This document is the Accepted Manuscript version of a Published Work that appeared in final form in Analytical Chemistry, copyright © American Chemical Society after peer review and technical editing by the publisher. To access the final edited and published work see: https://dx.doi.org/10.1021/acs.analchem.9b03898. Site-specific mRNA cleavage for selective and quantitative profil- ing of alternative splicing with label-free optical biosensors Cesar S. Huertas,a,b,* Sophie Bonnal,c,d Maria Soler,e,a Alfonso M. Escuelaf Juan Valcárcel,c,d,g and Lau- ra M. Lechugaa a Nanobiosensors and Bioanalytical Applications Group, Catalan Institute of Nanoscience and Nanotechnology (ICN2), CSIC, BIST and CIBER-BBN, 08193 Bellaterra, Barcelona, Spain b Integrated Photonics and Applications Centre, School of Engineering, RMIT University, Melbourne, VIC 3001, Australia c Centre de Regulació Genòmica and BIST, 08003 Barcelona, Spain d Universitat Pompeu Fabra, 08003 Barcelona, Spain e Networking Research Center on Bioengineering, Biomaterials and Nanomedicine (CIBER-BBN), Spain f Institute for Applied Microelectronics (IUMA). University of Las Palmas de Gran Canaria, E-35017 Las Palmas (Spain) g Institució Catalana de Recerca i Estudis Avançats, Spain ABSTRACT: Alternative Splicing of messenger RNA precursors is a key process in gene regulation, contributing to the diversity of proteomes by the alternative selection of exonic sequences. Most cancers are associated with alterations in this mechanism, en- hancing their proliferation and survival, and can be employed as cancer biomarkers. Label-free optical biosensors are ideal tools for the highly sensitive and label-free analysis of nucleic acids. However, their application for alternative splicing analysis has been hampered due to the formation of complex and intricate long-range base-pairing interactions which make the direct detection in mRNA isoforms difficult. To solve this bottleneck, we introduce a new methodology for the generation of length-controlled RNA fragments from purified total RNA, which can be easily detected by the biosensor. The methodology seizes RNase H enzyme activ- ity to degrade the upstream and downstream RNA segments flanking the target sequence upon hybridization to specific DNA- oligos. It allows the fast and direct monitoring of Fas gene alternative splicing in real-time employing a Surface Plasmon Reso- nance (SPR) biosensor. We demonstrate the selective and specific detection of mRNA fragments in the pM-nM concentration range, reducing quantification errors and showing 81% accuracy when compared to RT-qPCR. The site-specific cleavage outper- formed a random RNA hydrolysis by increasing the detection accuracy in 20%, making this methodology particularly appropriate for label-free quantification of alternative splicing events in complex samples. Gene regulation pathways play important roles in omarkers for patient stratification in cytotoxic and targeted every process of life, including cell differentiation, metabo- anticancer therapies4. Also, it has been demonstrated that RNA lism, cell cycle, and signal transduction. There are many regu- splicing events are crucial drivers of prostate cancer aggres- latory mechanisms that serve the cells to quickly adapt to envi- siveness and therapeutic resistance in African American men5. ronmental changes by modulating gene expression levels, es- Therefore, the evaluation of splice variants holds great prom- tablishing a complex and highly structured gene regulatory ise for improving disease diagnosis and, ultimately, patient network. Alternative splicing (AS) is a key post-transcriptional care in the era of precision medicine6. In fact, recent studies process in the gene expression regulatory pathway. Splicing of focusing on prostate cancer have demonstrated that mRNA precursor messenger RNA (Pre-mRNA) can generate different analysis of circulating tumour cells could reveal substantial mature mRNAs that contain various combinations of exons, information on drug sensitivity and resistance7, which can lead contributing to the diversity of proteomes. Alterations in AS to the development of less invasive approaches to modulate processes can cause or modify the development of a variety of and monitor this process in therapeutic settings 8,9. diseases including cancer1. Most cancers are associated with a The knowledge of the mechanisms and dynamics of AS has switch in the splicing pattern of specific isoforms that provides grown substantially in recent years, confirming its critical role them with proliferative capacity and survival properties 2. In in human health and disease. The gold-standard approach to addition, splice variants diversify the repertoire of biomarkers characterize AS is reverse transcription of mRNA followed by and functionally contribute to drug resistance during chemo- polymerase chain reaction amplification (RT-qPCR)10. Also, therapy3. For example, Safikhani et al. demonstrated that iso- microarrays have been designed to sample AS events on a form analysis represents a promising brand-new class of bi- genome scale and successfully used to examine AS across 1 tissues, cellular states and species11,12. RNA-sequencing com- for selective RNA sequence fragmentation. This disadvantage bined with computational tools have emerged as powerful makes particularly difficult to generate RNA fragments of tools for the examination of AS at a genome-wide level, interest in a controlled manner. RNase H is an enzyme known providing opportunities to leverage AS to advanced diagnos- to specifically degrade the RNA strand of RNA-DNA hybrid tics and prognostics tests for the delivery of effective medi- duplexes18. For example, it has been employed in the identifi- cines to patients. Recently, label-free optical biosensors have cation of a particular group of microbes based on the cleavage been pointed out as potential solutions for disease diagnostics of a particular region in ribosomal RNAs (rRNAs)19. In this and therapy follow-up by the analysis of nucleic acids13. These work, we introduce RNase H-mediated cleavage as a new biosensors are high-sensitive analytical devices able to per- methodology for the generation of specific RNA fragments of form label-free assays in a timely and inexpensive manner, a length of interest and demonstrate its applicability for the with minimal operator training and easy-to-perform proce- real-time analysis of AS events using an SPR biosensor. The dures. RNA site-specific cleavage employs two designed DNA oli- The Surface Plasmon Resonance (SPR) biosensor is consid- gonucleotides complementary to the upstream and down- ered the landmark in optical biosensors. SPR sensors have stream RNA segments flanking the specific RNA sequence of been widely employed in the pharmaceutical industry and interest (Figure 1A). These DNA oligonucleotides, once hy- research laboratories for the study of numerous types of bio- bridized to the endogenously transcribed AS isoforms, will molecular interactions14. SPR biosensors can detect, monitor, promote the degradation of the hybridized RNA segment by and quantify molecules attaching to the sensor surface by RNase H activity, liberating the flanked sequence and making measuring the change in the refractive index (RI) produced at it available for its subsequent analysis by the SPR biosensor its immediate vicinity, thus avoiding amplification steps or (Figure 1B). Compared to alkaline hydrolysis, which produces molecular labelling. However, the most challenging factor in random RNA fragments, the RNase H method enables high label-free detection of mRNAs is the target length. Long sin- precision fragmentation, thus ensuring that target RNA se- gle-stranded RNA sequences are prone to generate secondary quence is released intact with high selectivity and efficiency. and tertiary structures through complex base-pairing and Further, it offers the advantage of analysing the RNA frag- backbone interactions facilitated by the intrinsic flexibility of ments of interest directly in a PCR amplification-free mode RNA moieties. These complex structures can hide the target and without risk of sample input loss, contrary to the alkaline sequence and hinder their accessibility to the bioreceptor hydrolysis approach. monolayer. In addition, the production of nucleic acid se- The methodology is implemented for the evaluation of AS quences by conventional oligonucleotide synthesis processes events in Fas gene mRNA isoforms, which play antagonistic has some limitation due to chemical reaction efficiency. As a roles in programmed cell death and are relevant to cancer. AS result, the length of synthetic oligonucleotides typically do not of Fas gene generates two isoforms depending on the inclu- exceed 150-200 nucleotides (nt)15, which impedes the pre- sion or skipping of its exon 6 (ie. Fas567 or Fas57, respective- calibration of the biosensor by employing standards for target ly). Fas567 isoform encodes a full-length transmembrane pro- sequences over 200 nt. This is one possible reason why there tein receptor known as Fas/ CD95 that binds to Fas ligand is a shortage of publications related to the detection of long (FasL), activating the signalling cascade of the extrinsic apop- RNA sequences with label-free optical biosensors13. Our team totic pathway20. Fas57 isoform lacks the trans-membrane do- previously demonstrated the capabilities of an SPR biosensor main, producing a soluble protein known as sFas that com- for the label-free analysis of AS events16. In this study we petes with the Fas receptor in the extra-cellular environment showed that RNA fragmentation was necessary for the accu- by binding to FasL. This version of Fas is overexpressed in rate assessment of AS events by the SPR biosensor, since the cancer cells21,22, and contributes to cancer aggressiveness23,24. signal from these long-sequences was almost negligible prob- We have optimized the RNase H cleavage conditions in terms ably due to the target sequences low accessibility. To do that, of buffer composition, enzyme concentration and reaction a sample pre-processing step was applied for the fragmenta- temperature. Finally, the usefulness of the methodology has tion of purified total RNA. The strategy followed takes ad- been demonstrated by the analysis of the endogenous expres- vantage of the susceptibility of phosphodiester bonds from the sion of Fas gene alternative splicing isoforms in HeLa cells ribose sugar phosphate backbone of RNA to be hydrolysed in and its performance comparison with the gold-standard RT- alkaline medium17, generating ~200-nt mRNA fragments, qPCR technique for validation. which can be directly analysed by the SPR biosensor without PCR-amplification. However, the incubation time is a crucial parameter in this approach since it promotes a random cleav- age and is prone to lose sample input by disruption of the se- quence of interest. This time will also vary depending on the sample quality. Poor-quality samples could be caused by RNA degradation. Thus, additional alkaline degradation is not ad- visable because it can foster the loss of target input and bias the final biosensor readout. In such cases, it is important to keep RNA integrity to ensure an accurate analysis. Therefore, other methodologies should be considered in order to achieve a more controlled cleavage of RNA molecules. Whereas DNA molecules can be easily cut at specific se- quence sites by restriction enzymes, there are no specific tools 2 Figure 1. Scheme of the developed methodology. (A) RNase H specific cleavage process. (B) SPR biosensor methodology for specific detection of AS isoforms in HeLa cells. MATERIALS AND METHODS SPR biosensor. The SPR biosensor device is based on Chemical reagents and buffers. Solvents used for gold sen- Kretschmann configuration and monitors refractive index (RI) sor chip cleaning were purchased to Panreac Applichem (Bar- changes in real time27. A schematic illustration of the SPR celona, Spain): Acetone 99.5% and Ethanol 99%. Main salts biosensor is shown in the Suplementary Material (Figure S1). and chemical reagents for sensor cleaning, buffer preparation A p-polarized light of 670 nm from a laser source is divided in and biofunctionalization were acquired from Sigma-Aldrich two identical beams focused on the crystal-backside of the (Germany): Sodium Dodecyl Sulfate (SDS), Hydrochloric gold sensor chip (glass surface coated with 2 nm of chromium Acid (HCl), Sodium Phosphate monobasic (NaH2PO4) 99%, and 45 nm of gold, 10×10×0.3mm3, SSens, Enschede, The Sodium Phosphate dibasic (Na2HPO4) ≥99%, Sodium Chlo- Netherlands). Measurements are performed at a fixed angle of ride (NaCl) ≥99.5%, Sodium Citrate dihydrate ≥99%, 6- incidence. Variations of the RI are detected due to the bioin- Mercapto-1-hexanol (MCH) 97% and Formamide ≥99.5%. teraction events occurring at the sensor surface as changes in Several buffers and solvents have been prepared either for the reflected light intensity by a multielement photodiode. The functionalization or target analysis: PBS 50 mM (50 mM flow system consists of two flow cells (300 nL each) for inde- Phosphate buffer, 0.75 mM NaCl –pH 7-), 20x SSC (3 M pendent analysis. The device incorporates all optics, electron- NaCl, 0.3 M sodium citrate –pH 7-), 1x Alkaline hydrolysis ics and fluidics components necessary to operate autonomous- buffer (Carbonate/Bicarbonate 50mM, EDTA 1mM, pH 9.2) ly. Sensograms reproduce the binding event by monitoring the and RNA fragmentation stop solution (3M Sodium Acetate), increase (or decrease in case of unbinding events) of the inten- RNase H buffer (50 mM Tris-HCl, 75 mM KCl, 3 mM sity of the reflected light (ΔReflectivity (%), ΔR (%)) vs. time MgCl2, 10 mM DTT -pH 8.3-). Buffer solutions were pre- (seconds, s). This change of the intensity of the reflected light pared by using H2O milliQ incubated O/N with 2% DEPC and is directly related to changes in the RI of the dielectric medi- autoclaved at 121ºC for 1 hour. um caused by mass changes on the metallic sensor surface. DNA sequences. All DNA-probes and synthetic targets were DNA-probe immobilization. Prior to DNA-probe immobili- purchased from IBA GmbH (Goettingen, Germany) and are zation, gold sensor chips were cleaned by consecutive soni- summarized in Table 1. DNA-probe sequences incorporate a cation cycles (1min) with solvents of increasing polarity (i.e. thiol group at the 5’-end to enable chemical coupling with the acetone, ethanol and dH2O) previously heated up to their boil- gold sensor surface. In addition, a spacing region, which con- ing point. Then, substrates were dried under nitrogen flux and sists of a 15-thymine sequence (polyT15) is placed between the placed in a UV/O3 generator (BioForce Nanosciences, USA) thiol group and the matching region. This sequence will not for 20 min. After that, gold sensor chips were subsequently participate in the hybridization event but, instead, it acts as a rinsed with ethanol and water and dried under nitrogen flux. vertical spacer due to the low affinity of thymine bases for The gold sensor chip was then placed into the SPR device. gold surfaces25. The length of this polyT15 has been demon- strated to outperform the biosensor performance compared to other lengths 26. mRNA isoform sequences were obtained from Ensembl genenome browser (http://www.ensembl.org/index.html). DNA/RNA sequences employed are summarized in Table 1. 3 Table 1. Sequences and probes and DNA/RNA synthetic targets sponding to the exonic regions flanking the alternatively employed. spliced sequences29. For SPR biosensor analysis, two DNA- Name Sequence oligos were designed, complementary to the sequences flank- 5’ – (SH) – PolyT15 -CTTTCTCTTCACTTCCTCTTTG-3’ Fas57 probe ing exon 5 (3’ end of exon 4) and exon 7 (5’ end of exon 8) Fas56 probe 5’-(SH)- PolyT15- AGATCTGGATCCTTCCTCTTTG-3’ (see Table 2). These sequences, once hybridized to the endog- 5’ATGTAGAACATGGAATCATCAAGGAATGCACAC enously transcribed isoforms, will promote the degradation of TCACCAGCAACACCAAGTGCAAAGAGGAAGTGAA the RNA sequence in contact, producing fragments of approx- Fas57 GAGAAAGGAAGTACAGAAAACATGCAGAAAGCAC isoform AGAAAGGAAAACCAAGGTTCTCATGAATCTCCAA imately 200 nts (Table 2). We incubated total RNA with 10 CTTTAAATCCT3’ µM concentration of each DNA-probe at 95 ºC for 2 min and 5’ATGTGAACATGGAATCATCAAGGAATGCACACT cooled it on ice for 5 min for probe-annealing. After anneal- CACCAGCAACACCAAGTGCAAAGAGGAAGGATCC AGATCTAACTTGGGGTGGCTTTGTCTTCTTCTTTTG ing, RNA samples were incubated with 100 U/mL of RNase H Fas567 isoform CCAATTCCACTAATTGTTTGGGTGAAGAGAAAGGA in 1x RNase H buffer (50 mM Tris-HCl, 75 mM KCl, 3 mM AGTACAGAAAACATGCAGAAAGCACAGAAAGGAA AACCAAGGTTCTCATGAATCTCCAACTTTAAATCC MgCl2, 10 mM DTT –pH 8.3-) at room temperature (RT) for T3’ 60 min. RNase H was later inactivated by incubating at 65 ºC DNA1 probe 5’-(SH)-PolyT15-ATCACCGACAGCGT3’ for 15 min. After applying the fragmentation protocol, endog- RNA1 5’AACAUUCAACGCUGUCGGUGAGU3’ enous levels of Fas isoforms were evaluated using the SPR 5’GAGGCAGGCGACGAGTTTGAACTGCGGTACCGG biosensor. CGGGCATTCAGTGACCTGACATCCCAGCTCCACAT Isoform hybridization and biosensor regeneration. Splicing CACCCCAGGGACAGCATATCAGAGCTTTGAACAG Control GATACTTTTGTGGAACTCTATGGGAACAATGCAGC variants detection was performed by injection of the target AGCCGAGAGCCGAAAGGGCCAGGAACGCTTCAAC splicing variant samples into the biosensors at a 15 µL/min CGCTGGTTCCTGACGGGCATGACTGTGGC3’ rate and subsequent hybridization with their complementary DNA-probes immobilized on the sensor surface. These sam- For RNase H activity optimization, formation of a self- ples were dissolved in the hybridization buffer (3xSSC -0.45 assembled monolayer (SAM) of DNA1 probe was carried out M in NaCl, 0.045 M sodium citrate- with a 45% formamide). in-situ on the gold sensor chip by flowing 250 mL of a solu- Isoform-probe interactions were disrupted by using a 50% tion containing 1 µM of DNA1 probe in 1x PB buffer solution formamide in aqueous solution. Calibration curves were ob- at a 12 mL/ min rate. For Fas gene isoform detection, for- tained for each DNA probe by triplicate measurements of the mation of mixed SAMs of either Fas56-probe or Fas57- DNA Fas gene AS isoforms synthetic standards at different probe/MCH (20:1, 1 µM) was carried out in-situ on the gold concentrations (2.5, 5, 10, 20, 30, and 50 nM). The mean and sensor chip by flowing 250 mL of the mix in 1x PB buffer the standard deviation (SD) of each concentration were plotted solution at a 12 mL/ min rate. We immobilized each isoform versus the target concentration and fitted to a curve. Frag- probe in independent SPR channels. mented and non-fragmented total RNA samples from HeLa Alkaline hydrolysis of purified total RNA from HeLa cells. cells were diluted in hybridization buffer to 20 ng/µL and ana- Total RNA from human cervical carcinoma HeLa cells (ap- lysed by SPR biosensor at the same conditions used for the prox. 1.5 million cells) was isolated using the RNeasy kit (Qi- standards. In addition, purified total RNA from bacteria (XLI agen, Germany). For alkaline hydrolysis, samples were pre- Blue) was used as a negative control. heated at 95ºC for 15 s and mixed with preheated 1xAlkaline hydrolysis buffer (Carbonate/Bicarbonate 50mM, EDTA 1mM, pH 9.2) to start the hydrolysis reaction. Total RNA Table 2. DNA probes for RNase H cleavage and Fas mRNA samples were exposed to the alkaline buffer for 3 minutes. fragments generated after the cleavage. After each incubation time, samples were placed on ice and Name Length (nt) Sequence reaction was stopped with RNA fragmentation stop solution 5’CCAAAUGUGAACAUGGAAUCAUCAAGG AAUGCACACUCACCAGCAACACCAAGUG (3M Sodium Acetate, pH 5.2). After applying the fragmenta- Fas 567 CAAAGAGGAAGGAUCCAGAUCUAACUUG tion protocol, endogenous levels of Fas isoforms were isoform GGGUGGCUUUGUCUUCUUCUUUUGCCAA checked using the SPR biosensor. fragment 214 UUCCACUAAUUGUUUGGGUGAAGAGAAA after GGAAGUACAGAAAACAUGCAGAAAGCAC RNase H cleavage of purified total RNA from HeLa cells. RNase H AGAAAGGAAAACCAAGGUUCUCAUGAAU Total RNA from human cervical carcinoma HeLa cells (aprox. CUCCAACUUUAAAUCCU3’ 1.5 million cells) was isolated using the RNeasy kit (Qiagen, 5’CCAAATGTGAACATGGAATCATCAAGG Fas 57 Germany). They were transfected at 50% confluency with 0.4 isoform AATGCACACTCACCAGCAACACCAAGTGC micrograms of Fas minigenes28 and 10 micrograms of plasmid fragment 149 AAAGAGGAAGTGAAGAGAAAGGAAGTAC AGAAAACATGCAGAAAGCACAGAAAGGA DNA expressing either beta galactosidase or PTB, per culture after AAACCAAGGTTCTCATGAATCTCCAACTT plate of 10 cm. When 6-wells plates were used, 50 ng RNase H TAAATCCT3’ minigene and 3 micrograms of expression plasmid DNA were Fas exon 25 5’ TGCAAGGGTCACAGTGTTCACATAC 3’ transfected per well. When minigene and protein expression 4 probe Fas exon vectors were used, cells were collected 48 hours post- 25 5’ CAGATAAATTTATTGCCACTGTTTC 3’ 8 probe transfection. Total RNA was isolated using the RNeasy kit (Qiagen) and the pattern of alternative splicing was analyzed by RT-PCR. Reverse transcription was carried out using AMV-Reverse Transcriptase (Promega) and specific reverse primers28. Polymerase chain reaction was carried out using GoTaq (Promega) and forward and reverse primers corre- 4 Figure 2. Optimization of RNase H conditions for Fas gene alternative splicing analysis through SPR biosensor. (A) Scheme of the strate- gy followed for the optimization of the RNase H activity by SPR analysis. (B) RNase H buffer concentration optimization. (C) RNase H concentration optimization. (D) Temperature optimization for RNase H activity optimization (RT: Room Temperature). Data analysis. The data were collected and analysed using related to the mass changes on the gold surface, which corre- Origin 8.0 software (OriginLab, Northampton, MA). Graph- spond to the concentration of the hybridized RNA. The light ical representation and calibration curve interpolation was source is divided into two identical beams, generating a sur- performed in Graphpad prism 8 (Graphpad Software, San Di- face plasmon in two different flow-cells of 300 nL each. This ego, CA -EEUU-) The experimental detection limit (LOD) allows for parallel, independent analyses of two different sam- was defined as the target concentration providing a ΔR (%) in ples. We took advantage of this process to assess and optimize the hybridization signal at least three times higher than that of RNase H activity exploring different parameters of the reac- the standard deviation of the control signal. The coefficients of tion, including: (i) the reaction buffer concentration, (ii) the variation were obtained as the ratio of the standard deviation enzyme concentration, and (iii) the reaction temperature. to the mean, expressed in percentages (%CV). Agreement We employed a short RNA sequence (RNA1) (Table 1) for the between RT-qPCR and SPR was assessed by applying the evaluation of the activity of the enzyme. We immobilized a Bland-Altman model for replicate measurements. specific complementary DNA probe (DNA1 probe Table 1) for the specific capture of RNA1 and, subsequently, monitored the RESULTS AND DISCUSSION RNA hybridization and RNase H activity in real time (Figure Specific RNA cleavage optimization. 2A). A change in the refractive index will be observed during The assessment of the RNase H activity was carried out using the specific hybridization of the complementary RNA1 target, a portable custom-designed SPR biosensor27. This SPR bio- which will be directly related to its concentration in the ana- sensor is based on Kretschmann configuration and monitors lysed sample. Then, the interaction will find its equilibrium refractive index changes at a fixed angle of incidence. It ena- state and will reach a plateau in the SPR sensor signal. The net bles analysis in real time, offering the advantage of monitoring change in the baseline, expressed as variation of reflectivity biological interactions as they happen. (ΔR (%)), will be directly proportional to the concentration of The biosensor response is represented in sensograms that re- the hybridized target sequence. RNase H can be employed produce the binding event by monitoring the increase (binding during the examination of RNA sequences in SPR biosensors events) or decrease (unbinding events) of the intensity of the for the regeneration of the sensor surface. The regeneration is reflected light (ΔReflectivity (%), ΔR (%)) vs. time (seconds, underpinned by the RNase H-induced degradation of the RNA s). This change of the intensity of the reflected light is directly sequences previously hybridized to the immobilized DNA 5 probes, rendering them available for further analyses 30. Thus, Comparative study of mRNA fragmentation procedures eventually, the hybridization will be interrupted by the RNase for Fas gene AS evaluation. H solution, degrading RNA1 sequence, and returning the base- The optimized procedure for specific mRNA fragmentation by line to its original level. the RNase H enzyme was applied and evaluated for selective First, we evaluated effect of the reaction buffer on RNase H biosensing of endogenous levels of Fas gene AS isoforms activity. The buffer composition, pH, and ionic strength of the directly from HeLa cells samples. We also compared its per- solution are known to influence enzymatic cleavage efficien- formance with non-fragmented and with alkaline-hydrolyzed cy. The optimum buffer composition for RNase H activity has samples. been established and reported elsewhere (i.e., 50 mM Tris- RNase H cleavage was performed off-sensor on purified RNA HCl, 75 mM KCl, 3 mM MgCl2, 10 mM DTT, pH 8.3)19. from HeLa cells to assess the expression levels of Fas gene However, the concentration of salts must be tested for specific mRNA isoforms by following the experimental procedure applications. The study was carried out as depicted in Figure depicted in Figure 1. In order to obtain Fas gene isoform 2A. fragments of interest, we designed 25 nt DNA sequences com- A DNA1 probe was immobilized in-situ on the gold sensor plementary to the sequences flanking exon 5 (3’ end of exon chip and continuous 5x saline-sodium citrate (5x SSC) buffer 4) and exon 7 (5’ end of exon 8). These sequences, once hy- at pH 7 was supplied over the functionalized sensor surface bridized to the endogenously transcribed isoforms, should until a baseline was reached. Then, RNA1 was hybridized at a promote the degradation of the hybridized RNA sequence, 50 nM concentration in 5x SSC buffer with its specific recep- producing fragments of approximately 200 nt (Table 2). For tor attached to the biosensor surface. Once we reached the comparison, alkaline hydrolysis was performed in parallel as equilibrium of the interaction, we flowed 250 U/mL of the previously described16: RNA samples were preheated at 95 ºC enzyme at different RNase H buffer concentrations (1x, 2x and for 15 s, mixed them with preheated 1x alkaline hydrolysis 3x) at RT (i.e. 25 ºC). The capability of the enzyme at each buffer and incubated the mix for 3.5 min (incubation time was buffer concentration to return the sensor signal to the initial previously optimized in order to obtain RNA fragments of an level due to the cleavage was evaluated. As can be observed in average of 200 nt) (Figure S2). Figure 2B, the SPR signal dropped drastically below the initial baseline during the RNase H activity (RNase on). This dip in the signal was mainly caused by the difference in the RNase H buffer composition compared to the continuous buffer, pro- ducing a drastic drop in the refractive index of the medium and obscuring the monitoring of the degradation process. After RNase H treatment, the sensor surface was washed again with the running buffer and the net change between the sensor sig- nal at the equilibrium of interaction and the new baseline pro- vided the approximate % of degraded RNA by the enzyme's activity. At a 2x buffer concentration, the baseline did not return to its initial level, indicating that only a 48% of the hy- bridized RNA was degraded. A similar result was observed at 3x buffer concentration. On the contrary, the baseline com- pletely returned to the initial level at a 1x buffer concentration, confirming highest RNase H activity at this buffer concentra- tion. Once 1x was established as the proper buffer concentration, we tested the optimal enzyme concentration needed for the reaction. We injected four different concentrations of RNase H enzyme: none, 1, 10, 50 and 100 U/mL. As depicted in Figure 2C, the latter cleaved the hybridized RNA almost completely and achieved the same results as when using 250 U/mL while lower concentration failed in the full degradation of the RNA, indicating that a concentration of 100 U/mL of RNase H was sufficient to carry out the complete cleavage of the sequence. Finally, we explored the enzyme activity at different reaction Figure 3. SPR sensograms of the detection of 20 ng/µL of total temperatures. We tested room temperature (RT), 40 ºC and 50 HeLa cell RNA for the endogenous expression of both (A) ºC by preheating the RNase H solution before flowing it in the Fas567 isoform and (B) Fas57 isoform after applying RNase H SPR biosensor. At 40 ºC and 50 ºC, the enzyme was not fully cleavage (H) (purple line), the alkaline hydrolysis (Δ) (orange effective, cleaving less than half of the hybridized RNA (Fig- line) and without any sample fragmentation (0) (green line). The ure 2D). On the contrary, RT conditions achieved the best grey line represents the signal given by the RNA control sample. results, returning the sensor signal to the initial levels. Accord- Adapted from16 with permission of Elsevier. ing to these results, we considered that optimal conditions for RNase H activity were 100 U/mL enzyme concentration dilut- To stop RNA degradation, samples were placed on ice and ed in a 1x reaction buffer at RT. mixed with sodium acetate (pH 5.2). The time of incubation is crucial and will strongly depend on the concentration and 6 quality of the samples. Lower RNA concentrations will be degraded faster, leading to shorter fragments for similar incu- bation times. Likewise, poor-quality samples will already pre- sent some level of degradation and could lead to sample input losses. Therefore, it should be carefully optimized in each case. After each fragmentation process, samples were diluted in the hybridization buffer to 20 ng/μL of purified total RNA. In order to detect Fas gene AS isoforms through SPR, a clean gold sensor chip was activated and placed into the SPR device. Immobilization of Fas57 and Fas56 probes was carried out in independent microfluidic cells. Mixed SAMs of either Fas567 or Fas57 probes and alkanethiol 6-mercapto-1-hexanol (MCH) at a ratio of 20:1 were prepared and flowed over two different SPR sensor channels. MCH is a commonly used backfiller that acts as a lateral spacer, improving the target accessibility by minimizing steric hindrance forces created between the DNA probes in densely packed monolayers. After that, the mRNA samples obtained from HeLa cells after fragmentation are flowed over the functionalized sensor surface, and the specific Fas57 and Fas567 are captured and detected in real time. We monitored the SPR response recorded for each isoform in both SPR sensor channels. Results obtained using RNase H cleav- age (SPRH) and alkaline hydrolysis protocol (SPRΔ) were compared with non-fragmented samples (SPR0). Figures 3A and B show the SPR responses obtained after injection of HeLa cell total RNA samples for each receptor. SPR sen- sograms showed a significant increment of the sensor signal after sample injection time (≈ 100s) due to differences in the refractive index of the hybridization buffer. After sample in- teraction, we washed the sensor surface with the continuous running buffer and analyzed the net changes in the baseline levels, which will correspond to the quantity of target hybrid- ized to the biosensor. As can be seen in Figure 3, endogenous RNAs without any cleavage generated SPR responses of 0.02% and 0.09% ΔR for Fas57 and Fas567, respectively. In contrast, samples treated with RNase H produced an ΔR of Figure 4. Quantitative analysis of mRNA Fas gene isoforms by 0.12% and 0.57% for Fas57 and Fas567, respectively. Alka- SPR. SPR calibration plots for Fas57 (A) (R2= 0.99) and Fas56 line hydrolysed samples showed increments in the SPR reflec- (B) (R2=0.99) probes using the optimized hybridization and de- tivity of 0.09% (Fas57) and 0.49% (Fas567). Negative control tection conditions. Solid lines correspond to the non-linear fit of RNA purified from bacteria produced negligible SPR sensor the calibration curves. Red dashed line corresponds to 3xSD SPR responses, returning to the baseline level and confirming the noise, which is the limit for the minimum signal detectable. All specificity of the detection. Therefore, the application of either data show mean ± SD of triplicate measurements. (C) Histograms of the fragmentation protocols resulted in an increment in the comparing the analytical quantification of Fas57 (left) and SPR sensor responses for both isoforms. These results confirm Fas567 (right) isoforms. (D) Histogram comparing the 567/57 our hypothesis that RNA fragmentation increase the accessi- ratio after each condition tested by SPR. All data show mean ± bility of the target to the monolayer and, therefore, enhance SD of duplicate measurements. Figure A and B are reprinted the SPR detection response. from16 with permission of Elsevier. Validation of the measurement results using RT-qPCR. We analysed different concentrations (ranging from 0 to 50 In order to obtain quantitative data of Fas AS isoform levels, nM) for both sequences diluted in the hybridization buffer. By we carried out calibration curves using synthetic DNA stand- applying these conditions, we achieved limits of detection of ard sequences (Fas567 and Fas57 isoforms, Table 1) corre- 387 and 438 pM for Fas57 and Fas567 isoforms, respectively. sponding to the exonic regions 567 and 57 of Fas gene AS Such detection limits prove the excellent sensitivity of our isoforms (Figures 4A and 4B). These DNA sequences were methodology for the direct and label-free assay of nucleic designed with lengths of 150-200 nt to simulate the fragment acids, which is usually in the nM-pM range 31. lengths obtained by the fragmentation processes. SPR quantitative data was obtained by interpolation of the SPR response in the calibration curve equation specific for each isoform. Figure 4C shows the quantification of the two isoforms under each condition. Quantitative data obtained from non-fragmented samples (SPR0) were 24.6/5.5 nM for 7 Fas567/Fas57. In contrast, the quantities detected increased Table 3. RT-qPCR and SPR comparison of the isoform content by a factor of ten after the application of either fragmentation analysis from HeLa cells endogenous expression. Isoform concen- protocol (262/12 nM for SPRΔ and 295/13.1 nM for SPRH). tration in nM for SPR was calculated through the calibration To validate the results and the methodology introduced in this curves obtained for each receptor according to their ΔR (%). work for site-specific mRNA cleavage, we carried out parallel analysis of HeLa RNA samples with RT-qPCR. Table 3 shows Fas Concentration (nM) the comparison between the quantification performed by RT- isoform RT-qPCR* SPR* Fragmentation qPCR and the three different approaches carried out using the 24.6 ± 0.40 No fragmentation SPR biosensor. According to RT-qPCR data (365/20.3 nM), a SPR results from non-fragmented samples heavily underesti- 567 365 ± 17 262 ± 27 Alkaline hydrolisis mated RNA abundance (accuracy lower than 30%), confirm- 295 ± 14 RNaseH cleavage ing the need for a fragmentation process. 5.5 ± 0.1 No fragmentation RNase H cleavage results showed 81% accuracy for Fas567 a 57 20.3 ± 0.4 12.0 ± 0.8 Alkaline hydrolisis and 65% for Fas57 compared to RT-qPCR, whereas alkaline 13.1 ± 0.3 RNaseH cleavage hydrolysis showed accuracies of 65% for Fas567 and 59% for Fas57. Thus, RNase H outperformed alkaline hydrolysis up to *Mean ± SD of endogenous concentration of HeLa cell’s total 20% for the detection of the different isoforms, leveraging this RNA calculated from 2 different samples in each experiment. approach for a more accurate detection of AS events. The slight underestimation of isoform concentrations by SPR H CONCLUSION compared to the results from the RT-qPCR could be due to Alternative splicing can contribute to the development and limitations in the sensitivity of the SPR biosensor, since anal- progression of human malignancies and it has been highlight- yses are performed in an amplification-free and label-free ed as a hallmark of cancer. The use of alternatively spliced scheme. isoforms as biomarkers will likely increase in the near future. Finally, to further confirm the advantages of the RNase H Evaluating the impact of AS variants in cancer could be fragmentation, we applied the procedure to quantify Fas adopted as an integral part of clinical diagnosis. In addition, (567/57) isoform ratios in a highly accurate and selective modulation of isoform ratios poses great promise in future manner (Figure 4D). Isoform ratio is a key feature to predict precision medicine for personalized therapies. the aberrant regulation of AS events. Therefore, it is the most Despite the significant advances in optical biosensors and their important parameter in order to test the efficiency of AS event potential application for rapid diagnostics tests, there is a lack analysis. As can be appreciated in the figure, the ratio between of applications related to long RNA sequences, such as mRNA isoforms is very different in the absence of fragmentation. isoforms, due to the difficult access of these sequences to their According to SPRH results, Fas567 isoform had increased specific DNA-probes in the biosensor bioreceptor monolayer. expression compared to Fas57 isoform, leading to an isoform We show that this biosensing approach can be greatly en- ratio (567/57) of 22.0 ± 0.7. These results show a good corre- hanced by previous sample pre-processing steps to generate lation with the RT-qPCR (567/57 =17.9 ± 0.4). Also, in order targets with the desired length that will not display the limita- to test the agreement between the two techniques, different tions associated to long RNAs. RNA samples presenting different isoform ratios were ana- We have adopted a methodology for the site-specific cleavage lysed and compared by SPRH and RT-qPCR. To induce differ- of mRNA sequences in order to obtain fragments with a pre- ent isoform ratios, HeLa cells were transfected with a cise sequence and length of interest. It has been employed for minigene expressing Fas genomic sequences. Then, total RNA the fast and direct monitoring of alternative splicing events in was purified either alone or co-transfected with a vector ex- real-time using an SPR biosensor. Our methodology involves pressing the Polypyrimidine-Tract-Binding protein (PTB). the design of specific DNA oligonucleotides that hybridize the PTB induces skipping of Fas exon 6 acting through an exonic flanking segments of the RNA fragment of interest, promoting silencer sequence29. While expression of the minigene alone their degradation by RNase H activity. This approach permits leads to preferential accumulation of exon 6-including tran- the generation of mRNA fragments with the appropriate length scripts, co-expression of Fas567 minigene with PTB leads to with high selectivity, ensuring their accurate quantification via higher accumulation of transcripts that skip exon 6 28. Each optical biosensors. condition was analysed by SPRH and RT-qPCR and isoform The feasibility of the methodology was tested in complex ratios were calculated. All samples tested (6/6) were found RNA mixtures purified from HeLa cells expressing endoge- within the limits of agreement (Figure S3). In fact, the agree- nous Fas gene mRNA transcripts. The results strongly corre- ment between SPR measurements and RT-PCR is higher for lated with RT-qPCR data, with a detection accuracy up to RNase H digestion compared to alkaline hydrolysis performed 81%. In addition, they showed higher correlation between the in our previous work by a 20% (83% agreement), confirming RNase H cleavage and RT-qPCR compared with the conven- that RNase H cleavage is a more accurate approach for the tional fragmentation process based on alkaline hydrolysis by a analysis of AS isoforms in an amplification-free and label-free 20%. These results confirm that site-specific RNA fragmenta- detection system. tion reduces errors in isoform quantification, probably due to a lower loss of sample input than when applying random frag- mentation. A slight underestimation of the isoform concentra- tions was observed in the SPR analysis, which could be prob- ably due to limitations in the sensor sensitivity. One solution could be the implementation of this methodology in other la- 8 bel-free optical biosensors. For example, bimodal waveguide (2) Oltean, S.; Bates, D. O. Hallmarks of Alternative Splicing in interferometers (BiMW) have demonstrated to outperform Cancer. Oncogene 2013, No. November, 1–8. https://doi.org/10.1038/onc.2013.533. SPR sensitivities up to three orders of magnitude in the detec- (3) Ge, Y.; Weygant, N.; Qu, D.; May, R.; Berry, W. L.; Yao, J.; tion of AS events32. Chandrakesan, P.; Zheng, W.; Zhao, L.; Zhao, K. L.; et al. Our methodology, along with the label-free detection and the Alternative Splice Variants of DCLK1 Mark Cancer Stem Cells, minimized sample manipulation, provides an advance in the Promote Self-Renewal and Drug-Resistance, and Can Be real-time monitoring of AS events. In our view, these results Targeted to Inhibit Tumorigenesis in Kidney Cancer. Int. J. Cancer 2018, 143 (5), 1162–1175. open the door for the routine use of alternatively spliced https://doi.org/10.1002/ijc.31400. isoforms as biomarkers for diagnosis and patient follow-ups (4) Park, E.; Pan, Z.; Zhang, Z.; Lin, L.; Xing, Y. The Expanding during therapy. In addition, it tackles the challenges encoun- Landscape of Alternative Splicing Variation in Human tered in the analysis of long RNA sequences with label-free Populations. Am. J. Hum. Genet. 2018, 102 (1), 11–26. optical biosensors, enabling to exploit the potential of these https://doi.org/10.1016/j.ajhg.2017.11.002. biosensors for highly sensitive, selective, fast and user- (5) Wang, B.-D.; Ceniccola, K.; Hwang, S.; Andrawis, R.; Horvath, A.; Freedman, J. A.; Olender, J.; Knapp, S.; Ching, T.; Garmire, friendly genomic and epigenomic analyses. Moreover, it can L.; et al. Alternative Splicing Promotes Tumour Aggressiveness be implemented in more integrated and sensitive platforms and Drug Resistance in African American Prostate Cancer. Nat. that allow for multiplexed analysis of multiple AS events 32. Commun. 2017, 8, 15921. This work provides a significant step forward for the devel- https://doi.org/10.1038/ncomms15921. opment of sensitive diagnostic tools based on nucleic acid (6) Zhao, S. Alternative Splicing, RNA-Seq and Drug Discovery. Drug Discov. Today 2019. biomarker detection for cancer research. https://doi.org/10.1016/j.drudis.2019.03.030. (7) Alix-Panabières, C.; Pantel, K. Clinical Applications of ASSOCIATED CONTENT Circulating Tumor Cells and Circulating Tumor DNA as Liquid Biopsy. Cancer Discov. 2016, 6 (5), 479–491. Supporting Information https://doi.org/10.1158/2159-8290.CD-15-1483. Additional information as noted in text. The Supporting Infor- (8) Suñé-Pou, M.; Prieto-Sánchez, S.; Boyero-Corral, S.; Moreno- mation is available free of charge on the ACS Publications web- Castro, C.; El Yousfi, Y.; Suñé-Negre, J. M.; Hernández- site. Munain, C.; Suñé, C. Targeting Splicing in the Treatment of Human Disease. Genes (Basel). 2017, 8 (3). https://doi.org/10.3390/genes8030087. (9) Martinez-Montiel, N.; Rosas-Murrieta, N. H.; Anaya Ruiz, M.; AUTHOR INFORMATION Monjaraz-Guzman, E.; Martinez-Contreras, R. Alternative Splicing as a Target for Cancer Treatment. Int. J. Mol. Sci. 2018, Corresponding Author 19 (2). https://doi.org/10.3390/ijms19020545. (10) Harvey, S. E.; Cheng, C. Methods for Characterization of * E-mail: cesar.sanchez.huertas@rmit.edu.au Alternative RNA Splicing. Methods Mol. Biol. 2016, 1402, 229– Author Contributions 241. https://doi.org/10.1007/978-1-4939-3378-5_18. (11) Lee, C.; Roy, M. Analysis of Alternative Splicing with CSH, JV and LML devised the idea and designed the experi- Microarrays: Successes and Challenges. Genome Biol. 2004, 5 ments. CSH performed the SPR experiments. SB performed the (7), 231. https://doi.org/10.1186/gb-2004-5-7-231. RT-qPCR validation experiments and provided the HeLa cell (12) Castle, J. C.; Zhang, C.; Shah, J. K.; Kulkarni, A. V; Kalsotra, samples. CSH, SB, MS, JV and LML analyzed the data. The A.; Cooper, T. A.; Johnson, J. M. Expression of 24,426 Human manuscript was written through contributions of all authors. / All Alternative Splicing Events and Predicted Cis Regulation in 48 Tissues and Cell Lines. Nat. Genet. 2008, 40 (12), 1416–1425. authors have given approval to the final version of the manuscript. https://doi.org/10.1038/ng.264. (13) Carrascosa, L. G.; Huertas, C. S.; Lechuga, L. M. Prospects of ACKNOWLEDGMENT Optical Biosensors for Emerging Label-Free RNA Analysis. We acknowledge the financial support from PreDICT project TrAC - Trends in Analytical Chemistry. Elsevier June 1, 2016, (Programa estatal de investigación, desarrollo e innovación orien- pp 177–189. (14) Soler, M.; Huertas, C. S.; Lechuga, L. M. Label-Free Plasmonic tada a los Retos de la Sociedad, TEC2016-78515-R). SPR studies Biosensors for Point-of-Care Diagnostics: A Review. Expert were performed at the ICTS NANBIOSIS, especifically at the Rev. Mol. Diagn. 2018. Biodeposition and Biodetection Unit https://doi.org/10.1080/14737159.2019.1554435. (http://www.nanbiosis.es/portfolio/u4-biodeposition-and- (15) LeProust, E. M.; Peck, B. J.; Spirin, K.; McCuen, H. B.; Moore, biodetection-unit/). ICN2 is the recipient of Grant SEV-2017- B.; Namsaraev, E.; Caruthers, M. H. Synthesis of High-Quality 0706 from the “Severo Ochoa Centers of Excellence” Program of Libraries of Long (150mer) Oligonucleotides by a Novel Spanish Ministry of Science. Work in the JV laboratory is sup- Depurination Controlled Process. Nucleic Acids Res. 2010, 38 ported by the European Research Council (ERC AdvG 670146), (8), 2522–2540. https://doi.org/10.1093/nar/gkq163. (16) Huertas, C. S.; Carrascosa, L. G.; Bonnal, S.; Valcárcel, J.; AGAUR, Spanish Ministry of Economy and Competitiveness Lechuga, L. M. Quantitative Evaluation of Alternatively Spliced (BFU 2014-005153 and BFU 2017 89308-P) and the Centre of MRNA Isoforms by Label-Free Real-Time Plasmonic Sensing. Excellence Severo Ochoa. Biosens. Bioelectron. 2016, 78, 118–125. (17) Sasi, M. S.; Mlitan, A. M.; Alkherraz, A. M. Comparing CSH is a recipient of an RMIT Vice Chancellor's Postdoctoral Spontaneous Hydrolysis Rates of Activated Models of DNA and Fellowship. RNA. 2014. (18) Cerritelli, S. M.; Crouch, R. J. Ribonuclease H: The Enzymes in Eukaryotes. FEBS J. 2009, 276 (6), 1494–1505. REFERENCES https://doi.org/10.1111/j.1742-4658.2009.06908.x. (1) Scotti, M. M.; Swanson, M. S. RNA Mis-Splicing in Disease. (19) Uyeno, Y.; Sekiguchi, Y.; Sunaga, A.; Yoshida, H.; Kamagata, Nat. Rev. Genet. 2016, 17 (1), 19–32. Y. Sequence-Specific Cleavage of Small-Subunit (SSU) RRNA https://doi.org/10.1038/nrg.2015.3. with Oligonucleotides and RNase H: A Rapid and Simple 9 Approach to SSU RRNA-Based Quantitative Detection of Microorganisms. Appl. Environ. Microbiol. 2004, 70 (6), 3650– 3663. https://doi.org/10.1128/AEM.70.6.3650-3663.2004. (20) Krammer, P. H. CD95’s Deadly Mission in the Immune System. Nature 2000, 407 (6805), 789–795. https://doi.org/10.1038/35037728. (21) Cheng, J.; Zhou, T.; Liu, C.; Shapiro, J. P.; Brauer, M. J.; Kiefer, M. C.; Barr, P. J.; Mountz, J. D. Protection from Fas- Mediated Apoptosis by a Soluble Form of the Fas Molecule. Science 1994, 263 (5154), 1759–1762. (22) Cascino, I.; Fiucci, G.; Papoff, G.; Ruberti, G. Three Functional Soluble Forms of the Human Apoptosis-Inducing Fas Molecule Are Produced by Alternative Splicing. J. Immunol. 1995, 154 (6), 2706–2713. (23) Owen-Schaub, L.; Chan, H.; Cusack, J. C.; Roth, J.; Hill, L. L. Fas and Fas Ligand Interactions in Malignant Disease. Int. J. Oncol. 2000, 17 (1), 5–12. (24) Owen-Schaub, L. B.; van Golen, K. L.; Hill, L. L.; Price, J. E. Fas and Fas Ligand Interactions Suppress Melanoma Lung Metastasis. J. Exp. Med. 1998, 188 (9), 1717–1723. https://doi.org/10.1084/jem.188.9.1717. (25) Opdahl, A.; Petrovykh, D. Y.; Kimura-Suda, H.; Tarlov, M. J.; Whitman, L. J. Independent Control of Grafting Density and Conformation of Single-Stranded DNA Brushes. Proc. Natl. Acad. Sci. 2007. https://doi.org/10.1073/pnas.0608568103. (26) Carrascosa, L. G.; Calle, A.; Lechuga, L. M. Label-Free Detection of DNA Mutations by SPR: Application to the Early Detection of Inherited Breast Cancer. Anal. Bioanal. Chem. 2009. https://doi.org/10.1007/s00216-008-2555-1. (27) Huertas, C. S.; Aviñó, A.; Kurachi, C.; Piqué, A.; Sandoval, J.; Eritja, R.; Esteller, M.; Lechuga, L. M. Label-Free DNA- Methylation Detection by Direct Ds-DNA Fragment Screening Using Poly-Purine Hairpins. Biosens. Bioelectron. 2018. https://doi.org/10.1016/j.bios.2018.08.027. (28) Förch, P.; Puig, O.; Kedersha, N.; Martínez, C.; Granneman, S.; Séraphin, B.; Anderson, P.; Valcárcel, J. The Apoptosis- Promoting Factor TIA-1 Is a Regulator of Alternative Pre- MRNA Splicing. Mol. Cell 2000, 6 (5), 1089–1098. (29) Izquierdo, J. M.; Majós, N.; Bonnal, S.; Martínez, C.; Castelo, R.; Guigó, R.; Bilbao, D.; Valcárcel, J. Regulation of Fas Alternative Splicing by Antagonistic Effects of TIA-1 and PTB on Exon Definition. Mol. Cell 2005, 19 (4), 475–484. https://doi.org/10.1016/j.molcel.2005.06.015. (30) Joshi, G. K.; Deitz-Mcelyea, S.; Johnson, M.; Mali, S.; Korc, M.; Sardar, R. Highly Specific Plasmonic Biosensors for Ultrasensitive MicroRNA Detection in Plasma from Pancreatic Cancer Patients. 2014. https://doi.org/10.1021/nl503220s. (31) Šípová, H.; Homola, J. Surface Plasmon Resonance Sensing of Nucleic Acids: A Review. Analytica Chimica Acta. 2013, pp 9– 23. https://doi.org/10.1016/j.aca.2012.12.040. (32) Huertas, C. S.; Domínguez-Zotes, S.; Lechuga, L. M. Analysis of Alternative Splicing Events for Cancer Diagnosis Using a Multiplexing Nanophotonic Biosensor. Sci. Rep. 2017, 7, 41368. https://doi.org/10.1038/srep41368. 10 Insert Table of Contents artwork here 11