This is the accepted version of the article: Woloszynska, Magdalena; Le Gall, Sabine; Neyt, Pia; [et al.]. «Histone 2B monoubiquitination complex integrates transcript elongation with RNA process- ing at circadian clock and flowering regulators». Proceedings of the National Academy of Sciences of the United States of America, Vol. 116, Num. 16 (April 2019), p. 8060-8069. DOI 10.1073/pnas.1806541116 This version is avaible at https://ddd.uab.cat/record/221064 under the terms of the license BIOLOGICAL SCIENCES – Plant biology Histone 2B monoubiquitination complex integrates transcript elongation with RNA processing at circadian clock and flowering regulators Magdalena Woloszynskaa,b,1,2, Sabine Le Galla,b,1, Pia Neyta,b, Tommaso M. Boccardia,b, Marion Grasserc, Gernot Längstd, Stijn Aesaerta,b, Griet Coussensa,b, Stijn Dhondta,b, Eveline Van De Slijkea,b, Leonardo Brunoe, Jorge Fung-Ucedaf, Paloma Masf,g, Marc Van Montagua,b, Dirk Inzéa,b, Kristiina Himanena,b,3, Geert De Jaegera,b, Klaus D. Grasserc, and Mieke Van Lijsebettensa,b,4 a Department of Plant Biotechnology and Bioinformatics, Gent University, 9052 Ghent, Belgium; bCenter for Plant Systems Biology, VIB, 9052 Gent, Belgium; cDepartment of Cell Biology and Plant Biochemistry, Biochemistry Centre, University of Regensburg, 93053 Regensburg, Germany; dDepartment for Biochemistry III, Biochemistry Centre, University of Regensburg, 93053 Regensburg, Germany; eDipartimento di Biologia, Ecologia e Scienze della Terra, Università della Calabria, 87036 Arcavacata di Rende, Italy; fCenter for Research in Agricultural Genomics (CRAG), Consortium Consejo Superior de Investigaciones Científicas-Instituto Recerca i Tecnologia Agroalimentaries-Universidad Autonoma de Barcelona-Universidad de Barcelona (CSIC-IRTA-UAB-UB), 08193 Barcelona, Spain; g Consejo Superior de Investigaciones Científicas (CSIC), 08028 Barcelona, Spain. Running title: RNA-binding protein in pre-mRNA and antisense RNA processing 1 Footnotes Author contributions: M.W., S.L.G., M.V.M., K.H., and M.V.L. designed research; M.W., S.L.G., P.N., T.M.B., M.G., S.A., G.C., E.V.D.S., L.B., and J.F.-U. performed research; M.W., S.L.G., P.N., M.G., G.L., S.D., P.M., D.I., G.D.J., K.D.G., and M.V.L. analyzed data; and M.W., S.L.G., G.L., P.M., K.D.G., and M.V.L. wrote the paper. The authors declare no conflict of interest. Data deposition: The RNA-seq data reported in this paper have been deposited in ArrayExpress under accession number E-MATB-6780. 1 These authors contributed equally to this work. 2 Present address: Department of Genetics, Faculty of Biology and Animal Sciences, Wroclaw University of Environmental and Life Sciences, 51-631 Wroclaw, Poland. 3 Present address: Department of Agricultural Sciences, University of Helsinki, 00790 Helsinki, and Department of Biosciences, Viikki Plant Science Centre (ViPS), 00014 University of Helsinki, Finland. 4 To whom correspondence should be addressed. E-mail marc.vanmontagu@ugent.be; mieke.vanlijsebettens@psb.ugent.be This article contains supporting information online at www.pnas.org/. 0000-0001-5576-951X (M.W.), 0000-0001-8849-3812 (S.L.G.), 0000-0003-4494-6677 (P.N.), 0000-0002-7618- 1974 (M.G.), 0000-0002-8232-1179 (G.L.), 0000-0001-8787-7347 (S.A.), 0000-0003-4402-2191 (S.D.), 0000- 0003-2247-2976 (E.V.D.S.), 0000-0001-8260-4729 (L.B.), 0000-0003-3639-8885 (J.F.-U.), 0000-0002-3780- 8041 (P.M.), 0000-0003-4711-5131 (M.V.M.), 0000-0002-3217-8407 (D.I.), 0000-0003-4975-9467 (K.H.), 0000-0001-6558-5669 (G.D.J.), 0000-0002-7080-5520 (K.D.G.), 0000-0002-7632-1463 (M.V.L.) 2 Abstract HISTONE MONOUBIQUITINATION1 (HUB1) and its ortholog HUB2 act in a conserved heterotetrameric complex in the chromatin-mediated transcriptional modulation of developmental programs, such as flowering time, dormancy, and the circadian clock. The KHD1 and SPEN3 proteins were identified as interactors of the HUB1 and HUB2 proteins with in vitro RNA-binding activity. Mutants in SPEN3 and KHD1 had reduced rosette and leaf areas. Strikingly, in spen3 mutants, the flowering time was slightly, but significantly, delayed, as opposed to the early flowering time in the hub1-4 mutant. The mutant phenotypes in biomass and flowering time suggested a deregulation of their respective regulatory genes CIRCADIAN CLOCK-ASSOCIATED1 (CCA1) and FLOWERING LOCUS C (FLC) that are known targets of the HUB1-mediated histone H2B monoubiquitination (H2Bub). Indeed, in the spen3-1 and hub1-4 mutants, the circadian clock period was shortened as observed by luciferase reporter assays, the levels of the CCA1 and CCA1 splice forms were altered, and the CCA1 expression and H2Bub levels were reduced. In the spen3-1 mutant, the delay in flowering time was correlated with an enhanced FLC expression, possibly due to an increased distal versus proximal ratio of its antisense COOLAIR transcript. Together with transcriptomic and double-mutant analyses, our data revealed that the HUB1 interaction with SPEN3 links H2Bub during transcript elongation with pre-mRNA processing at CCA1. Furthermore, the presence of an intact HUB1 at the FLC is required for SPEN3 function in the formation of the FLC-derived antisense COOLAIR transcripts. Key words: RNA-binding protein, KH domain, RRM domain, H2Bub, HUB1 interactome 3 Significance statement In eukaryotes, the genomic DNA is organized in chromatin that consists of nucleosomal units formed by histone proteins. The accessibility of genes for RNA polymerase II transcription by the dynamic modification of histone tails during the transcript elongation phase is emerging as an important regulatory mechanism. Here, we show that RNA-binding proteins together with the conserved HUB1-HUB2 complex that mediates histone H2B monoubiquitination at the circadian clock and flowering time-regulatory genes during transcript elongation are required for the processing of their pre-mRNA respectively antisense RNA. 4 \body In eukaryotic cells, the genomic DNA is organized in nucleosomes that consist of 146-bp- long DNA wrapped around an octamer of the “core” histone dimers of H2A, H2B, H3, and H4 (1), whereas linker DNA and histone H1 connect adjacent nucleosomes. The chromatin structure is highly dynamic, with nucleosomal histone tail modifications, such as methylation, acetylation, and ubiquitination, that regulate the DNA availability to the RNA polymerase II (RNAPII) transcription. The major chromatin state for active genes in Arabidopsis thaliana is determined by histone H2B monoubiquitination (H2Bub), histone H3 acetylation, and methylation (2). H2Bub is absent from the Arabidopsis promoter regions, peaks at the gene bodies, and is required for maximal gene expression levels, implying that this histone modification is specifically linked with transcript elongation (3-6). In yeast, the E3 ubiquitin ligase Bre1 and the E2-conjugating enzyme Rad6 form a complex that catalyzes the H2B- K123 monoubiquitination (7, 8). In Arabidopsis, the relatives HUB1 and HUB2 E3 ubiquitin ligases and the UBC1 and UBC2 E2-conjugating enzymes work also together in a complex to monoubiquitinate H2B (9-12). In hub1, hub2, and ubc1 ubc2 double mutants, H2Bub was reduced at the FLC/MADS AFFECTING FLOWERING (MAF) genes, resulting in reduced FLC/MAF gene expression levels and early flowering (11-13). Monoubiquitinated H2B associated specifically with the gene body of the FLC clade genes and was necessary for enhancement of H3K4me3 and H3K36me2 and transcriptional activation in the FLC/MAF chromatin. Strikingly, the gene expression levels of FLC and relatives were also reduced in the Arabidopsis sup32/ubp26 deubiquitination mutants that were early flowering. The accumulated H2bub marks at the FLC led to a depletion of the activating H3K36me3 marks and an increase in repressive H3K27me3 marks, indicating that both H2B monoubiquitination and deubiquitylation and their steady state are critical in the deposition of other activating 5 histone marks during transcript elongation and in the proper gene activation (14), as also demonstrated in the yeast Ubp8 deubiquitylation mutant (15). Proteins interacting with the H2Bub machinery might represent regulators of H2Bub dynamics, transcript elongation efficiency, target gene specificity, or might identify a link to pre-mRNA processing or upstream signaling. In human, H2B deubiquitylation enzymes are required for efficient cotranscriptional pre-mRNA splicing (16, 17), whereas in yeast, H2B monoubiquitination and deubiquitylation enzymes genetically interact with the Npl3 SR-like protein in splicing (18). To further elucidate the H2Bub regulation and function in plants, we purified interacting proteins with HUB1 and HUB2 as baits and detected previously uncharacterized RNA-binding motif-containing proteins. SPEN3 and KHD1 bound RNA in an in vitro assay and their respective mutants showed circadian clock and flowering time phenotypes, two pathways that are also targeted by the HUB1/HUB2 complex activity. SPEN3 functioned in pre-mRNA processing at the CCA1 regulatory gene in concert with HUB1/HUB2-mediated H2Bub and in antisense COOLAIR transcript formation at the FLC regulatory gene, independently of H2Bub. Results and Discussion KHD1 and SPEN3 identified as core components of the HUB1/HUB2 complex. To detect HUB1-associated proteins that might represent upstream regulators, cofactors, or components of the core complex, several tandem affinity purifications (TAPs) were carried out with Arabidopsis cell cultures overexpressing N-terminally tagged full-length HUB1 and HUB2 proteins and a modified HUB1, with two point mutations introduced into the RING domain by replacing two cysteines by serines (C826S and C829S), resulting in HUB1pm, similarly to 6 the yBre1 mutations (19). With HUB1 as bait, only HUB2 and the RNA-binding domain- containing SPEN3 and KHD1 were retained in several TAPs (Table 1, Supplemental Data S1). The identified protein list was filtered for background proteins, according to standard procedures (20) and only the IDs were kept represented by two significant peptides in at least two independent TAP purifications. Reverse TAP with either HUB2 or SPEN3 as bait purified HUB1, KHD1, and SPEN3, or HUB1, HUB2, and KHD1 proteins, respectively. Hence, the SPEN3 and KHD1 proteins are part of the HUB1-HUB2 complex interactome. Upon introduction of point mutations into the RING domain of HUB1 (HUB1pm), no HUB2, SPEN3, and KHD1 interactions could be detected (Table 1), suggesting that the RING domain could be essential for the heterodimerization and formation of the complex with other interactors. A pairwise yeast two-hybrid system (Y2H) corroborated strong HUB1/HUB1 and HUB1/HUB2, but not HUB2/HUB2 interactions as already reported (13). Interestingly, a strong pairwise interaction between HUB1 and SPEN3 was demonstrated at 3 mM and 10 mM 3-AT (SI Appendix, Fig. S1 A and B) and required both N- and C-termini of SPEN3 (SI Appendix, Fig. S1 B, C, and D). The N-terminal SPEN3 fragment weakly interacted with HUB1 as shown at 3 mM 3-AT, whereas the C-terminal SPEN3 fragment did not at all interact with HUB1 (SI Appendix, Fig. S1 B, C, and D). Interactions with KHD1 could not be tested due to self-activation of the fusion protein. In conclusion, two RNA-binding domain proteins, SPEN3 and KHD1, were identified by TAP as integral part of the HUB1/HUB2 core complex and a strong and direct interaction for SPEN3 with HUB1 was confirmed by Y2H. The fusion constructs GFP-SPEN3 and GFP-KHD1 were transiently expressed upon infiltration of Nicotiana benthamiana (tobacco) leaves with agrobacteria and stably expressed in Arabidopsis lines obtained by floral dip. The GFP-SPEN3 fluorescence was located 7 exclusively in the nucleus, excluding the nucleolus, of leaf (Fig. 1A) and primary root (Fig. 1B) epidermis cells, whereas the GFP-KHD1 fluorescence occurred in the nucleus, with the exclusion of the nucleolus, in the leaf (Fig. 1C) and root (Fig. 1D) epidermis, in the cytoplasm around the nucleus, and near the plasmalemma, likewise to the GFP-HUB1 and GFP-HUB2 localization (10). The SPEN3 and KHD1 proteins contain RNA-binding domains. The SPEN3 and KHD1 interactors of the HUB1/HUB2 complex contain widely spread protein domains involved in RNA binding in eukaryotes, i.e. the RNA recognition motif (RRM) and the K homology (KH) motif, respectively (21) The SPEN3 gene (At1g27750) is 4326 nucleotides long, contains eight exons, and encodes a 117.47-kDa protein. Domain search performed with the InterProScan tool (http://www.ebi.ac.uk/interpro) revealed the presence of a conserved RRM and a Spen Paralog and Ortholog C-terminal (SPOC) protein-binding domain (SI Appendix, Fig. S2A), similarly to the mammalian Split Ends (Spen) proteins that function in transcriptional regulation, posttranscriptional processing, and nuclear export of mRNA (22). In human, direct interaction of the Spen proteins with histone modification enzymes has been demonstrated, namely histone deacetylases (23, 24) and histone methyltransferase (25), some of the mammalian Spen proteins regulate gene expression via the control of splicing activity (26-28). In the Arabidopsis genome, only three Spen proteins were retrieved that combined SPOC with one or more RRM motif(s), i.e. the SPEN3 protein studied in this work, with one RRM, the SPEN2 (AT4G12640) protein with two RRMs with a unknown function, because the knockout and overexpressing lines had no apparent phenotype (29), and the flowering time regulator FPA with three RRMs that controls alternative splicing and polyadenylation of antisense transcripts of the floral repressor FLC (30). The role in flowering time regulation has also been suggested in rice (Oryza sativa) for the Spen protein encoded by the OsRRMh 8 gene with two RRM motifs, as indicated by the flowering time delay in the knockdown line (31). Spen proteins with one-, two- or three RRM domains occur throughout eudicot species. The Spen protein cladogram of five selected eudicots created with the MEGAX bioinformatics tool showed clustering of all single RRM domain Spen proteins, including SPEN3 (SI Appendix, Fig. S2A). The KHD1 gene (At1g51580) is 2491 nucleotides long, consists of seven exons, and encodes a 67.12-kDa protein. The InterProScan analysis identified five KH domains in the KHD1 protein, ranging from 70 to 77 amino acids (SI Appendix, Fig. S2B). KH motifs were found in proteins of archeae, bacteria, and eucaryota.with five conserved K homology (KH) domains ranging from 70 to 77 amino acids (SI Appendix, Fig. S2B). In Arabidopsis, 37 unique AGI codes of proteins containing 1 to 5 KH domains were present. All proteins with three or more KH motifs (including KHD1) had no other domains. Proteins containing only one or two KH motifs frequently combined up to eight different domains. A cladogram was generated of 12 proteins with three, four, or five KH domains (SI Appendix, Fig. S2B). KHD1 grouped with HUA ENHANCER4 (HEN4; At5g64390) that facilitates the processing of AGAMOUS pre-mRNA (32) and REGULATOR OF CBF GENE EXPRESSION 3/SHINY1/HIGH OSMOTIC STRESS GENE EXPRESSION 5 (RCF3/SHI1/HOS5; At5g53060) that is involved in pre-mRNA processing (33). KH proteins with three KH motifs clustered together, among which FLOWERING LOCUS KH DOMAIN (FLK) and PEPPER (PEP), a FLC repressor and activator, respectively (34, 35). The in planta mRNA-binding proteome datasets (21, 36-38) that represent RNA interactors in a number of tissues and developmental stages contained KHD1 (21, 37), suggesting a role in poly(A) RNA-related processes. These datasets do not cover all RNA interactors, possibly the reason for the absence of SPEN3 or hinting at pre-mRNA or noncoding RNA rather than poly(A) RNA binding of SPEN3. 9 SPEN3 and KHD1 bind RNA. To test the in vitro RNA-binding capabilities of the SPEN3 protein, its RRM-containing region was selected because the production of the full-length protein in Escherichia coli proved unsuccessful. A GST-RRM-SPEN3 fusion was expressed and purified by affinity chromatography (Fig. 1 E and F). The RNA binding of the purified GST-RRM-SPEN3 was examined by Electrophoretic Mobility Shift Assays (EMSAs). Incubating increasing concentrations of the recombinant protein with the fluorescently labeled single-stranded (ss)RNA, followed by EMSA analysis, revealed a dose-dependent interaction of GST-RRM-SPEN3 with the RNA probe, starting at a protein concentration of 0.2 µM (Fig. 1G). To test the preference of the protein for RNA, competition experiments with increasing amounts of unlabeled ssRNA or ssDNA were carried out (Fig. 1H). The protein-RNA complex formed at a fixed concentration of GST-RRM-SPEN3 (3 µM) and a constant amount of labeled RNA probe is competed by the addition of a 50-fold excess of unlabeled ssRNA. In contrast, protein/RNA complex formation was hardly affected by the addition of a 50-fold excess of unlabeled ssDNA, demonstrating that the GST-RRM-SPEN3 displays a preference for ssRNA over ssDNA. To test the RNA-binding properties of KHD1, we expressed the region comprising the two N-terminal KH domains, as a 6×His-tagged fusion protein, designated 6×His-KHD1- N, in E. coli (Fig. 1 E and F), because the production of the full-length protein was also unsuccessful. The recombinant protein was purified by metal-chelate affinity chromatography (Fig. 1F). In EMSAs, a dose-dependent interaction with ssRNA was observed, starting at a protein concentration of 0.5 µM (Fig. 1I). In a competition assay (Fig. 1J), the complex formed by a fixed amount of 6×His-KHD1-N (3 µM) and the labeled ssRNA probe was efficiently competed by the addition of excess amounts of unlabeled ssRNA, whereas the 10 addition of ssDNA did not affect the detected protein-RNA complex. Therefore, 6×His- KHD1-N preferentially interacts with the ssRNA probe. The protein-nucleic acid interactions were additionally analyzed by means of Microscale Thermophoresis (MST). MST is an in-solution method to detect molecular interactions, due to the changes in thermophoretic mobility or fluorescence of interacting molecules, in a microscopic temperature gradient (39). Increasing concentrations of GST- RRM-SPEN3 resulted in enhanced binding to ssRNA, visualized as bound fraction (SI Appendix, Fig. S3A), whereas no binding occurred to ssDNA. Due to the weak RNA-binding activity, no complete binding of the SPEN3 protein to the nucleic acids was observed at the highest protein concentration used. Because of the variance in the three biological replicates and the lack of binding saturation, no exact KD affinity values could be derived, but the preferential binding of SPEN3 to ssRNA was evident from the sloping curve for ssRNA (SI Appendix, Fig. S3A) as compared to the absence of slope for ssDNA, hence confirming the EMSA data. The qualitative analysis of 6×His-KHD1-N binding to ssRNA and ssDNA by MST revealed a complex pattern of changes in the thermophoretic mobility of the interacting molecules (for details, see SI Appendix, Fig. S3), but the experiment supports the EMSA results, showing an enhanced binding to ssRNA relative to ssDNA (SI Appendix, Fig. S3B). Thus, EMSA and MST experiments showed that SPEN3 and KHD1 interact preferentially with ssRNA when compared with ssDNA. RNA-binding proteins frequently contain more than one RNA-binding region (i.e., additional KH domains in the case of KHD1), possibly increasing the RNA-binding affinity (40). Hence, the relatively low affinity for ssRNA observed in our assays relates most probably to the use for technical reasons of truncated SPEN3 and KHD1 proteins (Fig. 1E). 11 Growth and flowering time in spen3, khd1, and hub1/2 mutants. The expressions of HUB1, KHD1, and SPEN3 in the shoot apex and the root apical meristem were analyzed with whole-mount, multiprobe in situ hybridizations of 4-day-old seedlings grown in vitro with sequence-specific probes for SPEN3, KHD1, and HUB1 genes. A red fluorochrome label was used for SPEN3, a green one for KHD1, and a blue one for HUB1. Interestingly, HUB1, SPEN3, and KHD1 coexpressed strongly in the shoot apical meristem, visible as the white- pink complementary color of green, red, and blue (SI Appendix, Fig. S4A). The SPEN3 and HUB1 genes were coexpressed in cotelydons and KHD1 and HUB1 in leaf primordia and vascular tissue. In primary roots, the three genes did not coexpress, but SPEN3 and KHD1 coexpressed in the cortex, stele, and root apical meristem and SPEN3 with HUB1 in the epidermal cell layers (SI Appendix, Fig. S4B). The whole-mount in situ expression patterns of HUB1 correlated with previously described phenotypes in hub1 leaf, root, and flowering time (9, 13). Hence, flowering time and leaf and root growth were measured in spen3, khd1, and hub1 single and double mutants and in overexpression lines. The SALK_025388 and GABI_626H01 lines with T-DNA insertions into exon 2 of At1g27750 (SPEN3) with severely reduced SPEN3 transcript levels were designated spen3-1 and spen3-3, respectively (Fig. 2 A and B). The SALK_046957 line with T-DNA insertion into the promoter, next to the 5’ untranslated region (UTR) region of At1g51580 (KHD1) with slightly, but significantly, reduced KHD1 transcript levels, was designated khd1-1 (Fig. 2 A and B); the SAIL_1285_H03C1 line, with T-DNA insertion into exon 3 of At1g51580 with severely reduced KHD1 transcript levels, was designated khd1-3 (Fig. 2 A and B). Seedlings, 19 days after germination (DAG), grown in soil, showed slightly reduced rosette growth in spen3-1, khd1-1, and khd1-3, and early flowering in hub1-4 and the double mutants, spen3-1 hub1-4 and khd1-1 hub1-4 when compared to the wild type (Columbia-0 accession [Col-0]) (Fig. 2C), reduced rosette growth was also observed in the spen3-3 allele 12 (SI Appendix, Fig. S4C). Flowering time was determined in four independent biological repeats in a randomization experimental set up in soil under standardized growth room conditions. The genotypes were grouped by statistical analysis of variance (ANOVA). Strikingly, in spen3-1, the flowering time was significantly delayed by 2 days (Fig. 2D), which is an opposite phenotype as compared to hub1-4 that flowers 4 days earlier as compared to the wild type (Fig. 2D), as shown previously (13); the khd1-1 and khd1-3 mutants had a wild-type flowering time. Also in the spen3-3 allele, a small, but significant, delay in flowering time was observed in two independent biological repeat experiments under similar growth room conditions (SI Appendix, Fig. S4D). A second T-DNA insertion in the spen3-3 mutant did not affect the gene expression levels of its adjacent genes, At1g77920 and At1g77930 (SI Appendix, Fig. S5), thus, the delay in flowering time in spen3-3 was caused by the T-DNA insertion in exon 2 of the SPEN3 gene. Interestingly, the spen3-1 hub1-4 and khd1-1 hub1-4 double mutants were flowering as early as the hub1-4 parental (Fig. 2D), suggesting that HUB1 is epistatic to SPEN3 and KHD1 in flowering time regulation. The small, but significant, delay in flowering time in spen3-1, the normal flowering time in khd1- 1, and the earlier flowering in hub1-4 were also shown in an automated weighing, imaging and watering phenotyping platform (WIWAM XY; www.wiwam.com) (Fig. 2E). The overexpression lines of HUB1, SPEN3, and KHD1 included in this experiment had normal flowering times (Fig. 2E). The number of leaves at bolting, which is tightly correlated with flowering time (41, 42), was lower in the early flowering genotypes and slightly higher in spen3-1 and spen3-3 than that in the wild type, as expected (SI Appendix, Fig. S4E-G). In conclusion, both HUB1/HUB2 and SPEN3 regulate flowering time, but in an opposite manner, suggesting that SPEN3 might also function in the transcriptional control of the flowering time regulator FLC, which is targeted by HUB1/HUB2 for H2Bub activity (13). 13 Seedling growth of the mutant and overexpression lines was monitored in soil with the automated WIWAM platform. At 23 days after sowing (DAS), the projected rosette area (all green area from photographed rosette) was measured (Fig. 2F) and stockiness (leaf shape indicator), and compactness (projected rosette area/area of convex hull) were calculated (SI Appendix, Fig. S4 H and I). The projected rosette area was reduced in spen3-1 and khd1-1 by 16% and 17%, respectively, whereas it was similar to that of the wild type in hub1-4 and hub2-1 (Fig. 2F). In hub1-4 and hub2-1, stockiness was reduced (SI Appendix, Fig. S4H) and in spen3-1 compactness was reduced (SI Appendix, Fig. S4I). In 21-day-old in vitro grown plants, the individual leaf area was reduced in the hub1-4, hub2-1, khd1-1, and spen3-1 mutants (Fig 2G), corresponding with the data obtained in soil for spen3-1 and khd1-1, but differing for those for hub1-4 and hub2-1 (Fig. 2F; SI Appendix, Fig. S4 H and I), possibly hinting at a sensitivity of the hub mutants to the more stressful in vitro conditions. The leaf number decreased in the in vitro-grown hub1-4 and hub2-1 seedlings, but was normal in spen3-1 and khd1-1 (Fig. 2G), correlating with their flowering time measured in soil (Fig. 2 D and E). Leaf series of 26 DAG seedlings of the randomized jiffy-grown experiment at bolting (for flowering time and leaf number, see Fig. 2D and S4E), showed that the spen3-1 hub1-4 and khd1-1 hub1-4 double mutants had a smaller leaf size and a narrower shape than those of the hub1-4 parental under these conditions (SI Appendix, Fig. S4J), suggesting that HUB1 is also epistatic to SPEN3 and KHD1 for these parameters. The primary root length was reduced in all genotypes, except in hub1-4 (SI Appendix, Fig. S6A) which correlated with a reduced primary root meristem size (SI Appendix, Fig. S6 B and C), hence, indicating that mutation and overexpression of SPEN3 and KHD1 affect root growth by cell proliferation. Transcriptomes of spen3, khd1, and hub1 mutants. RNA deep-sequencing was done on hub1-4, khd1-1, spen3-1, and Col-0 total RNA prepared from shoot apices. The data were 14 analyzed for differentially expressed genes (DEGs), down-regulated with log2 fold change (FC) ≤-0.5 and up-regulated with log2 fold change (FC) ≥ 0.5 (P < 0.05) (Fig. 3A). More than 40% and almost 50% of the DEGs in hub1-4 and khd1-1, respectively, were common, suggesting that KHD1 might act together with HUB1 in the transcriptional regulation of a large number of genes. In contrast, only approximately 5.5% and 16% of the DEGs in hub1-4 and spen3-1 were common, indicating that SPEN3 and HUB1 coregulate limited, but specific classes of genes, possibly related to functions of the tissue used for RNA-seq (such as shoot apices) and that SPEN3 controls the expression of a number of other genes via a mechanism that is unrelated to HUB1-mediated H2Bub. Very few DEGs occurred in all three mutants, hinting at a limited combined activity of KHD1, SPEN3, and HUB1 in transcriptional regulation (SI Appendix, Table S1). Substantial portions of the DEGs were unique to each mutant, i.e. 44% in khd1-1, 52% in hub1-4, and 63% in spen3-1, implying additional specific roles for HUB1, KHD1, and SPEN1. Next, gene ontology (GO) classes were identified among down- or upregulated genes common for all three or two mutants or unique for only one mutant to define the molecular functions and biological processes affected (SI Appendix, Table S2). Genes downregulated in all three mutants and in the two mutants hub1-4 and spen3-1 fall into the same GO classes coding for cell cycle proteins, histone kinases, and ribosomal proteins. The detailed analysis of cell cycle-related genes commonly downregulated in hub1-4 and spen3-1 revealed several genes crucial for cell division: KNOLLE, HINKEL, AURORA2, AURORA3, CYCB1;4, CDKB1;2, RSW7, BUBR1, and POK2, confirming specialized function for the HUB1-SPEN3 interaction. Genes downregulated in hub1-4 and khd1-1 encode proteins related to cell cycle, DNA replication, response to stimuli, or involved in secondary metabolism. The hub1-4– specific downregulated genes grouped mainly into the GO classes related to defense and 15 stress response or cell wall organization or biosynthesis, but included also the GO flower development, containing the flowering repressors FLC, FLM, SMZ, and BOP2. Many khd1-1 unique downregulated genes clustered into the classes organ morphogenesis, shoot and leaf development, reproductive structure development (growth regulator GRF9, phase transition regulator SPL15, and RBR1 and VIM3 repressors of flowering activator FWA), or were involved in cell cycle or nucleic acid metabolism. The spen3-1-uniquely downregulated genes related to the circadian clock and flowering time (PRR3, PRR5, ELF3, FKF1, and SRR1). In summary, analysis of downregulated genes showed that HUB1, KHD1, and SPEN3 are involved in common pathways, but might only occasionally regulate the same target genes in a complex. As the number of genes commonly upregulated in all three mutants was too low for a reliable GO analysis, i.e. 38 genes, we compared the hub1-4 mutant individually with khd1-1 or spen3-1 (SI Appendix, Table S2). Both comparisons identified genes involved mainly in programmed cell death, regulatory processes, and response to different stimuli. Among the overlapping genes between the hub1-4 and khd1-1 transcriptomes, additional categories were detected, such as tropism, growth, cell wall, transmembrane transport, and response to hormones. Genes upregulated only in individual mutants clustered predominantly to the response to stimulus or signaling classes, but GO categories specific for only one mutant and highly enriched were also identified: circadian clock-related genes in hub1-4 (log2 enrichment 2.53) and growth-related genes in khd1-1 (log2 enrichment 1.77). SPEN3 and HUB1 regulate CCA1 gene expression through H2Bub and pre-mRNA processing. The H2Bub at the clock regulator CCA1, a known HUB1 target (4), was determined in the khd1-1 and spen3-1 mutants to investigate whether it could explain the reduced CCA1 expression in mutant seedlings (Fig. 3B) and whether the HUB1/HUB2- 16 mediated histone H2B monoubiquitylase activity could be affected by KHD1 and SPEN3 during transcript elongation. Chromatin immunoprecipitation with H2Bub antibodies followed by a quantitative polymerase chain reaction (qPCR) with primers annealing to the promoter and coding regions of the CCA1 gene (Fig. 3C) revealed that H2Bub was absent from the promoter and peaked centrally in the gene body in the wild type (Fig. 3C), but was very low over the whole gene in the hub1-4 mutant (Fig. 3C), characteristically for HUB1/HUB2 target genes (4). In the spen3-1 mutant, the reduced gene expression correlated with a significant decrease in H2Bub at the 5’ and central part of the CCA1 gene, suggesting that SPEN3 affects the HUB1-mediated H2Bub activity at the CCA1 locus (Fig. 3C). In the knock-down allele, khd1-1, the H2Bub at the CCA1 gene is reduced, but not significantly (Fig.3C); hence, it is unclear whether KHD1 functions in HUB1-mediated H2Bub at the CCA1 locus. The downregulation of the CCA1 gene expression in spen3-1 and khd1-1 as well as in hub1-4 prompted us to investigate circadian rhythms by means of reporter lines expressing the LUCIFERASE (LUC) fused to the promoters of CCA1 and TIMING OF CHLOROPHYLL A/B (CAB) EXPRESSION 1 (TOC1) (pCCA1::LUC and pTOC1::LUC) that were introgressed into the spen3-1, khd1-1, and hub1-4 mutants. Bioluminescence analysis showed that for both reporters and in hub1-4 and spen3-1, the amplitude of the rhythms was not altered, but the circadian period was significantly shorter than that of wild type plants (Fig. 4). In hub1-4 mutant plants, the advanced phase and short period were already detected from the second day under LL, whereas in the spen1-1 mutant plants, these phenotypes were visible from the third day. The observed period shortening was not very severe (approximately 1 h in hub1-4 and spen1-1), but it was reproducible in the biological triplicates (with 12 independent seedlings per genotype and replicate) and statistically significant. The results were fully consistent among the triplicates in terms of period, phase, and amplitude, confirming the reliability of 17 the conclusions. In khd1-1, the circadian period was not affected, but the amplitude of pTOC1::LUC was significantly reduced (Fig. 4). The short circadian period in hub1-4 and spen3-1 suggests that the loss of the HUB1 and SPEN3 activities makes the clock run faster than in wild-type plants. Subsequently, the alternative splicing of CCA1 was analyzed in the hub1-4, spen3-1, and khd1-1 mutants by qPCR measurements of the relative transcript levels of the CCA1α and CCA1β splice forms over a time course of 48 h under continuous light and under control (21˚C) and cold (6˚C) conditions (Fig. 3D) (43, 44). In CCA1α, the fourth intron was spliced, whereas in CCA1β the fourth intron was retained (Fig. 3C). The Col-0 wild type showed rhythmic patterns for both splice forms at a control temperature with a peak at the circadian time point CT28 (Fig. 3D). In the cold, Col-0 loses the CT28 peak and the relative levels of CCA1α and CCA1β are reduced. In the hub1-4, khd1-1, and spen3-1 mutants, under control conditions, the CCA1α splice variant peak shifts toward the time point CT24 (Fig. 3D), which correlates with the shorter circadian period observed with the LUC reporter lines for hub1-4 and spen3-1 (Fig. 4). Interestingly, under control conditions, spen3-1 has reduced CCA1α transcript levels, which might reveal a positive role for SPEN3 in the processing of the CCA1 pre-mRNA at the fourth intron. In contrast, in hub1-4, the CCA1α levels had increased, suggesting a regulatory effect of H2Bub on transcript processing. No peak for the CCA1β splice variant was observed in any of the mutants contrary to the Col-0 control with a clear peak, indicating that the intron retention mechanism necessary for the formation of the β transcript is affected in the mutants. Under cold conditions, Col-0 and the three mutants do not differ, because the rhythmic patterns of the CCA1 and CCA1 transcript levels were absent and all peaks were lost. The alternative splicing is regulated by RNA-binding proteins, chromatin structure, histone modifications, and the RNA polymerase II elongation rate (45). Slow transcript elongation expands and fast transcript elongation compresses the “window of 18 opportunity” for recognition of upstream splice sites, thereby decreasing or increasing intron retention (46). Moreover, alternatively spliced introns are removed more slowly than constitutive introns and, therefore, their splicing requires a longer transcript elongation time. In summary, at control temperature, the general CCA1 transcript level is reduced in hub1-4 but the level of the CCA1 splice form is increased and that of the CCA1 splice form is reduced, indicating that the transcript elongation rate might be slowed down by the reduced H2Bub, enhancing splicing of intron 4 and shifting the CCA1/CCA1 balance toward CCA1α. In spen3-1, the H2Bub at CCA1 is reduced in the first part of the coding region until intron 4, where the intron retention/splicing occurs, suggesting that SPEN3 plays a role in the establishment of a H2Bub maximum at the splice site that might function as a signal for splice site selection. Consequently, in spen3-1, a decrease in H2Bub at the intron 4 splice site might slow down the transcript elongation rate and retard the splicing, which might explain the reduced total CCA1, CCA1, and CCA1 transcript levels without shift in the CCA1/CCA1 balance. In yeast, H2Bub facilitates the early spliceosome assembly at certain genes (47). Our data suggest that SPEN3 might provide an important link between the splicing machinery and the HUB1-mediated H2Bub and that SPEN3 might be an adaptor protein between the histone mark H2Bub and the splicing factors. Moreover, the RRM domain of SPEN3 might bind the nascent ssRNA and its SPOC domain might associate with proteins of the spliceosome or the transcript elongation complex. Indeed, the RNA polymerase II transcript elongation complex interacts with the mRNA-splicing factors (48). We hypothesize that the interaction between the HUB1-mediated H2Bub and SPEN3 regulates the coupling of transcript elongation and the pre-mRNA processing at CCA1, identifying an until now unknown transcription regulation mechanism in plants. 19 SPEN3 function in FLC-derived antisense COOLAIR transcript formation. The flowering time repressor gene FLC (Fig. 5A) is also a known target of the HUB1-mediated H2bub that promotes FLC transcription (13, 49). In the hub1-4 mutant, the downregulation of the FLC gene expression correlated with reduced H2Bub levels (Fig. 5B-C) and early flowering time (Fig. 2 C-E). In khd1-1, FLC was downregulated and in spen3-1, FLC was upregulated (Fig. 5B), however, the H2Bub level at FLC was normal in both mutants (Fig. 5C). Thus, SPEN3 and KHD1 affect FLC gene expression through a mechanism that is not related to HUB1- mediated activity in H2Bub. The FLC transcription factor prevents flowering by repression of the floral pathway integrator genes that activate the transition to flowering and the FLC expression level quantitatively correlates with the time to flower (50, 51). Several regulatory pathways regulate the FLC expression at ambient temperature, i.e., the FRIGIDA (FRI) pathway that triggers the FLC expression through recruitment of activating chromatin-modifying complexes, promotion of its 5’ cap cotranscriptional processing, and the autonomous pathway that downregulates the FLC expression through an antisense RNA-mediated chromatin silencing mechanism. Indeed, noncoding FLC antisense transcripts, designated COOLAIR, might fully encompass the FLC gene or be shorter depending on the use of distal or proximal splice and polyadenylation sites at the FLC (Fig. 5A) (30, 52, 53). Splicing and 3’ processing at the proximal site is promoted by the core spliceosome component and pre-mRNA- processing-splicing factor 8 (PRP8), respectively, and by components of the autonomous pathway, including the RNA-binding proteins, FCA and FPA and the 3’ processing factors that trigger histone demethylation by FLOWERING LOCUS D (FLD) at the FLC gene body, which suppresses the FLC expression (see model Fig. 5E; 53, 54). In the spen3 alleles, the FLC expression is enhanced and the flowering time is delayed, which are phenotypes similar to those in the autonomous pathway mutants or the 20 prp8 spliceosome-defective mutant affecting the COOLAIR proximal site selection/processing. Hence, we investigated the FLC antisense COOLAIR transcripts by using total RNA of spen3-1, hub1-4, and khd1-1 mutant seedlings by means of qPCR in four biological replicates (Fig. 5D). In ambient temperature, the FLC expression was reduced in hub1-4 and khd1-1 and increased in spen3-1, confirming the results shown in Fig. 5B. In the hub1-4 and khd1-1 mutants, the proximal and distal COOLAIR transcript levels and their ratios were comparable to those in the Col-0 control. However, in spen3-1, significantly increased distal and reduced proximal transcript levels and altered distal/proximal ratios were observed (Fig. 5D). Thus, SPEN3 might inhibit the COOLAIR distal or promote the proximal transcript formation. Distal transcript secondary structure correlated with the FLC expression and flowering time in natural accessions (55, 56). Hence, it would be interesting to investigate whether SPEN3 affects the secondary structure or stability of distal transcripts in addition to a postulated role in distal/proximal site selection. In our qPCR experiment (Fig. 5D), the 7 days of cold treatment only slightly increased the proximal and distal COOLAIR transcripts in all genotypes, including the Col-0 control, and might have been too short for mimicking vernalization, usually 30 days of cold. Hence, as a consequence, no COOLAIR transcripts were induced under the cold conditions used in contrast to the vernalization conditions reported previously (57). However, the FLC expression was significantly reduced in all mutants upon the 7 days of cold treatment (Fig. 5D), indicating that the applied cold conditions did induce the FLC repression. The Col-0 background contains a mutated fri allele that is responsible for a weak FLC expression (58) and for the attenuation of the late flowering time phenotype in prp8 or autonomous pathway mutants (53, 54), a possible reason for the mild, but significant, delay in flowering time in the spen3-1 allele. 21 In conclusion, our data link the increase in FLC transcript in spen3-1 to a function in distal or proximal antisense COOLAIR formation without effect on the H2Bub level at the FLC, whereas the decrease in the FLC transcript in hub1-4 is only associated with a reduced H2Bub at the FLC. The reduced FLC expression in khd1-1 does not result in a flowering time phenotype and does not correspond to altered COOLAIR splice variant ratios or H2Bub levels. The delayed flowering time in spen3-1 and earlier flowering in the hub1 mutants was correlated with increased and decreased FLC expression levels, respectively. In the spen3-1 mutant, an increased distal antisense COOLAIR transcript and a distal/proximal COOLAIR ratio indicate that SPEN3 plays a role in COOLAIR polyadenylation or splicing to control the sense FLC transcript level and that it acts antagonistically to HUB1 in the FLC regulation. A number of flowering time regulators with RNA-binding capacity, such as FPA and FCA (RRM domain), and FLK and PEP (KH-domain) have been identified and are part of a regulatory loop in which FPA and FCA independently regulate 3’ end formation of antisense COOLAIR RNA at the FLC locus, triggering the FLD demethylation of H3K4me2, with a repressed chromatin state as a consequence (59). FLK and PEP have an antagonistic effect on the FLC expression, but their action mechanisms are unknown (35). They interact with the KH proteins HEN4 and HUA1 to form a complex that assists in transcript elongation and facilitates correct splicing (60). The SPOC domain in SPEN3 is important for its copurification with HUB1 and KHD1; hence, SPEN3 might function together with these proteins in the RNA-mediated control of FLC and might represent an antagonistic regulatory loop for the HUB1-mediated H2Bub transcriptional regulation. Both activities might cross- talk with environmental and developmental cues. The early flowering phenotype of the spen3- 1 hub1-4 double mutant together with the molecular data suggests that at FLC the presence of the intact HUB1 complex is required for SPEN3 to function in antisense COOLAIR transcript 22 formation. Thus, SPEN3 represents an, until now, unidentified player requiring HUB1 to regulate FLC expression and flowering time. Conclusion We demonstrated that the HUB1 and HUB2 subunits of the H2B monoubiquitination complex and the RNA-binding proteins, SPEN3 and KHD1, strongly interact. Moreover, SPEN3 is involved in the processing of the pre-mRNA of CCA1 and in the formation of antisense COOLAIR at FLC, key regulators of the circadian clock and flowering time, respectively. Consequently, these pathways were affected in the spen3 knockout mutants. Our data on CCA1 indicate that during transcript elongation the HUB1/HUB2 complex is a platform for integration of H2Bub deposition activity with pre-mRNA processing and that these processes influence each other reciprocally. Indeed, in the spen3-1 mutant, a reduced H2Bub level at the CCA1 intron 4 correlated with a decrease in CCA1 and CCA1 splice forms, a lowered CCA1 expression, and a shortened circadian clock period. These results are in line with the absence of SPEN3 in the mRNA-binding proteome datasets (21) and with the composition of the RNAPII transcript elongation complex that contains transcript elongation factors, such as PAF and FACT, histone modification enzymes, such as HUB1, Elongator, and histone methyltransferases, but also spliceosome and polyadenylation factors involved in pre-mRNA processing (48). In yeast, Npl3, an arginine-serine–like protein with an RRM motif and a domain enriched in arginine-serine dipeptides, is involved in pre-mRNA processing of predominantly ribosomal proteins in close cooperation with Bre1 (the yeast HUB1 ortholog) and its activity in H2B monoubiquitination during transcription (18). We showed that HUB1 is an anchor point for the SPEN3 RNA-binding protein that functions in transcript formation at specific genes, thus providing insight into the mechanism, players, and target genes in 23 plants. Hence, the integration of transcript elongation and transcript processing occurs through a conserved mechanism in yeast and plants, in which HUB1/Bre1 acts as anchor point for RNA-binding proteins such as SPEN3 with a function in transcript formation. Importantly, SPEN3 is not a homolog of the yeast Npl3 and, moreover, both proteins differ in their protein-interacting domain which might explain different target proteins between plants and yeast. The particular function of SPEN3 related to the formation of the noncoding antisense COOLAIR transcript might be facilitated by the presence of HUB1 at the FLC gene during transcript elongation, while the SPOC domain of SPEN3 might promote interaction with RNA-processing factors. The KHD1 interactor of HUB1 localizes in the nucleus and cytoplasm, binds to ssRNA; its mutant, khd1-1, has decreased leaf and root growth, and a transcriptome that overlapped substantially with that in hub1-4. However, flowering time and circadian clock period were normal in the khd1-1 mutant, coinciding with a normal H2Bub at the FLC and CCA1, a normal splicing at the CCA1 and FLC-derived antisense COOLAIR, despite the reduced expression of FLC and CCA1. The recently studied knockout allele khd1-3 has a normal flowering time as well, indicating that the complete loss-of-function of KHD1 might not affect the FLC biological function and that FLC might not be a target of the KHD1 activity. We postulate that KHD1 might function in mRNA stability, export, or translation rather than in transcript formation, which is supported by its presence in an mRNA-binding interactome (21, 37). Materials and Methods Plant material and growth conditions. The mutant lines and growth conditions are described in SI Materials and Methods. 24 Tandem Affinity Purification and Y2H. Cloning, tandem affinity purification of protein complexes, mass spectrometry and Y2H are described in SI Materials and Methods. RNA-binding assays. Cloning into the E. coli expression vector, protein production in E. coli, EMSA, and MST RNA-binding assays are described in SI Materials and Methods. Confocal Microscopy and Multiprobe in situ Hybridization. Primary roots of 5-day-old transgenic Arabidopsis seedlings, transformed with 35S::GFP::SPEN3 and 35S::GFP::KHD1, were grown vertically under continuous light and analyzed by confocal microscopy (Olympus, FV10 ASW) for fusion protein localization. Multiprobe in situ hybridization is described in SI Materials and Methods. Flowering time determination and shoot and root growth analyses. Flowering time was determined in several biological repeats in soil as the number of days between germination and the initiation of the floral stem elongation at 2 mm height. The number of rosette leaves produced by the apical meristem was recorded at that time (n ≥ 28). Image acquisition and data analyses on growth parameters are described (SI Appendix, SI Materials and Methods). Leaf series were prepared from in vitro-grown plants (IGIS platform) by aligning all the rosette leaves on 1% (w/v) agar plates (n = 10) at day 19. Leaves were photographed and scanned to measure the leaf area by ImageJ 1.41 ((http://rsbweb.nih.gov/ij/). Root growth and root meristem analyses are described in SI Appendix (Materials and Methods). RNA methods. RNA was isolated with the RNeasy Plant Kit (Qiagen) with on-column DNase digestion. The manufacturer’s protocol was modified by including two additional 25 washes of RNeasy spin columns with the RPE buffer. cDNA was synthesized with the iScript cDNA Synthesis Kit (Bio-Rad). Real-time PCR and transcriptome analysis are described in SI Appendix (Materials and Methods). ChIP-qPCR. Chromatin immunoprecipitation-qPCR was done as described (4) with 2-week- old seedlings. For details, see SI Appendix (Materials and Methods). Detection and quantification of polyadenylated COOLAIR. For nonvernalized samples, seedlings were grown under long-day (16 h light/8 h darkness) conditions for 10 days at 21˚C. For vernalization, seedlings were grown till 10 DAG under control conditions (long day, 21˚C), then transferred for 7 days to cold (short day [8 h light, 16 h darkness] at 7˚C), and finally allowed to recover for 7 days under control conditions (long day, 21˚C). Primer pairs used (Fig. 5A) are given in SI Appendix (Table S3. Detection and quantification of alternatively spliced CCA1 over a 48-h time course. Circadian time is defined on free-running conditions (constant light) based on the previous synchronization under light/dark cycles. By convention, the onset of activity of diurnal organisms (lights on under entraining conditions) is defined as Circadian Time 0 (CT0). Seedlings were grown under long-day conditions for 15 days at 21˚C, then transferred at the circadian time point CT0, under continuous light conditions at 21˚C or 6˚C. Seedling pools were harvested in triplicate every 4 h from time point CT0 until CT48. Primer pairs were used to identify the two splice variants, CCA1α and CCA1β (43) (Fig. 3D; SI Appendix, Table S3). Acknowledgements 26 The work was supported by the European Commission Marie Curie Initial Research Training network (FP7-PEOPLE-2013-ITN-607880; acronym, CHIP-ET [to P.M., K.D.G., and M.V.L.], the Spanish Ministry of Economy and Competitiveness, by the Generalitat de Catalunya (AGAUR) and by the Spanish Ministry of Economy and Competitiveness through the “Severo Ochoa Program for Centers of Excellence in R&D” 2016–2019 (to P.M.), and the Deutsche Forschungsgemeinschaft (grant SFB960 to K.D.G.). M.W. was the recipient of a Marie Curie Intra-European fellowship (FP7-PEOPLE-2010-IEF-273068; acronym, LightEr) and S.D. was a postdoctoral fellow of the Research Foundation-Flanders. References 1. Luger K, et al. (1997) Crystal structure of the nucleosome core particle at 2.8 Å resolution. Nature 389(6648), 251-260. 2. Roudier F, et al. (2011) Integrative epigenomic mapping defines four main chromatin states in Arabidopsis. EMBO J 30(10), 1928-1938. 3. Bourbousse C, et al. (2012) Histone H2B monoubiquitination facilitates the rapid modulation of gene expression during Arabidopsis photomorphogenesis. PLoS Genet 8(7), e1002825. 4. Himanen K, et al. (2012) Histone H2B monoubiquitination is required to reach maximal transcript levels of circadian clock genes in Arabidopsis. Plant J 72(2), 249-260. 5. Feng J, Shen W-H (2014) Dynamic regulation and function of histone monoubiquitination in plants. Front Plant Sci 5(3), 83. 6. Van Lijsebettens M, Grasser KD (2014) Transcript elongation factors: shaping transcriptomes after transcript initiation. Trends Plant Sci 19(11), 717-726. 7. Robzyk K, Recht J, Osley MA (2000) Rad6-dependent ubiquitination of histone H2B in 27 yeast. Science 287(5452), 501-504. 8. Wood A, et al. (2003) Bre1, an E3 ubiquitin ligase required for recruitment and substrate selection of Rad6 at a promoter. Mol. Cell 11(1), 267-274. 9. Fleury D, et al. (2007) The Arabidopsis thaliana homolog of yeast BRE1 has a function in cell cycle regulation during early leaf and root growth. Plant Cell 19(2), 417-432. 10. Liu Y, Koornneef M, Soppe WJJ (2007) The absence of histone H2B monoubiquitination in the Arabidopsis hub1 (rdo4) mutant reveals a role for chromatin remodeling in seed dormancy. Plant Cell 19(2), 433-444. 11. Gu X, Jiang D, Wang Y, Bachmair A, He Y (2009) Repression of the floral transition via histone H2B monoubiquitination. Plant J. 57(3), 522-533. 12. Xu L, et al. (2009) The E2 ubiquitin-conjugating enzymes, AtUBC1 and AtUBC2, play redundant roles and are involved in activation of FLC expression and repression of flowering in Arabidopsis thaliana. Plant J 57(2), 279-288. 13. Cao Y, Dai Y, Cui S, Ma L (2008) Histone H2B monoubiquitination in the chromatin of FLOWERING LOCUS C regulates flowering time in Arabidopsis. Plant Cell 20(10), 2586-2602. 14. Schmitz RJ, Tamada Y, Doyle MR, Xiaoyu Z, Amasino RM (2009) Histone H2B deubiquitination is required for transcriptional activation of FLOWERING LOCUS C and for proper control of flowering in Arabidopsis. Plant Physiol 149(2), 1196-1204. 15. Henry KW, et al. (2003) Transcriptional activation via sequential histone H2B ubiquitylation and deubiquitylation, mediated by SAGA-associated Ubp8. Genes Dev. 17(21), 2648-2663. 16. Zhang Z, et al. (2013) USP49 deubiquitinates histone H2B and regulates cotranscriptional pre-mRNA splicing. Genes Dev 27(14), 1581-1595. 28 17. Long, L., Thelen, J.P., Furgason, M., Haj-Yahya, M., Brik, A., Cheng, D., Peng, J., and Yao, T. (2014). The U4/U6 recycling factor SART3 has histone chaperone activity and associates with USP15 to regulate H2B deubiquitination. J. Biol. Chem. 289 (13), 8916- 8930. 18. Moehle EA, Ryan CJ, Krogan NJ, Kress TL, Guthrie C (2012) The yeast SR-like protein Npl3 links chromatin modification to mRNA processing. PLoS Genet 8(11), e1003101. 19. Kim J, Roeder RG (2009) Direct Bre1-Paf1 complex interactions and RING finger- independent Bre1-Rad6 interactions mediate histone H2B ubiquitylation in yeast. J Biol Chem 284 (31) 20582-20592. 20. Van Leene J, et al. (2010) Targeted interactomics reveals a complex core cell cycle machinery in Arabidopsis thaliana. Mol Syst Biol 6(1), 397. 21. Köster T, Marondedze C, Meyer K, Staiger D (2017) RNA-binding proteins revisited – the emerging Arabidopsis mRNA interactome. Trends Plant Sci 22(6), 512-526. 22. Ariyoshi M, Schwabe JWR (2003) A conserved structural motif reveals the essential transcriptional repression function of Spen proteins and their role in developmental signaling. Genes Dev 17(15), 1909-1920. 23. Shi Y, et al. (2001) Sharp, an inducible cofactor that integrates nuclear receptor repression and activation. Genes Dev 15(9), 1140-1151. 24. Sawada T, et al. (2008) Fusion of OTT to BSAC results in aberrant up-regulation of transcriptional activity. J Biol Chem 283(39), 26820-26828. 25. Lee J-H, Skalnik DG (2012) Rbm15-Mkl1 interacts with the Setd1b histone H3-Lys4 methyltransferase via a SPOC domain that is required for cytokine-independent proliferation. PLoS ONE 7(8), e42965. 29 26. Majerciak V, Lu M, Li X, Zheng Z-M (2014) Attenuation of the suppressive activity of cellular splicing factor SRSF3 by Kaposi sarcoma-associated herpesvirus ORF57 protein is required for RNA splicing. RNA 20(11), 1747-1758. 27. Hiriart E, et al. (2005) Interaction of the Epstein-Barr virus mRNA export factor EB2 with human Spen proteins SHARP, OTT1, and a novel member of the family, OTT3, links Spen proteins with splicing regulation and mRNA export. J Biol Chem 280 (44), 36935-36945. 28. Yan D, Perrimon N (2015) spenito is required for sex determination in Drosophila melanogaster. Proc Natl Acad Sci USA 112(37), 11606-11611. 29. Solís-Guzmán MG, et al. (2017) Expression analysis of the Arabidopsis thaliana AtSpen2 gene, and its relationship with other plant genes encoding Spen proteins. Genet Mol Biol 40(3), 643-655. 30. Hornyik C, Terzi LC, Simpson GG (2010) The spen family protein FPA controls alternative cleavage and polyadenylation of RNA. Dev Cell 18(2), 203-213. 31. Liu D, Cai X (2013) OsRRMh, a Spen-like gene, plays an important role during the vegetative to reproductive transition in rice. J. Integr. Plant Biol 55(9), 876-887. 32. Cheng Y, Kato N, Wang W, Li J, Chen X (2003) Two RNA binding proteins, HEN4 and HUA1, act in the processing of AGAMOUS pre-mRNA in Arabidopsis thaliana. Dev Cell 4(1), 53-66. 33. Chen T, et al. (2013) A KH-domain RNA-binding protein interacts with FIERY2/CTD phosphatase-like 1 and splicing factors and is important for pre-mRNA splicing in Arabidopsis. PLoS Genet 9(10), e1003875. 34. Mockler TC, et al. (2004) Regulation of flowering time in Arabidopsis by K homology domain proteins. Proc Natl Acad Sci USA 101(34), 12759-12764. 30 35. Ripoll JJ, et al. (2009) Antagonistic interactions between Arabidopsis K-homology domain genes uncover PEPPER as a positive regulator of the central floral repressor FLOWERING LOCUS C. Dev Biol 333(2), 251-262. 36. Zhang Z, et al. (2016). UV crosslinked mRNA-binding proteins captured from leaf mesophyll protoplasts. Plant Methods 12(11), 42. 37. Reichel M, et al. (2016) In planta determination of the mRNA-binding proteome of Arabidopsis etiolated seedlings. Plant Cell 28(10), 2435-2452. 38. Marondedze, C., Thomas, L., Serrano, N.L., Lilley, K.S., and Gehring, C. (2016). The RNA-binding protein repertoire of Arabidopsis thaliana. Sci. Rep. 6, 29766. 39. Baaske P, et al. (2010) Optical thermophoresis for quantifying the buffer dependence of aptamer binding. Angew Chem Int Ed 49(12), 2238-2241. 40. Helder S, Blythe AJ, Bond CS, Mackay JP (2016) Determinants of affinity and specificity in RNA-binding proteins. Curr Opin Struct Biol 38 (6), 83-91. 41. Koornneef M, Hanhart CJ, van der Veen JH (1991) A genetic and physiologial analysis of late flowering mutants in Arabidopsis thaliana. Mol. Gen. Genet. 229(1), 57-66. 42. Alonso-Blanco C, El-Din El-Assal S, Coupland G, Koornneef M (1998) Analysis of natural allelic variation at flowering time loci in the Landsberg erecta and Cape Verde Islands ecotypes of Arabidopsis thaliana. Genetics 149(2), 749-764. 43. Seo PJ, et al. (2012) A self-regulatory circuit of CIRCADIAN CLOCK- ASSOCIATED1 underlies the circadian clock regulation of temperature responses in Arabidopsis. Plant Cell 24(6), 2427-2442. 44. Cui Z, Xu Q, Wang X (2014) Regulation of the circadian clock through pre-mRNA splicing in Arabidopsis. J Exp Bot 65(8), 1973-1980. 45. Luco RF, Allo M, Schor IE, Kornblihtt AR, Misteli T (2011) Epigenetics in alternative pre-mRNA splicing. Cell 144(1), 16-26. 31 46. Fong N, et al. (2014) Pre-mRNA splicing is facilitated by an optimal RNA polymerase II elongation rate. Genes Dev 28(23), 2663-2676. 47. Hérissant L, et al. (2014) H2B ubiquitylation modulates spliceosome assembly and function in budding yeast. Biol Cell 106(4), 126-138. 48. Antosz W, et al. (2017) The composition of the Arabidopsis RNA polymerase II transcript elongation complex reveals the interplay between elongation and mRNA processing factors. Plant Cell 29(4), 854-870. 49. Crevillén P, Dean C (2011) Regulation of the floral repressor gene FLC: the complexity of transcription in a chromatin context. Curr Opin Plant Biol 14(1), 38-44. 50. Michaels SD, Amasino RM (1999) FLOWERING LOCUS C encodes a novel MADS domain protein that acts as a repressor of flowering. Plant Cell 11(5), 949-956. 51. Whittaker C, Dean C (2017) The FLC locus: a platform for discoveries in epigenetics and adaptation. Annu Rev Cell Dev Biol 33, 555-575. 52 Swiezewski S, Liu F, Magusin A, Dean C (2009) Cold-induced silencing by long antisense transcripts of an Arabidopsis Polycomb target. Nature 462(7274), 799-802. 53. Liu F, Marquardt S, Lister C, Swiezewski S, Dean C (2010) Targeted 3' processing of antisense transcripts triggers Arabidopsis FLC chromatin silencing. Science 327(5961), 94-97. 54 Marquardt S, et al. (2014) Functional consequences of splicing of the antisense transcript COOLAIR on FLC transcription. Mol Cell 54(1), 156-165. 55. Li P, Tao Z, Dean C (2015) Phenotypic evolution through variation in splicing of the noncoding RNA COOLAIR. Genes Dev 29(7), 696-701. 56. Hawkes EJ, et al. (2016) COOLAIR antisense RNAs form evolutionarily conserved elaborate secondary structures. Cell Rep 16(12), 3087-3096. 57 Csorba T, Questa JI, Sun Q, Dean C (2014) Antisense COOLAIR mediates the 32 coordinated switching of chromatin states at FLC during vernalization. Proc Natl Acad Sci USA 111(45), 16160-16165. 58. Johanson U, et al. (2000) Molecular analysis of FRIGIDA, a major determinant of natural variation in Arabidopsis flowering time. Science 290(5490), 344-347. 59 Ietswaart R, Wu Z, Dean C (2012) Flowering time control: another window to the connection between antisense RNA and chromatin. Trends Plant Sci 28(9), 445-453. 60. Rodríguez-Cazorla E, et al. (2015) K-homology nuclear ribonucleoproteins regulate floral organ identity and determinacy in Arabidopsis. PLoS Genet 10(2), e1004983. 33 Fig. 1. SPEN3 and KHD1 localization and RNA binding. (A-D) Detection of GFP::SPEN3 and GFP::KHD1 upon infiltration of N. benthamiana leaves (A and C) and stable transgenic A. thaliana roots (B and D). Scale bars = 10 μm. (E) Schemes of the SPEN3 and KHD1 proteins with their functional domains, RRM (blue), SPOC (green), and KH (red). Bracket indicates the part that was expressed in E. coli and purified for EMSA. (F) SDS-PAGE analysis of purified GST-RRM-SPEN3 and 6×His-KHD1-N proteins, stained with Coomassie Brilliant Blue. GST- RRM-SPEN3 is partially cleaved in E.coli and the band migrating below the fusion protein is free GST as determined by mass spectrometry. (G-J) Comparison of the binding of GST-RRM-SPEN3 (G) or 6×His-KHD1-N (I) to ssRNA, and competition assay with unlabeled ssRNA or ssDNA for analysis of GST-RRM-SPEN3 (H) or 6×His-KHD1-N (J). For titrations (G and I), the Cy3-labeled 25-nucleotide probe was incubated either in the absence (lane 1) or in the presence of increasing protein concentrations (0.1 μM, 0.2 μM, 0.5 μM, 1 μM, 2 μM, 3 μM, and 5 μM) (lanes 2–8, respectively). Samples were analyzed by PAGE. For competition assays, the Cy3-ssRNA 25-nucleotide probe was incubated with 3 μM of protein in all samples and binding to the labeled probe was competed (as indicated) with increasing concentrations of 25-bp ssDNA or ssRNA (5×, 10×, and 50× excess over Cy3-ssRNA). The bottom bands correspond to the unbound RNA and the asterisk or brackets indicate the protein-RNA complexes. Fig. 2. Phenotypes of single and double mutants and of overexpression lines. (A) Schematic view of the SPEN3 and KHD1 T-DNA insertion lines, spen3-1 (SALK_025388), spen3-3 (GABI_626H01), khd1-1 (SALK_046957), and khd1-3 (SAIL_1285_H03C1). (B) Relative expression of KHD1 and SPEN3 in Col-0 and mutant lines estimated with the qPCR assay in six biological replicates. Asterisks indicate statistically significant differences by Student’s t-test (**P < 0.01, ***P < 0.001). (C) Representative seedlings at 19 DAG grown in jiffy containers. Arrows mark early emerging inflorescences. (D) Flowering time of lines germinated in jiffy pots (n = 51). (E and F) Flowering time and projected rosette area of seedlings at 23 DAS (n = 24) respectively, grown on the WIWAM phenotyping platform. Error bars represent standard errors. Ordinary one-way ANOVA with 95% confidence shows a significant difference between the genotypes, represented by letters (panels D-F). (G) Individual leaf areas of seedlings at 21 DAS of mutant lines, in vitro grown on the IGIS platform. Fig. 3. Transcriptomes, CCA1 transcripts, and H2Bub in mutants. (A) Venn diagram of the transcriptomes of the hub1-4, spen3-1, and khd1-1 expression profiles compared to Col-0. (B) Relative expression of CCA1 by qPCR in Col-0 and mutants in six biological replicates. (C). Scheme of the CCA1 gene structure with the splice forms CCA1α and CCA1β at intron 4 and position of the primers used in ChIP-qPCR (top). Relative enrichment of H2Bub at the CCA1 gene established with antibodies against H2Bub and four biological replicates used for ChIP assay (bottom). Results were normalized versus input samples. Error bars represent standard errors. Asterisks indicate statistically significant differences from spen-1 to Col-0 with the Student’s t-test (*P < 0.05, **P < 0.01, ***P < 0.001) (B) and to Col-0 (*P < 0.05) (C). (D) Relative expression in a 48-h time course experiment of the CCA1 splice forms, CCA1α and CCA1β, by qPCR at 21 C and 6 C in three biological replicates. Fig. 4. Circadian waveforms and circadian period in wild type and mutants by means of LUC reporter lines. Luminescence in hub1-4, spen3-1, and khd1-1 mutants containing pCCA1::LUC (A) or pTOC1::LUC (B) reporter genes was recorded under constant white light conditions, following synchronization under 12 h light/12 h dark cycles; y-axes represent counts/seedling/5 seconds; lower scale in right-handed y- axis visualizes pTOC1::LUC amplitude and period in hub1-4 graph. Data are means + SEM of at least 12 individual seedlings. Statistical significance was calculated with an ordinary one-way ANOVA with 95% confidence value: ns, not significant, P > 0.05, *P ≤ 0.05, **P ≤ 0.01, *** P ≤ 0.001, ****P ≤ 0.0001. Fig. 5. FLC and COOLAIR transcripts and H2Bub in mutants. (A) Schematic representation of the FLC gene structure and antisense COOLAIR with primers (P2-P4) used in ChIP-qPCR and in qPCR for spliced FLC (orange), total COOLAIR (green), distal COOLAIR (grey), and proximal COOLAIR (blue). (B) Relative expression of FLC by qPCR in Col-0 and mutants in six biological replicates. (C) Relative enrichment of H2Bub at the FLC gene established with antibodies against H2Bub and four biological replicates used for ChIP assay. Results were normalized versus input samples. (D) qRT-PCR showing the relative expression of the FLC and COOLAIR forms before (bv) and after (av) vernalization in four biological replicates. (E) Hypothetical position and function of SPEN3 in FLC/COOLAIR regulation under normal conditions (model modified from 59). (B-D) Error bars represent standard errors. Asterisks indicate statistically significant differences to Col-0 with the Student’s t-test (*P < 0.05, **P < 0.01, ***P < 0.001). Supplementary Information for Histone 2B monoubiquitination complex integrates transcript elongation with splicing at circadian clock and flowering time regulators Magdalena Woloszynska, Sabine Le Gall, Pia Neyt, Tommaso M. Boccardi, Marion Grasser, Gernot Längst, Stijn Aesaert, Griet Coussens, Stijn Dhondt, Eveline Van De Slijke, Leonardo Bruno, Jorge Fung-Uceda, Paloma Mas, Marc Van Montagu, Dirk Inzé, Kristiina Himanen, Geert De Jaeger, Klaus D. Grasser, and Mieke Van Lijsebettens Corresponding author: Mieke Van Lijsebettens Email: mieke.vanlijsebettens@psb.ugent.be This PDF file includes: Supplementary text Figs. S1 to S6 Tables S1 to S3 SI References Other supplementary materials for this manuscript include the following: Dataset S1 1 MATERIALS AND METHODS Plant material and growth conditions. hub1-4 (SALK_122512), spen3-1 (SALK_025388) (1), spen3-3 (GABI_626H01) (2), khd1-1 (SALK_046957) (1), hub1-3 (GABI_276D08) (2), hub1-4 (SALK_122512) (1), hub2-1 (GABI_634H04) (2), khd1-3 (SAIL_1285_H03C1) (3) in Col-0 background were obtained from the Nottingham Arabidopsis Stock Centre. T-DNA insertions were confirmed by PCR. A second T-DNA in spen3-3 (GABI_626H01) was located at the 3’ UTR of the At1g77920 and the 5’ end of the At1g77930 genes, but did not affect their respective gene expression levels (Fig. S4). The hub1-3 hub2-1 mutant had been described previously (4), whereas the spen3-1 hub1-4 and khd1-1 hub1-4 double mutants were constructed in this work and the genotypes were verified by PCR. The clock reporter lines expressing pCCA1::LUC (5) and pTOC1::LUC (6) were crossed into the hub1-4, spen3-1, and khd1-1 mutants and homozygous lines analyzed by in vivo luminescence assays. The p35S::GFP::SPEN3 and p35S::GFP::KHD1 constructs were obtained by Gateway recombination and were transformed into Agrobacterium tumefaciens cells that were used for tobacco (Nicotiana benthamiana) leaf infiltration and stable transformation into Arabidopsis thaliana (L.) Heynh., accession Columbia-0 (Col-0) by floral dip. Seedlings were grown in soil (jiffy containers) under growth chamber conditions, namely 16 h day/8 h night with white light and 21°C for flowering time experiments. Seeds for in vitro time-lapse analysis on the IGIS platform (7) were sterilized in 3% (v/v) bleach for 15 min and sown on medium containing half-strength Murashige and Skoog (MS) medium (Duchefa), solidified with 0.9 g L-1 plant tissue culture agar (Lab M) on round Petri dishes, stratified for 2 days, then incubated in a growth chamber under long-day conditions (16 h light, 8 h darkness) at 21°C. The average light intensity supplied by cool-white fluorescent tubes (Spectralux Plus 36W/840; Radium) was approximately 60 µmol m-2 s-1 for in vitro and in soil-grown experiments. For bioluminescence assays, plants were stratified for 3 days at 4ºC on plates with MS agar medium and grown for 7 days under 12 h light, 12 h dark cycles with 60 µmol m-2 s-1 white light at a constant 22ºC temperature. Seedlings were transferred to 96-well plates containing MS agar and 3 mM luciferine (Promega). Luminescence rhythms were monitored under constant white light conditions (60 µmol m-2 s-1) with a luminometer LB-960 (Berthold Technologies) and analyzed with the software MikroWin 2000, version 4.34 (Mikrotek Laborsysteme). Growth parameters and flowering time were also measured by means of an automated weighing, imaging, and watering phenotyping platform, acronym WIWAM XY (www.wiwam.com) according to established protocols (8, 9). WIWAM was placed in an Arabidopsis growth room at 21°C, 55% relative humidity, 16 h day/8 h night, and 100 mol m−2 s−1 light intensity. Seeds were stratified 2 days before sowing in pots with 80-90 g of soil that were randomized by the WIWAM platform. During the entire experiment, the soil water content was set at a constant value of 2.19 g H2O/g dry soil. Images were acquired for each pot on a daily basis and analyzed. The data were validated with the in-house Interface for Plant Phenotype Analysis (PIPPA) (10). Circadian clock period calculation. The circadian periods were calculated with the Fast Fourier Transform–Non-Linear Least-squares (FFT-NLLS) suite of the BioDare online data repository (https://biodare2.ed.ac.uk/documents/period-methods) (11). This suite is commonly accepted and widely used in the circadian community and the method is clearly described on the web page. 2 Essentially, the period estimation is based on curve fitting. FFT NLLS starts with a model with a single cosine and determines the parameters (τ1, ϕ1, α1, and c) by means of a non-linear least squares fitting algorithm. This procedure is repeated with models with additional cosine components (increased N), until addition of a supplemental cosine term does not improve significantly the resulting fit. Once the best model and its parameters have been found, the period is taken to be the period of the cosine component lying within a user-defined range of likely circadian periods (typically 15-35 h). Bioinformatic analysis. With the PLAZA 2.5 bioinformatic tool, common down- or upregulated genes were classified into significantly overrepresented (P < 0.05) gene ontology (GO) classes of the Biological Process type (12). Multiprobe in situ hybridization. Short and specific ( GSTs) fragments of the HUB1 (At2g44950), SPEN3(At1g27750), and KHD1 (At1g51580) genes were cloned in the pGEM-T- Easy vector (Promega). Labeled RNA probes were synthesized by means of in vitro transcription in the presence of digoxigenin-11-UTP (SPEN3 probe), biotin-16-UTP (KHD1 probe), fluoroscein- 12-UTP (HUB1 probe) and processed as reported (13). Four-day-old Arabidopsis Col-0 seedlings were fixed, dehydrated, and handled as described (13). In situ hybridization was done with a mix of riboprobes and hybridized by in situ whole-mount methodology (13) with minor modifications, namely the hybridization step was carried out overnight at 55°C and the mixture of primary and secondary antibodies was diluted 1:500. Samples were imaged with a Leica inverted TCS SP8 confocal scanning laser microscope. The Alexa fluor dyes were detected simultaneously by combining the settings indicated in the sequential scanning facility of the microscope. Root growth analysis. Root growth was measured on seedlings grown vertically on half-strength MS medium supplemented with 1% (w/v) sucrose, 0.8% (w/v) agarose, pH 5.7, at 21°C under 24-h light conditions (75 µmol m-2 s-1). The root meristem size was determined 5 days after germination (DAG) as the number of cells in the cortex cell file from the quiescent center to the first elongated cell (14). The samples were mounted with clearing solution (80 g chloral hydrate, 30 ml glycerol, and 10 ml dH2O) and observed immediately. Root length was marked at 10 DAG and measured with the ImageJ software (http://rsbweb.nih.gov/ij/). Means between samples were compared by a two-tailed Student’s t-test and variances with an ANOVA. Tandem Affinity Purification. TAP (15) or GS (16) tags were fused N-terminally to full length cDNAs of HUB1, HUB1pm, and HUB2, and C-terminally to SPEN3. In the HUB1pm, two cysteines of the RING domain (positions 826 and 829) were replaced by serines. The TAP-tagged HUB1 proteins were enzymatically active and complemented partially the hub1-1 mutation (4). Tagged transgenes were expressed under the control of the constitutive cauliflower tobacco mosaic virus 35S promoter and transformed in Arabidopsis cell suspension cultures (17). Protocols of proteolysis and peptide isolation, acquisition of mass spectra by a 4800 Proteomics Analyzer (Applied Biosystems), and mass spectrometry-based protein homology identification based on the TAIR genomic database, were as described (18). Experimental background proteins were subtracted based on approximately 40 TAP experiments on wild-type cultures and cultures expressing the TAP-tagged mock proteins GUS, RFP, and GFP (18). 3 Production of recombinant proteins. The RRM domain-containing region of SPEN3 and the two KH domain-containing region of KHD1 were amplified by PCR with HiFi DNA polymerase (KAPA Biosystems) and the iProof high-fidelidy PCR kit (Bio-Rad), respectively, with an Arabidopsis cDNA library as template and primers providing the required restriction enzyme cleavage sites (Table S3). The amplified PCR fragment of SPEN3 was digested with BamHI/SalI and cloned into the BamHI/SalI-digested E. coli expression plasmid pGEX-5X-1 (GE Healthcare), providing an N-terminal GST with the pGEX-5X-1-RRM-SPEN3 plasmid for the RRM domain of SPEN3 as a result. The obtained PCR fragment of KHD1 was digested with BamHI/SalI and cloned into the BamHI/SalI-digested E. coli expression plasmid pQE9 (Qiagen), providing an N-terminal 6×His-tag, resulting in the pQE9-KHD1-N plasmid for the N-end part of KHD1 that contains two KH domains. Plasmid constructions were checked by DNA sequencing. For protein production, the pGEX-5X-1-RRM-SPEN3 expression vector was transformed into E. coli BL21+pRARE cells. After induction by 1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG; Sigma-Aldrich), the GST- tagged RRM-SPEN3 was purified by glutathione-sepharose affinity chromatography as previously described (19). E. coli M15 cells were transformed with the pQE9-KHD1-N expression vector. After induction by 1 mM IPTG, the 6×His-tagged KHD1-N was purified by metal-chelate chromatography with Ni-NTA agarose (Qiagen) from E. coli lysates essentially as described previously (20). By means of PD10 columns (Pharmacia), the purified proteins were collected in buffer (10 mM phosphate buffer, pH 7.0, 1 mM EDTA, 1 mM dithiothreitol [DTT], and 0.5 mM phenylmethanesulfonyl fluoride [PMSF; Sigma-Aldrich]) and the recombinant proteins were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and mass spectrometry. Fluorescent Electrophoretic Mobility Shift Assay (EMSA) binding. RNA binding of the recombinant proteins was examined by EMSA as described (20) with fluorescently labeled ssRNA oligonucleotides (Table S3) (21) used before to study general RNA interactions of various Arabidopsis proteins (20, 21). Different protein concentrations were incubated for 15 min with the Cy3-labeled ssRNA (25 nM) probe in binding buffer (10 mM Hepes, pH 7.9, 3% [w/v] Ficoll, 10 mM MgCl2, 5 mM KCl, 200 mM NaCl, 1 mM EDTA, 0.5 mM DTT, 1 mM spermidine, 0.1 mg/ml bovine serum albumin). Binding reactions were analyzed in 1× Tris/borate/EDTA (TBE) polyacrylamide gels. The RNA was visualized by imaging with a Typhoon 8600 instrument (GE Healthcare). Competition assays were done with constant protein concentrations (3 µM) and labeled ssRNA probes and increasing concentrations of unlabeled ssRNA or ssDNA. Fluorescent MicroScale Thermophoresis (MST) binding assay. MST binding experiments were carried out essentially as previously described (20) with 200 nM 25-nucleotide-long Cy3-labeled ssRNA or ssDNA oligonucleotides. MST measurements were done in protein buffers with a protein concentration range at 40% MST power, 50% LED power in standard capillaries at 25°C on a Monolith NT.115 device (NanoTemper Technologies). The data were analyzed with the MO.Affinity Analysis software (V2.3, NanoTemper Technologies) and binding reactions were determined by examining Temperature Related Intensity Changes (TRIC effect). To calculate the fraction bound, the ΔFnorm value of each point was divided by the amplitude of the fitted curve, resulting in values from 0 to 1 (0 = unbound, 1 = bound), and processed with the KaleidaGraph 4.5 (Synergy Software). 4 RNA methods. RNA was isolated with the RNeasy Plant Kit (Qiagen) with on-column DNase digestion. The manufacturer's protocol was modified by two additional washes of RNeasy spin columns with RPE buffer. Complementary DNA (cDNA) was synthesized with the SuperScript III First-strand Synthesis Kit (Life-Invitrogen, CAT. 18080051). Real-time PCR was run in technical triplicates with the LightCycler 480 SYBR Green I Master (Roche Life Science) and the Janus robot (PerkinElmer) for pipetting. The LightCycler 480 Real- Time PCR System was used for amplification (95°C for 10 min, 45 cycles of 95°C/10 s, 60°C/15 s, 72°C/30 s followed by a melting curve analysis). The qPCR results were analyzed with the qBase Plus software (Biogazelle). The PP2A (At1g13320) and UBC (At5g25760) genes were used as references for gene expression normalization. The primer sequences used are presented in Table S3. For the transcriptome, RNA was extracted from shoot apices of 10-day-old seedlings. The A260/A280 and the A260/A230 ratios were measured with a NanoDrop spectrophotometer (Thermo Fisher Scientific) to evaluate the quantity and purity of the samples. Additionally, the high RNA quality was verified by means of the Agilent Bioanalyzer system. After the library preparation by TruSeq, RNA was sequenced on the Illumina HiSeq. Normalization statistics, and bioinformatics were carried out on the raw data to allow pairwise differential gene expression analyses (Nucleomics Core Facility, VIB, Leuven, Belgium). The Gene Ontology categories of the differentially expressed genes were identified with the PLAZA 2.5 software (12). ChIP-qPCR. The isolated chromatin was sonicated in a Vibra-cell sonicator (Sonics & Materials) with four 15-s pulses at a 20% amplitude and immunoprecipitated with 5 µg of H2Bub antibodies (Medimabs, MM-029). Protein A Agarose (Millipore) was used to collect immunoprecipitated chromatin. After reverse cross-linking and proteinase K digestion, DNA was purified with the MinElute PCR Purification Kit (Qiagen) and eluted with the elution buffer supplemented with RNaseA (10 µg/ml). Samples were analyzed by real-time qPCR with primers in the promoter and coding regions of the FLC (22) and CCA1 (Table S3) genes. The amount of immunoprecipitated DNA was calculated relative to the input. Yeast Two-Hybrid Analysis. Constructs used for Y2H were obtained by cloning cDNAs of the HUB1, HUB2, SPEN3, SPEN3 N-terminus (761 amino acids, including RRM domain), and SPEN3 C-terminus (488 amino acids, including SPOC domain) by the Gateway Technology (Life Technologies). Constructs were introduced by an LR recombination into the pDESTtm22 and pDESTtm32 destination vectors, resulting in fusions to the GAL4 activation domain (AD) and GAL4-binding domain (BD), respectively (ProQuestTM Two-HybridSystem, Life Technologies). All plasmids were transformed into yeast strains with the opposite mating types MaV203 MATa and MATα. Transformed yeast strains were selected for the presence of pDEST22 or the pDEST32 vector. Transformed yeast strains were selected for the presence of pDEST22 or the pDEST32 vector and the abundance of the fusion proteins was assessed by Western-blot. Self-activation of both bait and prey constructs were tested by yeast transformation for non-PREY-specific activation of reporter gene expression by BAIT-constructs or BAIT-GAL-4-DNA-independent activation exerted by PREY constructs in a colony-lift filter assay with X-Gal as substrate. Fusion proteins that showed self-activation, i.e., HUB2 and KHD1, were omitted from the pairwise screens. Diploid transformants were tested for positive interactions by growing the mating strains in SD-leucine- tryptophan-histidine medium with increasing concentrations (0 mM, 3 mM, and 10 mM) of 3- amino-1,2,4-triazole (3-AT) to assess the interaction strengths. Constructs of known interacting 5 proteins, DmDP and DmE2F, were used as the positive control and the negative control consisted of yeast strains containing an empty AD vector mated with the BD fusion of the protein of interest. For each interaction, three independent biological repeats were done and for the assays the TECAN Genesis Automation and TECAN TEMO-96 pipetting robot were used (TECAN, Munich, Germany). 6 Fig. S1. Yeast two-hybrid interactions between HUB1, SPEN3, SPEN3 N-terminus, and SPEN3 C- terminus. The yeast strains expressing the HUB1, SPEN3, SPEN3 N-terminus, and SPEN3 C-terminus proteins fused to the activation domain (AD strains, ordinate) or binding domain (BD strains, panels A-D) did not show self-activation and were mated pairwise to test for direct interactions between proteins that allowed yeast growth on selective medium and quantification as the optical density (OD 600) of the culture. Different concentrations (0 mM, 3 mM, and 10 mM) of 3-amino-1,2,4-triazole (3-AT) were applied to the medium to detect the high-affinity binding between two interactors allowing yeast to survive increased 3-AT concentrations. For each interaction, the average of three independent biological repeats are shown. As a positive control, known interactors (DmDP and DmE2F) were used and, as negative control, the empty AD vector strain was mated with the BD fusion of the protein of interest. 7 Fig. S2. Evolutionary relationships of SPEN3 (A) and KHD1 (B) proteins over taxa and within Arabidopsis thaliana. The evolutionary history was inferred from two independent maximum likelihood (ML) and Bayesian approaches (BA) with PhyML (23, 24) and MrBayes 3.2.6 (25), respectively. Both trees were estimated with a best-fit model obtained by MEGA X (26) as JTT + G for SPEN3 (A) and LG + G for KHD1 (B). The analysis involved 17 (A) and 12 (B) amino acid sequences retrieved from the UniProt database. In MrBayes, two independent runs were applied and trees were sampled every 200th generation for 5 000 000 generations (with a 25% burn-in). Overall, deviation of split frequencies for all trees used for consensus was much below 0.01. The reliability of the nodes is indicated by their posterior probability values (BA) and bootstrap values (1000 replicates) (ML) presented along the nodes. Node support values below 70% were not shown. The scale bar represents the genetic distance. 8 Fig. S3. MST analysis of SPEN3 and KHD1 interactions with nucleic acids. (A) Increasing concentrations of the GST-RRM-SPEN3 protein incubated with 200 nM of 25- nucleotide-long ssRNA or ssDNA of the same sequence. Protein-nucleic acid interactions were quantified by MST. The approximate bound fraction of nucleic acids per tested protein concentration is plotted. (B) Increasing concentrations of binding of 6×His-KHD1-N protein incubated with ssRNA and ssDNA as in (A). Protein-nucleic acid interactions were measured by MST. In case of 6×His-KHD1-N binding to ssRNA and ssDNA, the MST analysis revealed a complex pattern of changes in the thermophoretic mobility of the interacting molecules. Instead of following a typical binding curve with increasing protein concentrations, a significant change in the mobility direction at a protein concentration of 1 µM. At lower concentrations, the protein- nucleic acid complexes moved toward the heated region in the capillary, whereas at higher concentrations (above 4 µM) they left the heated region. This behavior resulted in a “local minimum” of the plotted data that can be interpreted as two dependent binding events, creating two different protein-nucleic acid complexes with different thermophoretic behaviors established each one after the other with increasing protein concentration. The overlay of the thermophoretic properties can result in such plots. As no KD or Hill fitting could be applied, the curves can only be described in a qualitative manner. The plot is displayed as changes in normalized fluorescence exhibiting qualitative differences in the presence of RNA or DNA. The “local minimum” was much more pronounced in the presence of RNA and the curve reached a plateau at high protein concentrations. In contrast, in the presence of DNA, the curve did not reach a plateau, hinting at partial DNA binding. Hence, this qualitative analysis supports the EMSA experiments, suggesting improved RNA binding. Measurements were done with three biological and three technical replicates. Error bars indicate standard deviation of the biological replicates. 9 Fig. S4. in situ hybridization and leaf phenotypes of mutants and overexpression lines. (A and B) Whole-mount, multiprobe in situ hybridization of the shoot apex (A) and the primary root meristem (B). Arrow indicates white-pink merge of HUB1 (blue samples treated with HUB1 FITC riboprobe and rabbit anti-FITC followed by AF647 chicken antirabbit), SPEN3 (red samples treated with SPEN3 Dig-riboprobe and sheep anti-Dig, followed by AF555 Donkey anti-sheep), and KHD1 (green samples treated with KHD1 Bio-riboprobe and mouse anti-Bio followed by AF488-Donkey anti-mouse IgG) expression pattern in the shoot apex. (C) Rosette phenotype of the spen3-3 and spen3-1 alleles and their Col-0 controls at 25 DAG. 10 (D) Flowering time of spen3-3 and spen3-1 and their Col-0 controls grown in jiffy pots (n = 50). (E) Number of rosette leaves per seedling at bolting in jiffy pots (n = 51). (F) Number of rosette leaves per seedling at bolting in jiffy pots ((n = 50). (G) Number of rosette leaves per seedling at bolting grown in the WIWAM- automated platform (n = 24). (H) Stockiness and (I) compactness of the rosettes in WIWAM experiment calculated at 23 DAS. (J) Leaf series of 26 DAG seedlings grown in jiffy container experiment. Control, Col- 0; single mutants, spen3-1, khd1-1 and hub1-4; double mutants, spen3-1 hub1-4 and khd1-1 hub1-4. Error bars represent standard deviations. Ordinary one-way ANOVA with 95% confidence shows a significant difference between the genotypes, represented by the letters (panels E,G,H,I). Asterisks (D and F) indicate statistically significant differences by Student’s t-test (*P < 0.05, **P < 0.01). 11 Fig. S5. Expression levels of genes flanking the second T-DNA insertion in spen3-3. (A) Scheme of a second T-DNA insertion at the 3’ end of At1g77920 and the 5’ end of At1g77930 in the spen3-3 allele. (B) qPCR analysis of At1g77920 and At1g77930 gene expression levels in seedling (S) and cauline (C) leaf tissue of spen3-3 and Col-0 control (primers, see Table S3), five biological replicates. 12 Fig. S6. Primary root phenotypes of mutants and overexpression lines. (A) Primary root length at 10 DAG (n ≥ 15). (B and C) Root meristem size measured by the number of cortex cells of 5 DAG seedlings of overexpression lines (n > 15) (B) and mutant lines (n  10) (C). Error bars represent standard deviations. Ordinary one-way ANOVA with 95% confidence shows a significant difference between the genotypes, represented by the letters (panel A). Asterisks (panels B and C) indicate statistically significant differences by Student’s t-test (*P < 0.05, **P < 0.01). 13 Table S1. AGI codes of the 117 DEGs common to the hub1-4, khd1-1, and spen3-1 transcriptomes (log2FC≥0.5 or log2FC≤-0.5, P ≤ 0.05) Gene ID Gene name Function/process hub1-4 vs khd1-1 spen3-1 vs COL-0: vs COL- COL-0: log2 FC 0: log2 log2 FC FC AT3G30720 QQS Starch biosynthetic process -5.6626 -5.5745 -6.5275 AT4G08093 NA Unknown -3.7844 -5.5504 -4.0931 AT2G01422 NA Unknown -3.3395 -3.7738 -2.5119 AT4G04223 NA Unknown -3.1981 -2.3271 -3.6096 AT4G15320 ATCSLB06 Cellulose biosynthetic process -1.9482 -2.2482 -2.0571 AT1G48740 F11I4_9 Oxidation reduction process -1.7234 -1.2481 -1.8338 AT1G51055 NA Unknown -1.4514 -1.3610 -1.3864 AT1G55320 AAE18 Auxin metabolic process -1.2355 -0.8119 -0.6587 AT4G08991 NA Unknown -1.2329 -1.9179 -1.3986 AT5G25970 T1N24.19 Transferase activity -1.1978 -0.8172 -1.1685 AT5G07640 NA Zinc ion binding -1.1420 -0.9536 -0.9802 AT2G39460 ATRPL23A RNA binding -1.0806 -1.0022 -0.6850 AT3G05727 NA Unknown -0.9690 -0.6627 -1.0264 AT2G29570 PCNA2 DNA methylation -0.9243 -0.7950 -0.5766 AT3G55660 ATROPGEF6 Unknown -0.8981 -0.6359 -0.5877 AT5G22440 RPL10AC RNA methylation -0.8793 -0.8620 -0.7202 AT5G37010 NA DNA replication -0.8736 -0.7098 -0.4696 AT1G52770 F14G24.4 Response to light stimulus -0.8589 -1.3647 -0.8099 AT3G16490 IQD26 Calmodulin binding -0.8390 -0.8087 -0.8740 AT2G25880 AtAUR2 Histone kinase -0.8332 -0.8656 -0.5894 AT2G28620 NA DNA replication -0.8305 -0.7375 -0.5404 AT2G01020 NA Peptide biosynthetic process -0.7982 -0.9755 -0.8181 AT2G33400 F4P9.17 Unknown -0.7936 -0.5135 -0.6040 AT1G18370 HIK Microtubule movement -0.7906 -0.6073 -0.6042 AT5G01600 ATFER1 Iron ion binding -0.7852 -1.0765 -0.6556 AT4G02800 T5J8.12 Microtubule cytoskeleton -0.7802 -0.6539 -0.5214 AT4G03100 F4C21.2 Microtubule cytoskeleton -0.7608 -0.8148 -0.5114 AT1G02780 emb2386 RNA methylation -0.7545 -0.6800 -0.9208 AT3G23890 TOPII DNA topoisomerase -0.7470 -0.5620 -0.5724 AT4G35810 NA Oxidation reduction process -0.7201 -0.7203 -0.9608 AT3G01710 NA Unknown -0.7187 -0.5457 -0.5202 AT4G22505 NA Lipid transport -0.6991 -0.5741 -0.8263 AT5G38940 NA Response to salt stress -0.6947 -0.7681 -1.0002 AT2G38620 CDKB1 Regulation of cell cycle -0.6756 -0.5173 -0.7126 AT5G15200 RPS9B RNA methylation -0.6751 -0.5741 -0.6052 AT3G58650 F14P22.240 DNA replication -0.6746 -0.6901 -0.6336 AT5G60150 NA Petal formation -0.6702 -0.7296 -0.5222 AT1G05440 NA DNA methylation -0.6700 -0.7066 -0.5283 AT5G44560 VPS2.2 Protein binding -0.6659 -0.5251 -0.5011 AT2G26760 CYCB1 Regulation of cell cycle -0.6633 -0.7223 -0.6465 AT1G23790 F5O8.34 Cell proliferation -0.6442 -0.7267 -0.5978 AT3G26050 NA Unknown -0.6299 -0.6320 -0.5259 AT5G67270 ATEB1C Microtubule binding -0.6257 -0.6774 -0.6385 AT3G19050 POK2 Microtubule movement -0.6187 -0.5180 -0.5445 AT5G26742 emb1138 Embryo development -0.5808 -0.9022 -0.6706 AT2G36885 NA Unknown -0.5808 -0.8775 -0.8374 AT4G24670 TAR2 Cotyledon development -0.5388 -0.6692 -0.6080 AT2G45490 AtAUR3 Histone kinase -0.5322 -0.5612 -0.7462 AT2G33560 BUBR1 Cell proliferation -0.5258 -0.6428 -0.5698 AT4G37490 CYC1 Regulation of cell cycle -0.5244 -0.7092 -0.6084 AT5G35935 NA Transposon 3.8585 4.0484 3.9318 AT1G19510 ATRL5 Regulation of transcription 2.6802 1.7416 1.6497 AT3G10420 SPD1 Nucleoside-triphosphatase activity 2.4560 2.4592 2.6330 AT3G05660 AtRLP33 Kinase activity 2.4204 1.4367 1.4173 AT4G08040 ACS11 Biosynthetic process 1.8670 0.9910 1.2030 AT2G34010 T14G11.13 Negative regulation of transcription 1.7997 1.0896 0.8731 AT1G51820 NA Proline transport 1.6036 1.9470 1.5766 AT2G26560 PLP2 Lipase activity 1.5401 1.4479 1.6085 AT1G43910 F9C16_7 Response to ABA stimulus 1.4203 1.3555 1.1442 AT3G16030 CES101 Immune response 1.3967 1.1568 1.0114 AT4G36280 CRH1 ATP binding 1.2300 0.7077 0.5734 AT5G15510 NA Cell proliferation 1.1310 0.7409 1.2072 14 AT5G17860 CAX7 Transmembrane transport 1.1310 0.7409 1.2072 AT1G62510 NA Lipid transport 1.1214 0.9785 0.8740 AT5G38970 BR6OX1 Oxidation reduction process 1.1193 1.2404 1.2257 AT1G52880 NAM Regulation of transcription 1.1080 0.7682 0.9576 AT4G11900 NA Protein phosphorylation 1.0676 0.7431 0.7588 AT3G53250 T4D2.180 Response to auxin stimulus 1.0341 0.9364 0.7971 AT3G62860 F26K9_290 Catalytic activity 1.0282 1.0083 0.7175 AT1G72430 T10D10.10 Response to auxin stimulus 0.9981 1.0623 0.8578 AT1G21270 WAK2 Oligosaccharide metabolic process 0.9727 0.7971 0.6735 AT5G64780 NA Unknown 0.9604 0.6438 0.5608 AT2G39980 NA Response to karrikin 0.9578 0.6103 0.5734 AT3G61430 PIP1A Water channel activity 0.9367 0.7735 0.5416 AT4G18010 IP5PII Inositol tri-phosphate metabolic process 0.8834 1.2286 0.6841 AT3G56000 ATCSLA14 Transferase activity 0.8726 0.9119 0.7815 AT3G48720 T8P19.230 Cutin biosynthetic process 0.8433 0.8613 0.6017 AT5G08150 SOB5 Cytokinin metabolism process 0.8382 1.1877 0.6384 AT1G23130 T26J12.10 Defense response 0.8248 0.9054 0.6017 AT3G12090 TET6 Transition metal ion transport 0.8139 0.6686 0.6863 AT5G24030 SLAH3 Nitrate transport 0.7619 0.9383 0.6074 AT2G31730 BHLH-BETA Response to ethylene and GA stimulus 0.7106 0.8444 0.6729 AT5G07000 ATST2B Sulfotransferase activity 0.6955 0.9848 0.6295 AT3G07340 BHLH62 Regulation of transcription 0.6624 0.6468 0.5896 AT4G23190 CRK11 Kinase activity 0.6350 0.7084 0.8002 AT5G23750 MRO11.3 Cell wall biogenesis 0.5664 0.6600 0.7512 AT4G32790 F4D11.10 Catalytic activity 0.5664 0.5992 0.5092 AT2G41330 NA Cell redox homeostasis 0.5613 0.6276 0.7785 AT2G23690 NA Protein myristoylation 0.5438 0.7003 0.8397 AT1G02820 F22D16.18 Embryo development -1.7547 -1.2409 1.2362 AT1G62540 FMO GS-OX2 Oxidation reduction process -1.4021 -0.9912 0.9452 AT4G26790 NA Lipid metabolic process -1.1570 -1.1056 0.8255 AT3G21670 NRT1.3 Oligopeptide transport -1.1033 -1.0078 0.9084 AT1G16730 UP6 Fatty acid beta oxydation -1.0651 -1.2906 1.0012 AT4G37310 CYP81H1 Oxidation reduction process -1.0019 -0.7621 0.5620 AT2G46680 ATHB-7 Regulation of transcription -0.9295 -0.6854 0.6970 AT1G73390 T9L24.40 Protein myristoylation -0.9262 -0.6509 0.6113 AT2G17300 NA Unknown -0.7890 -0.5806 0.5410 AT5G03760 ATCSLA09 Calcium ion transport -0.7349 -0.7330 0.7095 AT5G61290 NA Oxidation reduction process -0.6413 -0.7854 0.7625 AT1G64770 NDF2 Carbohydrate metabolic process -0.5301 -0.5406 0.5175 AT4G37770 ACS8 Biosynthetic process 1.7545 2.0780 -1.8580 AT4G40065 NA Unknown 1.4381 1.1595 -1.3468 AT2G23170 GH3.3 Response to auxin stimulus 1.4334 1.2295 -0.7410 AT2G18010 SAUR10 Response to auxin stimulus 1.3172 1.5038 -1.1684 AT3G42800 T21C14_20 Unknown 1.1613 1.4009 -0.8314 AT1G04610 YUC3 Oxidation reduction process 0.8388 1.2292 -1.9934 AT1G30420 ATMRP12 Transmembrane transport 0.5738 0.5111 -1.0747 AT1G51830 T14L22.4 Nitrate transport -1.5491 1.2138 -1.0585 AT4G20320 F1C12.230 Pyrimidine nucleotide biosynthetic process -1.4217 -0.8890 -0.5056 AT4G30170 PER45 Oxidation reduction process -1.2226 1.4707 -1.1787 AT3G32925 NA Transposon 2.4493 -2.0186 1.4498 AT5G59670 NA Protein phosphorylation 1.2640 -1.1608 1.5756 AT1G73000 PYL3 Unknown 1.2088 -1.0563 1.6080 AT1G11070 NA Unknown 0.9290 -0.6423 0.8314 AT1G78000 SULTR1 Nitrate transport -1.5906 0.6725 0.8204 AT3G54160 F24B22.120 Unknown 0.9710 -1.2585 -1.0686 *P values for all log2FC ≤ 0.05. 15 Table S2. PLAZA enrichment of Biological Process Gene Ontology (GO) categories identified within genes down- or upregulated in the indicated mutants. For the single mutants, only the mutant-specific down- or upregulated genes are presented. The GO ratio is the ratio between the number of analyzed annotated genes that belong to the given GO category and the number of all analyzed annotated genes. GO term Log2- P value GO Description Enrichment ratio (%) Down-regulated in hub1-4, khd1-1, and spen3-1 GO:0051726 4.63 5.67E-04 12 Regulation of cell cycle GO:0016572 8.32 4,.0E-03 5 Histone phosphorylation GO:0007049 3.40 3.00E-02 12 Cell cycle Down-regulated in hub1-4 and spen3-1 GO:0051726 3.71 2.00E-02 6 Regulation of cell cycle GO:0016572 7.40 3.00E-02 2 Histone phosphorylation Down-regulated in hub1-4 and khd1-1 GO:0008152 0.54 4.52E-17 61 Metabolic process GO:0019748 2.13 4.61E-16 9 Secondary metabolic process GO:0006260 3.09 9.67E-13 4 Cellular DNA replication GO:0006259 2.22 1.73E-12 7 Cellular DNA metabolic process GO:0044238 0.53 6.76E-12 51 Primary metabolic process GO:0044237 0.53 3.52E-11 49 Cellular metabolic process GO:0044281 1.24 4.94E-11 16 Small molecule metabolic process GO:0006519 1.76 9.67E-11 9 Cellular amino acid and derivative metabolic process GO:0016144 3.62 1.52E-10 3 S-glycoside biosynthetic process GO:0019758 3.62 1.52E-10 3 Glycosinolate biosynthetic process GO:0019761 3.62 1.52E-10 3 Glucosinolate biosynthetic process GO:0009812 3.23 1.64E-10 3 Flavonoid metabolic process GO:0009987 0.42 2.07E-10 60 Cellular process GO:0009813 3.30 2.84E-10 3 Flavonoid biosynthetic process GO:0009058 0.70 4.05E-10 33 Biosynthetic process GO:0034637 2.36 6.90E-10 5 Cellular carbohydrate biosynthetic process GO:0044249 0.70 8.93E-10 33 Cellular biosynthetic process GO:0044283 1.59 3.03E-09 9 Small molecule biosynthetic process GO:0009698 2.50 3.42E-09 4 Phenylpropanoid metabolic process GO:0006807 0.79 4.56E-09 26 Nitrogen compound metabolic process GO:0016137 2.62 4.79E-09 4 Glycoside metabolic process GO:0016138 3.07 5.27E-09 3 Glycoside biosynthetic process GO:0016143 2.92 8.79E-09 3 S-glycoside metabolic process GO:0019757 2.92 8.79E-09 3 Glycosinolate metabolic process GO:0019760 2.92 8.79E-09 3 Glucosinolate metabolic process GO:0009699 2.63 1.12E-08 4 Phenylpropanoid biosynthetic process GO:0042398 2.26 5.03E-08 5 Cellular amino acid derivative biosynthetic process GO:0019438 2.21 5.06E-08 5 Aromatic compound biosynthetic process GO:0006725 1.87 5.39E-08 6 Cellular aromatic compound metabolic process GO:0006790 2.25 5.93E-08 5 Sulfur metabolic process GO:0016051 2.07 9.32E-08 5 Carbohydrate biosynthetic process GO:0007049 2.14 1.47E-07 5 Cell cycle GO:0006575 2.00 1.50E-07 5 Cellular amino acid derivative metabolic process GO:0044272 2.73 2.87E-07 3 Sulfur compound biosynthetic process GO:0005975 1.21 2.53E-06 10 Carbohydrate metabolic process GO:0050896 0.61 2.58E-06 29 Response to stimulus GO:0044262 1.49 6.89E-06 7 Cellular carbohydrate metabolic process GO:0022402 2.31 1.22E-05 3 Cell cycle process GO:0042440 2.48 1.22E-05 3 Pigment metabolic process GO:0043455 3.52 1.31E-05 2 Regulation of secondary metabolic process GO:0010439 5.36 2.42E-05 1 Regulation of glucosinolate biosynthetic process GO:0000103 4.34 2.64E-05 1 Sulfate assimilation GO:0006791 4.18 6.57E-05 1 Sulfur utilization GO:0006261 3.08 6.78E-05 2 DNA-dependent DNA replication GO:0034285 2.85 1.07E-04 2 Response to disaccharide stimulus GO:0006270 4.51 1.23E-04 1 DNA replication initiation GO:0006950 0.71 1.68E-04 19 Response to stress GO:0046148 2.45 3.03E-04 3 Pigment biosynthetic process GO:0006281 2.07 3.43E-04 3 DNA repair 16 GO:0034984 2.07 3.67E-04 3 Cellular response to DNA damage stimulus GO:0009744 2.82 4.69E-04 2 Response to sucrose stimulus GO:0043255 4.78 4.79E-04 1 Regulation of carbohydrate biosynthetic process GO:0044271 1.57 4.94E-04 5 Cellular nitrogen compound biosynthetic process GO:0006139 0.66 5.11E-04 19 Cellular nucleobase, nucleoside, nucleotide, and nucleic acid metabolic process GO:0006974 2.01 6.27E-04 3 Response to DNA damage stimulus GO:0009309 2.01 6.27E-04 3 Amine biosynthetic process GO:0010675 4.62 9.38E-04 1 Regulation of cellular carbohydrate metabolic process GO:0009753 1.90 9.81E-04 3 Response to jasmonic acid stimulus GO:0006996 1.20 2.20E-03 7 Organelle organization GO:0008652 2.02 2.50E-03 3 Cellular amino acid biosynthetic process GO:0033205 3.48 2.70E-03 1 Cytokinesis during cell cycle GO:0006268 4.36 2.80E-03 1 DNA unwinding during replication GO:0033554 1.38 4.00E-03 5 Cellular response to stress GO:0016043 0.93 4.20E-03 10 Cellular component organization GO:0042762 4.25 4.50E-03 1 Regulation of sulfur metabolic process GO:0008283 2.64 4.80E-03 2 Cell proliferation GO:0042180 1.09 1.00E-02 7 Cellular ketone metabolic process GO:0051716 1.02 1.00E-02 8 Cellular response to stimulus GO:0046283 3.30 1.00E-02 1 Anthocyanin metabolic process GO:0006109 4.14 1.00E-02 1 Regulation of carbohydrate metabolic process GO:0044106 1.40 1.00E-02 4 Cellular amine metabolic process GO:0034641 1.16 1.00E-02 6 Cellular nitrogen compound metabolic process GO:0042221 0.58 1.00E-02 18 Response to chemical stimulus GO:0051726 2.20 1.00E-02 2 Regulation of cell cycle GO:0009308 1.14 2.00E-02 6 Amine metabolic process GO:0006520 1.42 2.00E-02 4 Cellular amino acid metabolic process GO:0019752 1.03 2.00E-02 7 Carboxylic acid metabolic process GO:0043436 1.03 2.00E-02 7 Oxoacid metabolic process GO:0032392 3.86 2.00E-02 1 DNA geometric change GO:0032508 3.86 2.00E-02 1 DNA duplex unwinding GO:0006082 1.03 2.00E-02 7 Organic acid metabolic process GO:0009628 0.69 3.00E-02 13 Response to abiotic stimulus GO:0000910 2.72 3.00E-02 1 Cytokinesis GO:0007018 2.49 3.00E-02 2 Microtubule-based movement GO:0007017 2.06 3.00E-02 2 Microtubule-based process GO:0009411 1.76 4.00E-02 3 Response to UV GO:0019419 5.21 4.00E-02 1 Sulfate reduction GO:0051276 1.60 5.00E-02 3 Chromosome organization Down-regulated specifically in hub1-4 GO:0050896 0.96 2.40E-30 37 Response to stimulus GO:0006950 1.20 5.99E-29 26 Response to stress GO:0042221 1.13 3.33E-25 26 Response to chemical stimulus GO:0019748 2.12 2.47E-23 9 Secondary metabolic process GO:0006970 1.85 3.67E-22 11 Response to osmotic stress GO:0009651 1.86 7.93E-21 10 Response to salt stress GO:0010035 1.82 3.71E-20 10 Response to inorganic substance GO:0016137 2.88 9.30E-20 5 Glycoside metabolic process GO:0010038 1.86 4.49E-18 9 Response to metal ion GO:0016143 3.13 1.15E-17 4 S-glycoside metabolic process GO:0019757 3.13 1.15E-17 4 Glycosinolate metabolic process GO:0019760 3.13 1.15E-17 4 Glucosinolate metabolic process GO:0006952 1.59 1.36E-17 11 Defense response GO:0005975 1.48 1.64E-17 13 Carbohydrate metabolic process GO:0009628 1.17 6.67E-17 18 Response to abiotic stimulus GO:0009607 1.49 1.24E-16 12 Response to biotic stimulus GO:0051707 1.49 2.36E-16 12 Response to other organism GO:0006790 2.45 3.19E-16 5 Sulfur metabolic process GO:0009611 2.36 9.08E-15 5 Response to wounding GO:0051704 1.30 4.60E-14 13 Multi-organism process GO:0044283 1.59 8.36E-14 9 Small molecule biosynthetic process GO:0008152 0.41 5.47E-13 56 Metabolic process GO:0044262 1.67 1.10E-12 8 Cellular carbohydrate metabolic process GO:0009605 1.73 7.82E-12 7 Response to external stimulus GO:0009753 2.29 1.06E-11 4 Response to jasmonic acid stimulus GO:0009266 1.58 2.51E-11 8 Response to temperature stimulus GO:0010043 2.70 3.23E-11 3 Response to zinc ion GO:0006030 2.31 9.64E-11 4 Chitin metabolic process GO:0006022 2.29 1.39E-10 4 Aminoglycan metabolic process 17 GO:0044036 2.18 4.61E-10 4 Cell wall macromolecule metabolic process GO:0009409 1.67 5.73E-10 6 Response to cold GO:0044281 1.04 5.85E-10 14 Small molecule metabolic process GO:0046686 1.68 7.44E-10 6 Response to cadmium ion GO:0006037 2.33 8.66E-10 4 Cell wall chitin metabolic process GO:0071555 2.33 8.66E-10 4 Cell wall organization GO:0010383 2.25 1.73E-09 4 Cell wall polysaccharide metabolic process GO:0016138 2.72 2.24E-08 3 Glycoside biosynthetic process GO:0055114 1.19 2.30E-08 10 Oxidation reduction GO:0016144 3.13 2.68E-08 2 S-glycoside biosynthetic process GO:0019758 3.13 2.68E-08 2 Glycosinolate biosynthetic process GO:0019761 3.13 2.68E-08 2 Glucosinolate biosynthetic process GO:0005976 1.77 2.96E-08 5 Polysaccharide metabolic process GO:0010033 0.91 3.74E-08 14 Response to organic substance GO:0044272 2.52 3.87E-08 3 Sulfur compound biosynthetic process GO:0006629 1.31 4.34E-08 8 Lipid metabolic process GO:0071554 1.87 8.57E-08 4 Cell wall organization or biogenesis GO:0009308 1.38 1.12E-07 7 Amine metabolic process GO:0016053 1.62 2.00E-07 5 Organic acid biosynthetic process GO:0046394 1.62 2.00E-07 5 Carboxylic acid biosynthetic process GO:0016145 3.21 2.16E-07 2 S-glycoside catabolic process GO:0019759 3.21 2.16E-07 2 Glycosinolate catabolic process GO:0019762 3.21 2.16E-07 2 Glucosinolate catabolic process GO:0016139 2.94 2.24E-07 2 Glycoside catabolic process GO:0009058 0.53 2.84E-07 30 Biosynthetic process GO:0044238 0.37 3.22E-07 46 Primary metabolic process GO:0009414 1.67 6.66E-07 5 Response to water deprivation GO:0044273 3.08 7.88E-07 2 Sulfur compound catabolic process GO:0080028 3.39 8.63E-07 2 Nitrile biosynthetic process GO:0042398 1.93 8.77E-07 4 Cellular amino acid derivative biosynthetic process GO:0019438 1.86 1.21E-06 4 Aromatic compound biosynthetic process GO:0009415 1.63 1.29E-06 5 Response to water GO:0050898 3.32 1.61E-06 2 Nitrile metabolic process GO:0080027 3.32 1.61E-06 2 Response to herbivore GO:0044249 0.51 1.89E-06 29 Cellular biosynthetic process GO:0006575 1.68 2.49E-06 4 Cellular amino acid derivative metabolic process GO:0050832 1.93 2.90E-06 3 Defense response to fungus GO:0016051 1.72 4.12E-06 4 Carbohydrate biosynthetic process GO:0006519 1.30 4.79E-06 6 Cellular amino acid and derivative metabolic process GO:0009699 2.14 6.73E-06 3 Phenylpropanoid biosynthetic process GO:0034637 1.82 8.96E-06 4 Cellular carbohydrate biosynthetic process GO:0019752 1.15 1.21E-05 7 Carboxylic acid metabolic process GO:0043436 1.15 1.21E-05 7 Oxoacid metabolic process GO:0006082 1.14 1.31E-05 7 Organic acid metabolic process GO:0016052 1.82 1.51E-05 3 Carbohydrate catabolic process GO:0009698 1.94 1.90E-05 3 Phenylpropanoid metabolic process GO:0042180 1.13 1.96E-05 7 Cellular ketone metabolic process GO:0006631 1.83 2.36E-05 3 Fatty acid metabolic process GO:0044271 1.49 2.56E-05 5 Cellular nitrogen compound biosynthetic process GO:0006725 1.45 3.46E-05 5 Cellular aromatic compound metabolic process GO:0033037 3.32 3.87E-05 1 Polysaccharide localization GO:0051716 1.04 3.88E-05 8 Cellular response to stimulus GO:0009719 0.91 3.96E-05 10 Response to endogenous stimulus GO:0042742 1.60 4.78E-05 4 Defense response to bacterium GO:0009987 0.26 5.97E-05 54 Cellular process GO:0006979 1.50 8.26E-05 4 Response to oxidative stress GO:0032787 1.40 1.19E-04 5 Monocarboxylic acid metabolic process GO:0052543 3.39 1.20E-04 1 Callose deposition in cell wall GO:0052386 3.34 1.64E-04 1 Cell wall thickening GO:0009620 1.42 1.89E-04 4 Response to fungus GO:0044275 1.81 2.11E-04 3 Cellular carbohydrate catabolic process GO:0007155 2.74 2.13E-04 2 Cell adhesion GO:0022610 2.74 2.13E-04 2 Biological adhesion GO:0052545 3.30 2.21E-04 1 Callose localization GO:0009664 2.46 2.45E-04 2 Plant-type cell wall organization GO:0006633 1.96 4.90E-04 2 Fatty acid biosynthetic process GO:0009269 3.17 5.11E-04 1 Response to desiccation GO:0034641 1.10 9.25E-04 6 Cellular nitrogen compound metabolic process GO:0042430 2.48 1.50E-03 2 Indole and derivative metabolic process GO:0042434 2.48 1.50E-03 2 Indole derivative metabolic process 18 GO:0071669 1.96 1.90E-03 2 Plant-type cell wall organization or biogenesis GO:0006807 0.47 2.20E-03 21 Nitrogen compound metabolic process GO:0044255 1.19 2.50E-03 5 Cellular lipid metabolic process GO:0042435 2.52 3.20E-03 1 Indole derivative biosynthetic process GO:0009908 1.31 3.20E-03 4 Flower development GO:0052482 3.23 1.00E-02 1 Cell wall thickening during defense response GO:0052544 3.23 1.00E-02 1 Callose deposition in cell wall during defense response GO:0042343 3.54 1.00E-02 1 Indole glucosinolate metabolic process GO:0010143 3.99 1.00E-02 1 Cutin biosynthetic process GO:0007275 0.54 1.00E-02 15 Multicellular organismal development GO:0005985 2.88 1.00E-02 1 Sucrose metabolic process GO:0052542 3.13 1.00E-02 1 Callose deposition during defense response GO:0031668 1.73 2.00E-02 2 Cellular response to extracellular stimulus GO:0071496 1.73 2.00E-02 2 Cellular response to external stimulus GO:0009759 3.86 2.00E-02 1 Indole glucosinolate biosynthetic process GO:0080119 3.86 2.00E-02 1 ER body organization GO:0009684 3.39 2.00E-02 1 Indoleacetic acid biosynthetic process GO:0044237 0.25 2.00E-02 40 Cellular metabolic process GO:0033554 1.12 2.00E-02 4 Cellular response to stress GO:0032501 0.51 2.00E-02 15 Multicellular organismal process GO:0009408 1.68 2.00E-02 2 Response to heat GO:0009683 3.32 2.00E-02 1 Indoleacetic acid metabolic process GO:0032502 0.50 3.00E-02 15 Developmental process GO:0031669 1.80 3.00E-02 2 Cellular response to nutrient levels GO:0009751 1.60 3.00E-02 2 Response to salicylic acid stimulus GO:0042545 1.77 4.00E-02 2 Cell wall modification GO:0009991 1.61 4.00E-02 2 Response to extracellular stimulus GO:0006869 1.73 5.00E-02 2 Lipid transport Down-regulated specifically in khd1-1 GO:0006259 2.56 2.35E-17 9 Cellular DNA metabolic process GO:0006139 1.15 6.27E-16 27 Cellular nucleobase, nucleoside, nucleotide, and nucleic acid metabolic process GO:0006807 0.90 1.11E-10 28 Nitrogen compound metabolic process GO:0006260 3.06 3.86E-10 4 Cellular DNA replication GO:0022402 2.46 5.21E-06 4 Cell cycle process GO:0007049 2.01 6.90E-05 4 Cell cycle GO:0048367 1.89 6.92E-05 5 Shoot development GO:0022621 1.87 9.28E-05 5 Shoot system development GO:0044260 0.49 9.93E-05 36 Cellular macromolecule metabolic process GO:0006261 3.18 1.37E-04 2 DNA-dependent DNA replication GO:0048827 2.05 1.90E-04 4 Phyllome development GO:0043170 0.44 3.85E-04 39 Macromolecule metabolic process GO:0006281 2.13 7.89E-04 3 DNA repair GO:0034984 2.13 8.39E-04 3 Cellular response to DNA damage stimulus GO:0009987 0.30 1.20E-03 55 Cellular process GO:0016070 0.93 1.30E-03 12 Cellular RNA metabolic process GO:0006974 2.07 1.40E-03 3 Response to DNA damage stimulus GO:0022403 2.48 1.50E-03 3 Cell cycle phase GO:0031323 0.84 1.70E-03 14 Regulation of cellular metabolic process GO:0044237 0.37 1.90E-03 44 Cellular metabolic process GO:0051171 0.85 2.80E-03 13 Regulation of nitrogen compound metabolic process GO:0019219 0.84 3.80E-03 13 Regulation of cellular nucleobase, nucleoside, nucleotide, and nucleic acid metabolic process GO:0009887 2.03 4.20E-03 3 Organ morphogenesis GO:0044238 0.34 4.30E-03 45 Primary metabolic process GO:0019222 0.75 1.00E-02 15 Regulation of metabolic process GO:0031326 0.80 1.00E-02 13 Regulation of cellular biosynthetic process GO:0009889 0.80 1.00E-02 13 Regulation of biosynthetic process GO:0006350 0.79 1.00E-02 13 Cellular transcription GO:0061018 0.79 1.00E-02 13 Transcription GO:0008152 0.28 1.00E-02 51 Metabolic process GO:0010467 0.56 1.00E-02 21 Gene expression GO:0080090 0.77 1.00E-02 13 Regulation of primary metabolic process GO:0048608 0.95 1.00E-02 9 Reproductive structure development GO:0007126 2.83 1.00E-02 2 Meiosis GO:0051327 2.83 1.00E-02 2 M phase of meiotic cell cycle GO:0000279 2.43 2.00E-02 2 M phase GO:0045449 0.79 2.00E-02 12 Regulation of cellular transcription GO:0061019 0.79 2.00E-02 12 Regulation of transcription GO:0010556 0.78 2.00E-02 12 Regulation of macromolecule biosynthetic process 19 GO:0048366 1.83 2.00E-02 3 Leaf development GO:0022414 0.85 2.00E-02 11 Reproductive process GO:0010468 0.74 2.00E-02 13 Regulation of gene expression GO:0060255 0.73 2.00E-02 14 Regulation of macromolecule metabolic process GO:0009451 2.20 3.00E-02 2 RNA modification GO:0032501 0.64 3.00E-02 16 Multicellular organismal process GO:0000003 0.83 3.00E-02 11 Reproduction GO:0007275 0.64 3.00E-02 16 Multicellular organismal development GO:0007017 2.16 3.00E-02 2 Microtubule-based process GO:0042254 1.84 3.00E-02 3 Ribosome biogenesis GO:0009888 1.49 4.00E-02 4 Tissue development GO:0003006 0.86 5.00E-02 9 Reproductive developmental process Down-regulated specifically in spen3-1 GO:0023046 1.18 3.00E-02 10 Signaling process GO:0023060 1.18 3.00E-02 10 Signal transmission GO:0007623 2.80 5.00E-02 3 Circadian rhythm GO:0048511 2.80 5.00E-02 3 Rhythmic process Up-regulated in hub1-4 and khd1-1 GO:0050896 1.15 1.09E-25 42 Response to stimulus GO:0009725 2.00 1.78E-24 20 Response to hormone stimulus GO:0010033 1.67 7.16E-24 25 Response to organic substance GO:0009719 1.91 8.64E-24 20 Response to endogenous stimulus GO:0009733 2.76 2.17E-23 12 Response to auxin stimulus GO:0042221 1.27 9.13E-18 28 Response to chemical stimulus GO:0009741 3.53 2.69E-09 4 Response to brassinosteroid stimulus GO:0023052 1.26 9.32E-08 15 Signaling GO:0032870 2.25 1.09E-07 6 Cellular response to hormone stimulus GO:0007165 1.43 1.25E-07 12 Signal transduction GO:0009755 2.24 3.00E-07 6 Hormone-mediated signaling pathway GO:0051704 1.32 4.12E-07 13 Multi-organism process GO:0009607 1.42 4.20E-07 11 Response to biotic stimulus GO:0023046 1.38 4.87E-07 12 Signaling process GO:0023060 1.38 4.87E-07 12 Signal transmission GO:0051707 1.43 5.50E-07 11 Response to other organism GO:0071495 2.10 1.00E-06 6 Cellular response to endogenous stimulus GO:0007242 1.61 1.34E-06 9 Intracellular signaling cascade GO:0051716 1.43 1.97E-06 10 Cellular response to stimulus GO:0006952 1.44 2.24E-06 10 Defense response GO:0065008 1.51 3.19E-06 9 Regulation of biological quality GO:0009606 3.47 3.45E-06 3 Tropism GO:0006468 1.39 5.67E-06 10 Protein amino acid phosphorylation GO:0065007 0.72 8.30E-06 27 Biological regulation GO:0006796 1.25 1.70E-05 11 Phosphate metabolic process GO:0006793 1.24 1.78E-05 11 Phosphorus metabolic process GO:0071310 1.83 2.12E-05 6 Cellular response to organic substance GO:0055085 1.59 4.24E-05 7 Transmembrane transport GO:0006464 1.00 4.57E-05 15 Protein modification process GO:0043687 1.12 4.94E-05 13 Post-translational protein modification GO:0016310 1.24 7.49E-05 10 Phosphorylation GO:0006950 0.80 1.07E-04 20 Response to stress GO:0009630 3.39 1.44E-04 2 Gravitropism GO:0070887 1.66 2.05E-04 6 Cellular response to chemical stimulus GO:0008219 1.90 4.16E-04 5 Cell death GO:0016265 1.90 4.16E-04 5 Death GO:0016049 1.83 4.56E-04 5 Cell growth GO:0009639 2.17 4.97E-04 4 Response to red or far red light GO:0009629 3.18 5.31E-04 2 Response to gravity GO:0043412 0.89 6.22E-04 15 Macromolecule modification GO:0012501 1.97 7.42E-04 4 Programmed cell death GO:0008361 1.76 9.31E-04 5 Regulation of cell size GO:0032535 1.74 1.20E-03 5 Regulation of cellular component size GO:0090066 1.74 1.20E-03 5 Regulation of anatomical structure size GO:0051179 0.90 1.40E-03 14 Localization GO:0040007 1.61 1.70E-03 5 Growth GO:0048589 1.81 1.80E-03 5 Developmental growth GO:0006810 0.90 1.90E-03 14 Transport GO:0009638 4.44 1.90E-03 1 Phototropism GO:0051234 0.90 2.10E-03 14 Establishment of localization 20 GO:0050789 0.63 2.40E-03 23 Regulation of biological process GO:0009605 1.49 2.60E-03 6 Response to external stimulus GO:0080086 5.03 3.20E-03 1 Stamen filament development GO:0009692 3.76 3.80E-03 1 Ethylene metabolic process GO:0009693 3.76 3.80E-03 1 Ethylene biosynthetic process GO:0043449 3.71 4.70E-03 1 Cellular alkene metabolic process GO:0043450 3.71 4.70E-03 1 Alkene biosynthetic process GO:0050832 1.99 1.00E-02 4 Defense response to fungus GO:0050794 0.64 1.00E-02 20 Regulation of cellular process GO:0042742 1.71 1.00E-02 4 Defense response to bacterium GO:0009742 3.16 1.00E-02 2 Brassinosteroid mediated signaling pathway GO:0043401 3.16 1.00E-02 2 Steroid hormone mediated signaling pathway GO:0048545 3.16 1.00E-02 2 Response to steroid hormone stimulus GO:0071367 3.16 1.00E-02 2 Cellular response to brassinosteroid stimulus GO:0071383 3.16 1.00E-02 2 Cellular response to steroid hormone stimulus GO:0044042 2.26 2.00E-02 3 Glucan metabolic process GO:0010359 4.44 2.00E-02 1 Regulation of anion channel activity GO:0022898 4.44 2.00E-02 1 Regulation of transmembrane transporter activity GO:0032409 4.44 2.00E-02 1 Regulation of transporter activity GO:0032412 4.44 2.00E-02 1 Regulation of ion transmembrane transporter activity GO:0034762 4.44 2.00E-02 1 Regulation of transmembrane transport GO:0034765 4.44 2.00E-02 1 Regulation of ion transmembrane transport GO:0044070 4.44 2.00E-02 1 Regulation of anion transport GO:0009416 1.21 2.00E-02 7 Response to light stimulus GO:0000902 1.66 2.00E-02 4 Cell morphogenesis GO:0009314 1.18 3.00E-02 7 Response to radiation GO:0005976 1.55 3.00E-02 4 Polysaccharide metabolic process GO:0010200 1.72 4.00E-02 4 Response to chitin Up-regulated in hub1-4 and spen3-1 GO:0050896 1.39 2.17E-08 50 Response to stimulus GO:0042221 1.49 4.43E-05 33 Response to chemical stimulus GO:0006952 2.27 6.45E-05 18 Defense response GO:0010033 1.64 8.04E-04 24 Response to organic substance GO:0051704 1.90 8.14E-04 19 Multi-organism process GO:0051707 2.03 1.20E-03 17 Response to other organism GO:0009607 2.00 1.60E-03 17 Response to biotic stimulus GO:0065008 2.18 2.00E-03 15 Regulation of biological quality GO:0012501 3.05 2.30E-03 9 Programmed cell death GO:0006950 1.31 3.70E-03 28 Response to stress GO:0009626 4.13 4.50E-03 6 Plant-type hypersensitive response GO:0042592 2.92 4.60E-03 9 Homeostatic process GO:0034050 4.11 4.70E-03 6 Host programmed cell death induced by symbiont GO:0009719 1.76 1.00E-02 18 Response to endogenous stimulus GO:0008219 2.83 1.00E-02 9 Cell death GO:0016265 2.83 1.00E-02 9 Death GO:0009987 0.52 4.00E-02 65 Cellular process Up-regulated specifically in hub1-4 GO:0050896 0.82 3.06E-11 34 Response to stimulus GO:0006950 0.69 2.10E-03 19 Response to stress GO:0065007 0.56 3.30E-03 25 Biological regulation GO:0007623 2.53 1.00E-02 2 Circadian rhythm GO:0048511 2.53 1.00E-02 2 Rhythmic process GO:0009987 0.27 1.00E-02 55 Cellular process GO:0023052 0.86 1.00E-02 11 Signaling GO:0016310 1.00 1.00E-02 9 Phosphorylation GO:0000160 2.43 2.00E-02 2 Two-component signal transduction system (phosphorelay) GO:0006796 0.94 2.00E-02 9 Phosphate metabolic process GO:0006793 0.94 2.00E-02 9 Phosphorus metabolic process GO:0006468 1.03 2.00E-02 8 Protein amino acid phosphorylation GO:0044237 0.32 3.00E-02 42 Cellular metabolic process Up-regulated specifically in khd1-1 GO:0050896 1.1 3.53E-19 41 Response to stimulus GO:0042221 1.23 1.19E-13 28 Response to chemical stimulus GO:0006950 1.19 4.49E-12 26 Response to stress GO:0010033 1.21 1.28E-07 18 Response to organic substance GO:0006979 2.11 4.37E-06 6 Response to oxidative stress GO:0006952 1.41 7.54E-05 10 Defense response 21 GO:0065007 0.71 1.15E-04 27 Biological regulation GO:0009741 3.17 1.55E-04 3 Response to brassinosteroid stimulus GO:0040007 1.77 4.93E-04 6 Growth GO:0009607 1.27 5.13E-04 10 Response to biotic stimulus GO:0009628 0.97 6.55E-04 15 Response to abiotic stimulus GO:0051707 1.27 7.53E-04 10 Response to other organism GO:0051704 1.14 1.10E-03 11 Multi-organism process GO:0009651 1.45 1.20E-03 8 Response to salt stress GO:0006970 1.41 1.30E-03 8 Response to osmotic stress GO:0065008 1.36 1.70E-03 8 Regulation of biological quality GO:0009719 1.09 2.80E-03 11 Response to endogenous stimulus GO:0016049 1.83 3.00E-03 5 Cell growth GO:0050832 2.11 4.30E-03 4 Defense response to fungus GO:0009725 1.11 4.30E-03 11 Response to hormone stimulus GO:0008361 1.77 1.00E-02 5 Regulation of cell size GO:0006869 2.41 1.00E-02 3 Lipid transport GO:0032535 1.75 1.00E-02 5 Regulation of cellular component size GO:0090066 1.75 1.00E-02 5 Regulation of anatomical structure size GO:0019748 1.52 1.00E-02 6 Secondary metabolic process GO:0050789 0.63 1.00E-02 23 Regulation of biological process GO:0023052 0.96 1.00E-02 12 Signaling GO:0010876 2.25 2.00E-02 3 Lipid localization GO:0032502 0.72 2.00E-02 18 Developmental process GO:0050794 0.65 2.00E-02 21 Regulation of cellular process GO:0055114 1.09 3.00E-02 9 Oxidation reduction GO:0006810 0.85 3.00E-02 13 Transport GO:0051234 0.84 4.00E-02 13 Establishment of localization Up-regulated specifically in spen3-1 GO:0050896 0.79 3.05E-05 33 Response to stimulus GO:0042221 1.01 3.68E-05 24 Response to chemical stimulus GO:0009607 1.42 8.29E-04 11 Response to biotic stimulus GO:0051707 1.40 0.0015 11 Response to other organism GO:0008152 0.40 0.0037 56 Metabolic process GO:0009628 1.01 0.01 16 Response to abiotic stimulus GO:0051704 1.19 0.01 12 Multi-organism process GO:0055114 1.29 0.01 10 Oxidation reduction GO:0042542 3.43 0.01 2 Response to hydrogen peroxide GO:0015893 3.05 0.02 3 Drug transport GO:0042493 3.04 0.02 3 Response to drug GO:0006979 1.89 0.02 6 Response to oxidative stress GO:0000302 2.96 0.02 3 Response to reactive oxygen species GO:0010035 1.43 0.03 8 Response to inorganic substance 22 Table S3. Primer sequences Gene AGI code Primer Forward Primer Sequence Reverse Primer Sequence set Real-time qPCR SPEN3 At1g27750 CCCTGCATCAAGTCCCATGT ACCGATCAAGCATTCCGAGG KHD1 At1g51580 CCCCATTTGGACCGAGACAA CCAGGACCATGACAATGCCT CCA1 At2g46830 CCATGGAAGCCAAAGAAAGT GGAAGCTTGAGTTTCCAACC PP2A At1g13320 TAACGTGGCCAAAATGATGC GTTCTCCACAACCGCTTGGT UBC At5g25760 CTGCGACTCAGGGAATCTTCTAA TTGTGCCATTGAATTGAACCC FLC At5g10140 CCTCTCCGTGACTAGAGCCAAG AGGTGACATCTCCATCTCAGCTTC FLC2 TTTGTCCAGCAGGTGACATC AGCCAAGAAGACCGAACTCA totalCOOLAIR GCCGTAGGCTTCTTCACTGT TGTATGTGTTCTTCACTTCTGTCAA proxCOOLAIR CACACCACCAAATAACAACCA TTTTTTTTTTTTTTTACTGCTTCCA distCOOLAIR GGGGTAAACGAGAGTGATGC TTTTTTTTTTTTTTTGCGGTACAC CCA1α GATCTGGTTATTAAGACTCGGAAGCCATATAC GCCTCTTTCTCTACCTTGGAGA CCA1β GAATGTTCCTTGTGATAAGCCATAGAGG AGGATCGTTCCACTTCCCGTCTT At1g77920 CGAGTCCACGCATTATCCCA CCTCGAGCCGATTGTCTTGT At1g77930 TCGAGCTTGATACCGAAGCAG AGAGACAGAGAGGGAGCAAGT ChIP-qPCR CCA1 At2g46830 P1 GAACAAGTTGATGTTAAGATGGAC GGAGAAATCTCAGCCACTATAATTATC P2 GAAGTTGTGTAGAGGAGCTTAGTG CTTCCTCAGTCCACCTTTCACGTTGC P3 ATCCTCGAAAGACGGGAAGT GTCGATCTTCATTGGCCATC P4 AAGGCTCGATCTTCACTGGA CCATCCTCTTGCCTTTCTGA P5 CTCAAGCTTCCACATGAGACTC GTTACAGGAAGACTATGGACAAG FLC At5g10140 P1 GTTCGGGAGATTAACACAAATAATAAAGG GAAAACAAGCTGATACAAGCATTTCAC P2 GCTGGACCTAACTAGGGGTGAAC CCTCTTTGGTACGGATCTATAATGAATC P3 CCTCTCCGTGACTAGAGCCAAG CTTCAACATGAGTTCGGTCTGC P4 CCTTGGATAGAAGACAAAAAGAGAAAGTG AGGTGACATCTCCATCTCAGCTTC Cloning KHD1N ACAGGATCCAAACGTCCGGCGACGACA ACAGTCGACTCAACTCGTCCCATGTTGGA RRMSPEN3 CACGGATCCACTCTACGGATCGTAGGAA CACGTCGACTCAAATCCTTTCACTGGATCAAA EMSA RNA AAAACAAAAUAGCACCGUAAAGCAC DNA AAAACAAAATACCAGCGTAAAGCAC 23 Supplemental dataset S1 (separate file) Protein Identification details obtained with the 4800 MALDI TOF/TOFTM Proteomics analyzer (AB SCIEX) and the GPS explorer v3.6 (AB SCIEX) software package combined with the search engine Mascot version 2.1 (Matrix Science) and database TAIR8. 24 Supporting references 1. Alonso JM, et al. (2003) Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 301(5633), 653-657 [Err. Science 301(5641), 1849]. 2. Rosso MG, et al. (2003) An Arabidopsis thaliana T-DNA mutagenized population (GABI- Kat) for flanking sequence tag-based reverse genetics. Plant Mol Biol 53(1-2), 247-259. 3. Sessions A, et al. (2002) A high-throughput Arabidopsis reverse genetics system. Plant Cell 14(12), 2985-2994. 4. Fleury D, et al. (2007) The Arabidopsis thaliana homolog of yeast BRE1 has a function in cell cycle regulation during early leaf and root growth. Plant Cell 19(2), 417-432. 5. Salomé PA, McClung R (2005) PSEUDO-RESPONSE REGULATOR7 and 9 are partially redundant genes essential for the temperature responsiveness of the Arabidopsis circadian clock. Plant Cell 17(3), 791-803. 6. Portolés S, Más P (2007) Altered oscillator function affects clock resonance and is responsible for the reduced day-length sensitivity of CKB4 overexpressing plants. Plant J 51(6), 966-977. 7. Dhondt S, et al. (2014) High-resolution time-resolved imaging of in vitro Arabidopsis rosette growth. Plant J 80(1), 172-184. 8. Skirycz A, et al. (2011) Survival and growth of Arabidopsis plants given limited water are not equal. Nat. Biotechnol 29(3), 212-214. 9. Clauw P, et al. (2015) Leaf responses to mild drought stress in natural variants of Arabidopsis. Plant Physiol 167(3), 800-816. [Corrigendum Plant Physiol. 168(3), 1180]. 10. Coppens F, Wuyts N, Inzé D, Dhondt S (2017) Unlocking the potential of plant phenotyping data through integration and data-driven approaches. Curr Opin Syst Biol 4, 58-63. 11. Moore A, Zielinski T, Millar AJ (2014) Online period estimation and determination of rhythmicity in circadian data, using the BioDare data infrastructure. Methods Mol Biol 1158, 13-44. 12. Van Bel M, et al. (2012) Dissecting plant genomes with the PLAZA comparative genomics platform. Plant Physiol 158(2), 590-600. 13. Bruno L, et al. (2011) Multi-probe in situ hybridization to whole mount Arabidopsis seedlings. Int J Dev Biol 55 (2), 197-203. 14. Casamitjana-Martínez E, et al. (2003) Root-specific CLE19 overexpression and the sol1/2 suppressors implicate a CLV-like pathway in the control of Arabidopsis root meristem maintenance. Curr Biol 13(16), 1435-1441. 15. Rigaut G, et al. (1999) A generic protein purification method for protein complex characterization and proteome exploration. Nat Biotechnol 17(10), 1030-1032. 16. Bürckstümmer T, et al. (2006) An efficient tandem affinity purification procedure for interaction proteomics in mammalian cells. Nat Methods 3(12), 1013-1019. 17. Van Leene J, et al. (2007) A tandem affinity purification-based technology platform to study the cell cycle interactome in Arabidopsis thaliana. Mol Cell Proteomics 6(7), 1226-1238. 18. Van Leene J, et al. (2010) Targeted interactomics reveals a complex core cell cycle machinery in Arabidopsis thaliana. Mol Syst Biol 6(1), 397. 19. Krohn NM, Yanagisawa S, Grasser KD (2002) Specificity of the stimulatory interaction between chromosomal HMGB proteins and the transcription factor Dof2 and its negative regulation by protein kinase CK2-mediated phosphorylation. J Biol Chem 277(36), 32438- 32444. 20. Kammel C, et al. (2013) Arabidopsis DEAD-box RNA helicase UAP56 interacts with both RNA and DNA as well as with mRNA export factors. PLoS ONE 8(3), e60644. 21. Shen J, Zhang L, Zhao R (2007) Biochemical characterization of the ATPase and helicase activity of UAP56, an essential pre-mRNA splicing and mRNA export factor. J Biol Chem 282(31), 22544-22550. 25 22. Cao Y, Dai Y, Cui S, Ma L (2008) Histone H2B monoubiquitination in the chromatin of FLOWERING LOCUS C regulates flowering time in Arabidopsis. Plant Cell 20(10), 2586- 2602. 23. Guindon S, et al. (2010) New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0. Syst Biol 59(3), 307–321. 24. Guindon S, Gascuel O (2003) A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst Biol 52(5), 696-704. 25. Ronquist F, et al. (2012) MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Syst Biol 61(3), 539-542. 26. Kumar S, Stecher G, Li M, Knyaz C, Tamura K (2018) MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol Biol Evol 35(6), 1547-1549. 26