define dopaminergic cell phe- notype. In the SNc-VTA of tgHD rats, Msx1 was upregulated, which correlated with an altered expression of tran- scription factors Zbtb16 and Tcf12. Zbtb16 was upregulated in the DRN and it was the only gene that showed a correlated expression in the tgHD rats between SNc-VTA and DRN. Zbtb16 may be a candidate for regionally tuning its cell populations, resulting in the increase in dopaminergic cells observed in our previous studies. Here, we demonstrated an altered expression of genes related to dopaminergic cell fate regulation in the brainstem of 6 months-old tgHD rats. This suggests that changes in dopaminergic system in HD precede the manifestation of clinical symptoms, contradicting the theory that hyperdopaminergic status in HD is a con- sequence of neurodegeneration in the striatum. 1. Introduction motor symptoms, with mid-life onset (Pringsheim et al., 2012; Victorson et al., 2014). HD is caused by a CAG repeats expansion in the Huntington's disease (HD) is a rare neurodegenerative disorder huntingtin (Htt) gene (MacDonald et al., 1993). The Htt protein interacts characterized by progressive and disabling cognitive, emotional, and with a large number of effector proteins, including transcription factors Abbreviations: DA, dopamine; DEPC, diethylpyrocarbonate; DRN, dorsal raphe nucleus; HD, Huntington's disease; Htt, huntingtin; SNc, substantia nigra pars compacta; tgHD, transgenic rat model of HD; VTA, ventral tegmental area; WT, wild type ⁎ Corresponding author. E-mail addresses: gemma.huguet@udg.edu (G. Huguet), y.temel@maastrichtuniversity.nl (Y. Temel), elisabet.kadar@udg.edu (E. Kádár), sylvana.pol@maastrichtuniversity.nl (S. Pol), j.casacacarreira@maastrichtuniversity.nl (J. Casaca-Carreira), pilar.segura@uab.cat (P. Segura-Torres), a.jahanshahi@maastrichtuniversity.nl (A. Jahanshahi). https://doi.org/10.1016/j.brainres.2019.01.041 Received 11 October 2018; Received in revised form 24 January 2019; Accepted 30 January 2019 Available online 31 January 2019 0006-8993/ © 2019 Published by Elsevier B.V. G. Huguet et al. Brain Research 1712 (2019) 101–108 Table 1 Descriptive statistics and p values of differential gene expression analysis between WT and tgHD groups in the SNc-VTA and DRN. p values of differential expression between SVc-VTA and DRN regions in the WT group and in the tgHD group are also shown. Gene Group SNc-VTA DRN N Mean Std. Sig. N Mean Std. Sig. Deviation Deviation TH WT 8 1.032 0.761 0.135 8 2.005 1.151 0.338 tgHD 7 0.516 0.409 8 2.924 2.352 Slc6a3 WT 7 1.385 0.854 0.246 8 1.981 1.232 0.314 tgHD 7 0.842 0.809 8 3.401 3.637 Pitx3 WT 8 1.519 0.955 0.067 7 1.193 0.593 0.720 tgHD 7 0.690 0.568 8 1.373 1.173 En1 WT 8 1.411 1.049 0.641 8 1.091 0.359 0.091 tgHD 7 1.099 1.471 8 1.625 0.748 Msx1 WT 7 0.853 0.390 0.022 8 1.155 0.652 0.892 tgHD 7 1.363 0.332 8 1.095 1.038 Tcf12 WT 8 0.972 0.074 0.122 8 0.982 0.154 0.364 tgHD 7 0.891 0.112 8 1.092 0.296 Zbtb16 WT 8 1.022 0.217 0.060 8 0.992 0.219 0.028 tgHD 7 1.847 1.115 8 1.961 1.097 Gpr155 WT 7 1.003 0.082 0.287 8 0.8596 0.591 0.368 tgHD 6 0.910 0.201 8 0.6563 0.177 Ntkr WT 7 1.003 0.083 0.418 8 0.747 0.147 0.466 tgHD 6 1.073 0.203 8 0.812 0.193 Crh WT 8 0.952 0.483 0.117 8 0.831 0.441 0.734 tgHD 7 1.503 0.773 8 0.906 0.422 Descriptive statistics and p values of differential gene expression analysis between WT and tgHD groups in the SNc-VTA and DRN. and nuclear receptors (Futter et al., 2009). Mutant Htt disrupts phy- changes. Hyperkinesia emerges at 6 months of age, and an adult-onset siological functioning of its binding partners, disrupting normal tran- neurological phenotype with motor, cognitive and affective impair- scriptional regulation in both HD animal models (Benn et al., 2008; ments, as well as progressive histopathological alterations starts from Luthi-Carter et al., 2002; Moily et al., 2017; van Hagen et al., 2017), 12 months of age (Kántor et al., 2006; Cao et al., 2006; Zeef et al., and HD patients (Lin et al., 2016; Martí et al., 2010). 2012). The HD symptomology includes hyperkinesia and chorea in the We hypothesized that the hyperdopaminergic status could not be early stages, and rigidity, hypokinesia and debilitating psychiatric secondary to striatal neurodegeneration. Instead, mutations in the Htt symptoms in the later stages (Phillips et al., 2008). In the pre-manifest gene might lead to the hyperactivity of the dopaminergic system by phase of HD, mild cognitive and emotional deficits can already be de- altering the transcription factors involved in defining dopaminergic cell tected up to 15 years prior to the appearance of motor symptoms phenotype. To this end, we investigate changes in the expression pat- (Paulsen, 2010; Scahill et al., 2013). Early signs of HD neuropathology tern of a group of genes that encode for transcription factors known to emerge in the striatum and the cerebral cortex despite there being play a role in controlling neuronal cell fate in tgHD rats at pre-manifest widespread histopathological changes (Paulsen 2010; Scahill et al., stage and compared to the corresponding controls. The following genes 2013). Massive atrophy of the striatum is the major pathological hall- where examined. Zbtb16 (Zinc Finger and BTB Domain Containing 16), mark of the disease in clinical phase (Vonsattel et al., 1985), and is also known as PLZF, is a transcriptional modulator controlling early largely caused by the loss of GABA-ergic medium spiny neurons, neuronal lineage (Gaber et al., 2013; He et al., 2016). Tcf12 (Tran- (Graveland et al., 1985; Vonsattel et al., 2008). This early degeneration scription Factor 12), recently identified as a novel factor in midbrain of striatal inhibitory MSNs, that project to the substantia nigra pars dopaminergic neuronal development, plays a major role in orches- compacta (SNc), is suggested to be one of the causes of hyperactivity in trating neuronal linage (Fischer et al., 2014; Mesman and Smidt, 2017). the dopaminergic pathways (Cepeda et al., 2014; Hedreen and Folstein, Msx1 (msh homeobox 1) is a transcription factor known to play a 1995). A link between the early clinical symptoms of HD and a hy- prominent role in defining dopaminergic cell phenotype (Andersson peractivity of the dopaminergic system has been suggested based on et al., 2006), and polymorphisms in this gene have been associated with post-mortem and clinical studies (Bird, 1980; Garrett and Soares-da- early motor symptoms in HD (Djoussé et al., 2004). Pitx3 (paired-like Silva, 1992; Jahanshahi et al., 2010; Klawans et al., 1970). homeodomain 3) is a transcription factor essential for the late phases of To understand the origins of the hyperactive state of the dopami- dopaminergic neurons development (Maxwell et al., 2005), and En1 nergic system, we have studied neural populations in brain regions (engrailed homeobox 1) is a transcription factor involved in survival of relevant for HD using a transgenic rat model of HD (tgHD). In this dopaminergic neurons both in the early and late development stages model, we have shown an increased number of dopaminergic cells in (Rekaik et al., 2015). We also quantified expression of TH (tyrosine the SNc and ventral tegmental area (VTA), two main dopaminergic hydroxylase), widely used as dopaminergic cell marker, and the ex- areas (Jahanshahi et al., 2010). In the dorsal raphe nucleus (DRN), pression of Slc6a3 (solute carrier family 6 member 3) encoding a do- mainly considered a serotonergic nucleus, but with an important sub- pamine transporter (DAT), because not all TH expressing neurons ex- population of dopaminergic cells projecting to the VTA, we found a press DAT (Ugrumov, 2009; Yip et al., 2018). Moreover, the expression concomitant increase in the number of dopaminergic cells with less level of a number of genes previously related to HD pathology was serotonin-containing cells. The latter was also observed in the DRN of quantified, including; Gpr155 (G protein coupled receptor 155) human HD post-mortem specimens (Jahanshahi et al., 2013). Increased (Brochier et al., 2008), the BDNF receptor Ntrk2 (neurotrophic tyrosine dopaminergic input to the dorsal and ventral parts of the striatum might kinase, receptor, type 2) (Brito et al., 2013), and Crh (corticotropin explain the hyperkinetic features (Jahanshahi et al., 2010) and reduced releasing hormone) (Heuser et al., 1991). anxiety-like behavior (Basar et al., 2010; Zeef et al., 2012). Intriguingly, tgHD rats exhibit progressive symptomatic and histopathological 102 G. Huguet et al. Brain Research 1712 (2019) 101–108 SNc-VTA DRN WT WT tgHD tgHD Relative mRNA level * * TH Slc6a3 Pitx3 En1 Msx1 Tcf12 Zbtb16 Gpr155 Ntkr Crh TH Slc6a3 Pitx3 En1 Msx1 Tcf12 Zbtb16 Gpr155 Ntkr Crh Fig. 1. Quantification of differential gene expression between WT and tgHD groups in the SNc-VTA and in the DRN. Box plots show the relative mRNA expression levels in the WT and the HD subjects, determined by quantitative reverse transcriptase–polymerase chain reaction (real-time PCR) in SNc-VTA and DRN for TH, Slc6a3, Pitx3, En1, Msx, Tcf12, Zbtb16, Gpr155, Ntkr, and Crh genes. Data are presented as mean relative transcript abundance of indicated genes to the house- keeping gene HPRT using the Pfaffl formula (Pfaffl, 2001), and error bars indicate the SD. *p ≤ 0.05 versus WT group. 2. Results 2.3. Correlative gene expression in the SNc-VTA and the DRN Quantitative real-time PCR was performed to identify differences in Next, we tested if the expression patterns of the different genes were Tcf12, Zbtb16, Msx1, Pitx3, En1, TH, Slc6a3, Gpr155, Ntrk2, and Crh correlated between the SNc-VTA and DRN. We observed no correlations gene expression levels in the SNc-VTA and DRN of tgHD versus WT rats of gene expression between the brain regions in WT animals. However, (Table 1). we did find a positive correlation of Zbtb16 between the SNc-VTA and DRN of the tgHD group (rs = 0.929, p = 0.003) (Fig. 4). This was the only gene that showed a correlated expression in the mutated group 2.1. Gene expression in the substantia nigra and ventral tegmental area between these two brain regions (Table 3 supplementary material). In the SNc-VTA of tgHD rats, the Msx1 expression was significantly 3. Discussion enhanced when compared to the WT (p = 0.022). In addition, Zbtb16 tended to be upregulated (p = 0.060), and Pitx3 tended to be down- Transgenic HD rats at pre-manifest phase of the disease showed regulated (p = 0.067) (Fig. 1 and Table 1). altered gene expression of transcription factors that are known to play Next, we examined if the expression patterns of different genes role in defining cell phenotype. correlated with each other. In the SNc-VTA of WT rats a positive cor- As expected, in the SNc-VTA of WT rats positive correlations be- relation was found between TH, Slc6a3, and late dopaminergic cell tween the expression of four dopaminergic cell fate related genes, TH, phenotype determining factors Pitx3 and En1 (rs > 0.88, p < 0.01) Slc6a3, Pitx3 and En1 were found. In the tgHD rats, although the cor- (Fig. 2). Furthermore, Pitx3 and En1 were also positively correlated relations were maintained, this group of genes tended to be down- with Tcf12 (rs > 0.71, p < 0.05). Also in the tgHD rats, a positive regulated; especially the late cell fate related gene, the Pitx3. In con- correlation between TH, Slc6a3, Pitx3 and En1 was found (rs > 0.89, trast, the expression of the early cell fate related gene Msx1 (Andersson p < 0.01). Moreover, in this group, Tcf12 negatively correlated with et al., 2006) was enhanced and became closely correlated with two Msx1 (rs = -0.94, p = 0.005), while Zbtb16 positively correlated with transcription factors known to define cell fate; positively with Zbtb16, Msx1 (rs = 0.95, p = 0.005) (Fig. 2). The Spearman’s correlation ana- controlling early neuronal lineage (Gaber et al., 2013; He et al., 2016), lysis is shown in Table 1 of supplementary material. and negatively with Tcf12, an orchestrator of neuronal lineage (Fischer et al., 2014). Tcf12, closely interacts with Pitx3 and En-1 to regulate the specification of dopaminergic cells in the brainstem (Mesman and 2.2. Gene expression in the dorsal raphe nucleus Smidt, 2017). Notably, in tgHD rats, Tcf12 did not show a positive correlation with Pitx3 and En1, unlike WT controls. This pattern of In the DRN of tgHD rats, only the expression of Zbtb16 was en- dopaminergic related gene expression illustrates a situation in which, hanced when compared to the WT (p = 0.028) (Fig. 1 and Table 1). cells at initial stage of dopaminergic differentiation are present in ma- Positive correlations were observed between Slc6a3, Pitx3 and En1 ture tgHD rats. Based on this we suggest that, while differentiation expression (rs > 0.82, p < 0.01) in the WT group, without a sig- process has been completed and cells are at their mature state in adult nificant correlation of these genes with TH (Fig. 3). In WT rats Pitx3 rats, cell fate regulating genes are still active inside those mature cells negatively correlated with Zbtb16 (rs = -0.85, p = 0.014), and Zbtb16 to govern the re-specification of cell phenotype, probably from non- positively correlated with Crh (rs = 0.81, p = 0.015). In tgHD rats, the dopaminergic to dopaminergic phenotype. positive correlation between Slc6a3 and Pitx3 was maintained In the DRN, Zbtb16 was significantly upregulated in the mutated (rs = 0.83, p = 0.010), while there was no correlation between these rats. In contrary to our earlier study (Jahanshahi et al., 2013), we did two genes and En1. In these animals, we did find a positive correlation not observed any increase in direct dopaminergic markers such as TH. of Slc6a3 and Pitx3 with TH (rs > 0.85, p < 0.01). In addition, En1 Given the selective expression of Slc6a3 in dopaminergic neurons positively correlated with Tcf12 (rs = 0.74, p = 0.047) (Fig. 3). The (unlike TH, which can be expressed in all catecholaminergic neurons) Spearman’s correlation analysis is shown in Table 2 of supplementary (Ugrumov, 2009; Yip et al., 2018). Moreover, En1 tended to upregulate material. and showed a positive correlation with Tcf12. These changes showed a 103 G. Huguet et al. Brain Research 1712 (2019) 101–108 Fig. 2. Gene expression correlations in the SNc-VTA. Each dot represents a SNc-VTA sample plotted against its expression levels for two genes, dark dots represent tgHD samples and clear dots represent WT samples. Spearman’s correlation coefficient rho (rs) and corresponding p values are indicated for the WT and the tgHD groups. different pattern compared to the SNc-VTA, suggesting that dopami- our results, Ntrk2 was neither affected in the pre-manifestation stage of nergic cell fate regulatory events is tuned differentially in the DRN. HD mutant mouse, whereas reduced expression had been reported in Zbtb16, was the only gene that showed correlated expression be- neurodegenerative stages (Brito et al., 2013). tween SN-VTA and DRN in tgHD rats, a transcription factor known to It should be noted that since the changes in mRNA expression were regulate cell fate (Gaber et al., 2013). These results highlight a role for examined in tissue homogenates of full brain regions and not neuron Zbtb16 in orchestrating the changes associated with the early patho- specific, caution must be taken when interpreting these data. More genesis in HD, which may also derive cell fate towards dopaminergic precise dissection techniques, such as laser capture dissection can phenotype in tgHD animals. provide more insight into cell specificity of these changes. Yet, the Htt interacts with nuclear receptors that hetero-dimerize with re- expression pattern of transcription factors observed in tgHD rats in pre- tinoic acid receptor α (RXRα) (Futter et al., 2009), and Zbtb16 is a manifest phase suggests a tendency towards potentiation of dopami- fusion partner of RXRα (Liu et al., 2016). Therefore, it is conceivable nergic function. Seemingly, this potentiation is caused by upregulation that Zbtb16 could participate in HD pathogenesis. Furthermore, we of factors that define dopaminergic phenotype, which could explain propose that regulation of Zbtb16 may be an interesting strategy for HD enhanced dopaminergic cell population in the brainstem of tgHD rats in therapy. Interacting molecules known to regulate Zbtb16 activity in- manifest phase of the disease that was reported earlier (Jahanshahi clude retinoic acid (Hong et al., 1997), metadherin (Thirkettle et al., et al., 2013, 2010). 2009), the drug genistein (Senbonmatsu et al., 2003) and interleukin- Hyperactivity of the DA system has been suggested to be caused by 32-alpha (IL-32α) (Park et al., 2014). Moreover, its expression could be disinhibition of dopaminergic cells due to degeneration of GABA-ergic induced by glucocorticoids (Wasim et al., 2010), and interestingly, medium spiny neurons (Cepeda et al., 2014; Hedreen and Folstein, pridopidine, that upregulates glucocorticoid receptor GR, demonstrated 1995). But tgHD rats exhibit behavioral symptoms prior to appearance therapeutic benefit in HD animal models (Geva et al., 2016), whereas of neurodegeneration in the striatum (Cao et al., 2006; Faure et al., treatment of dexamethasone (a synthetic glucocorticoid) to HD mice or 2013; Höhn et al., 2011; Kántor et al., 2006; Nguyen et al., 2006; von flies decreased the aggregate load, and transiently recover HD-related Hörsten et al., 2003; Zeef et al., 2012). Our results, together with these behavioral phenotypes (Maheshwari et al., 2014), and dexamethasone data, suggest that hyperdopaminergic status in tgHD rats could not be therapy to HD patients improved dyskinesia (Nuti et al., 1991). secondary to neurodegeneration and it is more likely due to altered On the other hand, the expression of genes Ntrk2, Gpr155, Crh, that dopaminergic cell fate related regulators. There is increasing evidence had been reported to be dysregulated at manifest stages of the disease that the clinical signs of HD manifest long before the prominent cell (Brito et al., 2013; Brochier et al., 2008; Heuser et al., 1991), was not death caused by the genetic mutation (Cepeda et al., 2014; Miller and altered in the pre-manifestation stage of tgHD rats. Accordingly, with Bezprozvanny, 2010). Transcriptome dysregulation has been described 104 G. Huguet et al. Brain Research 1712 (2019) 101–108 Fig. 3. Gene expression correlations in the DRN. Each dot represents a DRN sample plotted against its expression levels for two genes, dark dots represent tgHD samples and clear dots represent WT samples. Spearman’s correlation coefficient rho (rs) and corresponding p values are indicated for the WT and the tgHD groups. throughout life, but recent studies show that neurotransmitters and their post-synaptic receptors can reconfigure by changes in electrical activity (Dulcis et al., 2013; Dulcis and Spitzer, 2008). One type of neurotransmitter respecification, which might be an interesting candi- date for reorganizing the dopaminergic cells in the brainstem in HD brain, is reserve pool plasticity. Reserve pool neurons are integrated into active circuits, but are able to express different neurotransmitters, thereby influencing their inputs and outputs (Dulcis and Spitzer, 2012). Transmitter switching in reserve pool neurons is induced by chronic changes (Dulcis et al., 2013; Gutiérrez, 2005; Tandé et al., 2006). Since Htt mutation has a chronic impact on cell physiology in the brain, neurotransmitter respecification could be a possible mechanism for the Fig. 4. Zbtb16 gene expression correlation between the SNc-VTA and the DRN. changes in the cell population found in tgHD rats. One might argue that Each dot represents a subject plotted against its expression levels for two brain areas, dark dots represent tgHD samples and clear dots represent WT samples. the increase in dopaminergic neurons could be due to neurogenesis in Spearman’s correlation coefficient rho (rs) and corresponding p values are in- the brainstem. However, this is very unlikely, since there is no con- dicated for the WT and the tgHD groups. vincing evidence reported for rodents of neurogenesis and neuronal migration towards the brainstem regions. Zhao et al. (2003) reported dopaminergic neurogenesis in the SNc, but later studies could not re- in HD patients (Lin et al., 2016; Martí et al., 2010), as well as in Htt plicate those findings, while the other reports are conflicting mutant mice (Benn et al., 2008; Luthi-Carter et al., 2002), or HD cell (Farzanehfar, 2016; Lie et al., 2002; Shan et al., 2006). line models (Moily et al., 2017). Therefore, it is plausible that Htt mutation affects dopaminergic cell phenotype regulators in the early stages of the disease. Interestingly, transcription of dopamine bio- 4. Conclusions synthesis related genes has recently been shown to be affected in a HD cell line (van Hagen et al., 2017). Taken together, here we report altered dopaminergic cell fate reg- Altered cell fate regulating transcription factors is in line with our ulating genes in the SNc-VTA and DRN of tgHD rats in pre-symptomatic previous findings in tgHD rats, where we observed an increased number phase of the disease. of dopaminergic cells in the brainstem (Jahanshahi et al., 2013, 2010). This finding suggests that pathological changes in the dopaminergic Neurotransmitter re-specification was suggested as underlying me- system in tgHD model precede manifestation of disease symptoms, chanism for increased dopaminergic cell population. The type of neu- which contradicts the theories that indicate the hyperdopaminergic rotransmitter expressed by neurons has been thought to be fixed status is the consequence of neurodegeneration in the striatum. 105 G. Huguet et al. Brain Research 1712 (2019) 101–108 Table 2 5.3. Quantitative real-time PCR Primers sequences used for real-time PCR assays. F: forward primer, R: reverse primer. Genbank identification . For the selected genes, specific primers were designed using Primer available at http://www.ncbi.nlm.nih.gov/ Blast (NCBI) (Table 2) and purchased from Invitrogen. Hypoxanthine Gene name Genbank ID 5′- 3′ primer sequence guanine phosphoribosyl transferase (Hprt) was used as a reference gene. Total RNA was treated with the DNA-free kit (Ambion) and cDNA was Crh NM_031019 F GCAGCCGTTGAATTTCTTGC synthesized from 100 ng of total RNA using High Capacity cDNA, Re- R AGCGGGACTTCTGTTGAGGT En1 XM_001056699.6 F ACGGGAGAAAGACTCGGACAG verse Transcription Kit with RNase Inhibitor (Applied Biosystems) and R ACACGGTCGTAAGCAGTTTGG random primers according to the manufacturer’s instructions. PCR re- Gpr155 NM_001107811 F AGTCATCCAGCACATCACCAAT action cocktails (25 µl) contained cDNA, Power SYBR green PCR master R GGACTCCGTTCAGGACTCTTTT mix (Applied Biosystems), DEPC-treated water, and custom primers HPRT NM_012583 F AAAGGACCTCTCGAAGTGTTGG (Invitrogen, Paisley, UK). The PCR reaction was performed in an ABI R AAGTGCTCATTATAGTCAAGGGCA Msx1 NM_031059 F GCCCTATAGAAAGCAAGGAGCA PRISM 7300 Sequence Detector System (Applied Biosystems). Each R GGTCCTGGGAAAGTCTCTTCAA reaction was performed in triplicate. The mRNA abundances for each Ntrk2 NM_012731.2 F TCTGCTCAAGTTGGCGAGAC candidate gene were calculated using the following formula: Relative R GTTGCTCCCGTTGGAGATGT Transcript Abundance = (E target) ΔCt target (control – sample)/(E reference) Pitx3 NM_019247 F GACAGGGGTCGCCTAGACTG ΔCt reference (control – sample) R GGTCTCCGTATAGGGGTCAGA (Pfaffl, 2001), where E is real-time PCR effi- Slc6a3 XM_012694 F TCCTGGAGTGAAAAGTGGATGT ciency calculated as Efficiency = 10(−1/slope), and control is the mean R AACACCCTCGTGCCAATGTA Ct value of samples of the WT subjects. Tcf12 NM_013176 F CATCAGCCAGTTCCAGAGTCAT R TGCCAGGTTTGTGTCTTCAGAT 5.4. Data analysis Th NM_012740.3 F CCAGCCTGTGTACTTTGTGTCC R ACGAGAGGCATAGTTCCTGAGC Zbtb16 NM_001013181 F GGTCTCCACCTCTTTTGGTCTCT The statistical computer package program PASW Statistics 23.0 R TGGTCATCAAACTGTCCACTGC (SPSS) was used to process the data. Differential gene expression was analyzed by a one-way ANOVA test or Mann-Whitney U test for non- Primers sequences used for real-time PCR assays. parametric data. The Spearman’s correlation coefficient rho (rs) was F: forward primer, R: reverse primer. Genbank identification available at used to analyze correlated patterns of gene expression levels, along with http://www.ncbi.nlm.nih.gov/. linear regression line modelling of the main correlations. A p-value of < 0.05 was considered significant. 5. Material and methods Acknowledgements 5.1. Subjects This work was conducted by funding from CHDI (Grant No. A-6390) Eight wild type (WT) and 8 homozygote tgHD male rats 6–7 months and partially by the University of Girona (Grant No. MPCUdG2016/ old, 400–450 g, bred and housed at the Central Animal Facility of 092). The authors are grateful to Ms. Sara Gomez for her technical Maastricht University, (Maastricht, the Netherlands) were used. This work. model carries a truncated huntingtin cDNA fragment with 51 CAG re- peats under control of the native rat Huntington promoter (von Hörsten Appendix A. Supplementary data et al., 2003). The rats show slowly progressive clinical signs that in- clude choreiform movements, cognitive and emotional alterations. Supplementary data to this article can be found online at https:// Furthermore, progressive striatal cell loss, striatal atrophy, and cortical doi.org/10.1016/j.brainres.2019.01.041. cell damage are found (Cao et al., 2006; Kántor et al., 2006; Nguyen et al., 2006; Temel et al., 2005; von Hörsten et al., 2003). Rats were References housed socially in standard cages on sawdust bedding in an air-venti- lated room (controlled temperature: 20–22 °C; humidity: 50–70%) Andersson, E., Tryggvason, U., Deng, Q., Friling, S., Alekseenko, Z., Robert, B., Perlmann, under 12/12-h reversed light/dark cycle. Food, standard laboratory T., Ericson, J., 2006. Identification of intrinsic determinants of midbrain dopamine chow (Hopefarms, Woerden, the Netherlands) and water were available neurons. Cell 124, 393–405. https://doi.org/10.1016/j.cell.2005.10.037. ad libitum. All experimental procedures were approved by the Animal Basar, K., Sesia, T., Groenewegen, H., Steinbusch, H.W.M., Visser-Vandewalle, V., Temel, Y., 2010. Nucleus accumbens and impulsivity. Prog. Neurobiol. 92, 533–557. https:// Experiments and Ethics Committee of Maastricht University. doi.org/10.1016/j.pneurobio.2010.08.007. Benn, C.L., Sun, T., Sadri-Vakili, G., McFarland, K.N., DiRocco, D.P., Yohrling, G.J., Clark, T.W., Bouzou, B., Cha, J.-H.J., 2008. Huntingtin modulates transcription, occupies gene promoters in vivo, and binds directly to DNA in a polyglutamine-dependent 5.2. Tissue preparation and RNA extraction manner. J. Neurosci. 28, 10720–10733. https://doi.org/10.1523/JNEUROSCI.2126- 08.2008. Rats were sacrificed by decapitation. Brains were hand dissected Bird, E.D., 1980. Chemical pathology of Huntington’s disease. Annu. Rev. Pharmacol. and sliced with a brain matrix (Stoelting Wood Dale, Illinois, USA). Toxicol. 20, 533–551. https://doi.org/10.1146/annurev.pa.20.040180.002533. Brito, V., Puigdellívol, M., Giralt, A., del Toro, D., Alberch, J., Ginés, S., 2013. Imbalance Slices between Bregma levels −5.0 to −6.0 and −7.3 to −8.3, ac- of p75(NTR)/TrkB protein expression in Huntington’s disease: implication for neu- cording to the Rat Stereotactic Brain Atlas of Paxinos and Watson roprotective therapies. Cell Death Dis. 4, e595. https://doi.org/10.1038/cddis.2013. (1998), were used to dissect the DRN and SNc-VTA, respectively. All 116. Brochier, C., Gaillard, M.-C., Diguet, E., Caudy, N., Dossat, C., Ségurens, B., Wincker, P., tissues were conserved in RNA later (Ambion, Austin, TX) for 24 h at Roze, E., Caboche, J., Hantraye, P., Brouillet, E., Elalouf, J.-M., de Chaldée, M., 2008. 4 °C, and then at −20 °C. After tissue homogenization, total RNA was Quantitative gene expression profiling of mouse brain regions reveals differential prepared using an RNeasy Lipid Tissue Mini kit according to manu- transcripts conserved in human and affected in disease models. Physiol. Genomics 33, 170–179. https://doi.org/10.1152/physiolgenomics.00125.2007. facturer’s protocol (Quiagen, Valencia, CA). RNA was quantified using Cao, C., Temel, Y., Blokland, A., Ozen, H., Steinbusch, H.W.M., Vlamings, R., Nguyen, the NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, H.P., von Hörsten, S., Schmitz, C., Visser-Vandewalle, V., 2006. Progressive dete- Wilmington, DE). Quality of RNA was assessed with a 2100 Bioanalyzer rioration of reaction time performance and choreiform symptoms in a new Huntington’s disease transgenic ratmodel. Behav. Brain Res. 170, 257–261. https:// (Agilent, Palo Alto, CA) giving an RNA integrity number (RIN) ranking doi.org/10.1016/j.bbr.2006.02.028. between 9 and 9.50, which is indicative of high quality RNA. Cepeda, C., Murphy, K.P.S., Parent, M., Levine, M.S., 2014. The role of dopamine in 106 G. Huguet et al. Brain Research 1712 (2019) 101–108 Huntington’s disease. Prog. Brain Res. 211, 235–254. https://doi.org/10.1016/B978- Xing, Y., 2016. Transcriptome sequencing reveals aberrant alternative splicing in 0-444-63425-2.00010-6. Huntington’s disease. Hum. Mol. Genet. 25, 3454–3466. https://doi.org/10.1093/ Djoussé, L., Knowlton, B., Hayden, M.R., Brinkman, R.R., Ross, C.A., Margolis, R.L., hmg/ddw187. Rosenblatt, A., Durr, A., Dode, C., Morrison, P.J., Novelletto, A., Frontali, M., Trent, Liu, T.M., Lee, E.H., Lim, B., Shyh-Chang, N., 2016. Concise review: balancing stem cell R.J.A., McCusker, E., Gómez-Tortosa, E., Mayo Cabrero, D., Jones, R., Zanko, A., self-renewal and differentiation with PLZF. Stem Cells 34, 277–287. https://doi.org/ Nance, M., Abramson, R.K., Suchowersky, O., Paulsen, J.S., Harrison, M.B., Yang, Q., 10.1002/stem.2270. Cupples, L.A., Mysore, J., Gusella, J.F., MacDonald, M.E., Myers, R.H., Almqvist, Luthi-Carter, R., Strand, A.D., Hanson, S.A., Kooperberg, C., Schilling, G., La Spada, A.R., E.W., 2004. Evidence for a modifier of onset age in Huntington disease linked to the Merry, D.E., Young, A.B., Ross, C.A., Borchelt, D.R., Olson, J.M., 2002. Polyglutamine HD gene in 4p16. Neurogenetics 5, 109–114. https://doi.org/10.1007/s10048-004- and transcription: gene expression changes shared by DRPLA and Huntington’s dis- 0175-2. ease mouse models reveal context-independent effects. Hum. Mol. Genet. 11, Dulcis, D., Jamshidi, P., Leutgeb, S., Spitzer, N.C., 2013. Neurotransmitter switching in 1927–1937. the adult brain regulates behavior. Science 340, 449–453. https://doi.org/10.1126/ MacDonald, M.E., Ambrose, C.M., Duyao, M.P., Myers, R.H., Lin, C., Srinidhi, L., Barnes, science.1234152. G., Taylor, S.A., James, M., Groot, N., MacFarlane, H., Jenkins, B., Anderson, M.A., Dulcis, D., Spitzer, N.C., 2012. Reserve pool neuron transmitter respecification: novel Wexler, N.S., Gusella, J.F., Bates, G.P., Baxendale, S., Hummerich, H., Kirby, S., neuroplasticity. Dev. Neurobiol. 72, 465–474. https://doi.org/10.1002/dneu.20920. North, M., Youngman, S., Mott, R., Zehetner, G., Sedlacek, Z., Poustka, A., Frischauf, Dulcis, D., Spitzer, N.C., 2008. Illumination controls differentiation of dopamine neurons A.-M., Lehrach, H., Buckler, A.J., Church, D., Doucette-Stamm, L., O’Donovan, M.C., regulating behaviour. Nature 456, 195–201. https://doi.org/10.1038/nature07569. Riba-Ramirez, L., Shah, M., Stanton, V.P., Strobel, S.A., Draths, K.M., Wales, J.L., Farzanehfar, P., 2016. Towards a better treatment option for Parkinson’s disease: a review Dervan, P., Housman, D.E., Altherr, M., Shiang, R., Thompson, L., Fielder, T., of adult neurogenesis. Neurochem. Res. 41, 3161–3170. https://doi.org/10.1007/ Wasmuth, J.J., Tagle, D., Valdes, J., Elmer, L., Allard, M., Castilla, L., Swaroop, M., s11064-016-2053-3. Blanchard, K., Collins, F.S., Snell, R., Holloway, T., Gillespie, K., Datson, N., Shaw, D., Faure, A., Es-Seddiqi, M., Brown, B.L., Nguyen, H.P., Riess, O., von Hörsten, S., Le Blanc, Harper, P.S., 1993. A novel gene containing a trinucleotide repeat that is expanded P., Desvignes, N., Bozon, B., El Massioui, N., Doyère, V., 2013. Modified impact of and unstable on Huntington’s disease chromosomes. The Huntington’s Disease emotion on temporal discrimination in a transgenic rat model of Huntington disease. Collaborative Research Group. Cell 72, 971–983. https://doi.org/10.1016/0092- Front. Behav. Neurosci. 7, 130. https://doi.org/10.3389/fnbeh.2013.00130. 8674(93)90585-E. Fischer, B., Azim, K., Hurtado-Chong, A., Ramelli, S., Fernández, M., Raineteau, O., 2014. Maheshwari, M., Bhutani, S., Das, A., Mukherjee, R., Sharma, A., Kino, Y., Nukina, N., E-proteins orchestrate the progression of neural stem cell differentiation in the Jana, N.R., 2014. Dexamethasone induces heat shock response and slows down dis- postnatal forebrain. Neural Dev. 9, 23. https://doi.org/10.1186/1749-8104-9-23. ease progression in mouse and fly models of Huntington’s disease. Hum. Mol. Genet. Futter, M., Diekmann, H., Schoenmakers, E., Sadiq, O., Chatterjee, K., Rubinsztein, D.C., 23, 2737–2751. https://doi.org/10.1093/hmg/ddt667. 2009. Wild-type but not mutant huntingtin modulates the transcriptional activity of Martí, E., Pantano, L., Bañez-Coronel, M., Llorens, F., Miñones-Moyano, E., Porta, S., liver X receptors. J. Med. Genet. 46, 438–446. https://doi.org/10.1136/jmg.2009. Sumoy, L., Ferrer, I., Estivill, X., 2010. A myriad of miRNA variants in control and 066399. Huntington’s disease brain regions detected by massively parallel sequencing. Gaber, Z.B., Butler, S.J., Novitch, B.G., 2013. PLZF regulates fibroblast growth factor Nucleic Acids Res. 38, 7219–7235. https://doi.org/10.1093/nar/gkq575. responsiveness and maintenance of neural progenitors. PLoS Biol. 11, e1001676. Maxwell, S.L., Ho, H.-Y., Kuehner, E., Zhao, S., Li, M., 2005. Pitx3 regulates tyrosine Garrett, M.C., Soares-da-Silva, P., 1992. Increased cerebrospinal fluid dopamine and 3,4- hydroxylase expression in the substantia nigra and identifies a subgroup of me- dihydroxyphenylacetic acid levels in Huntington’s disease: evidence for an overactive sencephalic dopaminergic progenitor neurons during mouse development. Dev. Biol. dopaminergic brain transmission. J. Neurochem. 58, 101–106. https://doi.org/10. 282, 467–479. https://doi.org/10.1016/j.ydbio.2005.03.028. 1111/j.1471-4159.1992.tb09283.x. Mesman, S., Smidt, M.P., 2017. Tcf12 is involved in early cell-fate determination and Geva, M., Kusko, R., Soares, H., Fowler, K.D., Birnberg, T., Barash, S., Wagner, A.M., Fine, subset specification of midbrain dopamine neurons. Front. Mol. Neurosci. 10, 353. T., Lysaght, A., Weiner, B., Cha, Y., Kolitz, S., Towfic, F., Orbach, A., Laufer, R., https://doi.org/10.3389/fnmol.2017.00353. Zeskind, B., Grossman, I., Hayden, M.R., 2016. Pridopidine activates neuroprotective Miller, B.R., Bezprozvanny, I., 2010. Corticostriatal circuit dysfunction in Huntington’s pathways impaired in Huntington Disease. Hum. Mol. Genet. 25, 3975–3987. https:// disease: intersection of glutamate, dopamine and calcium. Future Neurol. 5, 735–756. doi.org/10.1093/hmg/ddw238. https://doi.org/10.2217/fnl.10.41. Graveland, G.A., Williams, R.S., DiFiglia, M., 1985. Evidence for degenerative and re- Moily, N.S., Ormsby, A.R., Stojilovic, A., Ramdzan, Y.M., Diesch, J., Hannan, R.D., Zajac, generative changes in neostriatal spiny neurons in Huntington’s disease. Science 227, M.S., Hannan, A.J., Oshlack, A., Hatters, D.M., 2017. Transcriptional profiles for 770–773. https://doi.org/10.1126/science.3155875. distinct aggregation states of mutant Huntingtin exon 1 protein unmask new Gutiérrez, R., 2005. The dual glutamatergic–GABAergic phenotype of hippocampal Huntington’s disease pathways. Mol. Cell. Neurosci. https://doi.org/10.1016/j.mcn. granule cells. Trends Neurosci. 28, 297–303. https://doi.org/10.1016/j.tins.2005.04. 2017.07.004. 005. Nguyen, H.P., Kobbe, P., Rahne, H., Worpel, T., Jager, B., Stephan, M., Pabst, R., He, M., Liu, Y., Shen, J., Duan, C., Lu, X., 2016. Upregulation of PLZF is Associated with Holzmann, C., Riess, O., Korr, H., Kantor, O., Petrasch-Parwez, E., Wetzel, R., Neuronal Injury in Lipopolysaccharide-Induced Neuroinflammation. Neurochem. Osmand, A., von Hörsten, S., 2006. Behavioral abnormalities precede neuropatho- Res. https://doi.org/10.1007/s11064-016-2027-5. logical markers in rats transgenic for Huntington’s disease. Hum. Mol. Genet. 15, Hedreen, J.C., Folstein, S.E., 1995. Early loss of neostriatal striosome neurons in 3177–3194. https://doi.org/10.1093/hmg/ddl394. Huntington’s disease. J. Neuropathol. Exp. Neurol. 54, 105–120. Nuti, A., Maremmani, C., Ceravolo, R., Pavese, N., Bonuccelli, U., Muratorio, A., 1991. Heuser, I.J., Chase, T.N., Mouradian, M.M., 1991. The limbic-hypothalamic-pituitary- Dexamethasone therapy in Huntington chorea: preliminary results. Riv. Neurol. 61, adrenal axis in Huntington’s disease. Biol. Psychiatry 30, 943–952. 225–227. Höhn, S., Dallérac, G., Faure, A., Urbach, Y.K., Nguyen, H.P., Riess, O., von Hörsten, S., Le Park, Y.S., Kang, J.-W., Lee, D.H., Kim, M.S., Bak, Y., Yang, Y., Lee, H.-G., Hong, J., Yoon, Blanc, P., Desvignes, N., El Massioui, N., Brown, B.L., Doyère, V., 2011. Behavioral D.-Y., 2014. Interleukin-32α modulates promyelocytic leukemia zinc finger gene and in vivo electrophysiological evidence for presymptomatic alteration of pre- activity by inhibiting protein kinase Cɛ-dependent sumoylation. Int. J. Biochem. Cell frontostriatal processing in the transgenic rat model for Huntington disease. J. Biol. 55, 136–143. https://doi.org/10.1016/j.biocel.2014.08.018. Neurosci. 31. Paulsen, J.S., 2010. Early detection of huntington disease. Future Neurol. 5. https://doi. Hong, S.H., David, G., Wong, C.W., Dejean, A., Privalsky, M.L., 1997. SMRT corepressor org/10.2217/fnl.09.78. interacts with PLZF and with the PML-retinoic acid receptor alpha (RARalpha) and Paxinos, G., Watson, C., 1998. The Rat Brain in Stereotaxic Coordinates Academic Press. PLZF-RARalpha oncoproteins associated with acute promyelocytic leukemia. Proc. Academic Press, San Diego. Natl. Acad. Sci. U.S.A. 94, 9028–9033. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RT- Jahanshahi, A., Vlamings, R., Kaya, A.H., Lim, L.W., Janssen, M.L.F., Tan, S., Visser- PCR. Nucleic Acids Res. 29, e45. Vandewalle, V., Steinbusch, H.W.M., Temel, Y., 2010. Hyperdopaminergic status in Phillips, W., Shannon, K.M., Barker, R.A., 2008. The current clinical management of experimental Huntington disease. J. Neuropathol. Exp. Neurol. 69, 910–917. https:// Huntington’s disease. Mov. Disord. 23, 1491–1504. https://doi.org/10.1002/mds. doi.org/10.1097/NEN.0b013e3181ee005d. 21971. Jahanshahi, A., Vlamings, R., van Roon-Mom, W., Faull, R.L.M., Waldvogel, H.J., Janssen, Pringsheim, T., Wiltshire, K., Day, L., Dykeman, J., Steeves, T., Jette, N., 2012. The in- M.L.F., Yakkioui, Y., Zeef, D., Kocabicak, E., Steinbusch, H.W.M., Temel, Y., 2013. cidence and prevalence of Huntington’s disease: a systematic review and meta-ana- Changes in brainstem serotonergic and dopaminergic cell populations in experi- lysis. Mov. Disord. 27, 1083–1091. https://doi.org/10.1002/mds.25075. mental and clinical Huntington’s disease. Neuroscience. https://doi.org/10.1016/j. Rekaik, H., Blaudin de Thé, F.-X., Prochiantz, A., Fuchs, J., Joshi, R.L., 2015. Dissecting neuroscience.2013.01.071. the role of Engrailed in adult dopaminergic neurons–Insights into Parkinson disease Kántor, O., Temel, Y., Holzmann, C., Raber, K., Nguyen, H.-P., Cao, C., Türkoglu, H.O., pathogenesis. FEBS Lett. 589, 3786–3794. https://doi.org/10.1016/j.febslet.2015. Rutten, B.P.F., Visser-Vandewalle, V., Steinbusch, H.W.M., Blokland, A., Korr, H., 10.002. Riess, O., von Hörsten, S., Schmitz, C., 2006. Selective striatal neuron loss and al- Scahill, R.I., Hobbs, N.Z., Say, M.J., Bechtel, N., Henley, S.M.D., Hyare, H., Langbehn, terations in behavior correlate with impaired striatal function in Huntington’s disease D.R., Jones, R., Leavitt, B.R., Roos, R.A.C., Durr, A., Johnson, H., Lehéricy, S., transgenic rats. Neurobiol. Dis. 22, 538–547. https://doi.org/10.1016/j.nbd.2005. Craufurd, D., Kennard, C., Hicks, S.L., Stout, J.C., Reilmann, R., Tabrizi, S.J., 2013. 12.014. Clinical impairment in premanifest and early Huntington’s disease is associated with Klawans, H., Paulson, G., Barbeau, A., 1970. Predictive test for Huntington's chorea. regionally specific atrophy. n/a-n/a. Hum. Brain Mapp. 34. https://doi.org/10. Lancet 296, 1185–1186. https://doi.org/10.1016/S0140-6736(70)90367-3. 1002/hbm.21449. Lie, D.C., Dziewczapolski, G., Willhoite, A.R., Kaspar, B.K., Shults, C.W., Gage, F.H., 2002. Senbonmatsu, T., Saito, T., Landon, E.J., Watanabe, O., Price, E., Roberts, R.L., Imboden, The adult substantia nigra contains progenitor cells with neurogenic potential. J. H., Fitzgerald, T.G., Gaffney, F.A., Inagami, T., Inagami, T., 2003. A novel angio- Neurosci. 22, 6639–6649. https://doi.org/20026700. tensin II type 2 receptor signaling pathway: possible role in cardiac hypertrophy. Lin, L., Park, J.W., Ramachandran, S., Zhang, Y., Tseng, Y.-T., Shen, S., Waldvogel, H.J., EMBO J. 22, 6471–6482. https://doi.org/10.1093/emboj/cdg637. Curtis, M.A., Faull, R.L.M., Troncoso, J.C., Pletnikova, O., Ross, C.A., Davidson, B.L., Shan, X., Chi, L., Bishop, M., Luo, C., Lien, L., Zhang, Z., Liu, R., 2006. Enhanced de novo 107 G. Huguet et al. Brain Research 1712 (2019) 101–108 neurogenesis and dopaminergic neurogenesis in the substantia nigra of 1-methyl-4- M., Pabst, R., Kobbe, P., Krotova, J., Stiller, D., Kask, A., Vaarmann, A., Rathke- phenyl-1,2,3,6-tetrahydropyridine-induced Parkinson’s disease-like mice. Stem Cells Hartlieb, S., Schulz, J.B., Grasshoff, U., Bauer, I., Vieira-Saecker, A.M.M., Paul, M., 24, 1280–1287. https://doi.org/10.1634/stemcells.2005-0487. Jones, L., Lindenberg, K.S., Landwehrmeyer, B., Bauer, A., Li, X.-J., Riess, O., 2003. Tandé, D., Höglinger, G., Debeir, T., Freundlieb, N., Hirsch, E.C., François, C., 2006. New Transgenic rat model of Huntington’s disease. Hum. Mol. Genet. 12, 617–624. striatal dopamine neurons in MPTP-treated macaques result from a phenotypic shift Vonsattel, J.-P., Myers, R.H., Stevens, T.J., Ferrante, R.J., Bird, E.D., Richardson, E.P., and not neurogenesis. Brain 129, 1194–1200. https://doi.org/10.1093/brain/ 1985. Neuropathological classification of huntinqton’s disease. J. Neuropathol. Exp. awl041. Neurol. 44, 559–577. https://doi.org/10.1097/00005072-198511000-00003. Temel, Y., Blokland, A., Steinbusch, H.W.M., Visser-Vandewalle, V., 2005. The functional Vonsattel, J.P.G., Keller, C., del Pilar Amaya, M., 2008. Neuropathology of Huntington’s role of the subthalamic nucleus in cognitive and limbic circuits. Prog. Neurobiol. 76, Disease. Handb. Clin. Neurol. 89, 599–618. https://doi.org/10.1016/S0072- 393–413. https://doi.org/10.1016/j.pneurobio.2005.09.005. 9752(07)01256-0. Thirkettle, H.J., Mills, I.G., Whitaker, H.C., Neal, D.E., 2009. Nuclear LYRIC/AEG-1 in- Wasim, M., Carlet, M., Mansha, M., Greil, R., Ploner, C., Trockenbacher, A., Rainer, J., teracts with PLZF and relieves PLZF-mediated repression. Oncogene 28, 3663–3670. Kofler, R., 2010. PLZF/ZBTB16, a glucocorticoid response gene in acute lympho- https://doi.org/10.1038/onc.2009.223. blastic leukemia, interferes with glucocorticoid-induced apoptosis. J. Steroid Ugrumov, M.V., 2009. Non-dopaminergic neurons partly expressing dopaminergic phe- Biochem. Mol. Biol. 120, 218–227. https://doi.org/10.1016/j.jsbmb.2010.04.019. notype: distribution in the brain, development and functional significance. J. Chem. Yip, S.H., York, J., Hyland, B., Bunn, S.J., Grattan, D.R., 2018. Incomplete concordance of Neuroanat. 38, 241–256. https://doi.org/10.1016/j.jchemneu.2009.08.004. dopamine transporter Cre (DATIREScre)-mediated recombination and tyrosine hy- van Hagen, M., Piebes, D.G.E., de Leeuw, W.C., Vuist, I.M., van Roon-Mom, W.M.C., droxylase immunoreactivity in the mouse forebrain. J. Chem. Neuroanat. 90, 40–48. Moerland, P.D., Verschure, P.J., 2017. The dynamics of early-state transcriptional https://doi.org/10.1016/j.jchemneu.2017.12.002. changes and aggregate formation in a Huntington’s disease cell model. BMC Zeef, D.H., Vlamings, R., Lim, L.W., Tan, S., Janssen, M.L.F., Jahanshahi, A., Hoogland, Genomics 18, 373. https://doi.org/10.1186/s12864-017-3745-z. G., Prickaerts, J., Steinbusch, H.W.M., Temel, Y., 2012. Motor and non-motor be- Victorson, D., Carlozzi, N.E., Frank, S., Beaumont, J.L., Cheng, W., Gorin, B., Duh, M.S., haviour in experimental Huntington’s disease. Behav. Brain Res. 226, 435–439. Samuelson, D., Tulsky, D., Gutierrez, S., Nowinski, C.J., Mueller, A., Shen, V., Sung, https://doi.org/10.1016/j.bbr.2011.09.041. V., 2014. Identifying Motor, Emotional-Behavioral, and Cognitive Deficits that Zhao, M., Momma, S., Delfani, K., Carlen, M., Cassidy, R.M., Johansson, C.B., Brismar, H., Comprise the Triad of HD Symptoms from Patient, Caregiver, and Provider Shupliakov, O., Frisen, J., Janson, A.M., 2003. Evidence for neurogenesis in the adult Perspectives. Tremor Other Hyperkinet. Mov. (N. Y). 4, 224. https://doi.org/10. mammalian substantia nigra. Proc. Natl. Acad. Sci. U.S.A. 100, 7925–7930. https:// 7916/D8JW8BWS. doi.org/10.1073/pnas.1131955100. von Hörsten, S., Schmitt, I., Nguyen, H.P., Holzmann, C., Schmidt, T., Walther, T., Bader, 108