This is the accepted version of the article: Guan, Dailu; Mármol-Sánchez, Emilio; Cardoso, Tainã Figueiredo; [et al.]. «Genomic analysis of the origins of extant casein variation in goats». Journal of Dairy Science, Vol. 102, issue 6 (June 2019), p. 5230-5241. DOI 10.3168/jds.2018- 15281 This version is avaible at https://ddd.uab.cat/record/221270 under the terms of the license 1 INTERPRETIVE SUMMARY: A genomic analysis about the origins of extant 2 casein variation in goats. By Guan et al., Genetic variation in the casein loci has 3 multiple effects on milk protein composition and other dairy traits. Here, we have 4 investigated whether the emergence of caprine casein variation predates goat 5 domestication by comparing casein diversity of bezoars (wild goats) and domestic goats. 6 Our results show that much of the casein diversity is shared between both groups, 7 indicating that probably a significant part of casein polymorphisms already segregated 8 in the wild ancestor of domestic goats. 9 10 RUNNING HEAD: ORIGINS OF GOAT CASEIN VARIATION 11 12 A genomic analysis about the origins of extant casein variation in goats 13 14 D. Guan,* E. Mármol-Sánchez,* T. F. Cardoso,*† X. Such,‡ V. Landi,§ N. R. 15 Tawari,# and M. Amills*‡1 16 17 * Department of Animal Genetics, Centre for Research in Agricultural Genomics 18 (CRAG), CSIC-IRTA-UAB-UB, Campus Universitat Autònoma de Barcelona, 19 Bellaterra 08193, Spain 20 † CAPES Foundation, Ministry of Education of Brazil, Brasilia D.F, 70.040-020 Brazil 21 ‡ Departament de Ciència animal i dels Aliments, Facultat de Veterinària, Universitat 22 Autònoma de Barcelona, Bellaterra 08193, Spain 23 § Departamento de Genética, Universidad de Córdoba, Córdoba 14071, Spain 1 24 # Computational and Systems Biology, Genome Institute of Singapore, 60 Biopolis 25 Street, Genome, #02-01, Singapore 138672 26 1 27 Corresponding author: marcel.amills@uab.cat 28 2 29 ABSTRACT 30 31 The variation of the casein genes has a strong impact on the milk composition of 32 goats. Despite the fact that many casein polymorphisms have been identified so far, we 33 do not know yet whether they are evolutionary ancient (i.e. they existed before 34 domestication) or young (i.e. they emerged after domestication). Herewith, we have 35 identified casein polymorphisms in a data set of 106 caprine whole-genome sequences 36 corresponding to bezoars (Capra aegagrus, the ancestor of domestic goats) and four 37 domestic goat (Capra hircus) populations from Europe (EU), Africa (AF), Far East (FE) 38 and Near East (NE). Domestic and wild goat populations shared a substantial amount of 39 casein SNPs i.e. from 36.1% (CSN2) to 55.1% (CSN1S2). The comparison of casein 40 variation amongst bezoars and the four domestic goat populations (EU, AF, FE and NE) 41 also evidenced that more than 50% of the casein SNPs are shared by two or more 42 populations, and 18-44% are shared by all populations. Moreover, the majority of casein 43 alleles reported in domestic goats also segregate in the bezoar, including several alleles 44 displaying significant associations with milk composition (e.g. A/B alleles of the 45 CSN1S1 and CSN3 genes, A-allele of the CSN2 gene). We conclude that much of the 46 current diversity of the caprine casein genes comes from ancient standing variation 47 segregating in the ancestor of modern domestic goats. 48 49 Key words: Domestication, standing variation, next generation sequencing, single 50 nucleotide polymorphism 3 51 INTRODUCTION 52 53 Caseins represent 80% of the protein content of milk and they have a strong 54 impact on dairy traits as well as on cheese yield and texture (Remeuf et al., 1991). Goat 55 caseins αS1, αS2, β and κ are encoded by the CSN1S1, CSN1S2, CSN2 and CSN3 genes, 56 respectively, which map to a 250 kb region on chromosome 6 in the order CSN1S1- 57 CSN2-CSN1S2-CSN3 (Rijnkels, 2002). The polymorphism of these four genes has been 58 implicated in the variation of milk yield and composition (protein and fat contents) as 59 well as in the determination of milk rheological properties and the yield and 60 organoleptic attributes of cheese (revised in Martin et al., 1999, Moioli et al., 2007, 61 Amills et al., 2012). 62 The domestication of the bezoar (Capra aegagrus) in the Fertile Crescent 10,000 63 years before present (YBP) gave birth to domestic goats (Capra hircus), an important 64 economic resource in developing countries (Zeder and Hesse 2000, Naderi et al., 2008). 65 Despite the fact that many reports describing the variability of the goat casein genes 66 have been published so far (Martin et al., 2002, Moioli et al., 2007, Amills, 2014), we 67 do not know yet if casein polymorphisms are evolutionary ancient (i.e. they existed 68 before domestication) or young (i.e. they emerged after domestication). Herewith, we 69 have addressed this question by identifying casein polymorphisms from 106 caprine 70 whole-genome sequences and comparing the allelic variation of the four casein genes in 71 (1) two populations: bezoars and domestic goats, (2) five populations: bezoars and four 72 groups of domestic goats from Europe (EU), Africa (AF), Far East (FE) and Near East 73 (NE). In this way, we aimed to find out whether extant genetic variation in the goat 74 casein genes was already present before domestication (as standing variation 4 75 segregating in the bezoar) or if it emerged in the context of the evolutionary processes 76 that took place during and well after domestication. 77 78 MATERIALS AND METHODS 79 80 Retrieval of Goat Whole-Genome Sequences 81 82 Whole genome sequences from 110 wild and domestic goats (Becker et al., 2014, 83 Benjelloun et al., 2015, Reber et al., 2015, Menzi et al., 2016, Wang et al., 2016, Li et 84 al., 2017, Alberto et al., 2018) were retrieved from the NCBI Sequence Read Archive 85 (SRA, https://www.ncbi.nlm.nih.gov/sra, Supplementary Table S1). More specifically, 86 this data set included genome sequences from bezoars (N=22) as well as 4 domestic 87 goat populations from Europe (Alpine, N=2; Chamois Colored, N=2; Grisons Striped, 88 N=1; Saanen, N=6; Coppernecked, N=1; Tessin Grey, N=1), Africa (local Moroccan 89 population, N=20), Far East (Inner Mongolia Cashmere goat, N=9, Liaoning Cashmere 90 goat, N=10; Tibetan goat, N=16) and Near East (local Iranian breed, N=20). We 91 retrieved all goat genome sequences that were available at the moment of initiating our 92 experiment. All raw data in SRA format were converted into the fastq format by using 93 the fastq-dump 2.8.2 tool available in the SRA-toolkits package 94 (https://www.ncbi.nlm.nih.gov/sra/docs/ toolkitsoft/). 95 96 Discovery and Annotation of Genomic Variants 97 98 In order to obtain high quality single nucleotide polymorphisms (SNPs) and 99 insertion/deletions (INDELs), fastq files were filtered with the Trimommatic software 5 100 (version 0.36, Bolger et al., 2014). Only paired-end reads were used in the alignment 101 step. Sequences were aligned to the goat reference genome (ARS1, Bickhart et al., 2017) 102 with the BWA MEM algorithm with default settings (Li, 2013). Files with Sequence 103 Alignment Map (SAM) format were sorted and converted into binary format to remove 104 PCR duplicates and to realign INDEL regions with the Picard tool 105 (https://broadinstitute.github.io/picard/). The HaplotypeCaller function of the Genome 106 Analysis Toolkit (GATK, version 3.8) was employed to generate vcf files by 107 considering default parameters (McKenna et al., 2010). Finally, a hard filtering step was 108 performed by following the GATK Best Practices recommendations. The SNP dataset 109 was then imputed and phased by using the Beagle 4.1 software (Browning et al., 2016) 110 in order to improve genotype calls based on genotype likelihoods. 111 112 Investigation of Population Structure 113 114 We have used the autosomal SNPs identified with GATK (McKenna et al., 2010) 115 to investigate the population structure of bezoars and domestic goats. A thinned set of 116 autosomal SNPs was selected with the command “--hwe 0.001 --maf 0.05 --geno 0.3 -- 117 indep-pairwise 50 5 0.2” of the PLINK v1.9 software (Purcell et al., 2007). Beforehand, 118 individuals with pi-hat values, estimated on the basis of an identity-by-descent (IBD) 119 matrix, above 0.4 were removed from the data set to avoid biases produced by 120 relatedness. By doing so, four individuals (2 European and 2 Far Eastern goats) were 121 excluded and the final data set was based on 106 caprine genomes. A neighbor-joining 122 tree was constructed with the MEGA7 software (Kumar et al., 2016) on the basis of an 123 identity-by-state (IBS) distance matrix (Purcell et al., 2007). Principal components 124 analyses (PCA) based on 11,226,125 SNPs with a whole-genome distribution and 1,221 6 125 SNPs mapping to the casein genes were performed with the PLINK v1.9 software 126 (Purcell et al., 2007) by using the flag “--pca” with default parameters. In addition, the 127 ADMIXTURE software (version 1.3.0, Alexander et al., 2009) was employed to 128 estimate population structure with a block relaxation algorithm. The K-values were set 129 from 2 to 5, and the K-value with the lowest cross-validation error was identified with 130 the method of Alexander and Lange (2011). Moreover, we repeated the ADMIXTURE 131 analysis by just considering a data set of 1,221 SNPs mapping to the casein genes. 132 133 Annotating the Variation of Caprine Casein Genes 134 135 The genomic coordinates of the goat casein genes (CSN1S1, CSN2, CSN1S2 and 136 CSN3) in the ARS1 reference genome (Bickhart et al., 2017), were used to retrieve 137 polymorphisms mapping to these four loci with VCFtools 1.8 (Danecek et al. 2011, 138 https://samtools.github.io/bcftools/bcftools.html). Casein polymorphisms were 139 classified and their effects were predicted with the SnpEff 4.3 software (Cingolani et al., 140 2012). Moreover, the SIFT Annotator (Vaser et al., 2015) was employed to predict 141 deleteriousness of missense SNPs. When the SIFT predicted score is less than 0.05, the 142 amino acid substitution is classified as deleterious (Vaser et al., 2015). Otherwise, it is 143 tolerated or neutral. By following the strategy outlined in Supplementary Figure S1, 144 we were able to convert sequence data into casein alleles or groups of alleles. Such 145 classification, which was based on information provided by Marletta et al. (2007), took 146 into account several missense mutations that are outlined in Supplementary Figure S1. 147 We were unable to discriminate between the B4 and E alleles of the CSN1S1 gene 148 because we could not trace the presence of the LINE insertion characteristic of the E- 149 allele (repetitive elements are usually filtered out before the alignment step). The 7 150 SnpEff 4.3 software did not detect any mutation introducing a premature stop codon, so 151 we did not identify null alleles in the casein genes. It is difficult to know whether this is 152 due to a biological reality (absence of null alleles in the analysed populations) or to an 153 annotation problem associated with SnpEff 4.3. On the other hand, the O1-allele and 154 O2-allele of the CSN1S1 gene are large copy number variants whose genomic 155 coordinates have not been reported at a fine resolution. Maybe they could be detected 156 with softwares such as Cn.MOPS or CNVnator, but the main limitation of our 157 experiment is that we have a very heterogeneous data set composed by whole-genome 158 sequences generated with different types of libraries, platforms and, more importantly, 159 coverages, so to detect copy number variants based on read depth would be quite 160 inaccurate. We have not used INDEL information to classify alleles because we 161 consider that INDEL calling from sequence data can be quite unreliable. Indeed, 162 O’Rawe et al. (2013) compared the concordance rates among INDELs detected by the 163 GATK Unified Genotyper (v1.5), SOAPindel (v1.0) and SAMtools (v0.1.18) and 164 concluded that there was just a 26.8% agreeing across all three softwares. Hasan et al. 165 (2015) compared the performance of seven INDEL calling tools and reported that the 166 number of common INDELs called by all seven tools was very low. By this reason, we 167 decided to report the B2, F and D alleles as a group. 168 The nucleotide diversity (π-value, average number of pairwise differences 169 between all individuals in the population) of the casein loci (based on 1,221 SNPs 170 mapping to casein genes) was calculated with the VCFtools software (Danecek et al. 171 2011) by using the “--site-pi” command. The same conditions were used to estimate 172 nucleotide diversity at the whole genome level. All results in this study were visualized 173 under the R software environment (https://www.r-project.org/). 174 8 175 RESULTS 176 177 Genome-wide Analysis of Population Structure 178 179 By using a data set of 106 whole-genome sequences (Supplementary Table S1) 180 from domestic goats and bezoars, a total of 31 billion paired-end reads were mapped to 181 the goat reference genome ARS1 (Bickhart et al., 2017). The average sequencing depth 182 was 9.92× and the average mapping rate > 99% (Supplementary Table S1). Analysis 183 of the sequence data with the GATK package (McKenna et al., 2010) made possible to 184 identify 51 million SNPs. The majority of these SNPs were biallelic, and only 509,001 185 sites displayed three or more alleles. Moreover, 35.17% of SNPs had MAFs > 0.05 186 (17.94 million), while rare (MAF between 0.01 and 0.05) and very rare (MAF < 0.01) 187 SNPs displayed frequencies of 29.72% and 36.74%, respectively. The average ratio of 188 transitions-to-transversions was 2.11 for the whole data set, a result consistent with 189 previous reports (Guan et al., 2016, Li et al., 2017). 190 After filtering, 11,226,125 autosomal SNPs were used to assess the population 191 structure of the 106 bezoars and domestic goats (four highly related individuals with pi- 192 hat values above 0.4 were removed). The PCA and the neighbor-joining tree (Figures 193 1a and 1b) evidenced that individuals clustered according to their geographic origin. In 194 the PCA, bezoars and domestic goats from the Near East occupy an intermediate 195 position between Far Eastern goats and those from Europe and Africa. Moreover, Far 196 Eastern domestic goats form a tight cluster, while bezoars have a more scattered 197 distribution (Figure 1b). At K=2, the Admixture analysis showed the existence of two 198 different backgrounds in domestic goats i.e. Africa/Europe vs Far East, while Near 199 Eastern goats displayed an intermediate or admixed background (Figure 2). At the K- 9 200 value with the lowest cross-validation error (K = 3), bezoars formed a distinctive group 201 clearly differentiated from domestic goats (Figure 2). At K=4, we observed the 202 existence of two genetically differentiated subgroups in Far Eastern goats, while at K=5 203 European and African goats displayed different genetic backgrounds (Figure 2). When 204 we repeated the PCA and Admixture analysis by using a panel of 1,221 SNPs mapping 205 to the casein genes, we observed a substantial weakening of population structure 206 (Supplementary Figure S2). This result might be due to the fact that this second 207 analysis is based on a very reduced set of SNPs (1,221 SNPs instead of the 11,226,125 208 SNPs employed in the first analysis). 209 210 Characterization of the Variation of the Goat Casein Genes 211 212 We identified hundreds of SNPs in the CSN1S1 (455 SNPs, 6 missense), CSN2 213 (194 SNPs, 5 missense), CSN1S2 (292 SNPs, 11 missense) and CSN3 (280 SNPs, 9 214 missense) genes (Table 1, Supplementary Tables S2-S4). In the four casein genes, the 215 broad majority of SNPs were intronic, and the second most abundant category was 216 represented by SNPs located in upstream and downstream genic regions 217 (Supplementary Table S4). The annotation of SNPs with the SnpEff software 218 (Cingolani et al., 2012) showed that the majority of casein polymorphisms are expected 219 to have low or moderate effects. Indeed, only one SNP (g.85982647G>A) affecting a 220 splice site in the CSN1S1 gene (G-allele) was predicted to have a high impact 221 (Supplementary Tables S2-S4). The SIFT annotator (Vaser et al., 2015) captured 222 additional missense SNPs predicted to be functionally relevant (Supplementary Tables 223 S2-S4). Additionally, the majority of casein SNPs identified in our investigation had 224 MAFs above 0.05 (47.1%), a result consistent with that obtained in the analysis of 10 225 genome-wide diversity. With regard to INDELs, we have found 81 in CSN1S1, 25 in 226 CSN2, 59 in CSN1S2 and 49 in CSN3 (Supplementary Table S2). However, we did not 227 use INDELs in subsequent analyses because INDEL calling is still an error-prone 228 process and the rate of false positives might be high due to alignment artifacts and to the 229 fact that most of the INDEL calling tools lack accurate methods for checking 230 sequencing errors before calling INDEL (Hasan et al. 2015). Indeed, concordance rates 231 of INDEL calls between algorithms and sequencing platforms are reportedly low (Fang 232 et al. 2014). 233 Casein SNP variation of bezoars and domestic goats was analysed (Figure 3). 234 Domestic and wild populations shared a substantial amount of casein SNPs i.e. from 235 36.1% (CSN2) to 55.1% (CSN1S2). The comparison of casein variation amongst the 236 five populations (bezoars and domestic goats from Europe, Africa, Near East and Far 237 East) also evidenced that more than 50% casein SNPs are shared by two or more 238 populations and 18%(CSN3) - 44% (CSN1S1) SNPs are shared by all populations 239 (Figure 3). Nucleotide diversity in the casein loci was quite similar in bezoar and 240 domestic goat populations (Figure 4a), with the exception of Far Eastern goats that 241 showed a reduced level of variation (t-test, P < 0.05). Moreover, the nucleotide 242 diversity of the casein loci happened to be higher (t-test, P < 0.001) than that observed 243 along the autosomal genome (Figure 4b). 244 We have used the pipeline reported in Supplementary Figure S1 to detect 245 casein alleles or groups of alleles based on sequence data (Table 1). In the CSN1S1 246 gene, the A/I/N/O group of alleles was quite frequent in all populations, with an average 247 frequency above 0.5. Moreover, we were able to detect combinations of SNPs that do 248 not correspond to any of the CSN1S1 alleles catalogued by Marletta et al. (2007) e.g. 249 H8P16Q77R100A195, H8L16Q77R100A195, H8P16Q77R100T195 and H8L16E77K100A195. These 11 250 novel haplotypes were especially frequent in Far Eastern goats. In the CSN1S2, CSN2 251 and CSN3 genes the most abundant alleles were A (average frequency = 0.54), C 252 (average frequency = 0.67) and A/B (average frequency = 0.68), respectively. On the 253 other hand, we have also identified certain alleles in the CSN1S1 (B1, C and G), 254 CSN1S2 (E) and CSN3 (I, K and M) genes that are rare (average frequency < 0.05) or 255 very rare (average frequency < 0.01). Five of these rare alleles were present in Far 256 Eastern goats at low frequencies, and two of them (the K and I alleles of the CSN3 gene) 257 segregated exclusively in this population. We were unable to identify the D-allele of the 258 CSN1S2 gene, and the null alleles plus the A1-allele of the CSN2 gene also remained 259 undetected in our data set. 260 In certain cases, frequencies of casein alleles were quite divergent amongst 261 populations. For instance, the H-allele of the CSN3 gene is relatively common in Far 262 Eastern goats but rare in goats from Africa, Europe or the Near East (Table 1), and the 263 D-allele of the CSN3 gene is quite frequent in goats from the Near and Far East but it is 264 completely absent in the remaining caprine populations (Table 1). In the CSN1S1 gene, 265 the B3 allele segregates at moderate frequencies in African goats but it does not 266 segregate in the European population. Importantly, we have found that the majority of 267 casein alleles are present in the population of bezoars, indicating that their existence 268 probably predates domestication. This finding is further supported by the segregation of 269 the majority of casein alleles in two or more of the analysed populations (Table 1), 270 despite the fact that they are separated by considerable geographic distances. 271 272 273 274 12 275 DISCUSSION 276 277 A relevant evolutionary question that we aimed to answer in the current study is 278 whether extant casein genetic variation segregating in domestic goats comes from 279 standing variation (already present in bezoars before their domestication) or if it did 280 emerge after goat domestication and dispersal (novel variation). Before analyzing casein 281 variation, we investigated the genetic relationships and population structure of the five 282 caprine populations under analysis (bezoars and goats from Europe, Africa, Near East 283 and Far East). Our results showed that individuals clustered according to their 284 geographic origin (Figure 1). Goats were domesticated in a geographic area covering 285 from the Central Zagros to Eastern Anatolia (Zeder and Hesse, 2000, Naderi et al., 2008, 286 reviewed in Pereira and Amorim, 2010) and subsequently they spread into Europe, 287 Africa and Asia (Pereira and Amorim, 2010). The existence of genetic differentiation 288 between the five populations analysed in our study (Figure 1) is compatible with the 289 hypothesis that different gene pools migrated through the Mediterranean and Danubian 290 corridors in Europe, the Central Steppe and the Indus Valley in Asia, and North Africa 291 (Pereira and Amorim, 2010). Indeed, the analysis of goat ancient genomes has shown 292 that goats were domesticated at multiple locations (and time periods) in the Fertile 293 Crescent (Daly et al. 2018). Genetic drift combined with the existence of differences in 294 breed management, reproductive isolation and selection goals probably contributed to 295 the establishment of genetic differences between Asian, European and African goats. 296 The analysis of population structure with ADMIXTURE evidenced the existence 297 of Western (Africa and Europe) and Eastern (Far East) genetic backgrounds, while the 298 genetic background of Near Eastern domestic goats shared both components (K = 3, 299 Figure 2). The third distinctive genetic background was represented by bezoars from 13 300 the Near East (K = 3, Figure 2). The analysis of mitochondrial variation of Iranian wild 301 boars revealed the segregation of not only Middle East haplotypes but also of 302 haplotypes that are typically found in wild boars from the West (Europe and Africa) and 303 Far East (Khalilzadeh et al., 2016). These results highlight that Iran has been an 304 important contact zone between the East and the West, and also a key hotspot of genetic 305 diversity (Khalilzadeh et al., 2016). Moreover, we also detected the existence of two 306 different backgrounds in Far Eastern goats, reflecting the existence of two different 307 populations (K=5, Figure 2) i.e. Tibetan goats and two Cashmere breeds (Wang et al. 308 2016, Li et al., 2017). Furthermore, Inner Mongolia Cashmere goats (IMCG) display a 309 genetic background intermediate between Tibetan (TB) and Liaoning Cashmere goats 310 (LNCG, Figure 2). This result points to the Mongolian Plateau as a critical hub for the 311 dispersal of goats across East Asia (Pereira and Amorim, 2010), as reported for cattle 312 (Ajmone-Marsan et al., 2010) and sheep (Zhao et al., 2017). 313 We have annotated casein polymorphisms according to the genomic coordinates 314 provided in the ARS1 assembly of the goat genome (Bickhart et al., 2017). Obviously, 315 this annotation may differ from the one employed in previous publications. For instance, 316 the missense CSN3 Asn74Ser and Val86Ile polymorphisms identified by us 317 (Supplementary Table S2) correspond to the Asn53Ser and Val65Ile substitutions 318 reported by Marletta et al. (2007). These differences might be due, for instance, to the 319 fact that amino acid residue numbering in a protein sequence may begin with the first 320 amino acid of either the leader peptide or the mature protein sequence. Moreover, 321 whole-genome sequencing with a modest coverage (average of 9.92× in the current 322 work) can yield thousands of false polymorphisms that are produced by sequencing 323 errors (Robasky et al., 2014). However, these drawbacks should not have a strong 324 impact on the main conclusions of our study because we did not intend to build a 14 325 curated catalogue of casein variation in goats, something that sooner or later will be 326 reported in the Ensembl database (https://www.ensembl.org). On the contrary, we 327 aimed to investigate the geographic distribution of caprine casein variation in order to 328 make inferences about the origins of such variation (i.e. to ascertain if it comes from 329 standing or novel variation). 330 The comparison of the nucleotide diversity of the casein loci in bezoars vs 331 domestic goats showed that they have similar levels of variation (Figure 4a). In contrast, 332 goats from the Far East displayed lower levels of diversity, a feature that might be due 333 to an ancient founder effect associated with goat dispersal after domestication. 334 Moreover, the nucleotide diversity of the casein loci was remarkably higher than that 335 observed in the autosomal genome (Figure 4b). Two preferential recombination sites 336 have been reported in the casein cluster (Bevilacqua et al. 2002, Hayes et al. 2006), a 337 circumstance that is known to promote the generation of diversity. Moreover, the casein 338 genes are not indispensable to sustain life, so purifying selection is probably less intense 339 than in other genomic regions containing housekeeping genes. 340 In the four casein genes a substantial amount of SNPs (36-55%) were shared 341 between the wild and domestic forms. Importantly, the number of analysed bezoars was 342 relatively low, so we cannot rule out the possibility that the percentage of shared 343 variation between bezoars and domestic goats may increase if sample size is also 344 augmented. The variation shared between the wild and the domestic forms might have 345 an ancestral origin, but such pattern could be also produced by an introgression of the 346 bezoar population with domestic goats. However, the analysis of Figure 1 does not 347 provide evidence about the existence of introgressed bezoars in our data set. Moreover, 348 the comparison of casein polymorphisms across the five populations evidenced that 349 more than 50% of the polymorphisms are shared between two or more populations, and 15 350 that between 18-44% are shared by all populations. Casein diversity shared by all five 351 populations probably has an ancestral origin (i.e. its existence probably predates the 352 post-domestication dispersal of goats). These results indicate that a considerable 353 proportion of casein variation might have been already present in the bezoar before the 354 domestication process. 355 Our findings agree well with other studies demonstrating that genetic variants of 356 agricultural importance such as those related with tomato fruit size, maize plant 357 architecture (e.g. teosinte branched 1), seasonality controls and seed size were already 358 present as standing variation in the wild progenitors of domestic plant species (Larson et 359 al., 2014). One exception to this general trend would be that of mutations that could be 360 deleterious in the wild but not in a domestic context, but in principle mutations with 361 functional consequences on the casein genes are not expected to have any effect on the 362 biological efficacy of the individuals harbouring them. These results contrast strongly 363 with those obtained in dogs, where a number of mutations with large phenotypic effects 364 are present in dogs but not in wolves, implying that these mutations probably emerged 365 during or after domestication and reached detectable allelic frequencies because they 366 were selected for (Boyko et al., 2010, Larson et al., 2014). We have also observed that a 367 relevant fraction of the casein diversity is not shared across populations (Figure 3). This 368 variation might be represented by either mutations that emerged after the domestication 369 and dispersal of goats or they may be due to insufficient sampling or to sequencing 370 errors (because of limited genomic coverage). 371 The allelic frequencies of the casein genes reported in Table 1 were consistent 372 with previous studies, although it is important to emphasize that such frequencies can be 373 very variable even when comparing breeds reared in the same geographic location e.g. 374 the CSN1S1 A and E alleles are the most frequent ones in Italian Saanen and Alpine 16 375 breeds (Frattini et al. 2014), while in Sarda goats the most abundant CSN1S1 allele is B 376 (Vacca et al. 2014). In the CSN1S1 gene, we observed that A-I-N-O1-O2, the B2-D-F 377 and the B4-E groups of alleles were well represented in the European and African 378 populations (Table 1). The genotyping of the CSN1S1 gene in French (Grosclaude et al. 379 1994, Pepin et al. 1994, Carillier-Jacquin et al. 2016) and Italian (Sacchi et al. 2005, 380 Caroli et al. 2006, Gigli et al. 2008, Mastrangelo et al. 2013, Frattini et al. 2014) goats 381 showed that the A and F-alleles are quite abundant, while in Spanish (Jordana et al. 382 1996, Caravaca et al. 2008) and African (Caroli et al. 2007) goats the B/E and A/B pairs 383 of alleles are the most frequent ones, respectively. In strong contrast, the C, G, N and 384 O1 alleles tend to have low frequencies in Italian (Sacchi et al. 2005, Caroli et al. 2006, 385 Gigli et al. 2008, Mastrangelo et al. 2013, Frattini et al. 2014) and African breeds 386 (Caroli et al. 2007). According to our results (Table 1), the A-I-N-O1-O2 group of 387 alleles is prevalent in Near Eastern and Far Eastern domestic goats as well as in bezoars. 388 A previous study focused on Indian and Turkish goats (Chessa et al. 2007) also 389 reflected the same trend, with high frequencies of the A-allele in the majority of the 390 analysed populations. With regard to the CSN1S2 and CSN2 genes, we found that the A 391 and C alleles, respectively, were the majority ones, a finding that is concordant with 392 what has been published in European, African, Turkish and Indian goats (Sacchi et al. 393 2005, Caroli et al. 2006, Caroli et al. 2007, Chessa et al. 2007, Gigli et al. 2008, Vacca 394 et al. 2014, Tortorici et al. 2014, Kusza et al. 2016, Grobler et al. 2017). In the CSN3 395 gene, the A and B alleles were predominant in most populations (Table 1), as 396 previously published in a broad array of caprine breeds (Yahyaoui et al. 2003, 397 Prinzenberg et al. 2005, Caroli et al. 2007, Chessa et al. 2007, Kiplagat et al. 2010, Di 398 Gerlando et al. 2015). Interestingly, the D-allele was frequent in Far and Near Eastern 399 goats, and the G/L group of alleles in Near Eastern goats and bezoars (Table 1). The 17 400 genetic analysis of the CSN3 locus in Turkish and Indian goats has evidenced that the 401 D-allele is relatively frequent, and that the G-allele also segregates in these two 402 populations but at lower frequencies (Prinzenberg et al. 2005, Chessa et al. 2007). The 403 CSN3 D and G alleles, in contrast, are rare in African (Caroli et al. 2007) and the 404 majority of European breeds (Yahyaoui et al. 2003, Prinzenberg et al. 2005), with the 405 exception of several Italian populations (Sacchi et al. 2005, Di Gerlando et al. 2015). 406 In summary, our main finding is that a significant number of casein alleles (or 407 groups of alleles) are present in the bezoar, suggesting that they existed before 408 domestication. Noteworthy, a number of the casein alleles detected in the bezoar have 409 been associated with dairy traits in domestic goats. For instance, the A and B alleles of 410 the CSN1S1 gene determine a high content of CSN1S1 in milk and they increase milk 411 protein, casein and fats contents and they also improve cheese yield (revised in Martin 412 et al., 1999, Moioli et al., 2007, Amills et al., 2012, Amills, 2014). The A-allele of the 413 CSN2 gene and the B-allele of the CSN3 gene have been also associated with a higher 414 protein content (Caravaca et al. 2009, Vacca et al. 2014). We have also found that 415 several CSN3 polymorphisms that are very rare in European breeds display significant 416 frequencies in goat populations from other continents, emphasizing the need to 417 investigate their effects on dairy traits. 418 419 CONCLUSIONS 420 421 The main conclusion that can be derived from our work is that a relevant fraction of the 422 casein variation segregating in domestic goats probably emerged before the 423 domestication process. 424 18 425 ACKNOWLEDGMENTS 426 427 Research presented in this publication was Funded by FEDER/Ministerio de 428 Ciencia, Innovación y Universidades – Agencia Estatal de Investigación/ Project 429 Reference AGL2016-76108-R. We also acknowledge the support of the Spanish 430 Ministry of Economy and Competitivity for the Center of Excellence Severo Ochoa 431 2016–2019 (SEV-2015-0533) grant awarded to the Centre for Research in Agricultural 432 Genomics (CRAG). Dailu Guan was funded with a PhD fellowship from the China 433 Scholarship Council (CSC). Emilio Mármol-Sánchez was funded with a FPU Ph.D. 434 grant from the Spanish Ministry of Education (FPU15/01733). Tainã Figueiredo 435 Cardoso was funded with a fellowship from the CAPES Foundation-Coordination of 436 Improvement of Higher Education, Ministry of Education of the Federal Government of 437 Brazil. Thanks also to the CERCA Programme of the Generalitat de Catalunya for their 438 support and also to those who provided publicly available data. 439 440 REFERENCES 441 442 Ajmone-Marsan, P., J. F. Garcia, and J. A. Lenstra. 2010. On the origin of cattle: How 443 aurochs became cattle and colonized the world. Evol. Anthropol. 19:148-157. 444 https://doi.org/10.1002/evan.20267. 445 Alberto, F. J., F. Boyer, P. Orozco-ter Wengel, I. Streeter, B. Servin, P. de Villemereuil, 446 B. Benjelloun, P. Librado, F. Biscarini, L. Colli, M. Barbato, W. Zamani, A. 447 Alberti, S. Engelen, A. Stella, S. Joost, P. Ajmone-Marsan, R. Negrini, L. 448 Orlando, H. R. Rezaei, S. Naderi, L. Clarke, P. Flicek, P. Wincker, E. Coissac, J. 449 Kijas, G. Tosser-Klopp, A. Chikhi, M. W. Bruford, P. Taberlet, and F. 19 450 Pompanon. 2018. Convergent genomic signatures of domestication in sheep and 451 goats. Nat. Commun. 9:813. https://doi.org/10.1038/s41467-018-03206-y. 452 Alexander, D. H., J. Novembre, and K. Lange. 2009. Fast model-based estimation of 453 ancestry in unrelated individuals. Genome Res. 19:1655-1664. 454 https://doi.org/10.1101/gr.094052.109. 455 Alexander, D. H. and K. Lange. 2011. Enhancements to the ADMIXTURE algorithm 456 for individual ancestry estimation. BMC Bioinform. 12:246. 457 https://doi.org/10.1186/1471-2105-12-246. 458 Amills, M., J. Jordana, A. Zidi, and J. M. Serradilla. 2012. Genetic factors that regulate 459 milk protein and lipid composition in goats. In: Milk Production - Advanced 460 Genetic Traits, Cellular Mechanism, Animal Management and Health. N. 461 (Chaiyabutr N., Ed.). InTech, Rijeka. http://dx.doi.org/10.5772/51716. 462 Amills, M. 2014. The application of genomic technologies to investigate the inheritance 463 of economically important traits in goats. Adv. in Biol. 2014:13. 464 https://doi.org/10.1155/2014/904281. 465 Angiolillo, A., M. H. Yahyaoui, A. Sanchez, F. Pilla, and J. M. Folch. 2002. Short 466 communication: Characterization of a new genetic variant in the caprine κ-casein 467 gene. J. Dairy Sci. 85:2679-2680. 468 Becker, D., M. Otto, P. Ammann, I. Keller, C. Drögemüller, and T. Leeb. 2014. The 469 brown coat colour of Coppernecked goats is associated with a non‐synonymous 470 variant at the TYRP1 locus on chromosome 8. Anim. Genet. 46:50-54. 471 http://dx.doi.org/10.1111/age.12240. 472 Benjelloun, B., F. J. Alberto, I. Streeter, F. Boyer, E. Coissac, S. Stucki, M. BenBati, M. 473 Ibnelbachyr, M. Chentouf, A. Bechchari, K. Leempoel, A. Alberti, S. Engelen, A. 474 Chikhi, L. Clarke, P. Flicek, S. Joost, P. Taberlet, F. Pompanon, and NextGen 20 475 Consortium. 2015. Characterizing neutral genomic diversity and selection 476 signatures in indigenous populations of Moroccan goats (Capra hircus) using 477 WGS data. Front. Genet. 6:107. http://dx.doi.org/10.3389/fgene.2015.00107. 478 Bevilacqua, C., P. Ferranti,G. Garro, C. Veltri, R. Lagonigro, C. Leroux, E. Pietrolà, F. 479 Addeo, F. Pilla, L. Chianese, P. Martin. 2002. Interallelic recombination is 480 probably responsible for the occurrence of a new αS1-casein variant found in the 481 goat species. Eur. J. Biochem. 269: 1293-1303. 482 Bickhart, D. M., B. D. Rosen, S. Koren, B. L. Sayre, A. R. Hastie, S. Chan, J. Lee, E. T. 483 Lam, I. Liachko, S. T. Sullivan, J. N. Burton, H. J. Huson, J. C. Nystrom, C. M. 484 Kelley, J. L. Hutchison, Y. Zhou, J. Sun, A. Crisa, F. A. Ponce de Leon, J. C. 485 Schwartz, J. A. Hammond, G. C. Waldbieser, S. G. Schroeder, G. E. Liu, M. J. 486 Dunham, J. Shendure, T. S. Sonstegard, A. M. Phillippy, C. P. Van Tassell, and 487 T. P. L. Smith. 2017. Single-molecule sequencing and chromatin conformation 488 capture enable de novo reference assembly of the domestic goat genome. Nat. 489 Genet. 49:643-650. http://dx.doi.org/10.1038/ng.3802. 490 Bolger, A. M., M. Lohse, and B. Usadel. 2014. Trimmomatic: a flexible trimmer for 491 Illumina sequence data. Bioinformatics 30:2114-2120. 492 http://dx.doi.org/10.1093/bioinformatics/btu170. 493 Boyko, A. R., P. Quignon, L. Li, J. J. Schoenebeck, J. D. Degenhardt, K. E. Lohmueller, 494 K. Y. Zhao, A. Brisbin, H. G. Parker, B. M. vonHoldt, M. Cargill, A. Auton, A. 495 Reynolds, A. G. Elkahloun, M. Castelhano, D. S. Mosher, N. B. Sutter, G. S. 496 Johnson, J. Novembre, M. J. Hubisz, A. Siepel, R. K. Wayne, C. D. Bustamante, 497 and E. A. Ostrander. 2010. A simple genetic architecture underlies 498 morphological variation in dogs. Plos Biol. 8:1000451. 499 http://dx.doi.org/10.1371/journal.pbio.1000451. 21 500 Brignon, G., M. F. Mahe, F. Grosclaude, and B. Ribadeau-Dumas. 1989. Sequence of 501 caprine alpha s1-casein and characterization of those of its genetic variants 502 which are synthesized at a high level, alpha s1-CnA, B and C. Protein Seq. Data 503 Anal. 2:181-188. 504 Browning, B. L. and S. R. Browning. 2016. Genotype imputation with millions of 505 reference samples. Am. J. Hum. Genet. 98:116-126. 506 http://dx.doi.org/10.1016/j.ajhg.2015.11.020. 507 Caravaca, F., M. Amills, J. Jordana, A. Angiolillo, P. Agüera, C. Aranda, A. Menéndez- 508 Buxadera, A. Sánchez, J. Carrizosa, B. Urrutia, A. Sànchez, and J. M. Serradilla. 509 2008. Effect of αs1-casein (CSN1S1) genotype on milk CSN1S1 content in 510 Malagueña and Murciano-Granadina goats. J. Dairy Res. 75:481-484. 511 https://doi.org/10.1017/S0022029908003609. 512 Caravaca, F., J. Carrizosa, B. Urrutia, F. Baena, J. Jordana, M. Amills, B. Badaoui, A. 513 Sánchez, A. Angiolillo, and J. M. Serradilla. 2009. Short communication: Effect 514 of αS1-casein (CSN1S1) and κ-casein (CSN3) genotypes on milk composition in 515 Murciano-Granadina goats. J. Dairy Sci. 92:2960-2964. 516 https://doi.org/10.3168/jds.2008-1510. 517 Carillier-Jacquin, C., H. Larroque, and C. Robert-Granié. 2016. Including α s1 casein 518 gene information in genomic evaluations of French dairy goats. Genet. Sel. Evol. 519 48:54. https://doi.org/10.1186/s12711-016-0233-x. 520 Caroli, A., F. Chiatti, S. Chessa, D. Rignanese, P. Bolla, and G. Pagnacco. 2006. 521 Focusing on the goat casein complex. J. Dairy Sci. 89: 3178-3187. 522 http://dx.doi.org/10.3168/jds.S0022-0302(06)72592-9. 523 Caroli, A., F. Chiatti, S. Chessa, D. Rignanese, E. M. Ibeagha-Awemu, and G. Erhardt. 524 2007. Characterization of the casein gene complex in West African goats and 22 525 description of a new αS1-casein polymorphism. J. Dairy Sci. 90: 2989-2996. 526 https://doi.org/10.3168/jds.2006-674. 527 Chessa, S., F. Chiatti, D. Rignanese, E. M. Ibeagha-Awemu, C. Özbeyaz, Y. A. Hassan, 528 M. M. Baig, G. Erhardt, and A. Caroli. 2007. The casein genes in goat breeds 529 from different continents: analysis by Polymerase Chain Reaction – Single 530 Strand Conformation Polymorphism (PCR-SSCP). Ital. J. Anim. Sci. 6:73-75. 531 https://doi.org/10.4081/ijas.2007.1s.73. 532 Cingolani, P., A. Platts, L. L. Wang, M. Coon, T. Nguyen, L. Wang, S. J. Land, X. Lu, 533 and D. M. Ruden. 2012. A program for annotating and predicting the effects of 534 single nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila 535 melanogaster strain w1118; iso-2; iso-3. Fly 6:80-92. 536 http://dx.doi.org/10.4161/fly.19695. 537 Daly, K. G., P. Maisano Delser, V. E. Mullin, A. Scheu, V. Mattiangeli, M. D. Teasdale, 538 A. J. Hare, J. Burger, M. P. Verdugo, M. J. Collins, R. Kehati, C. M. Erek, G. 539 Bar-Oz, F. Pompanon, T. Cumer, C. Çakırlar, A. F. Mohaseb, D. Decruyenaere, 540 H. Davoudi, Ö. Çevik, G. Rollefson, J.-D. Vigne, R. Khazaeli, H. Fathi, S. B. 541 Doost, R. Rahimi Sorkhani, A. A. Vahdati, E. W. Sauer, H. Azizi Kharanaghi, S. 542 Maziar, B. Gasparian, R. Pinhasi, L. Martin, D. Orton, B. S. Arbuckle, N. 543 Benecke, A. Manica, L. K. Horwitz, M. Mashkour, and D. G. Bradley. 2018. 544 Ancient goat genomes reveal mosaic domestication in the Fertile Crescent. 545 Science 361:85-88. http://dx.doi.org/10.1126/science.aas9411. 546 Danecek, P., A. Auton, G. Abecasis, C. A. Albers, E. Banks, M. A. DePristo, R. E. 547 Handsaker, G. Lunter, G. T. Marth, S. T. Sherry, G. McVean, R. Durbin, and 548 1000 Genomes Project Analysis Group. 2011. The variant call format and 23 549 VCFtools. Bioinformatics 27:2156-2158. 550 https://doi.org/10.1093/bioinformatics/btr330. 551 Di Gerlando, R., L. Tortorici, M. T. Sardina, G. Monteleone, S. Mastrangelo, and B. 552 Portolano. 2015. Molecular characterisation of κ-casein gene in Girgentana dairy 553 goat breed and identification of two new alleles. Ital. J. Anim. Sci. 14:3464. 554 https://doi.org/10.4081/ijas.2015.3464. 555 Fang, H., Y. Y. Wu, G. Narzisi, J. A. O'Rawe, L. T. J. Barron, J. Rosenbaum, M. 556 Ronemus, I. Iossifov, M. C. Schatz, and G. J. Lyon. 2014. Reducing INDEL 557 calling errors in whole genome and exome sequencing data. Genome Med. 6:89. 558 https://doi.org/10.1186/s13073-014-0089-z. 559 Frantz, L. A. F., J. G. Schraiber, O. Madsen, H.-J. Megens, A. Cagan, M. Bosse, Y. 560 Paudel, R. P. M. A. Crooijmans, G. Larson, and M. A. M. Groenen. 2015. 561 Evidence of long-term gene flow and selection during domestication from 562 analyses of Eurasian wild and domestic pig genomes. Nat. Genet. 47:1141-1148. 563 http://dx.doi.org/10.1038/ng.3394. 564 Frattini, S., L. Nicoloso, B. Coizet, S. Chessa, L. Rapetti, G. Pagnacco, and P. Crepaldi. 565 2014. Short communication: the unusual genetic trend of αS1-casein in Alpine 566 and Saanen breeds. J Dairy Sci. 97:7975-7979. https://doi.org/10.3168/jds.2014- 567 7780. 568 Galliano, F., R. Saletti, V. Cunsolo, S. Foti, D. Marletta, S. Bordonaro, and G. D'Urso. 569 2004. Identification and characterization of a new β-casein variant in goat milk 570 by high-performance liquid chromatography with electrospray ionization mass 571 spectrometry and matrix-assisted laser desorption/ionization mass spectrometry. 572 Rapid commun. Mass Spectrom. 18:1972-1982. 573 http://dx.doi.org/10.1002/rcm.1575. 24 574 Gigli, I., D. O. Maizon, V. Riggio, M. T. Sardina, and B. Portolano. 2008. Short 575 communication: Casein haplotype variability in sicilian dairy goat breeds. J. 576 Dairy Sci. 91:3687-3692. http://dx.doi.org/10.3168/jds.2008-1067. 577 Grobler, R., C. Visser, S. Chessa, and E. van Marle-Köster. 2017. Genetic 578 polymorphism of CSN1S2 in South African dairy goat populations. S. Afr. j. 579 anim. sci. 47: 72-78. http://dx.doi.org/10.4314/sajas.v47i1.11. 580 Grosclaude, F., G. Ricordeau, P. Martin, F. Remeuf, L. Vassal, and J. Bouillon. 1994. 581 Du gène au fromage: le polymorphisme de la caséine αS1 caprine, ses effets, son 582 évolution. INRA Prod Anim. 7:3-19. 583 Guan, D., N. Luo, X. Tan, Z. Zhao, Y. Huang, R. Na, J. Zhang, and Y. Zhao. 2016. 584 Scanning of selection signature provides a glimpse into important economic 585 traits in goats (Capra hircus). Sci. Rep. 6:36372. 586 http://dx.doi.org/10.1038/srep36372. 587 Hasan, M. S., X. Wu, L. Zhang. 2015. Performance evaluation of indel calling tools 588 using real short-read data. Hum Genomics 9:20. 589 http://dx.doi.org/10.1186/s40246-015-0042-2. 590 Hayes, B., N. Hagesæther, T. Ådnøy, G. Pellerud, P. R. Berg, and S. Lien. 2006. Effects 591 on production traits of haplotypes among casein genes in Norwegian goats and 592 evidence for a site of preferential recombination. Genetics 174:455. 593 http://dx.doi.org/10.1534/genetics.106.058966. 594 Jordana, J., M. Amills, E. Díaz, C. Angulo, J. M. Serradilla, and A. Sànchez. 1996. 595 Gene frequencies of caprine αs1-casein polymorphism in Spanish goat breeds. 596 Small Rumin Res. 20:215-221. https://doi.org/10.1016/0921-4488(95)00813-6. 25 597 Khalilzadeh, P., H. R. Rezaei, D. Fadakar, M. Serati, M. Aliabadian, J. Haile, and H. 598 Goshtasb. 2016. Contact zone of Asian and European wild boar at North West of 599 Iran. PLoS One 11: e0159499. http://dx.doi.org/10.1371/journal.pone.0159499. 600 Kiplagat, S. K., M. Agaba, I. S. Kosgey, A. M.Okeyo, D. Indetie, O. Hanotte, and M. K. 601 Limo. 2010. Genetic polymorphism of kappa-casein gene in indigenous Eastern 602 Africa goat populations. Int. J. Genet. Mol. Biol. 2:1-5. 603 Kumar, S., G. Stecher, and K. Tamura. 2016. MEGA7: Molecular Evolutionary 604 Genetics Analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 33:1870-1874. 605 http://dx.doi.org/10.1093/molbev/msw054. 606 Kusza, S., D. E. Ilie, M. Sauer, K. Nagy, I. Patras, and D. Gavojdian. 2016. Genetic 607 polymorphism of CSN2 gene in Banat White and Carpatina goats. Acta Biochim 608 Pol. 63:577-580. http://dx.doi.org/10.18388/abp.2016_1266. 609 Lagonigro, R., E. Pietrola, M. D'Andrea, C. Veltri, and F. Pilla. 2001. Molecular genetic 610 characterization of the goat s2-casein E allele. Anim. Genet. 32:391-393. 611 http://dx.doi.org/10.1046/j.1365-2052.2001.0781c.x. 612 Larson, G., D. R. Piperno, R. G. Allaby, M. D. Purugganan, L. Andersson, M. Arroyo- 613 Kalin, L. Barton, C. C. Vigueira, T. Denham, K. Dobney, A. N. Doust, P. Gepts, 614 M. T. P. Gilbert, K. J. Gremillion, L. Lucas, L. Lukens, F. B. Marshall, K. M. 615 Olsen, J. C. Pires, P. J. Richerson, R. R. de Casas, O. I. Sanjur, M. G. Thomas, 616 and D. Q. Fuller. 2014. Current perspectives and the future of domestication 617 studies. Proc. Natl. Acad. Sci. USA. 111:6139-6146. 618 http://dx.doi.org/10.1073/pnas.1323964111. 619 Leroux, C., N. Mazure, and P. Martin. 1992. Mutations away from splice site 620 recognition sequences might cis-modulate alternative splicing of goat alpha s1- 26 621 casein transcripts. Structural organization of the relevant gene. J. Biol. Chem. 622 267:6147-6157. 623 Li, H. 2013. Aligning sequence reads, clone sequences and assembly contigs with 624 BWA-MEM. arXiv:1303.3997v2 [q-bio.GN]. 625 Li, X., R. Su, W. Wan, W. Zhang, H. Jiang, X. Qiao, Y. Fan, Y. Zhang, R. Wang, Z. 626 Liu, Z. Wang, B. Liu, Y. Ma, H. Zhang, Q. Zhao, T. Zhong, R. Di, Y. Jiang, W. 627 Chen, W. Wang, Y. Dong, and J. Li. 2017. Identification of selection signals by 628 large-scale whole-genome resequencing of cashmere goats. Sci. Rep. 7:15142. 629 http://dx.doi.org/10.1038/s41598-017-15516-0 630 Marletta, D., A. Criscione, S. Bordonaro, A. M. Guastella, and G. D'Urso. 2007. Casein 631 polymorphism in goat's milk. Lait 87:491-504. 632 Martin, P., M. Ollivier-Bousquet, and F. Grosclaude. 1999. Genetic polymorphism of 633 caseins: a tool to investigate casein micelle organization. Int. Dairy J. 9:163-171. 634 http://dx.doi.org/10.1016/S0958-6946(99)00055-2. 635 Martin, P., M. Szymanowska, L. Zwierzchowski, and C. Leroux. 2002. The impact of 636 genetic polymorphisms on the protein composition of ruminant milks. Reprod. 637 Nutr. Dev. 42:433-459. http://dx.doi.org/10.1051/rnd:2002036. 638 Mastrangelo, S., M. T. Sardina, M. Tolone, and B. Portolano. 2013. Genetic 639 polymorphism at the CSN1S1 gene in Girgentana dairy goat breed. Animal Prod. 640 Sci. 53: 403-406 .http://dx.doi.org/10.1071/AN12242. 641 McKenna, A., M. Hanna, E. Banks, A. Sivachenko, K. Cibulskis, A. Kernytsky, K. 642 Garimella, D. Altshuler, S. Gabriel, M. Daly, and M. A. DePristo. 2010. The 643 Genome Analysis Toolkit: a MapReduce framework for analyzing next- 644 generation DNA sequencing data. Genome Res. 20:1297-1303. 645 http://dx.doi.org/10.1101/gr.107524.110. 27 646 Menzi, F., I. Keller, I. Reber, J. Beck, B. Brenig, E. Schutz, T. Leeb, and C. 647 Drogemuller. 2016. Genomic amplification of the caprine EDNRA locus might 648 lead to a dose dependent loss of pigmentation. Sci. Rep. 6: 28438. 649 http://dx.doi.org/10.1038/srep28438. 650 Moioli, B., M. D'Andrea, and F. Pilla. 2007. Candidate genes affecting sheep and goat 651 milk quality. Small Rumin. Res. 68:179-192. 652 http://dx.doi.org/10.1016/j.smallrumres.2006.09.008. 653 Naderi, S., H. R. Rezaei, F. Pompanon, M. G. Blum, R. Negrini, H. R. Naghash, O. 654 Balkiz, M. Mashkour, O. E. Gaggiotti, P. Ajmone-Marsan, A. Kence, J. D. 655 Vigne, and P. Taberlet. 2008. The goat domestication process inferred from 656 large-scale mitochondrial DNA analysis of wild and domestic individuals. Proc. 657 Natl. Acad. Sci. USA. 105:17659-17664. 658 http://dx.doi.org/10.1073/pnas.1215985110. 659 Neveu, C., D. Molle, J. Moreno, P. Martin, and J. Leonil. 2002. Heterogeneity of 660 caprine β-casein elucidated by RP-HPLC/MS: genetic variants and 661 phosphorylations. J. Protein Chem. 21:557-567. 662 O'Rawe, J., Jiang, T., Sun, G., Wu, Y., Wang, W., Hu, J., Bodily, P., Tian, L., 663 Hakonarson, H., Johnson, W.E., Wei, Z., Wang, K., and Lyon, G. J. 2013. Low 664 concordance of multiple variant-calling pipelines: practical implications for 665 exome and genome sequencing. Genome Med. 5:28. 666 Pepin, L. 1994. Recherche de polymorphisme genetique chez les caprins. Application a 667 l'etude de la diversite des populations, au controle de filiation et a la resistance 668 genetique a la cowdriose. Doctoral Thesis, Universite de Paris XI Orsay. 28 669 Pereira, F. and A. Amorim. 2010. Origin and spread of goat pastoralism. In: 670 Encyclopedia of Life Sciences (ELS). John Wiley & Sons, Ltd: Chichester. 671 http://dx.doi.org/10.1002/9780470015902.a0022864. 672 Prinzenberg, E. M., K. Gutscher, S. Chessa, A. Caroli, and G. Erhardt. 2005. Caprine κ- 673 casein (CSN3) polymorphism: New developments in molecular knowledge. J. 674 Dairy Sci. 88:1490-1498. https://doi.org/10.3168/jds.S0022-0302(05)72817-4. 675 Purcell, S., B. Neale, K. Todd-Brown, L. Thomas, M. A. R. Ferreira, D. Bender, J. 676 Maller, P. Sklar, P. I. W. de Bakker, M. J. Daly, and P. C. Sham. 2007. PLINK: 677 A tool set for whole-genome association and population-based analyses. Am. J. 678 Hum. Genet. 81:559-575. https://doi.org/10.1086/519795. 679 Reber, I., I. Keller, D. Becker, C. Flury, M. Welle, and C. Drogemuller. 2015. Wattles 680 in goats are associated with the FMN1/GREM1 region on chromosome 10. Anim. 681 Genet. 46:316-320. https://doi.org/10.1111/age.12279. 682 Remeuf, F., V. Cossin, C. Dervin, J. Lenoir, and R. Tomassone. 1991. Relationships 683 between physico-chemical characteristics of milks and their cheese-making 684 properties. Lait 71:397-421. 685 Rijnkels, M. 2002. Multispecies comparison of the casein gene loci and evolution of 686 casein gene family. J. Mammary Gland. Biol. 7:327-345. 687 https://doi.org/10.1023/A:1022808918013. 688 Robasky, K., N. E. Lewis, and G. M. Church. 2014. The role of replicates for error 689 mitigation in next-generation sequencing. Nat. Rev. Genet. 15:56-62. 690 https://doi.org/10.1038/nrg3655. 691 Sacchi, P., S. Chessa, E. Budelli, P. Bolla, G. Ceriotti, D. Soglia, R. Rasero, E. Cauvin, 692 and A. Caroli. 2005. Casein haplotype structure in five Italian goat breeds. J. 693 Dairy Sci. 88:1561-1568. https://doi.org/10.3168/jds.S0022-0302(05)72825-3. 29 694 Tortorici, L., R. Di Gerlando, S. Mastrangelo, M. T. Sardina, and B. Portolano. 2014. 695 Genetic characterisation of CSN2 gene in Girgentana goat breed. Ital. J. Anim. 696 Sci. 13:3414. https://doi.org/10.4081/ijas.2014.3414. 697 Vacca, G. M., M. L. Dettori, G. Piras, F. Manca, P. Paschino, and M. Pazzola. 2014. 698 Goat casein genotypes are associated with milk production traits in the Sarda 699 breed. Anim. Genet. 45:723-731. https://doi.org/10.1111/age.12188. 700 Vaser, R., S. Adusumalli, S. N. Leng, M. Sikic, and P. C. Ng. 2015. SIFT missense 701 predictions for genomes. Nat. Protoc. 11:1. 702 http://dx.doi.org/10.1038/nprot.2015.123. 703 Wang, X., J. Liu, G. Zhou, J. Guo, H. Yan, Y. Niu, Y. Li, C. Yuan, R. Geng, X. Lan, X. 704 An, X. Tian, H. Zhou, J. Song, Y. Jiang, and Y. Chen. 2016. Whole-genome 705 sequencing of eight goat populations for the detection of selection signatures 706 underlying production and adaptive traits. Sci. Rep. 6:38932. 707 http://dx.doi.org/10.1038/srep38932. 708 Yahyaoui, M. H., A. Angiolillo, F. Pilla, A. Sànchez, and J. M. Folch. 2003. 709 Characterization and genotyping of the caprine κ-casein variants. J. Dairy Sci. 710 86:2715-2720. https://doi.org/10.3168/jds.S0022-0302(03)73867-3. 711 Zeder, M. A. and B. Hesse. 2000. The initial domestication of goats (Capra hircus) in 712 the Zagros mountains 10,000 years ago. Science 287:2254-2257. 713 https://doi.org/10.1126/science.287.5461.2254. 714 Zhao, Y., J. Yang, F. Lv, X. Hu, X. Xie, M. Zhang, W. Li, M. Liu, Y. Wang, J. Li, Y. 715 Liu, Y. Ren, F. Wang, E. Hehua, J. Kantanen, J. Arjen Lenstra, J. Han, and M. 716 Li. 2017. Genomic reconstruction of the history of native sheep reveals the 717 peopling patterns of nomads and the expansion of early pastoralism in East Asia. 718 Mol. Biol. Evol. 34:2380-2395. http://dx.doi.org/10.1093/molbev/msx181. 719 30 720 Table 1 Frequencies of alleles or groups of alleles identified in the bezoars (BE) and domestic 721 goats from Europe (EU), Africa (AF), Near East (NE) and Far East (FE) in current study. AF BE EU FE NE Total Allele (N=20) (N=22) (N=11) (N=33) (N=20) (N=106) A-I-N-O1-O2 0.30 0.55 0.27 0.57 0.67 0.51 B1 0 0.02 0 0.03 0 0.01 B2-D-F 0.13 0.11 0.41 0.02 0 0.09 B3 0.27 0.16 0 0.02 0.10 0.11 CSN1S1 B4-E 0.30 0.09 0.27 0.06 0.05 0.13 C 0 0 0 0.03 0.08 0.02 G 0 0 0.05 0 0 0.01 Unreported 0 0.07 0 0.27 0.1 0.12 A 0.45 0.62 0.64 0.59 0.43 0.54 B 0 0.02 0 0.14 0 0.05 CSN1S2 C 0.43 0.10 0.09 0.18 0.50 0.26 E 0 0.02 0 0.05 0 0.02 F 0.12 0.24 0.27 0.04 0.07 0.13 A 0.58 0.22 0.25 0.24 0.25 0.30 CSN2 C 0.39 0.75 0.60 0.76 0.75 0.67 C1 0.03 0.03 0.15 0 0 0.03 A 0.50 0.25 0.05 0.19 0.30 0.27 B 0.45 0.52 0.95 0.23 0.25 0.41 D 0 0 0 0.24 0.28 0.13 G-L 0 0.14 0 0 0.10 0.05 CSN3 H 0 0.09 0 0.23 0 0.09 I 0 0 0 0.08 0 0.02 K 0 0 0 0.03 0 0.01 M 0.05 0 0 0 0.07 0.02 722 723 724 725 726 727 728 729 730 731 31 732 LEGENDS TO FIGURES 733 734 Figure 1 (a) Neighbor-joining tree and (b) principal components analysis (PCA) of 106 735 bezoars (BE) and domestic goats from Europe (EU), Africa (AF), Near East (NE) and 736 Far East (FE) based on a data set of 11,226,125 autosomal SNPs. The neighbor-joining 737 tree was built according to an identity by state (IBS) distance matrix constructed with 738 the PLINK software (Purcell et al. 2007) with default parameters. The PCA considered 739 the principal components 1 (PC1) and 2 (PC2), which explained 14.20% 740 (6.20/eigenvalues) and 13.54% (5.91/eigenvalues) of the variance, respectively. 741 742 Figure 2. ADMIXTURE analysis of 106 bezoars (BE) and domestic goats from Europe 743 (EU), Africa (AF), Near East (NE) and Far East (FE) based on a data set of 11,226,125 744 autosomal SNPs. Each bar represents one individual and the length of the colored bar 745 represents the proportion of the goat genome inherited from each ancestral population. 746 In the Far East group, the following subpopulations are indicated: TB, Tibetan; IMCG, 747 Inner Mongolia Cashmere goats; LNCG, Liaoning Cashmere goats. 748 749 Figure 3a-d. Venn diagrams depicting the αS1- (CSN1S1), αS2- (CSN1S2), β- (CSN2) 750 and κ- (CSN3) casein SNPs shared between bezoars (BE) and domestic goats (DG). 3e- 751 h. Venn diagrams depicting the αS1- (CSN1S1), αS2- (CSN1S2), β- (CSN2) and κ- (CSN3) 752 casein SNPs shared between bezoars (BE) and domestic goats from Europe (EU), 753 Africa (AF), Near East (NE) and Far East (FE). 754 755 Figure 4. Nucleotide diversity of the (a) casein loci in the bezoars (BE) and domestic 756 goats from Africa (AF), Europe (EU), Near East (NE) and Far East (FE) and (b) the 32 757 casein loci vs the autosomal genome. Each bar represents the mean nucleotide diversity 758 and its standard error. The standard error (2.08×10-5) of the estimate of the nucleotide 759 diversity corresponding to the autosomal genome is very small, so it is not been 760 depicted in the graph. 761 33 762 Figure 1 763 764 34 765 Figure 2 766 767 35 768 Figure 3 769 770 36 771 Figure 4 772 773 37 Supplementary Figure S1. The strategy used for inferring alleles of CSN1S1 (a), CSN2 (b), CSN1S2 (c) and CSN3 gene (d), which was based on information provided by Marletta et al. (2007). Supplementary Figure S2. Principal components analysis (PCA, a) and ADMIXTURE analysis (b) based on 1,221 SNPs mapping to casein genes in bezoars (BE) and four domestic goat populations corresponding to Europe (EU), Africa (AF), Near East (NE) and Far East (FE). Sheet1 Supplementary Table 1. List of the caprine whole-genome sequences used in the current study Organism SRA ID Sample name Breed Region Country Latitude Longitude Sex Age Tissue Total reads Mapped Reads Mapping Rate Depth Publication Capra aegagrus ERR219211 IRCA-C3-1002 - Near East Iran 38.63 45.16 male missing missing 407117878 406691266 99.90% 11.07 Alberto et al., 2018, https://nextgen.epfl.ch/ Capra aegagrus ERR340328 IRCA-M7-0652 - Near East Iran 36.65 50.27 female missing missing 189475827 189292834 99.90% 6.53 Alberto et al., 2018, https://nextgen.epfl.ch/ Capra aegagrus ERR340329 IRCA-I11-0002 - Near East Iran 34.60 48.21 male missing missing 166826202 166574223 99.85% 5.72 Alberto et al., 2018, https://nextgen.epfl.ch/ Capra aegagrus ERR340330 IRCA-N8-0006 - Near East Iran 36.44 50.59 male 108 months missing 368676764 368229077 99.88% 12.88 Alberto et al., 2018, https://nextgen.epfl.ch/ Capra aegagrus ERR340331 IRCA-I6-5237 - Near East Iran 37.16 48.39 male missing missing 341870050 341568819 99.91% 12.10 Alberto et al., 2018, https://nextgen.epfl.ch/ Capra aegagrus ERR340333 IRCA-I11-0001 - Near East Iran 34.60 48.20 male missing missing 187650854 187441350 99.89% 6.55 Alberto et al., 2018, https://nextgen.epfl.ch/ Capra aegagrus ERR340334 IRCA-C3-1001 - Near East Iran 38.63 45.16 male missing missing 369791011 369512004 99.92% 12.90 Alberto et al., 2018, https://nextgen.epfl.ch/ Capra aegagrus ERR340335 IRCA-K12-0005 - Near East Iran 34.21 49.05 male missing missing 193643194 193368011 99.86% 6.76 Alberto et al., 2018, https://nextgen.epfl.ch/ Capra aegagrus ERR340336 IRCA-F3-0597 - Near East Iran 38.88 46.66 male missing missing 187438444 187276068 99.91% 6.59 Alberto et al., 2018, https://nextgen.epfl.ch/ Capra aegagrus ERR340338 IRCA-K7-0009 - Near East Iran 36.68 49.37 male missing missing 334178821 333916774 99.92% 11.80 Alberto et al., 2018, https://nextgen.epfl.ch/ Capra aegagrus ERR340340 IRCA-G2-5063 - Near East Iran 39.18 47.13 male missing missing 359913613 358204161 99.53% 12.60 Alberto et al., 2018, https://nextgen.epfl.ch/ Capra aegagrus ERR340341 IRCA-I11-0003 - Near East Iran 34.60 48.21 male missing missing 149716312 149436381 99.81% 5.26 Alberto et al., 2018, https://nextgen.epfl.ch/ Capra aegagrus ERR340342 IRCA-F3-0600 - Near East Iran 38.92 46.87 male missing missing 186534047 186281194 99.86% 6.53 Alberto et al., 2018, https://nextgen.epfl.ch/ Capra aegagrus ERR340343 IRCA-F2-5064 - Near East Iran 39.25 46.84 male missing missing 212276200 211009172 99.40% 7.54 Alberto et al., 2018, https://nextgen.epfl.ch/ Capra aegagrus ERR340344 IRCA-F2-5026 - Near East Iran 39.16 46.69 male missing missing 333435356 333017953 99.87% 11.66 Alberto et al., 2018, https://nextgen.epfl.ch/ Capra aegagrus ERR340345 IRCA-F2-5066 - Near East Iran 39.08 46.93 male missing missing 87018563 86992885 99.97% 9.75 Alberto et al., 2018, https://nextgen.epfl.ch/ Capra aegagrus ERR340347 IRCA-G2-0568 - Near East Iran 39.35 47.47 male missing missing 138763744 138734320 99.98% 11.27 Alberto et al., 2018, https://nextgen.epfl.ch/ Capra aegagrus ERR340348 IRCA-M12-0008 - Near East Iran 34.18 50.34 male missing missing 117206276 117177563 99.98% 9.67 Alberto et al., 2018, https://nextgen.epfl.ch/ Capra aegagrus ERR340426 IRCA-G2-5065 - Near East Iran 39.16 47.13 male missing missing 180075946 180023075 99.97% 11.76 Alberto et al., 2018, https://nextgen.epfl.ch/ Capra aegagrus ERR470100 IRCA-M7-5041 - Near East Iran 36.55 50.42 male 60 months missing 321131238 320984037 99.95% 13.53 Alberto et al., 2018, https://nextgen.epfl.ch/ Capra aegagrus ERR470104 IRCA-N8-5141 - Near East Iran 36.37 50.60 male 84 months missing 424483520 424062497 99.90% 14.80 Alberto et al., 2018, https://nextgen.epfl.ch/ Capra aegagrus ERR470106 IRCA-M7-5147 - Near East Iran 36.60 50.35 male 60 months missing 447109081 427812381 95.68% 14.16 Alberto et al., 2018, https://nextgen.epfl.ch/ Capra hircus ERR297229 IRCH-F4-5093 local breed Near East Iran 38.30 46.61 female 12 months missing 379151641 378857509 99.92% 12.54 Alberto et al., 2018, https://nextgen.epfl.ch/ Capra hircus ERR299449 IRCH-D6-5189 local breed Near East Iran 37.47 45.88 female 36 months missing 381861059 381557832 99.92% 12.75 Alberto et al., 2018, https://nextgen.epfl.ch/ Capra hircus ERR299456 IRCH-B4-5209 local breed Near East Iran 38.15 44.84 female 36 months missing 372195363 371909016 99.92% 5.25 Alberto et al., 2018, https://nextgen.epfl.ch/ Capra hircus ERR313197 IRCH-E7-5193 local breed Near East Iran 36.95 46.25 male 24 months missing 353043634 352780840 99.93% 12.08 Alberto et al., 2018, https://nextgen.epfl.ch/ Capra hircus ERR313198 IRCH-C6-5204 local breed Near East Iran 37.18 45.21 female 60 months missing 341402089 341135717 99.92% 11.98 Alberto et al., 2018, https://nextgen.epfl.ch/ Capra hircus ERR313199 IRCH-D7-5132 local breed Near East Iran 36.98 45.59 male 12 months missing 393673889 393380804 99.93% 9.86 Alberto et al., 2018, https://nextgen.epfl.ch/ Capra hircus ERR313200 IRCH-C3-5039 local breed Near East Iran 38.86 45.06 female 48 months missing 390966886 390649355 99.92% 13.43 Alberto et al., 2018, https://nextgen.epfl.ch/ Capra hircus ERR313202 IRCH-E5-5053 local breed Near East Iran 37.92 46.09 female 18 months missing 377246573 376965429 99.93% 12.35 Alberto et al., 2018, https://nextgen.epfl.ch/ Capra hircus ERR313204 IRCH-F3-5044 local breed Near East Iran 38.52 46.85 female 24 months missing 377551996 377266564 99.92% 12.44 Alberto et al., 2018, https://nextgen.epfl.ch/ Capra hircus ERR313206 IRCH-G5-5185 local breed Near East Iran 37.97 47.08 male 12 months missing 346949355 346682466 99.92% 12.37 Alberto et al., 2018, https://nextgen.epfl.ch/ Capra hircus ERR313207 IRCH-D5-5240 local breed Near East Iran 37.81 45.57 female 36 months missing 383771191 383470239 99.92% 13.23 Alberto et al., 2018, https://nextgen.epfl.ch/ Capra hircus ERR313209 IRCH-E6-5087 local breed Near East Iran 37.22 46.08 female 24 months missing 353888406 353603653 99.92% 11.86 Alberto et al., 2018, https://nextgen.epfl.ch/ Capra hircus ERR313210 IRCH-F11-5140 local breed Near East Iran 34.90 46.91 female 24 months missing 377093111 376795608 99.92% 12.92 Alberto et al., 2018, https://nextgen.epfl.ch/ Capra hircus ERR313211 IRCH-C5-5206 local breed Near East Iran 37.78 45.06 male 12 months missing 372728543 372448647 99.92% 12.93 Alberto et al., 2018, https://nextgen.epfl.ch/ Capra hircus ERR313212 IRCH-B3-5031 local breed Near East Iran 38.65 44.94 female 36 months missing 370069849 369780083 99.92% 12.74 Alberto et al., 2018, https://nextgen.epfl.ch/ Capra hircus ERR313213 IRCH-B5-5032 local breed Near East Iran 37.97 44.95 male missing missing 374971142 374684198 99.92% 13.09 Alberto et al., 2018, https://nextgen.epfl.ch/ Capra hircus ERR313215 IRCH-F5-5133 local breed Near East Iran 37.91 46.62 female 36 months missing 368403194 368120979 99.92% 12.60 Alberto et al., 2018, https://nextgen.epfl.ch/ Capra hircus ERR340332 IRCH-G4-5194 local breed Near East Iran 38.39 47.43 female 72 months missing 325235527 324988396 99.92% 11.25 Alberto et al., 2018, https://nextgen.epfl.ch/ Capra hircus ERR340337 IRCH-G3-5210 local breed Near East Iran 38.53 47.16 male 12 months missing 315414552 315186734 99.93% 11.29 Alberto et al., 2018, https://nextgen.epfl.ch/ Capra hircus ERR340339 IRCH-C7-5144 local breed Near East Iran 36.73 45.24 male 12 months missing 329508630 329279092 99.93% 11.49 Alberto et al., 2018, https://nextgen.epfl.ch/ Capra hircus ERR313259 MOCH-V10-1083 local populations Africa Morocco missing missing male missing missing 444198628 443875264 99.93% 15.07 Benjelloun et al., 2015, Alberto et al., 2018, https://nextgen.epfl.ch/ Capra hircus ERR313264 MOCH-R13-1104 local populations Africa Morocco missing missing female missing missing 446770484 446770484 99.92% 14.60 Benjelloun et al., 2015, Alberto et al., 2018, https://nextgen.epfl.ch/ Capra hircus ERR315501 MOCH-AA7-2026 local populations Africa Morocco missing missing female missing missing 442877435 442548200 99.93% 14.75 Benjelloun et al., 2015, Alberto et al., 2018, https://nextgen.epfl.ch/ Capra hircus ERR315503 MOCH-N16-1231 local populations Africa Morocco missing missing female missing missing 459159122 458811288 99.92% 15.36 Benjelloun et al., 2015, Alberto et al., 2018, https://nextgen.epfl.ch/ Capra hircus ERR315504 MOCH-AA6-2034 local populations Africa Morocco missing missing female missing missing 444073531 443746453 99.93% 14.63 Benjelloun et al., 2015, Alberto et al., 2018, https://nextgen.epfl.ch/ Capra hircus ERR315506 MOCH-M16-1227 local populations Africa Morocco missing missing female missing missing 474100441 473568522 99.89% 15.67 Benjelloun et al., 2015, Alberto et al., 2018, https://nextgen.epfl.ch/ Capra hircus ERR315511 MOCH-M18-1285 local populations Africa Morocco missing missing female missing missing 438785780 438405607 99.91% 14.70 Benjelloun et al., 2015, Alberto et al., 2018, https://nextgen.epfl.ch/ Capra hircus ERR345977 MOCH-N10-3078 local populations Africa Morocco missing missing female missing missing 357516082 357415502 99.97% 13.99 Benjelloun et al., 2015, Alberto et al., 2018, https://nextgen.epfl.ch/ Capra hircus ERR345980 MOCH-T4-3026 local populations Africa Morocco missing missing female missing missing 431590733 431462319 99.97% 14.37 Benjelloun et al., 2015, Alberto et al., 2018, https://nextgen.epfl.ch/ Capra hircus ERR229484 MOCH-Q10-0090 local populations Africa Morocco missing missing female missing missing 446045210 445692981 99.92% 15.05 Benjelloun et al., 2015, Alberto et al., 2018, https://nextgen.epfl.ch/ Page 1 Sheet1 Capra hircus ERR234310 MOCH-J19-1309 local populations Africa Morocco missing missing female missing missing 438000396 437874904 99.97% 14.41 Benjelloun et al., 2015, Alberto et al., 2018, https://nextgen.epfl.ch/ Capra hircus ERR234316 MOCH-X9-2235 local populations Africa Morocco missing missing female missing missing 435430167 435329501 99.98% 14.82 Benjelloun et al., 2015, Alberto et al., 2018, https://nextgen.epfl.ch/ Capra hircus ERR246145 MOCH-T8-2261 local populations Africa Morocco missing missing female missing missing 437183185 436819138 99.92% 14.72 Benjelloun et al., 2015, Alberto et al., 2018, https://nextgen.epfl.ch/ Capra hircus ERR246149 MOCH-U8-2266 local populations Africa Morocco missing missing female missing missing 438150896 437813623 99.92% 14.81 Benjelloun et al., 2015, Alberto et al., 2018, https://nextgen.epfl.ch/ Capra hircus ERR248918 MOCH-K16-1367 local populations Africa Morocco missing missing female missing missing 470456851 470092257 99.92% 15.92 Benjelloun et al., 2015, Alberto et al., 2018, https://nextgen.epfl.ch/ Capra hircus ERR248919 MOCH-Z5-2083 local populations Africa Morocco missing missing female missing missing 440653104 440328693 99.93% 14.93 Benjelloun et al., 2015, Alberto et al., 2018, https://nextgen.epfl.ch/ Capra hircus ERR248931 MOCH-J17-1355 local populations Africa Morocco missing missing female missing missing 463796214 463416061 99.92% 15.89 Benjelloun et al., 2015, Alberto et al., 2018, https://nextgen.epfl.ch/ Capra hircus ERR248932 MOCH-X5-2098 local populations Africa Morocco missing missing female missing missing 455014622 454677124 99.93% 15.45 Benjelloun et al., 2015, Alberto et al., 2018, https://nextgen.epfl.ch/ Capra hircus ERR248934 MOCH-Z7-2010 local populations Africa Morocco missing missing female missing missing 101427172 101407401 99.98% 13.49 Benjelloun et al., 2015, Alberto et al., 2018, https://nextgen.epfl.ch/ Capra hircus ERR276219 MOCH-X7-2064 local populations Africa Morocco missing missing female missing missing 461343083 460978000 99.92% 15.35 Benjelloun et al., 2015, Alberto et al., 2018, https://nextgen.epfl.ch/ Capra hircus SRR3144601 BST001 Grisons Striped Europe Switzerland missing missing female 2 years blood 125108812 124679903 99.66% 5.30 Becker et al., 2014, Reber et al., 2015, Menzi et al., 2016 Capra hircus SRR3144619 CAG038 Tessin Grey Europe Switzerland missing missing male 2 years blood 145153962 144914652 99.84% 6.43 Becker et al., 2014, Reber et al., 2015, Menzi et al., 2016 Capra hircus SRR3144621 GFG024 Chamois Colored Europe Switzerland missing missing female 2 years blood 129023757 128810529 99.83% 5.50 Becker et al., 2014, Reber et al., 2015, Menzi et al., 2016 Capra hircus SRR3144622 GFG034 Chamois Colored Europe Switzerland missing missing female 2 years blood 148032999 147777485 99.83% 6.33 Becker et al., 2014, Reber et al., 2015, Menzi et al., 2016 Capra hircus SRR3144623 KHZ098 Coppernecked Europe Switzerland missing missing female adult blood 173029651 172682305 99.80% 7.33 Becker et al., 2014, Reber et al., 2015, Menzi et al., 2016 Capra hircus SRR3144624 SAN041 Saanen Europe Switzerland missing missing female 2 years blood 115862069 115529708 99.71% 4.92 Becker et al., 2014, Reber et al., 2015, Menzi et al., 2016 Capra hircus SRR3144625 SAN049 Saanen Europe Switzerland missing missing female 2 years blood 389873370 387863717 99.48% 13.16 Becker et al., 2014, Reber et al., 2015, Menzi et al., 2016 Capra hircus SRR3144630 SAN075 Saanen Europe Switzerland missing missing female 2 years blood 266551249 265295464 99.53% 9.01 Becker et al., 2014, Reber et al., 2015, Menzi et al., 2016 Capra hircus SRR3144633 SAN081 Saanen Europe Switzerland missing missing male 2 years blood 157071301 156719106 99.78% 6.84 Becker et al., 2014, Reber et al., 2015, Menzi et al., 2016 Capra hircus ERR470101 FRCH-SA-0001 Saanen Europe France 46.57 -0.28 female missing missing 214954141 214848480 99.95% 12.59 https://nextgen.epfl.ch/ Capra hircus ERR470102 FRCH-SA-0002 Saanen Europe France 47.69 -0.87 female missing missing 277215487 277150745 99.98% 12.11 https://nextgen.epfl.ch/ Capra hircus ERR470103 FRCH-AL-0001 Alpine Europe France 47.04 0.79 female missing missing 426904442 426583336 99.92% 14.50 https://nextgen.epfl.ch/ Capra hircus ERR470105 FRCH-AL-0002 Alpine Europe France 46.69 -0.36 female missing missing 405734455 405424639 99.92% 13.66 https://nextgen.epfl.ch/ Capra hircus SRR1999390 Tibetan goat1 Tibetan goat Far East China missing missing missing adult blood 287025996 286464263 99.80% 9.53 https://trace.ncbi.nlm.nih.gov/Traces/sra/?study=SRP057710 Capra hircus SRR1999396 Tibetan goat3 Tibetan goat Far East China missing missing missing adult blood 308865310 307958383 99.71% 9.82 https://trace.ncbi.nlm.nih.gov/Traces/sra/?study=SRP057710 Capra hircus SRR1999407 Tibetan goat4 Tibetan goat Far East China missing missing missing adult blood 313674863 312793091 99.72% 10.35 https://trace.ncbi.nlm.nih.gov/Traces/sra/?study=SRP057710 Capra hircus SRR1999408 Tibetan goat5 Tibetan goat Far East China missing missing missing adult blood 288189075 287928895 99.91% 8.97 https://trace.ncbi.nlm.nih.gov/Traces/sra/?study=SRP057710 Capra hircus SRR1999409 Tibetan goat6 Tibetan goat Far East China missing missing missing adult blood 315982304 315572549 99.87% 10.33 https://trace.ncbi.nlm.nih.gov/Traces/sra/?study=SRP057710 Capra hircus SRR1999410 Tibetan goat7 Tibetan goat Far East China missing missing missing adult blood 405301838 404754502 99.86% 8.86 https://trace.ncbi.nlm.nih.gov/Traces/sra/?study=SRP057710 Capra hircus SRR1999411 Tibetan goat8 Tibetan goat Far East China missing missing missing adult blood 293213699 292906984 99.90% 10.16 https://trace.ncbi.nlm.nih.gov/Traces/sra/?study=SRP057710 Capra hircus SRR1999413 Tibetan goat10 Tibetan goat Far East China missing missing missing adult blood 412382631 411734620 99.84% 7.84 https://trace.ncbi.nlm.nih.gov/Traces/sra/?study=SRP057710 Capra hircus SRR1999415 Tibetan goat11 Tibetan goat Far East China missing missing missing adult blood 428534092 427622808 99.79% 8.45 https://trace.ncbi.nlm.nih.gov/Traces/sra/?study=SRP057710 Capra hircus SRR1999416 Tibetan goat12 Tibetan goat Far East China missing missing missing adult blood 295628082 295252906 99.87% 9.79 https://trace.ncbi.nlm.nih.gov/Traces/sra/?study=SRP057710 Capra hircus SRR1999419 Tibetan goat13 Tibetan goat Far East China missing missing missing adult blood 273463552 272700672 99.72% 9.10 https://trace.ncbi.nlm.nih.gov/Traces/sra/?study=SRP057710 Capra hircus SRR1999477 Tibetan goat14 Tibetan goat Far East China missing missing missing adult blood 329230508 328728792 99.85% 10.33 https://trace.ncbi.nlm.nih.gov/Traces/sra/?study=SRP057710 Capra hircus SRR1999645 Tibetan goat16 Tibetan goat Far East China missing missing missing adult blood 314647084 314216409 99.86% 10.14 https://trace.ncbi.nlm.nih.gov/Traces/sra/?study=SRP057710 Capra hircus SRR1999646 Tibetan goat15 Tibetan goat Far East China missing missing missing adult blood 283134647 283134647 99.86% 9.17 https://trace.ncbi.nlm.nih.gov/Traces/sra/?study=SRP057710 Capra hircus SRR1999647 Tibetan goat17 Tibetan goat Far East China missing missing missing adult blood 377981754 377555276 99.89% 7.52 https://trace.ncbi.nlm.nih.gov/Traces/sra/?study=SRP057710 Capra hircus SRR5149617 High-altitude_goat Tibetan goat Far East China missing missing female adult blood 206817767 206321898 99.76% 9.74 Tang et al. 2017 Capra hircus SRR4051866 a19-13 Inner Mongolia cashmere goat Far East China missing missing female adult blood 128206465 128102831 99.92% 4.12 Wang et al., 2016, Li et al., 2017 Capra hircus SRR4051928 a33-14 Inner Mongolia cashmere goat Far East China missing missing female adult blood 146283012 146166904 99.92% 4.79 Wang et al., 2016, Li et al., 2017 Capra hircus SRR4051964 a48-12 Inner Mongolia cashmere goat Far East China missing missing female adult blood 184310811 184143736 99.91% 5.03 Wang et al., 2016, Li et al., 2017 Capra hircus SRR4052103 a13-13 Inner Mongolia cashmere goat Far East China missing missing female adult blood 136347816 135998335 99.74% 3.36 Wang et al., 2016, Li et al., 2017 Capra hircus SRR4052272 a30-1 Inner Mongolia cashmere goat Far East China missing missing female adult blood 116077351 115965880 99.90% 3.07 Wang et al., 2016, Li et al., 2017 Capra hircus SRR4052346 a43-3 Inner Mongolia cashmere goat Far East China missing missing female adult blood 136708343 136530426 99.87% 4.55 Wang et al., 2016, Li et al., 2017 Capra hircus SRR4052349 a45-5 Inner Mongolia cashmere goat Far East China missing missing female adult blood 169591085 169194844 99.77% 5.50 Wang et al., 2016, Li et al., 2017 Capra hircus SRR5557418 Chir_183 Inner Mongolia cashmere goat Far East China missing missing female missing blood 79642650 70717205 88.79% 1.19 Qiao et al. 2017 Capra hircus SRR5557598 Chir_458 Inner Mongolia cashmere goat Far East China missing missing female missing blood 75256299 65014732 86.39% 1.16 Qiao et al. 2017 Capra hircus SRR4064255 a18-1 Liaoning cashmere Far East China missing missing female 7 years blood 91410380 91306970 99.89% 3.08 Wang et al., 2016, Li et al., 2017 Capra hircus SRR4064259 a21-4 Liaoning cashmere Far East China missing missing female 8 years blood 88853679 88777183 99.91% 2.69 Wang et al., 2016, Li et al., 2017 Capra hircus SRR4067780 a24-2 Liaoning cashmere Far East China missing missing female 3 years blood 123294860 122994567 99.76% 3.95 Wang et al., 2016, Li et al., 2017 Capra hircus SRR4067798 a33-3 Liaoning cashmere Far East China missing missing female 4 years blood 124034168 123928016 99.91% 3.76 Wang et al., 2016, Li et al., 2017 Capra hircus SRR4068049 a37-4 Liaoning cashmere Far East China missing missing female 6 years blood 102633262 102370930 99.74% 3.00 Wang et al., 2016, Li et al., 2017 Capra hircus SRR4068051 a38-5 Liaoning cashmere Far East China missing missing female 9 years blood 80436139 80322946 99.86% 2.50 Wang et al., 2016, Li et al., 2017 Capra hircus SRR4068053 a47-3 Liaoning cashmere Far East China missing missing female 3 years blood 122176975 121912696 99.78% 3.76 Wang et al., 2016, Li et al., 2017 Page 2 Sheet1 Capra hircus SRR4068056 a52-10 Liaoning cashmere Far East China missing missing female 3 years blood 117189492 117070791 99.90% 3.30 Wang et al., 2016, Li et al., 2017 Capra hircus SRR4068057 a54-13 Liaoning cashmere Far East China missing missing female 5 years blood 103703020 103604843 99.91% 3.15 Wang et al., 2016, Li et al., 2017 Capra hircus SRR4068058 a56-10 Liaoning cashmere Far East China missing missing female 3 years blood 115716990 115260683 99.61% 3.48 Wang et al., 2016, Li et al., 2017 Page 3 Supplementary Table S2. Polymorphisms (SNPs in black, INDEL in red) detected in the goat casein genes (CSN1S1) Chromosome Position Ref allele Alt_allele QUAL Variant_type Effect Nucleotide substitution AA substitution Subst. literature Alt_freq SIFT_score SIFT_median SIFT_prediction AF BE EU FE NE 6 85978500 G A 828.77 5_prime_UTR_variant MODIFIER c.-82G>A 0.4151 0.7000 0.3864 0.6818 0.2727 0.2500 6 85978529 A G 1026.77 5_prime_UTR_variant MODIFIER c.-53A>G 0.1085 0.2750 - 0.3182 0.0606 0.0250 6 85978639 G A 1217.77 upstream_gene_variant MODIFIER c.-14842G>A 0.4340 0.7000 0.4318 0.6818 0.2879 0.2750 6 85978648 A G,C 1242.77 upstream_gene_variant MODIFIER c.-14833A>C 0.4340 0.7000 0.4318 0.6818 0.2879 0.2750 6 85978841 A G 39.77 upstream_gene_variant MODIFIER c.-14640A>G 0.0047 - - - 0.0152 - 6 85978933 G A 170.77 upstream_gene_variant MODIFIER c.-14548G>A 0.0094 - 0.0455 - - - 6 85979000 A T 860.77 upstream_gene_variant MODIFIER c.-14481A>T 0.4528 0.7000 0.4318 0.6818 0.3485 0.2750 6 85979027 C T 786.77 upstream_gene_variant MODIFIER c.-14454C>T 0.4340 0.7000 0.4318 0.6818 0.3030 0.2500 6 85979093 G T 60.74 upstream_gene_variant MODIFIER c.-14388G>T 0.0094 - - - 0.0303 - 6 85979123 A G 421.77 upstream_gene_variant MODIFIER c.-14358A>G 0.0613 - 0.2955 - - - 6 85979294 C T 822.77 upstream_gene_variant MODIFIER c.-14187C>T 0.4764 0.7000 0.4318 0.7273 0.3788 0.3250 6 85979316 G A 175.77 upstream_gene_variant MODIFIER c.-14165G>A 0.0047 0.0250 - - - - 6 85979372 C T 218.77 upstream_gene_variant MODIFIER c.-14109C>T 0.0047 0.0250 - - - - 6 85979379 G T 24.78 upstream_gene_variant MODIFIER c.-14102G>T 0.0047 - - - 0.0152 - 6 85979447 A G 221.77 upstream_gene_variant MODIFIER c.-14034A>G 0.0047 - - - - 0.0250 6 85979465 A C 313.78 upstream_gene_variant MODIFIER c.-14016A>C 0.0283 - 0.1364 - - - 6 85979518 T G 242.77 upstream_gene_variant MODIFIER c.-13963T>G 0.0047 - - - - 0.0250 6 85979525 A T 775.77 upstream_gene_variant MODIFIER c.-13956A>T 0.4670 0.7500 0.4091 0.7273 0.3333 0.3250 6 85979526 A T 775.77 upstream_gene_variant MODIFIER c.-13955A>T 0.1792 0.3250 0.0682 - 0.2273 0.1750 6 85979559 T C 452.77 upstream_gene_variant MODIFIER c.-13922T>C 0.0660 0.1500 0.0227 - 0.0606 0.0750 6 85979624 T C 109.77 upstream_gene_variant MODIFIER c.-13857T>C 0.0047 0.0250 - - - - 6 85979652 C A 1147.77 upstream_gene_variant MODIFIER c.-13829C>A 0.6887 0.8000 0.9545 1.0000 0.4545 0.5000 6 85979710 G C 265.77 upstream_gene_variant MODIFIER c.-13771G>C 0.0047 0.0250 - - - - 6 85979715 G A 1162.77 upstream_gene_variant MODIFIER c.-13766G>A 0.4575 0.7000 0.4318 0.6818 0.3636 0.2750 6 85979745 C T 451.77 upstream_gene_variant MODIFIER c.-13736C>T 0.0189 0.0750 0.0227 - - - 6 85979787 A G 101.03 upstream_gene_variant MODIFIER c.-13694A>G 0.0142 - - - 0.0455 - 6 85979851 A G 971.77 upstream_gene_variant MODIFIER c.-13630A>G 0.4623 0.7000 0.4091 0.6818 0.3939 0.2750 6 85979873 T C 79.77 upstream_gene_variant MODIFIER c.-13608T>C 0.0094 - - - 0.0303 - 6 85979926 T C 922.77 upstream_gene_variant MODIFIER c.-13555T>C 0.4481 0.7000 0.4091 0.6818 0.3485 0.2750 6 85980048 G C 945.77 intron_variant MODIFIER c.51+39G>C 0.4434 0.7000 0.4091 0.6818 0.3333 0.2750 6 85980071 T C 601.77 intron_variant MODIFIER c.51+62T>C 0.0330 - - - 0.0606 0.0750 6 85980182 C G 392.77 intron_variant MODIFIER c.51+173C>G 0.0425 0.1250 - - - 0.1000 6 85980234 G T 702.77 intron_variant MODIFIER c.51+225G>T 0.0094 - - - - 0.0500 6 85980337 G A 970.77 intron_variant MODIFIER c.51+328G>A 0.0660 - 0.3182 - - - 6 85980427 G A 155.77 intron_variant MODIFIER c.51+418G>A 0.0094 - - - 0.0303 - 6 85980442 C T,A 511.77 intron_variant MODIFIER c.51+433C>A 0.0802 0.1000 0.0682 0.3636 0.0303 - 6 85980463 A C 360.77 intron_variant MODIFIER c.51+454A>C 0.0189 0.1000 - - - - 6 85980533 G T 139.03 intron_variant MODIFIER c.51+524G>T 0.0189 - 0.0909 - - - 6 85980570 A G 1084.77 intron_variant MODIFIER c.51+561A>G 0.4717 0.7000 0.4318 0.7727 0.3333 0.3500 6 85980624 C T 226.77 intron_variant MODIFIER c.51+615C>T 0.0189 - - 0.0455 0.0152 0.0500 6 85980625 G A 223.77 intron_variant MODIFIER c.51+616G>A 0.0094 - - 0.0455 - 0.0250 6 85980643 G A 339.77 intron_variant MODIFIER c.51+634G>A 0.0425 0.1250 - - - 0.1000 6 85980706 G A 187.77 intron_variant MODIFIER c.51+697G>A 0.0047 0.0250 - - - - 6 85980721 A G 785.77 intron_variant MODIFIER c.51+712A>G 0.4481 0.7000 0.4318 0.6818 0.3333 0.2750 6 85980810 T C 39.77 intron_variant MODIFIER c.51+801T>C 0.0047 - - 0.0455 - - 6 85980845 A G 316.77 intron_variant MODIFIER c.51+836A>G 0.0425 0.1250 - - - 0.1000 6 85980874 A G 936.77 intron_variant MODIFIER c.52-821A>G 0.3774 0.5750 0.4091 0.5909 0.2879 0.1750 6 85980896 T A 10.2 intron_variant MODIFIER c.52-799T>A 0.0047 - - - 0.0152 - 6 85980905 A G 553.77 intron_variant MODIFIER c.52-790A>G 0.0708 0.0250 0.0455 - 0.1818 - 6 85980968 C T 26.78 intron_variant MODIFIER c.52-727C>T 0.0047 - - - - 0.0250 6 85981008 G A 153.77 intron_variant MODIFIER c.52-687G>A 0.0094 - - - 0.0303 - 6 85981070 G A 1051.77 intron_variant MODIFIER c.52-625G>A 0.4623 0.7000 0.4091 0.6818 0.3939 0.2750 6 85981078 A G 731.77 intron_variant MODIFIER c.52-617A>G 0.0189 0.1000 - - - - 6 85981115 T C 771.77 intron_variant MODIFIER c.52-580T>C 0.1226 0.2750 0.0909 0.3182 0.0455 0.0250 6 85981136 G C 869.77 intron_variant MODIFIER c.52-559G>C 0.3160 0.5000 0.3636 0.6818 0.1061 0.2250 6 85981181 G A 814.77 intron_variant MODIFIER c.52-514G>A 0.4340 0.7000 0.4091 0.6818 0.3030 0.2750 6 85981193 C T 305.77 intron_variant MODIFIER c.52-502C>T 0.0189 - 0.0909 - - - 6 85981280 C T 228.84 intron_variant MODIFIER c.52-415C>T 0.0283 - 0.0455 - 0.0606 - 6 85981351 A G 136.77 intron_variant MODIFIER c.52-344A>G 0.0047 0.0250 - - - - 6 85981474 G T 923.77 intron_variant MODIFIER c.52-221G>T 0.1085 0.1750 0.0682 - 0.1515 0.0750 6 85981549 G A 657.77 intron_variant MODIFIER c.52-146G>A 0.0094 - - - - 0.0500 6 85981622 T C 200.84 intron_variant MODIFIER c.52-73T>C 0.0189 - 0.0909 - - - 6 85981710 C A 376.78 missense_variant MODERATE c.67C>A, c.68A>T p.His23Ile p.His8Ile 0.0330 0.03 2.74 DELETERIOUS - - - 0.0606 0.0750 6 85981735 T C 363.77 splice_region_variant LOW c.84+8T>C 0.0283 - 0.1364 - - - 6 85981739 T A 794.77 intron_variant MODIFIER c.84+12T>A 0.4481 0.7000 0.4318 0.6818 0.3333 0.2750 6 85981746 T C 306.77 intron_variant MODIFIER c.84+19T>C 0.0283 - - 0.0909 0.0303 0.0500 6 85981799 T A 862.77 intron_variant MODIFIER c.84+72T>A 0.4623 0.7000 0.4091 0.6818 0.3939 0.2750 6 85981816 G T 863.77 intron_variant MODIFIER c.84+89G>T 0.4623 0.7000 0.4091 0.6818 0.3939 0.2750 6 85981818 C T 208.77 intron_variant MODIFIER c.84+91C>T 0.0047 - - - - 0.0250 6 85981851 C T 884.77 intron_variant MODIFIER c.84+124C>T 0.3160 0.5000 0.2955 0.6818 0.1667 0.2000 6 85981916 A G 236.77 intron_variant MODIFIER c.84+189A>G 0.0047 0.0250 - - - - 6 85981928 G A 146.77 intron_variant MODIFIER c.84+201G>A 0.0094 - 0.0455 - - - 6 85981976 A G 243.77 intron_variant MODIFIER c.84+249A>G 0.0094 - - - 0.0303 - 6 85982020 T A 670.77 intron_variant MODIFIER c.84+293T>A 0.0802 0.1000 0.0909 0.3636 0.0152 - 6 85982105 A T 846.77 intron_variant MODIFIER c.84+378A>T 0.3160 0.5000 0.3409 0.6818 0.1364 0.2000 6 85982132 C T 140.77 intron_variant MODIFIER c.84+405C>T 0.0142 - - 0.0455 - 0.0500 6 85982136 G A 951.77 intron_variant MODIFIER c.84+409G>A 0.4528 0.7000 0.4318 0.6818 0.3485 0.2750 6 85982149 T C 951.77 intron_variant MODIFIER c.84+422T>C 0.4434 0.7000 0.4091 0.6818 0.3333 0.2750 6 85982210 C T 542.77 intron_variant MODIFIER c.85-398C>T 0.0047 - 0.0227 - - - 6 85982261 A G 411.77 intron_variant MODIFIER c.85-347A>G 0.0425 0.1250 - - - 0.1000 6 85982286 C T 109.77 intron_variant MODIFIER c.85-322C>T 0.0094 - - - 0.0303 - 6 85982287 G A 490.77 intron_variant MODIFIER c.85-321G>A 0.0613 0.1500 0.0227 - 0.0758 0.0250 6 85982533 G A 306.77 intron_variant MODIFIER c.85-75G>A 0.0047 - 0.0227 - - - 6 85982583 A G 535.77 intron_variant MODIFIER c.85-25A>G 0.0660 0.1750 - 0.3182 - - 6 85982615 T C 1616.77 missense_variant MODERATE c.92T>C p.Leu31Pro p.Leu16Pro 0.4292 0.1 2.86 TOLERATED 0.7000 0.3864 0.6818 0.3030 0.2750 6 85982631 C G 1603.77 synonymous_variant LOW c.108C>G p.Leu36Leu 0.4292 0.7000 0.3636 0.6818 0.3182 0.2750 6 85982647 G A 111.77 splice_donor_variant HIGH c.123+1G>A 0.0047 - - 0.0455 - - 6 85982740 A G 1246.77 intron_variant MODIFIER c.123+94A>G 0.4340 0.7000 0.4318 0.6818 0.2879 0.2750 6 85982793 A G 1137.77 intron_variant MODIFIER c.123+147A>G 0.4387 0.7000 0.4091 0.6818 0.3182 0.2750 6 85982829 G A 258.77 intron_variant MODIFIER c.123+183G>A 0.0094 - 0.0455 - - - 6 85982853 A G 1124.77 intron_variant MODIFIER c.123+207A>G 0.4245 0.7000 0.4318 0.6818 0.2576 0.2750 6 85982911 T C 1147.77 intron_variant MODIFIER c.124-182T>C 0.4340 0.7000 0.4318 0.6818 0.2879 0.2750 6 85982914 G A 264.77 intron_variant MODIFIER c.124-179G>A 0.0047 0.0250 - - - - 6 85982925 C T 836.77 intron_variant MODIFIER c.124-168C>T 0.0094 - - - - 0.0500 6 85982965 T C 165.77 intron_variant MODIFIER c.124-128T>C 0.0094 - - - 0.0303 - 6 85983009 T C 273.8 intron_variant MODIFIER c.124-84T>C 0.0142 - 0.0682 - - - 6 85983179 T C 1125.77 intron_variant MODIFIER c.147+63T>C 0.3066 0.5000 0.2955 0.6818 0.1364 0.2000 6 85983185 C T 1113.77 intron_variant MODIFIER c.147+69C>T 0.4292 0.7000 0.4091 0.6818 0.2879 0.2750 6 85983257 C A 1047.77 intron_variant MODIFIER c.147+141C>A 0.4340 0.7000 0.3864 0.6818 0.3182 0.2750 6 85983281 A G 146.77 intron_variant MODIFIER c.147+165A>G 0.0047 0.0250 - - - - 6 85983289 T A 1065.77 intron_variant MODIFIER c.147+173T>A 0.4292 0.7000 0.3864 0.6818 0.3030 0.2750 6 85983335 A C 1047.77 intron_variant MODIFIER c.148-205A>C 0.4057 0.7000 0.3864 0.6818 0.2273 0.2750 6 85983337 A G 540.77 intron_variant MODIFIER c.148-203A>G 0.1038 0.2000 0.0682 - 0.1212 0.0750 6 85983410 G T 758.77 intron_variant MODIFIER c.148-130G>T 0.0802 0.1000 0.0909 0.3636 0.0152 - 6 85983448 A G 891.77 intron_variant MODIFIER c.148-92A>G 0.0566 - 0.1364 - 0.0606 0.0500 6 85983450 T G 344.77 intron_variant MODIFIER c.148-90T>G 0.0236 0.0750 - - 0.0152 0.0250 6 85983563 G A 370.98 synonymous_variant LOW c.171G>A p.Lys57Lys 0.0094 - - - 0.0303 - 6 85983577 A G 1003.77 intron_variant MODIFIER c.171+14A>G 0.4292 0.7000 0.4091 0.6818 0.2879 0.2750 6 85983631 T A 380.77 intron_variant MODIFIER c.171+68T>A 0.0047 0.0250 - - - - 6 85983681 T C 1034.77 intron_variant MODIFIER c.171+118T>C 0.9151 1.0000 0.9091 1.0000 0.7879 1.0000 6 85983700 G A 1069.77 intron_variant MODIFIER c.171+137G>A 0.4528 0.7000 0.3864 0.6818 0.3788 0.2750 6 85983717 G T 546.77 intron_variant MODIFIER c.171+154G>T 0.0802 0.1750 0.0227 - 0.0909 0.0750 6 85983745 C T 882.77 intron_variant MODIFIER c.171+182C>T 0.4528 0.7000 0.4318 0.6818 0.3485 0.2750 6 85983897 G T 479.77 intron_variant MODIFIER c.172-254G>T 0.0566 0.1500 0.0227 - 0.0606 0.0250 6 85983939 G A 805.77 intron_variant MODIFIER c.172-212G>A 0.4387 0.7000 0.4318 0.6818 0.3030 0.2750 6 85984009 C T 976.77 intron_variant MODIFIER c.172-142C>T 0.1226 0.2000 0.1136 - 0.1515 0.0750 6 85984028 C T 960.77 intron_variant MODIFIER c.172-123C>T 0.4434 0.7000 0.3864 0.6818 0.3333 0.3000 6 85984094 A G 467.77 intron_variant MODIFIER c.172-57A>G 0.0330 - - - 0.0606 0.0750 6 85984305 C T 334.77 intron_variant MODIFIER c.195+131C>T 0.0613 0.1250 - - 0.0606 0.1000 6 85984331 A T 721.77 intron_variant MODIFIER c.195+157A>T 0.4575 0.7000 0.4318 0.7273 0.3333 0.3000 6 85984357 T C 906.77 intron_variant MODIFIER c.195+183T>C 0.1085 0.2000 0.0682 - 0.1364 0.0750 6 85984395 A T 860.77 intron_variant MODIFIER c.195+221A>T 0.3679 0.5250 0.4318 0.3636 0.2879 0.2750 6 85984423 C T 1039.77 intron_variant MODIFIER c.195+249C>T 0.3774 0.5250 0.4318 0.3636 0.3182 0.2750 6 85984512 C T 645.77 intron_variant MODIFIER c.195+338C>T 0.1179 0.2000 0.1136 - 0.1364 0.0750 6 85984519 C T 241.77 intron_variant MODIFIER c.195+345C>T 0.0142 - - 0.0455 0.0152 0.0250 6 85984530 G A 229.77 intron_variant MODIFIER c.196-337G>A 0.0094 - 0.0455 - - - 6 85984603 A G 199.77 intron_variant MODIFIER c.196-264A>G 0.0189 - - - 0.0455 0.0250 6 85984648 A T 127.77 intron_variant MODIFIER c.196-219A>T 0.0236 - - - 0.0758 - 6 85984650 A G 307.77 intron_variant MODIFIER c.196-217A>G 0.0566 0.0250 0.0455 - 0.1364 - 6 85984702 A G 649.77 intron_variant MODIFIER c.196-165A>G 0.1274 0.2000 0.1136 - 0.1667 0.0750 6 85984781 T A 997.77 intron_variant MODIFIER c.196-86T>A 0.4623 0.6750 0.4545 0.7273 0.3485 0.3000 6 85984785 C T 238.77 intron_variant MODIFIER c.196-82C>T 0.0047 - - - - 0.0250 6 85984930 A C 901.77 intron_variant MODIFIER c.219+40A>C 0.4292 0.6750 0.3864 0.7273 0.3182 0.2500 6 85984938 G T 688.77 intron_variant MODIFIER c.219+48G>T 0.1226 0.1750 0.1136 - 0.1970 0.0250 6 85984964 A T 895.77 intron_variant MODIFIER c.219+74A>T 0.4387 0.6750 0.4091 0.7273 0.3182 0.2750 6 85985065 A C 640.77 intron_variant MODIFIER c.219+175A>C 0.0991 0.1750 0.1136 - 0.1212 0.0250 6 85985092 T C 1006.77 intron_variant MODIFIER c.219+202T>C 0.2123 0.3000 0.1364 0.3182 0.1667 0.2250 6 85985094 T G 1006.77 intron_variant MODIFIER c.219+204T>G 0.2123 0.3000 0.1364 0.3182 0.1667 0.2250 6 85985148 C G,A 675.77 intron_variant MODIFIER c.219+258C>A 0.0283 0.1000 - - - 0.0500 6 85985149 G A 338.77 intron_variant MODIFIER c.219+259G>A 0.0047 0.0250 - - - - 6 85985183 C A 374.77 intron_variant MODIFIER c.219+293C>A 0.0047 0.0250 - - - - 6 85985242 T G 861.77 intron_variant MODIFIER c.219+352T>G 0.0802 0.1000 0.0909 0.3636 0.0152 - 6 85985289 T C 876.77 intron_variant MODIFIER c.219+399T>C 0.4717 0.8000 0.4091 0.5909 0.3333 0.3750 6 85985322 G A 903.77 intron_variant MODIFIER c.219+432G>A 0.4292 0.6750 0.4091 0.6818 0.3030 0.2750 6 85985357 C T 739.77 intron_variant MODIFIER c.219+467C>T 0.4198 0.6750 0.4318 0.6818 0.2576 0.2750 6 85985359 G C 667.77 intron_variant MODIFIER c.219+469G>C 0.1226 0.2000 0.1818 0.4091 - 0.0250 6 85985443 C T 230.77 intron_variant MODIFIER c.219+553C>T 0.0425 0.0250 - - 0.1212 - 6 85985458 G A 860.77 intron_variant MODIFIER c.219+568G>A 0.4528 0.6750 0.4091 0.6818 0.3788 0.2750 6 85985503 T C 187.77 intron_variant MODIFIER c.219+613T>C 0.0047 0.0250 - - - - 6 85985526 G A 272.77 intron_variant MODIFIER c.219+636G>A 0.0189 - 0.0909 - - - 6 85985599 C T 217.77 intron_variant MODIFIER c.219+709C>T 0.0047 0.0250 - - - - 6 85985622 T A 921.77 intron_variant MODIFIER c.219+732T>A 0.3208 0.4750 0.2500 0.3182 0.3182 0.2500 6 85985630 T C 581.77 intron_variant MODIFIER c.219+740T>C 0.0849 0.1750 - 0.3182 0.0455 0.0250 6 85985689 G A 142.77 intron_variant MODIFIER c.220-715G>A 0.0047 - - - - 0.0250 6 85985736 C A 385.77 intron_variant MODIFIER c.220-668C>A 0.0613 0.1500 0.0227 - 0.0758 0.0250 6 85985762 T C 563.77 intron_variant MODIFIER c.220-642T>C 0.0660 - 0.3182 - - - 6 85985763 A C 273.77 intron_variant MODIFIER c.220-641A>C 0.0047 - 0.0227 - - - 6 85985765 G T 898.77 intron_variant MODIFIER c.220-639G>T 0.4292 0.7000 0.4318 0.6818 0.2879 0.2500 6 85985806 A G 310.9 intron_variant MODIFIER c.220-598A>G 0.0189 - 0.0909 - - - 6 85985820 T C 846.77 intron_variant MODIFIER c.220-584T>C 0.4434 0.7000 0.4091 0.6818 0.3485 0.2500 6 85985829 T C 367.77 intron_variant MODIFIER c.220-575T>C 0.0330 - 0.1591 - - - 6 85985836 G A 214.77 intron_variant MODIFIER c.220-568G>A 0.0047 0.0250 - - - - 6 85985858 T C 106.77 intron_variant MODIFIER c.220-546T>C 0.0047 0.0250 - - - - 6 85985890 C G 178.77 intron_variant MODIFIER c.220-514C>G 0.0047 0.0250 - - - - 6 85985922 C T 71.77 intron_variant MODIFIER c.220-482C>T 0.0047 - 0.0227 - - - 6 85985952 G A 385.77 intron_variant MODIFIER c.220-452G>A 0.0330 - 0.1591 - - - 6 85985954 T C 424.77 intron_variant MODIFIER c.220-450T>C 0.0566 0.1000 - 0.0455 0.0152 0.1500 6 85985968 T C 471.77 intron_variant MODIFIER c.220-436T>C 0.0047 0.0250 - - - - 6 85986087 G C 353.77 intron_variant MODIFIER c.220-317G>C 0.0047 0.0250 - - - - 6 85986106 C T 361.77 intron_variant MODIFIER c.220-298C>T 0.0047 0.0250 - - - - 6 85986239 C T 155.77 intron_variant MODIFIER c.220-165C>T 0.0047 - - - 0.0152 - 6 85986246 C T 971.77 intron_variant MODIFIER c.220-158C>T 0.4151 0.7000 0.4318 0.6818 0.2424 0.2500 6 85986322 A T,G 591.77 intron_variant MODIFIER c.220-82A>G 0.0377 - 0.0227 - 0.0606 0.0750 6 85986334 G A 341.77 intron_variant MODIFIER c.220-70G>A 0.0047 0.0250 - - - - 6 85986339 T G 1152.77 intron_variant MODIFIER c.220-65T>G 0.7075 0.8750 1.0000 1.0000 0.4394 0.5000 6 85986363 A G 187.9 intron_variant MODIFIER c.220-41A>G 0.0094 - 0.0455 - - - 6 85986379 G A 199.77 intron_variant MODIFIER c.220-25G>A 0.0047 0.0250 - - - - 6 85986427 G T,C,A 415.77 synonymous_variant LOW c.243G>A p.Ser81Ser 0.0660 0.1500 0.0682 - - 0.1250 6 85986459 A C 108.77 intron_variant MODIFIER c.252+23A>C 0.0047 0.0250 - - - - 6 85986466 C T 1002.77 intron_variant MODIFIER c.252+30C>T 0.4198 0.6750 0.4091 0.6818 0.2879 0.2500 6 85986479 G T 195.77 intron_variant MODIFIER c.252+43G>T 0.0094 - - - 0.0303 - 6 85986502 T C 107.77 intron_variant MODIFIER c.252+66T>C 0.0047 - - 0.0455 - - 6 85986573 C A 183.77 intron_variant MODIFIER c.252+137C>A 0.0047 0.0250 - - - - 6 85986644 A T 148.77 intron_variant MODIFIER c.252+208A>T 0.0094 - - - 0.0303 - 6 85986739 A G 246.77 intron_variant MODIFIER c.252+303A>G 0.0142 - 0.0682 - - - 6 85986773 T C 152.77 intron_variant MODIFIER c.252+337T>C 0.0047 0.0250 - - - - 6 85986837 T C 137.77 intron_variant MODIFIER c.253-339T>C 0.0094 - 0.0455 - - - 6 85986847 A G 481.77 intron_variant MODIFIER c.253-329A>G 0.0377 - - - 0.0758 0.0750 6 85986864 A G 294.77 intron_variant MODIFIER c.253-312A>G 0.0047 0.0250 - - - - 6 85986893 G A 781.77 intron_variant MODIFIER c.253-283G>A 0.0660 0.1750 - 0.3182 - - 6 85986905 G A 295.77 intron_variant MODIFIER c.253-271G>A 0.0047 0.0250 - - - - 6 85986939 T C 227.77 intron_variant MODIFIER c.253-237T>C 0.0047 0.0250 - - - - 6 85986951 T A 268.77 intron_variant MODIFIER c.253-225T>A 0.0047 0.0250 - - - - 6 85986962 C T 906.77 intron_variant MODIFIER c.253-214C>T 0.4481 0.6750 0.4318 0.6818 0.3485 0.2750 6 85987033 C T 312.77 intron_variant MODIFIER c.253-143C>T 0.0330 - 0.1591 - - - 6 85987078 A G 562.77 intron_variant MODIFIER c.253-98A>G 0.0519 0.1500 0.0455 - 0.0303 0.0250 6 85987083 T C 1036.77 intron_variant MODIFIER c.253-93T>C 0.4104 0.6750 0.4545 0.6818 0.2121 0.2750 6 85987138 T C 1037.77 intron_variant MODIFIER c.253-38T>C 0.4198 0.7000 0.4545 0.6818 0.2273 0.2750 6 85987155 A G 409.77 intron_variant MODIFIER c.253-21A>G 0.0566 0.1750 - - - 0.1250 6 85987162 T G 157.77 intron_variant MODIFIER c.253-14T>G 0.0047 - - 0.0455 - - 6 85987189 A G 529.77 missense_variant MODERATE c.266A>G p.Asn89Ser 0.0047 0.35 2.74 TOLERATED 0.0250 - - - - 6 85987197 C G 866.77 missense_variant MODERATE c.274C>G p.Gln92Glu p.Gln77Glu 0.4245 0.29 2.74 TOLERATED 0.7000 0.4773 0.6818 0.2273 0.2750 6 85987210 T C 378.77 intron_variant MODIFIER c.276+11T>C 0.0330 0.0250 0.1136 - - 0.0250 6 85987242 A T 237.84 intron_variant MODIFIER c.276+43A>T 0.0189 - 0.0909 - - - 6 85987273 T C 36.77 intron_variant MODIFIER c.277-17T>C 0.0047 - - - 0.0152 - 6 85987307 G A 213.77 synonymous_variant LOW c.294G>A p.Lys98Lys 0.0094 - 0.0455 - - - 6 85987376 A G 150.77 intron_variant MODIFIER c.330+33A>G 0.0047 0.0250 - - - - 6 85987400 G T 385.77 intron_variant MODIFIER c.330+57G>T 0.0047 - 0.0227 - - - 6 85987401 T A 385.77 intron_variant MODIFIER c.330+58T>A 0.0047 - 0.0227 - - - 6 85987405 G A 173.77 intron_variant MODIFIER c.330+62G>A 0.0047 0.0250 - - - - 6 85987423 C A 122.77 intron_variant MODIFIER c.330+80C>A 0.0047 0.0250 - - - - 6 85987436 G A 124.77 intron_variant MODIFIER c.330+93G>A 0.0047 0.0250 - - - - 6 85987500 T C 1174.77 intron_variant MODIFIER c.330+157T>C 0.3491 0.6000 0.3182 0.3182 0.2727 0.2750 6 85987501 G T 474.77 intron_variant MODIFIER c.330+158G>T 0.0047 0.0250 - - - - 6 85987517 C A 281.77 intron_variant MODIFIER c.330+174C>A 0.0283 0.1250 - - - 0.0250 6 85987563 A G 328.77 intron_variant MODIFIER c.330+220A>G 0.0047 0.0250 - - - - 6 85987573 G A 845.77 intron_variant MODIFIER c.330+230G>A 0.3396 0.6000 0.3636 0.3182 0.2121 0.2750 6 85987603 C T 40.77 intron_variant MODIFIER c.330+260C>T 0.0047 - - - 0.0152 - 6 85987615 G T 437.77 intron_variant MODIFIER c.330+272G>T 0.0142 - 0.0682 - - - 6 85987646 C A 1051.77 intron_variant MODIFIER c.330+303C>A 0.3443 0.6000 0.3182 0.3182 0.2576 0.2750 6 85987650 C T 1051.77 intron_variant MODIFIER c.330+307C>T 0.3396 0.6000 0.3182 0.3182 0.2576 0.2500 6 85987658 A T 1199.77 intron_variant MODIFIER c.330+315A>T 0.3302 0.6000 0.3182 0.2273 0.2576 0.2500 6 85987785 C T 947.77 intron_variant MODIFIER c.330+442C>T 0.3538 0.6000 0.3182 0.3182 0.2879 0.2750 6 85987796 G A 851.77 intron_variant MODIFIER c.330+453G>A 0.3585 0.6000 0.3182 0.3182 0.3030 0.2750 6 85987829 C T 947.77 intron_variant MODIFIER c.330+486C>T 0.3302 0.6000 0.3409 0.2727 0.2121 0.2750 6 85987841 T A 581.77 intron_variant MODIFIER c.330+498T>A 0.0330 - - - 0.0606 0.0750 6 85987882 G T 1014.77 intron_variant MODIFIER c.330+539G>T 0.3255 0.5750 0.3182 0.2273 0.2576 0.2500 SNP 6 85987919 G A 977.77 intron_variant MODIFIER c.330+576G>A 0.2689 0.5250 0.0909 0.3182 0.2121 0.2750 6 85987939 G C 916.77 intron_variant MODIFIER c.330+596G>C 0.3208 0.5750 0.2955 0.3182 0.2121 0.2750 6 85987946 A G 736.77 intron_variant MODIFIER c.330+603A>G 0.0519 0.2250 - - - 0.0500 6 85987956 G T 701.77 intron_variant MODIFIER c.330+613G>T 0.3302 0.5750 0.3182 0.3636 0.2121 0.2750 6 85988005 A C 245.77 intron_variant MODIFIER c.330+662A>C 0.0425 0.0250 0.0455 - 0.0909 - 6 85988049 C T 798.77 intron_variant MODIFIER c.331-643C>T 0.3679 0.6000 0.3409 0.3182 0.3182 0.2750 6 85988101 A G 1027.77 intron_variant MODIFIER c.331-591A>G 0.3679 0.6000 0.3409 0.2727 0.3333 0.2750 6 85988127 T C 897.77 intron_variant MODIFIER c.331-565T>C 0.3443 0.5750 0.2955 0.3182 0.3030 0.2500 6 85988128 G A 897.77 intron_variant MODIFIER c.331-564G>A 0.3443 0.5750 0.2955 0.3182 0.3030 0.2500 6 85988138 T C 395.77 intron_variant MODIFIER c.331-554T>C 0.0047 0.0250 - - - - 6 85988170 C T 570.77 intron_variant MODIFIER c.331-522C>T 0.0377 0.0500 0.1136 - 0.0152 - 6 85988209 C T 777.77 intron_variant MODIFIER c.331-483C>T 0.0094 - 0.0455 - - - 6 85988222 G A 878.77 intron_variant MODIFIER c.331-470G>A 0.3302 0.6000 0.3409 0.2727 0.2273 0.2500 6 85988253 A C 881.77 intron_variant MODIFIER c.331-439A>C 0.3349 0.6000 0.3409 0.2727 0.2273 0.2750 6 85988301 C T 1048.77 intron_variant MODIFIER c.331-391C>T 0.3443 0.6000 0.3636 0.2727 0.2424 0.2750 6 85988308 C G,A 1138.77 intron_variant MODIFIER c.331-384C>A 0.3443 0.6000 0.3636 0.3182 0.2273 0.2750 6 85988365 G A 955.77 intron_variant MODIFIER c.331-327G>A 0.3585 0.6000 0.3409 0.3182 0.2879 0.2750 6 85988390 G A 1065.77 intron_variant MODIFIER c.331-302G>A 0.3585 0.6000 0.3636 0.2727 0.2879 0.2750 6 85988405 C A 401.77 intron_variant MODIFIER c.331-287C>A 0.0236 0.0250 0.0455 - 0.0303 - 6 85988477 T C 927.77 intron_variant MODIFIER c.331-215T>C 0.4198 0.7000 0.3409 0.4091 0.3182 0.4000 6 85988516 A G 981.77 intron_variant MODIFIER c.331-176A>G 0.3349 0.6000 0.3409 0.3182 0.2121 0.2750 6 85988536 T G 1051.77 intron_variant MODIFIER c.331-156T>G 0.3255 0.5750 0.2727 0.3182 0.2424 0.2750 6 85988540 C T 1006.77 intron_variant MODIFIER c.331-152C>T 0.3208 0.6000 0.2727 0.3182 0.2121 0.2750 6 85988608 G C 121.77 intron_variant MODIFIER c.331-84G>C 0.0047 0.0250 - - - - 6 85988643 T A 730.77 intron_variant MODIFIER c.331-49T>A 0.1840 0.3250 0.1136 0.2727 0.1364 0.1500 6 85988650 T C 781.77 intron_variant MODIFIER c.331-42T>C 0.3113 0.6000 0.3409 0.2727 0.1515 0.2750 6 85988659 T C 953.77 intron_variant MODIFIER c.331-33T>C 0.4104 0.7000 0.4545 0.3636 0.1970 0.4500 6 85988664 T C 871.77 intron_variant MODIFIER c.331-28T>C 0.3019 0.5750 0.3409 0.2727 0.1364 0.2750 6 85988682 C T 1006.77 intron_variant MODIFIER c.331-10C>T 0.2925 0.5750 0.3182 0.2727 0.1212 0.2750 6 85988705 G A 871.77 missense_variant MODERATE c.344G>A p.Arg115Lys p.Arg100Lys 0.2830 0.07 2.68 TOLERATED 0.5750 0.2955 0.2727 0.1061 0.2750 6 85988712 A G 781.77 synonymous_variant LOW c.351A>G p.Lys117Lys 0.2830 0.5750 0.2955 0.2727 0.1061 0.2750 6 85988739 G A 728.77 splice_region_variant LOW c.372+6G>A 0.3396 0.6000 0.3636 0.3182 0.2121 0.2750 6 85988745 T G 731.77 intron_variant MODIFIER c.372+12T>G 0.3349 0.5750 0.3636 0.3182 0.2121 0.2750 6 85988758 A G 49.77 intron_variant MODIFIER c.372+25A>G 0.0047 - - - 0.0152 - 6 85988788 G A 250.77 intron_variant MODIFIER c.372+55G>A 0.0236 0.0500 - 0.0455 0.0152 0.0250 6 85988831 G A 191.77 intron_variant MODIFIER c.372+98G>A 0.0047 0.0250 - - - - 6 85988840 A G 613.77 intron_variant MODIFIER c.372+107A>G 0.0519 - - - 0.1212 0.0750 6 85988857 G A 608.77 intron_variant MODIFIER c.372+124G>A 0.0094 0.0250 - - - 0.0250 6 85988911 C T 904.77 intron_variant MODIFIER c.372+178C>T 0.3443 0.6000 0.3636 0.3182 0.2273 0.2750 6 85988914 A G 190.9 intron_variant MODIFIER c.372+181A>G 0.0189 0.0250 0.0682 - - - 6 85988971 T C 1082.77 intron_variant MODIFIER c.372+238T>C 0.3491 0.6000 0.3636 0.3182 0.2576 0.2500 6 85989021 A G 992.77 intron_variant MODIFIER c.372+288A>G 0.3396 0.6000 0.2955 0.3182 0.2727 0.2500 6 85989107 A T 907.77 intron_variant MODIFIER c.373-270A>T 0.3538 0.6000 0.3182 0.3182 0.2879 0.2750 6 85989108 T C 907.77 intron_variant MODIFIER c.373-269T>C 0.3538 0.6000 0.3182 0.3182 0.2879 0.2750 6 85989166 T C 277.77 intron_variant MODIFIER c.373-211T>C 0.0189 0.0250 0.0682 - - - 6 85989187 C T 352.77 intron_variant MODIFIER c.373-190C>T 0.0377 0.0500 - 0.0455 0.0303 0.0750 6 85989190 A C 971.77 intron_variant MODIFIER c.373-187A>C 0.3679 0.5750 0.3182 0.3182 0.3485 0.2750 6 85989234 C T 873.77 intron_variant MODIFIER c.373-143C>T 0.3491 0.5750 0.3182 0.3182 0.2879 0.2750 6 85989257 T C 949.77 intron_variant MODIFIER c.373-120T>C 0.2028 0.3000 0.1136 0.3182 0.1970 0.1500 6 85989260 T C 949.77 intron_variant MODIFIER c.373-117T>C 0.2028 0.3000 0.1136 0.3182 0.1970 0.1500 6 85989481 G T 736.77 intron_variant MODIFIER c.396+81G>T 0.0802 0.1000 - 0.3182 0.0758 0.0250 6 85989491 C T 1017.77 intron_variant MODIFIER c.396+91C>T 0.3726 0.6000 0.3636 0.3182 0.3333 0.2500 6 85989585 A T 395.77 intron_variant MODIFIER c.396+185A>T 0.0566 0.1000 - 0.0455 0.0303 0.1250 6 85989632 T C 357.89 intron_variant MODIFIER c.396+232T>C 0.0236 - 0.0909 - - 0.0250 6 85989645 A T 871.77 intron_variant MODIFIER c.396+245A>T 0.4575 0.7000 0.4545 0.4091 0.3485 0.4250 6 85989662 T A 1307.77 intron_variant MODIFIER c.396+262T>A 0.9245 1.0000 0.9545 1.0000 0.7879 1.0000 6 85989686 T C 32.77 intron_variant MODIFIER c.396+286T>C 0.0047 - - - 0.0152 - 6 85989691 A C 699.77 intron_variant MODIFIER c.396+291A>C 0.3679 0.6000 0.3636 0.3182 0.3030 0.2750 6 85989744 C G 355.77 intron_variant MODIFIER c.396+344C>G 0.0236 - 0.1136 - - - 6 85989768 T C 710.77 intron_variant MODIFIER c.396+368T>C 0.3396 0.5750 0.2955 0.2727 0.2879 0.2750 6 85989770 G A 710.77 intron_variant MODIFIER c.396+370G>A 0.3349 0.5500 0.2955 0.2727 0.2879 0.2750 6 85989813 C T 322.77 intron_variant MODIFIER c.396+413C>T 0.0047 - 0.0227 - - - 6 85989815 C T 622.77 intron_variant MODIFIER c.396+415C>T 0.3443 0.6000 0.2955 0.2727 0.2879 0.2750 6 85989826 A T 691.77 intron_variant MODIFIER c.396+426A>T 0.4151 0.7000 0.3409 0.3182 0.3333 0.4000 6 85989834 T C 729.77 intron_variant MODIFIER c.396+434T>C 0.3632 0.6000 0.3409 0.2727 0.3182 0.2750 6 85989894 C T 781.77 intron_variant MODIFIER c.396+494C>T 0.3632 0.6000 0.3636 0.3182 0.2879 0.2750 6 85989895 A G 781.77 intron_variant MODIFIER c.396+495A>G 0.3632 0.6000 0.3636 0.3182 0.2879 0.2750 6 85989926 C G 679.77 intron_variant MODIFIER c.396+526C>G 0.0519 - - - 0.1212 0.0750 6 85989940 C G 43.77 intron_variant MODIFIER c.396+540C>G 0.0047 - - - 0.0152 - 6 85989948 C A 946.77 intron_variant MODIFIER c.396+548C>A 0.3538 0.6000 0.3864 0.3182 0.2424 0.2750 6 85989950 A G 43.77 intron_variant MODIFIER c.396+550A>G 0.0047 - - - 0.0152 - 6 85989951 A G 946.77 intron_variant MODIFIER c.396+551A>G 0.3491 0.6000 0.3636 0.3182 0.2424 0.2750 6 85989992 G A 37.77 intron_variant MODIFIER c.396+592G>A 0.0047 - - - - 0.0250 6 85989994 G A 225.77 intron_variant MODIFIER c.396+594G>A 0.0047 0.0250 - - - - 6 85990036 C G 168.77 intron_variant MODIFIER c.397-559C>G 0.0047 - - 0.0455 - - 6 85990040 C A,T 965.77 intron_variant MODIFIER c.397-555C>A 0.4198 0.4500 0.1136 0.3182 0.5000 0.6500 6 85990049 A G 809.77 intron_variant MODIFIER c.397-546A>G 0.3491 0.6000 0.2955 0.3182 0.3030 0.2500 6 85990082 A G 940.77 intron_variant MODIFIER c.397-513A>G 0.3208 0.6000 0.3409 0.3182 0.1970 0.2250 6 85990092 A T 946.77 intron_variant MODIFIER c.397-503A>T 0.3396 0.6000 0.3409 0.3182 0.2576 0.2250 6 85990118 G T 507.77 intron_variant MODIFIER c.397-477G>T 0.0377 0.0500 0.1136 - 0.0152 - 6 85990138 T A 169.77 intron_variant MODIFIER c.397-457T>A 0.0047 - - 0.0455 - - 6 85990142 T A 169.77 intron_variant MODIFIER c.397-453T>A 0.0047 - - 0.0455 - - 6 85990152 T C 904.77 intron_variant MODIFIER c.397-443T>C 0.3302 0.6000 0.2955 0.3182 0.2273 0.2750 6 85990162 C T 852.77 intron_variant MODIFIER c.397-433C>T 0.3349 0.6000 0.3182 0.3182 0.2273 0.2750 6 85990182 A T 910.77 intron_variant MODIFIER c.397-413A>T 0.3208 0.6000 0.3182 0.3182 0.1818 0.2750 6 85990237 T G 329.77 intron_variant MODIFIER c.397-358T>G 0.0330 0.0500 - - 0.0152 0.1000 6 85990269 C A 1290.77 intron_variant MODIFIER c.397-326C>A 0.3066 0.6000 0.2955 0.3182 0.1515 0.2750 6 85990290 G A 385.77 intron_variant MODIFIER c.397-305G>A 0.0425 0.0500 0.0909 - 0.0455 - 6 85990299 G T 977.77 intron_variant MODIFIER c.397-296G>T 0.3208 0.6000 0.2955 0.3182 0.2121 0.2500 6 85990349 C T 973.77 intron_variant MODIFIER c.397-246C>T 0.3585 0.6000 0.3636 0.3182 0.2727 0.2750 6 85990386 C T 241.79 intron_variant MODIFIER c.397-209C>T 0.0094 - - - 0.0303 - 6 85990408 G A 822.77 intron_variant MODIFIER c.397-187G>A 0.3396 0.6000 0.3636 0.3182 0.2121 0.2750 6 85990416 A G 871.77 intron_variant MODIFIER c.397-179A>G 0.3255 0.6000 0.3182 0.2727 0.2121 0.2750 6 85990432 A G 1006.77 intron_variant MODIFIER c.397-163A>G 0.3302 0.6000 0.2727 0.3182 0.2424 0.2750 6 85990454 A G,T 1064.77 intron_variant MODIFIER c.397-141A>G 0.3396 0.6000 0.2955 0.3182 0.2576 0.2750 6 85990531 A G 890.77 intron_variant MODIFIER c.397-64A>G 0.4104 0.7000 0.3409 0.4091 0.3030 0.3750 6 85990548 T C 992.77 intron_variant MODIFIER c.397-47T>C 0.3632 0.6000 0.3409 0.3182 0.3182 0.2500 6 85990699 T C 768.77 intron_variant MODIFIER c.438+63T>C 0.1226 0.3250 - 0.3182 0.0606 0.0500 6 85990773 A C 928.77 intron_variant MODIFIER c.438+137A>C 0.3726 0.6000 0.3182 0.3182 0.3485 0.2750 6 85990791 C A 203.77 intron_variant MODIFIER c.438+155C>A 0.0094 - 0.0455 - - - 6 85990847 T C 891.77 intron_variant MODIFIER c.438+211T>C 0.3632 0.6000 0.2955 0.3182 0.3333 0.2750 6 85990898 C T 45.77 intron_variant MODIFIER c.438+262C>T 0.0047 - - 0.0455 - - 6 85991024 C T 15.65 intron_variant MODIFIER c.438+388C>T 0.0094 - 0.0455 - - - 6 85991177 A G 117.77 intron_variant MODIFIER c.439-359A>G 0.0047 - 0.0227 - - - 6 85991241 A T 1029.77 intron_variant MODIFIER c.439-295A>T 0.3679 0.6000 0.3182 0.3182 0.3333 0.2750 6 85991284 G A 731.77 intron_variant MODIFIER c.439-252G>A 0.1981 0.3250 0.1364 0.3636 0.1515 0.1250 6 85991345 T C 1209.77 intron_variant MODIFIER c.439-191T>C 0.4151 0.7000 0.3182 0.3636 0.3333 0.4000 6 85991355 G A 1082.77 intron_variant MODIFIER c.439-181G>A 0.3538 0.6000 0.3182 0.2727 0.3030 0.2750 6 85991440 G T 989.77 intron_variant MODIFIER c.439-96G>T 0.3491 0.5750 0.3409 0.3182 0.2727 0.2750 6 85991446 G T 1160.77 intron_variant MODIFIER c.439-90G>T 0.5660 0.8000 0.5682 0.7727 0.4394 0.4250 6 85991481 C T 954.77 intron_variant MODIFIER c.439-55C>T 0.3538 0.6000 0.3182 0.3182 0.2879 0.2750 6 85991482 A G 954.77 intron_variant MODIFIER c.439-54A>G 0.3538 0.6000 0.3182 0.3182 0.2879 0.2750 6 85991487 C T 980.77 intron_variant MODIFIER c.439-49C>T 0.3491 0.6000 0.2955 0.3182 0.2879 0.2750 6 85991509 G T 154.77 intron_variant MODIFIER c.439-27G>T 0.0094 - - - 0.0303 - 6 85991559 C T 974.77 synonymous_variant LOW c.462C>T p.Asn154Asn 0.3302 0.6000 0.2500 0.3182 0.2576 0.2750 6 85991580 T C 1104.77 intron_variant MODIFIER c.465+18T>C 0.3396 0.6000 0.2955 0.3182 0.2576 0.2750 6 85991587 G A 1061.77 intron_variant MODIFIER c.465+25G>A 0.3443 0.6000 0.2955 0.3182 0.2727 0.2750 6 85991602 C T 576.77 intron_variant MODIFIER c.465+40C>T 0.1274 0.2500 0.1591 - 0.0758 0.1250 6 85991607 T G 893.77 intron_variant MODIFIER c.465+45T>G 0.3491 0.6000 0.2955 0.3182 0.2879 0.2750 6 85991635 G A 864.77 intron_variant MODIFIER c.465+73G>A 0.3538 0.6000 0.3182 0.3182 0.2879 0.2750 6 85991651 C T 821.77 intron_variant MODIFIER c.465+89C>T 0.3491 0.6000 0.3182 0.3182 0.2727 0.2750 6 85991661 T G 241.77 intron_variant MODIFIER c.465+99T>G 0.0142 - 0.0682 - - - 6 85991685 T C 945.77 intron_variant MODIFIER c.465+123T>C 0.3538 0.6000 0.3182 0.2727 0.3030 0.2750 6 85991713 A G 1085.77 intron_variant MODIFIER c.465+151A>G 0.3396 0.6000 0.2955 0.2727 0.2727 0.2750 6 85991733 G A 118.77 intron_variant MODIFIER c.465+171G>A 0.0047 - - 0.0455 - - 6 85991803 A T,G 863.77 intron_variant MODIFIER c.465+241A>G 0.3538 0.6000 0.3409 0.3182 0.2727 0.2750 6 85991807 G A 213.77 intron_variant MODIFIER c.465+245G>A 0.0142 - 0.0682 - - - 6 85991808 G A 163.77 intron_variant MODIFIER c.465+246G>A 0.0094 - - - 0.0303 - 6 85991817 C T 904.77 intron_variant MODIFIER c.465+255C>T 0.3443 0.5750 0.3409 0.3182 0.2576 0.2750 6 85991831 A C 946.77 intron_variant MODIFIER c.465+269A>C 0.3491 0.5750 0.3182 0.3182 0.2879 0.2750 6 85991850 C T 180.77 intron_variant MODIFIER c.465+288C>T 0.0094 0.0250 - 0.0455 - - 6 85991890 G T 257.77 intron_variant MODIFIER c.465+328G>T 0.0047 0.0250 - - - - 6 85991957 G C 1003.77 intron_variant MODIFIER c.465+395G>C 0.0708 0.2000 0.0455 - - 0.1250 6 85991994 T A 1041.77 intron_variant MODIFIER c.465+432T>A 0.3160 0.5750 0.2500 0.3182 0.2424 0.2500 6 85991995 T A 1041.77 intron_variant MODIFIER c.465+433T>A 0.3160 0.5750 0.2500 0.3182 0.2424 0.2500 6 85992002 T A 328.77 intron_variant MODIFIER c.465+440T>A 0.0047 0.0250 - - - - 6 85992080 G A 954.77 intron_variant MODIFIER c.466-428G>A 0.3538 0.5750 0.3409 0.3182 0.2879 0.2750 6 85992114 T G 378.77 intron_variant MODIFIER c.466-394T>G 0.0236 - 0.0909 - - 0.0250 6 85992211 A G 939.77 intron_variant MODIFIER c.466-297A>G 0.3302 0.5750 0.2727 0.2727 0.2727 0.2750 6 85992238 A T 11.12 intron_variant MODIFIER c.466-270A>T 0.0047 - - - 0.0152 - 6 85992268 T G 242.85 intron_variant MODIFIER c.466-240T>G 0.0047 0.0250 - - - - 6 85992331 T C 903.77 intron_variant MODIFIER c.466-177T>C 0.3679 0.6000 0.3182 0.2727 0.3485 0.2750 6 85992334 C T 402.77 intron_variant MODIFIER c.466-174C>T 0.0330 - 0.1364 - - 0.0250 6 85992335 G A 284.77 intron_variant MODIFIER c.466-173G>A 0.0047 - - - - 0.0250 6 85992343 T C 403.77 intron_variant MODIFIER c.466-165T>C 0.0377 0.0250 0.0682 0.0909 - 0.0500 6 85992347 A G 907.77 intron_variant MODIFIER c.466-161A>G 0.4292 0.6750 0.3182 0.4091 0.3788 0.4000 6 85992386 T G 153.77 intron_variant MODIFIER c.466-122T>G 0.0094 - - - 0.0303 - 6 85992418 C T 1070.77 intron_variant MODIFIER c.466-90C>T 0.5849 0.7250 0.3636 0.3636 0.6061 0.7750 6 85992483 A T 40.77 intron_variant MODIFIER c.466-25A>T 0.0047 - - - 0.0152 - 6 85992591 C T 160.77 intron_variant MODIFIER c.489+60C>T 0.0094 - 0.0455 - - - 6 85992672 A C 368.77 intron_variant MODIFIER c.489+141A>C 0.0236 0.0500 - 0.0455 0.0152 0.0250 6 85992703 C T 984.77 intron_variant MODIFIER c.489+172C>T 0.3585 0.6000 0.3864 0.3182 0.2576 0.2750 6 85992805 C T 1096.77 intron_variant MODIFIER c.489+274C>T 0.3632 0.6000 0.2955 0.3182 0.3333 0.2750 6 85992812 G C 253.77 intron_variant MODIFIER c.489+281G>C 0.0094 0.0250 0.0227 - - - 6 85992858 T C 249.77 intron_variant MODIFIER c.489+327T>C 0.0047 - - - - 0.0250 6 85992900 T C 86.77 intron_variant MODIFIER c.489+369T>C 0.0047 - 0.0227 - - - 6 85992912 A G 244.77 intron_variant MODIFIER c.489+381A>G 0.0047 0.0250 - - - - 6 85992960 C T 157.77 intron_variant MODIFIER c.490-367C>T 0.0330 - 0.0455 - 0.0758 - 6 85992975 T C 602.77 intron_variant MODIFIER c.490-352T>C 0.2170 0.3250 0.1591 0.3182 0.1970 0.1500 6 85992976 G A 466.77 intron_variant MODIFIER c.490-351G>A 0.0094 - 0.0455 - - - 6 85992980 A G 373.77 intron_variant MODIFIER c.490-347A>G 0.0566 0.1000 - 0.0455 0.0303 0.1250 6 85993013 C T 168.77 intron_variant MODIFIER c.490-314C>T 0.0047 - - 0.0455 - - 6 85993106 A G 732.77 intron_variant MODIFIER c.490-221A>G 0.2217 0.3250 0.1818 0.2727 0.2121 0.1500 6 85993120 C A 708.77 intron_variant MODIFIER c.490-207C>A 0.1934 0.3250 0.1364 0.2727 0.1515 0.1500 6 85993303 T C 240.84 intron_variant MODIFIER c.490-24T>C 0.0377 - - - 0.1212 - 6 85993314 T C 272.77 intron_variant MODIFIER c.490-13T>C 0.0377 0.0250 0.0682 - 0.0606 - 6 85993335 A G 125.77 synonymous_variant LOW c.498A>G p.Arg166Arg 0.0094 - - - 0.0303 - 6 85993353 C T 642.77 synonymous_variant LOW c.516C>T p.Asp172Asp 0.0189 0.0250 - 0.1364 - - 6 85993377 C T 718.77 synonymous_variant LOW c.540C>T p.Tyr180Tyr 0.3491 0.6000 0.3636 0.2727 0.2576 0.2750 6 85993465 A G 692.77 missense_variant MODERATE c.628A>G p.Thr210Ala p.Thr195Ala 0.2358 0.45 2.79 TOLERATED 0.3000 0.1591 0.2727 0.3030 0.1250 6 85993489 C A 701.77 splice_region_variant LOW c.644+8C>A 0.1887 0.3250 0.1136 0.2727 0.1667 0.1250 6 85993501 C T 813.77 downstream_gene_variant MODIFIER c.*13542C>T 0.3491 0.6000 0.3636 0.2727 0.2576 0.2750 6 85993527 A G 918.77 downstream_gene_variant MODIFIER c.*13568A>G 0.3538 0.6000 0.3409 0.2727 0.2879 0.2750 6 85993557 T A 1055.77 downstream_gene_variant MODIFIER c.*13598T>A 0.3538 0.6000 0.3409 0.2727 0.2879 0.2750 6 85993575 A T 259.77 downstream_gene_variant MODIFIER c.*13616A>T 0.0047 0.0250 - - - - 6 85993594 C T 933.77 downstream_gene_variant MODIFIER c.*13635C>T 0.3443 0.6000 0.3409 0.2727 0.2576 0.2750 6 85993618 A T 817.77 downstream_gene_variant MODIFIER c.*13659A>T 0.3443 0.6000 0.3409 0.2727 0.2727 0.2500 6 85993643 C T 286.77 downstream_gene_variant MODIFIER c.*13684C>T 0.0472 0.0500 0.1136 - 0.0455 - 6 85993651 C T 781.77 downstream_gene_variant MODIFIER c.*13692C>T 0.3491 0.5750 0.3409 0.3182 0.2879 0.2500 6 85993653 C T 781.77 downstream_gene_variant MODIFIER c.*13694C>T 0.3538 0.6000 0.3409 0.3182 0.2879 0.2500 6 85993699 G A 845.77 downstream_gene_variant MODIFIER c.*13740G>A 0.3396 0.6000 0.3409 0.2727 0.2576 0.2500 6 85993712 A T 888.77 downstream_gene_variant MODIFIER c.*13753A>T 0.3396 0.5750 0.3636 0.2727 0.2576 0.2500 6 85993727 T C 375.77 downstream_gene_variant MODIFIER c.*13768T>C 0.0472 0.1000 - 0.0455 0.0152 0.1000 6 85993747 C T 219.77 downstream_gene_variant MODIFIER c.*13788C>T 0.0047 0.0250 - - - - 6 85993765 C T 58.74 downstream_gene_variant MODIFIER c.*13806C>T 0.0094 - - - 0.0303 - 6 85993774 A C 1001.77 downstream_gene_variant MODIFIER c.*13815A>C 0.3302 0.6000 0.2955 0.3182 0.2273 0.2750 6 85993778 T C 239.77 downstream_gene_variant MODIFIER c.*13819T>C 0.0047 0.0250 - - - - 6 85993794 A G 145.77 downstream_gene_variant MODIFIER c.*13835A>G 0.0047 - - 0.0455 - - 6 85993802 C T 159.77 downstream_gene_variant MODIFIER c.*13843C>T 0.0047 0.0250 - - - - 6 85993820 G A 415.77 downstream_gene_variant MODIFIER c.*13861G>A 0.0189 - 0.0909 - - - 6 85993838 T G 126.79 downstream_gene_variant MODIFIER c.*13879T>G 0.0189 - - - 0.0606 - 6 85993851 G A 252.77 downstream_gene_variant MODIFIER c.*13892G>A 0.0047 - - - - 0.0250 6 85993904 T C 641.77 downstream_gene_variant MODIFIER c.*13945T>C 0.3019 0.5750 0.2955 0.2727 0.1667 0.2750 6 85993905 G A 102.77 downstream_gene_variant MODIFIER c.*13946G>A 0.0047 - 0.0227 - - - 6 85993909 T C 677.77 downstream_gene_variant MODIFIER c.*13950T>C 0.3019 0.5750 0.2955 0.2727 0.1667 0.2750 6 85993917 T A 43.77 downstream_gene_variant MODIFIER c.*13958T>A 0.0047 - - - 0.0152 - 6 85993920 A C 43.77 downstream_gene_variant MODIFIER c.*13961A>C 0.0047 - - - 0.0152 - 6 85993926 G C 40.77 downstream_gene_variant MODIFIER c.*13967G>C 0.0047 - - - 0.0152 - 6 85993967 G A 913.77 downstream_gene_variant MODIFIER c.*14008G>A 0.2170 0.3250 0.1364 0.2727 0.2273 0.1500 6 85993972 T C 1010.77 downstream_gene_variant MODIFIER c.*14013T>C 0.3585 0.5750 0.3636 0.2727 0.3030 0.2750 6 85993990 T G 404.77 downstream_gene_variant MODIFIER c.*14031T>G 0.0142 - 0.0682 - - - 6 85994045 A T 893.77 splice_region_variant LOW c.645-5A>T 0.3302 0.5750 0.3409 0.2727 0.2424 0.2500 6 85994070 G A 1099.77 3_prime_UTR_variant MODIFIER c.*20G>A 0.3491 0.5750 0.3636 0.2727 0.2879 0.2500 6 85994072 A G 1099.77 3_prime_UTR_variant MODIFIER c.*22A>G 0.3491 0.5750 0.3636 0.2727 0.2879 0.2500 6 85994113 T C 1096.77 downstream_gene_variant MODIFIER c.*14154T>C 0.3255 0.5750 0.3409 0.2727 0.2273 0.2500 6 85994117 G A 1136.77 downstream_gene_variant MODIFIER c.*14158G>A 0.3349 0.5750 0.3409 0.2727 0.2576 0.2500 6 85994176 T C 948.77 downstream_gene_variant MODIFIER c.*14217T>C 0.0566 0.2000 - - - 0.1000 6 85994216 A G 929.77 downstream_gene_variant MODIFIER c.*14257A>G 0.2972 0.5750 0.3182 0.2727 0.1515 0.2500 6 85994218 T C 121.77 downstream_gene_variant MODIFIER c.*14259T>C 0.0047 0.0250 - - - - 6 85994228 T C 354.77 downstream_gene_variant MODIFIER c.*14269T>C 0.0047 - 0.0227 - - - 6 85994271 A G 237.84 downstream_gene_variant MODIFIER c.*14312A>G 0.0094 - 0.0455 - - - 6 85994538 T C 196.9 downstream_gene_variant MODIFIER c.*14579T>C 0.0142 - - - 0.0455 - 6 85994582 T C 775.77 downstream_gene_variant MODIFIER c.*14623T>C 0.3726 0.6000 0.3409 0.3182 0.3485 0.2500 6 85994603 A G 384.77 downstream_gene_variant MODIFIER c.*14644A>G 0.0047 0.0250 - - - - 6 85994777 C T 576.77 downstream_gene_variant MODIFIER c.*14818C>T 0.0708 0.2250 0.0455 - - 0.1000 6 85994889 G A 744.77 3_prime_UTR_variant MODIFIER c.*48G>A 0.3396 0.5750 0.3182 0.3182 0.2727 0.2500 6 85994922 T C 228.84 3_prime_UTR_variant MODIFIER c.*81T>C 0.0142 - 0.0682 - - - 6 85994963 G A 755.77 3_prime_UTR_variant MODIFIER c.*122G>A 0.0566 0.2500 - - - 0.0500 6 85994992 G T 100.77 3_prime_UTR_variant MODIFIER c.*151G>T 0.0047 0.0250 - - - - 6 85995000 T C 317.77 3_prime_UTR_variant MODIFIER c.*159T>C 0.0047 0.0250 - - - - 6 85995016 C T 827.77 3_prime_UTR_variant MODIFIER c.*175C>T 0.4198 0.7000 0.4318 0.0909 0.3636 0.4000 6 85995040 T C 341.78 3_prime_UTR_variant MODIFIER c.*199T>C 0.0094 - - - 0.0303 - 6 85995065 C T 159.77 3_prime_UTR_variant MODIFIER c.*224C>T 0.0047 0.0250 - - - - 6 85995097 G T 565.77 3_prime_UTR_variant MODIFIER c.*256G>T 0.1179 0.2500 0.1364 - 0.0606 0.1250 6 85995112 A G 136.77 3_prime_UTR_variant MODIFIER c.*271A>G 0.0047 0.0250 - - - - 6 85995124 T C 103.77 3_prime_UTR_variant MODIFIER c.*283T>C 0.0047 - - - - 0.0250 6 85995157 G A 128.77 3_prime_UTR_variant MODIFIER c.*316G>A 0.0094 - 0.0455 - - - 6 85979524 TA T 18.79 upstream_gene_variant MODIFIER c.-13956delA 0.0047 - - - 0.0152 - 6 85979859 CA C 637.73 upstream_gene_variant MODIFIER c.-13621delA 0.0425 - - - 0.0909 0.0750 6 85979892 TA T 310.73 upstream_gene_variant MODIFIER c.-13588delA 0.0142 - - - 0.0303 0.0250 6 85980078 C CAA 1087.73 intron_variant MODIFIER c.51+69_51+70insAA 0.4198 0.7000 0.3864 0.6818 0.2727 0.2750 6 85980207 CTT C 271.73 intron_variant MODIFIER c.51+199_51+200delTT 0.0047 0.0250 - - - - 6 85980785 TG T 468.73 intron_variant MODIFIER c.51+777delG 0.0425 0.1250 - - - 0.1000 6 85980931 T TC 931.73 intron_variant MODIFIER c.52-764_52-763insC 0.4292 0.7000 0.4091 0.6818 0.3030 0.2500 6 85981527 A AT 117.87 intron_variant MODIFIER c.52-168_52-167insT 0.0094 - 0.0455 - - - 6 85981679 AT ATT,A,ATTT 59.73 intron_variant MODIFIER c.52-15delT 0.0377 0.0250 0.1591 - - - 6 85982000 A AT 803.73 intron_variant MODIFIER c.84+273_84+274insT 0.4717 0.7000 0.3636 0.7727 0.3939 0.3250 6 85982011 TA T 165.73 intron_variant MODIFIER c.84+285delA 0.0047 0.0250 - - - - 6 85982013 TTC T 165.73 intron_variant MODIFIER c.84+287_84+288delTC 0.0047 0.0250 - - - - 6 85982039 C CA 782.73 intron_variant MODIFIER c.84+312_84+313insA 0.7075 0.8000 0.9545 0.8636 0.5758 0.4750 6 85982445 ATT A 409.73 intron_variant MODIFIER c.85-162_85-161delTT 0.0047 - 0.0227 - - - 6 85983623 AC A 260.73 intron_variant MODIFIER c.171+61delC 0.0283 - 0.1364 - - - 6 85983759 G GA 485.73 intron_variant MODIFIER c.171+196_171+197insA 0.4481 0.7000 0.3864 0.6818 0.3636 0.2750 6 85984180 ATTCT A 82.73 splice_region_variant LOW c.195+7_195+10delTTCT 0.0047 - - - 0.0152 - 6 85984273 T TG 1013.73 intron_variant MODIFIER c.195+99_195+100insG 0.4387 0.7000 0.3864 0.7273 0.3182 0.2750 6 85985882 GA G 211.75 intron_variant MODIFIER c.220-521delA 0.0189 - 0.0909 - - - ATTAAGTGTGGGTTGTTTCCTTCTAATGAAACAATGGAAT 6 85986289 A 311.73 intron_variant MODIFIER c.220-114_220-76delTTAAGTGTGGGTTGTTTCCTTCTAATGAAACAATGGAAT 0.0047 0.0250 - - - - 6 85986425 TC T 1048.73 frameshift_variant HIGH c.242delC 0.0660 0.1500 - 0.3636 - - 6 85986505 AGTTTCCGTAAT,AGTTTACATGTCCCGTAAG A 1222.73 intron_variant MODIFIER c.252+69_252+70insGTTTCCGTAAT 0.4292 0.7000 0.4318 0.6818 0.2727 0.2750 6 85986675 AT A 109.73 intron_variant MODIFIER c.252+240delT 0.0047 0.0250 - - - - 6 85986833 T TA 248.73 intron_variant MODIFIER c.253-343_253-342insA 0.0047 0.0250 - - - - 6 85987157 GTT GT,GTTT,G,GTTTT249.73 intron_variant MODIFIER c.253-18_253-17delTT 0.1651 0.1000 0.2273 0.1364 0.0303 0.4000 6 85987159 T TTG 372.73 intron_variant MODIFIER c.253-17_253-16insTG 0.0094 - 0.0455 - - - 6 85987160 T TG,TA 287.73 intron_variant MODIFIER c.253-16_253-15insA 0.0236 0.0500 - - 0.0455 - 6 85987166 T TAA,TA,TTAA 940.73 intron_variant MODIFIER c.253-10_253-9insTAA 0.4057 0.7000 0.4318 0.6818 0.1970 0.2750 6 85987354 AT A 66.73 intron_variant MODIFIER c.330+12delT 0.0047 0.0250 - - - - 6 85987396 G GATA 418.73 intron_variant MODIFIER c.330+53_330+54insATA 0.0047 - 0.0227 - - - 6 85987410 TA T 319.74 intron_variant MODIFIER c.330+68delA 0.0094 - 0.0455 - - - 6 85987444 T TAAAAC,TA 1267.73 intron_variant MODIFIER c.330+101_330+102insA 0.3349 0.5500 0.2955 0.2727 0.2879 0.2750 6 85987448 C CAAAG 320.73 intron_variant MODIFIER c.330+105_330+106insAAAG 0.0047 0.0250 - - - - 6 85987824 TC T 84.25 intron_variant MODIFIER c.330+482delC 0.0094 - - - 0.0303 - 6 85988124 ATG A 355.73 intron_variant MODIFIER c.331-567_331-566delTG 0.0047 0.0250 - - - - 6 85988131 C CAT 355.73 intron_variant MODIFIER c.331-561_331-560insAT 0.0047 0.0250 - - - - 6 ACCAGGACTCCCTGTCCATGACCAGCATG 85988198 A 238.73 intron_variant MODIFIER c.331-493_331-466delCCAGGACTCCCTGTCCATGACCAGCATG 0.0094 - - - 0.0152 0.0250 6 85988319 TCTC T 1032.73 intron_variant MODIFIER c.331-372_331-370delCTC 0.3302 0.6000 0.3409 0.3182 0.1970 0.2750 6 85988504 TA T 484.73 intron_variant MODIFIER c.331-187delA 0.0236 0.0250 - 0.0909 - 0.0500 6 85988539 TC T 309.37 intron_variant MODIFIER c.331-152delC 0.0047 - 0.0227 - - - INDEL 6 85988545 T TAAAG 952.73 intron_variant MODIFIER c.331-147_331-146insAAAG 0.3302 0.6000 0.3182 0.3182 0.2121 0.2750 6 85988600 GATT G 112.73 intron_variant MODIFIER c.331-91_331-89delATT 0.0047 0.0250 - - - - 6 85988963 A AG 1110.73 intron_variant MODIFIER c.372+230_372+231insG 0.3491 0.6000 0.3636 0.3182 0.2576 0.2500 6 85989187 CA C 962.73 intron_variant MODIFIER c.373-189delA 0.3491 0.5250 0.3182 0.3182 0.3485 0.2250 6 85989267 GT G 652.73 intron_variant MODIFIER c.373-109delT 0.3585 0.5750 0.3409 0.3182 0.3030 0.2750 6 85989314 AT A 644.73 intron_variant MODIFIER c.373-62delT 0.3632 0.5750 0.3636 0.3182 0.3030 0.2750 6 85989360 G GT 213.73 intron_variant MODIFIER c.373-17_373-16insT 0.0047 0.0250 - - - - 6 85989785 T TAGA 700.73 intron_variant MODIFIER c.396+385_396+386insAGA 0.3160 0.5750 0.2955 0.2273 0.2273 0.2750 6 85989835 TAATCTAAGAAATTAT 34.73 intron_variant MODIFIER c.396+436_396+449delAATCTAAGAAATTA 0.0047 - - - 0.0152 - 6 85989853 GAA G 28.74 intron_variant MODIFIER c.396+454_396+455delAA 0.0047 - - - 0.0152 - 6 85989859 TA T 31.73 intron_variant MODIFIER c.396+460delA 0.0047 - - - 0.0152 - 6 85989861 TA T 31.73 intron_variant MODIFIER c.396+462delA 0.0047 - - - 0.0152 - 6 85989867 AGCACCTTAATTATGATAT A 22.75 intron_variant MODIFIER c.396+468_396+485delGCACCTTAATTATGATAT 0.0047 - - - 0.0152 - 6 85989891 GGCCA G 25.74 intron_variant MODIFIER c.396+492_396+495delGCCA 0.0047 - - - 0.0152 - 6 85989898ACCTCCACAAG A 22.75 intron_variant MODIFIER c.396+499_396+508delCCTCCACAAG 0.0047 - - - 0.0152 - 6 85989910 GTTAGAACT G 31.73 intron_variant MODIFIER c.396+511_396+518delTTAGAACT 0.0047 - - - 0.0152 - 6 85989921 ATGGTCCTGCTAT A 22.75 intron_variant MODIFIER c.396+522_396+533delTGGTCCTGCTAT 0.0047 - - - 0.0152 - 6 85989931 TC,TCATAGTGTTCATCATTC T 846.73 intron_variant MODIFIER c.396+531_396+532insC 0.3585 0.6000 0.3864 0.3182 0.2576 0.2750 6 85989936 TG T 31.73 intron_variant MODIFIER c.396+537delG 0.0047 - - - 0.0152 - 6 85989942 TCATTCC T 34.73 intron_variant MODIFIER c.396+543_396+548delCATTCC 0.0047 - - - 0.0152 - 6 85990259 A AAT 1262.73 intron_variant MODIFIER c.397-336_397-335insAT 0.3066 0.6000 0.2955 0.3182 0.1515 0.2750 6 85990894 GTGTCAATTTCCATGGTTA G 693.73 intron_variant MODIFIER c.438+259_438+276delTGTCAATTTCCATGGTTA 0.3396 0.6000 0.2727 0.2727 0.2879 0.2750 6 85991028 ATTATGC A 811.73 intron_variant MODIFIER c.438+393_438+398delTTATGC 0.3113 0.5750 0.2955 0.2273 0.2121 0.2750 6 85991172 TTTTATCTA,TTTATATA 1144.73 intron_variant MODIFIER c.439-364_439-363insTTATATA 0.3538 0.7000 0.2955 0.2727 0.1818 0.4000 6 TTTTTCTTTCCAGAAACAGCCTATGATAG 85991523 T 196.73 frameshift_variant HIGH c.439-12_454delTTTTCTTTCCAGAAACAGCCTATGATAG 0.0047 - - - - 0.0250 6 85992039 GT G 657.73 intron_variant MODIFIER c.466-468delT 0.3349 0.5750 0.3409 0.2727 0.2727 0.2250 6 GAATCTGATAAGGGATTAAACAAGATTCAA 85992178 G 190.73 intron_variant MODIFIER c.466-329_466-301delAATCTGATAAGGGATTAAACAAGATTCAA 0.0094 0.0250 0.0227 - - - 6 85992237 TA T 711.73 intron_variant MODIFIER c.466-270delA 0.1792 0.3250 0.1136 0.2727 0.1212 0.1500 6 85992387 T TA 63.73 intron_variant MODIFIER c.466-121_466-120insA 0.0047 - - - 0.0152 - 6 85992469TGAATCACAAAA T 31.73 intron_variant MODIFIER c.466-38_466-28delGAATCACAAAA 0.0047 - - - 0.0152 - TTGCTGCCTTATCAAAGG,TTGCTGCCTTATCAAAGGG,TTGCTGCCTTATTAAAGGG 6 85993507 T 1312.73 downstream_gene_variant MODIFIER c.*13548_*13549insTGCTGCCTTATCAAAGG 0.9151 1.0000 0.9545 1.0000 0.7576 1.0000 6 85993870 AT,ATT,ATTTT,ATTT,ATTTTT A 691.73 downstream_gene_variant MODIFIER c.*13911_*13912insT 0.2547 0.5500 0.1591 0.2727 0.1364 0.2500 6 85993882 TCG T 53.7 downstream_gene_variant MODIFIER c.*13924_*13925delCG 0.0094 - - - 0.0303 - 6 85993897 AATATAATGATGTTTGT A 28.74 downstream_gene_variant MODIFIER c.*13939_*13954delATATAATGATGTTTGT 0.0047 - - - 0.0152 - 6 85993943 A ATAATATAT 405.73 downstream_gene_variant MODIFIER c.*13984_*13985insTAATATAT 0.0142 - 0.0455 - - 0.0250 6 85994041 TAAATTTGGCAATAACAA T 142.73 splice_region_variant LOW c.645-9_645-8insAAATTTGGCAATAACAA 0.0047 - - - - 0.0250 6 85994127 TC T 1028.73 downstream_gene_variant MODIFIER c.*14169delC 0.0613 0.2000 0.0227 - - 0.1000 6 85994531 T,TTGTGTG,TTGTGTGTG,TTGTG,TTGTGTGTGTG TTG 587.73 downstream_gene_variant MODIFIER c.*14573_*14574delTG 0.4481 0.7500 0.4773 0.4091 0.3182 0.3500 6 85994551 GTA G 51.73 downstream_gene_variant MODIFIER c.*14593_*14594delTA 0.0047 - - - 0.0152 - 6 85995007 TGAG T 53.7 3_prime_UTR_variant MODIFIER c.*167_*169delGAG 0.0094 - - 0.0909 - - 6 85995012 TCTCCACTGTA T 43.73 3_prime_UTR_variant MODIFIER c.*172_*181delCTCCACTGTA 0.0047 - - 0.0455 - - Supplementary Table S2. Polymorphisms (SNPs in black, INDEL in red) detected in the goat casein genes (CSN2) Chromosome Position Ref allele Alt_allele QUAL Variant_type Effect Nucleotide substitution AA substitution subst. literature Alt_freq SIFT_score SIFT_median SIFT_prediction AF BE EU FE NE 6 86006349 T A 230.77 3_prime_UTR_variant MODIFIER c.*219A>T 0.0142 - 0.0682 - - - 6 86006351 T C 427.77 3_prime_UTR_variant MODIFIER c.*217A>G 0.0047 - - - - 0.0250 6 86006385 T C 96.28 3_prime_UTR_variant MODIFIER c.*183A>G 0.0142 - - - 0.0455 - 6 86006394 G A 813.77 3_prime_UTR_variant MODIFIER c.*174C>T 0.0802 0.1000 0.1136 0.3636 - - 6 86006395 T C 487.77 3_prime_UTR_variant MODIFIER c.*173A>G 0.0142 0.0250 0.0455 - - - 6 86006437 C T 148.77 3_prime_UTR_variant MODIFIER c.*131G>A 0.0094 - 0.0455 - - - 6 86006505 A G 124.81 3_prime_UTR_variant MODIFIER c.*63T>C 0.0094 - - - 0.0303 - 6 86006583 A T 25.78 intron_variant MODIFIER c.769-10T>A 0.0047 - - - 0.0152 - 6 86006585 A T 25.78 intron_variant MODIFIER c.769-12T>A 0.0047 - - - 0.0152 - 6 86006621 T C 68.77 intron_variant MODIFIER c.769-48A>G 0.0047 - - - - 0.0250 6 86006689 G T 274.77 intron_variant MODIFIER c.769-116C>A 0.0283 - 0.1364 - - - 6 86006776 C T 797.77 intron_variant MODIFIER c.769-203G>A 0.0896 0.1000 0.1364 0.3636 0.0152 - 6 86006785 A T 132.77 intron_variant MODIFIER c.769-212T>A 0.0047 0.0250 - - - - 6 86006797 T A 1093.77 intron_variant MODIFIER c.769-224A>T 0.3208 0.5750 0.3182 0.3182 0.2121 0.2500 6 86006815 A T 236.77 intron_variant MODIFIER c.769-242T>A 0.0236 0.0250 0.0909 - - - 6 86006864 A G 196.77 intron_variant MODIFIER c.769-291T>C 0.0047 0.0250 - - - - 6 86006920 G A 926.77 intron_variant MODIFIER c.769-347C>T 0.0519 0.1750 - - - 0.1000 6 86007057 T C 308.78 intron_variant MODIFIER c.769-484A>G 0.0142 - 0.0682 - - - 6 86007097 A G 456.77 intron_variant MODIFIER c.769-524T>C 0.0047 0.0250 - - - - 6 86007190 C T 1112.77 intron_variant MODIFIER c.769-617G>A 0.3066 0.5750 0.2955 0.3182 0.1818 0.2500 6 86007476 G T 982.77 intron_variant MODIFIER c.768+452C>A 0.3208 0.5750 0.2955 0.3182 0.2273 0.2500 6 86007506 T A 603.28 intron_variant MODIFIER c.768+422A>T 0.1509 0.2000 0.1591 - 0.1515 0.1750 6 86007568 C T 346.77 intron_variant MODIFIER c.768+360G>A 0.0189 - 0.0909 - - - 6 86007572 G A 825.77 intron_variant MODIFIER c.768+356C>T 0.3208 0.5750 0.3182 0.2727 0.2273 0.2500 6 86007588 C A 563.77 intron_variant MODIFIER c.768+340G>T 0.0613 0.1250 - 0.3182 0.0152 - 6 86007660 A G 278.77 intron_variant MODIFIER c.768+268T>C 0.0377 - 0.1818 - - - 6 86007724 T G 219.77 intron_variant MODIFIER c.768+204A>C 0.0283 - 0.1364 - - - 6 86007760 G A 52.77 intron_variant MODIFIER c.768+168C>T 0.0047 - - 0.0455 - - 6 86007851 T G 169.78 intron_variant MODIFIER c.768+77A>C 0.0094 - - - 0.0303 - 6 86007882 A G 519.77 intron_variant MODIFIER c.768+46T>C 0.1745 0.2250 0.2500 - 0.1515 0.1750 6 86008016 A G 866.77 missense_variant MODERATE c.680T>C p.Val227Ala p.Val177Ala 0.3160 0.12 3.08 TOLERATED 0.5750 0.2727 0.2727 0.2424 0.2500 6 86008103 G A 105.77 missense_variant MODERATE c.593C>T p.Pro198Leu 0.0094 0.12 3.08 TOLERATED - - - 0.0303 - 6 86008279 C T 78.77 synonymous_variant LOW c.417G>A p.Gln139Gln 0.0094 - - - 0.0303 - 6 86008407 C A 125.77 missense_variant MODERATE c.289G>T p.Asp97Tyr 0.0047 0 3 DELETERIOUS 0.0250 - - - - 6 86008441 C A 536.77 intron_variant MODIFIER c.277-22G>T 0.0472 0.0250 - - 0.1364 - 6 86008491 C T 102.77 intron_variant MODIFIER c.277-72G>A 0.0047 - - 0.0455 - - 6 86008578 C T 779.77 intron_variant MODIFIER c.277-159G>A 0.1226 0.3250 - 0.3182 0.0455 0.0750 6 86008583 G C 309.78 intron_variant MODIFIER c.277-164C>G 0.0094 0.0500 - - - - 6 86008812 G A 832.77 intron_variant MODIFIER c.277-393C>T 0.3396 0.5750 0.3182 0.3182 0.2727 0.2500 6 86008813 T C 166.77 intron_variant MODIFIER c.277-394A>G 0.0283 - 0.1364 - - - 6 86008828 A G 657.77 intron_variant MODIFIER c.277-409T>C 0.1604 0.1750 0.1818 - 0.1818 0.1750 6 86008971 T C 439.77 intron_variant MODIFIER c.277-552A>G 0.0189 0.0250 - - 0.0152 0.0500 6 86008987 C A 171.77 intron_variant MODIFIER c.277-568G>T 0.0094 - 0.0455 - - - 6 86008988 A G 763.77 intron_variant MODIFIER c.277-569T>C 0.1321 0.3500 - 0.3182 0.0606 0.0750 6 86009018 T G 971.77 intron_variant MODIFIER c.277-599A>C 0.0330 0.0500 0.0227 - 0.0152 0.0750 6 86009029 A T 150.77 intron_variant MODIFIER c.277-610T>A 0.0047 - - - 0.0152 - 6 86009039 A C 381.77 intron_variant MODIFIER c.277-620T>G 0.0189 0.0500 - - 0.0152 0.0250 6 86009064 T C 201.77 intron_variant MODIFIER c.277-645A>G 0.0094 - - - 0.0303 - 6 86009084 C A 18.83 intron_variant MODIFIER c.276+665G>T 0.0047 - - - 0.0152 - 6 86009107 G A 153.77 intron_variant MODIFIER c.276+642C>T 0.0094 - - - 0.0303 - 6 86009297 G A 294.78 intron_variant MODIFIER c.276+452C>T 0.0142 0.0250 0.0455 - - - 6 86009349 C T 346.78 intron_variant MODIFIER c.276+400G>A 0.0142 - 0.0682 - - - 6 86009350 A G 710.77 intron_variant MODIFIER c.276+399T>C 0.3349 0.5750 0.3182 0.3182 0.2576 0.2500 6 86009395 G A 714.77 intron_variant MODIFIER c.276+354C>T 0.0142 - 0.0682 - - - 6 86009425 C T 456.77 intron_variant MODIFIER c.276+324G>A 0.0849 0.1000 0.0909 0.3636 0.0303 - 6 86009478 C T 166.77 intron_variant MODIFIER c.276+271G>A 0.0094 - - - 0.0303 - 6 86009501 A G 1009.77 intron_variant MODIFIER c.276+248T>C 0.3113 0.5750 0.2727 0.2727 0.2273 0.2500 6 86009623 C A 264.8 intron_variant MODIFIER c.276+126G>T 0.0330 - - - 0.1061 - 6 86009649 T C 1093.77 intron_variant MODIFIER c.276+100A>G 0.3396 0.5750 0.3182 0.3182 0.2727 0.2500 6 86009752 T C 248.77 synonymous_variant LOW c.273A>G p.Thr91Thr 0.0283 - 0.1364 - - - 6 86009770 A G 52.77 synonymous_variant LOW c.255T>C p.Ser85Ser 0.0047 - 0.0227 - - - 6 86009827 C T 658.77 intron_variant MODIFIER c.235-37G>A 0.1509 0.2000 0.1818 - 0.1364 0.1750 6 86009847 C T 1096.77 intron_variant MODIFIER c.234+41G>A 0.2925 0.5750 0.2727 0.3182 0.1515 0.2500 6 86009848 A G 1096.77 intron_variant MODIFIER c.234+40T>C 0.2925 0.5750 0.2727 0.3182 0.1515 0.2500 6 86009856 T A 121.77 intron_variant MODIFIER c.234+32A>T 0.0047 - - - - 0.0250 6 86009867 A G 951.77 intron_variant MODIFIER c.234+21T>C 0.3019 0.5750 0.2727 0.3182 0.1818 0.2500 6 86009990 C T 301.77 intron_variant MODIFIER c.211-79G>A 0.0094 - - - 0.0303 - 6 86010024 G A 199.77 intron_variant MODIFIER c.211-113C>T 0.0047 - - - 0.0152 - 6 86010087 A T 247.77 intron_variant MODIFIER c.211-176T>A 0.0047 0.0250 - - - - 6 86010104 C T 80.77 intron_variant MODIFIER c.211-193G>A 0.0047 0.0250 - - - - 6 86010119 G T 875.77 intron_variant MODIFIER c.211-208C>A 0.3113 0.5750 0.2045 0.2727 0.2727 0.2500 6 86010127 A G 301.84 intron_variant MODIFIER c.211-216T>C 0.0236 - - - 0.0606 0.0250 6 86010178 G A 971.77 intron_variant MODIFIER c.211-267C>T 0.1462 0.3750 0.1136 0.1818 0.0606 0.0750 6 86010193 C T 525.77 intron_variant MODIFIER c.211-282G>A 0.0142 - 0.0682 - - - 6 86010264 C T 227.77 intron_variant MODIFIER c.211-353G>A 0.0047 0.0250 - - - - 6 86010306 G A 66.77 intron_variant MODIFIER c.211-395C>T 0.0047 - - - 0.0152 - 6 86010313 A T 325.77 intron_variant MODIFIER c.211-402T>A 0.0189 - 0.0909 - - - 6 86010365 C T 778.77 intron_variant MODIFIER c.211-454G>A 0.0142 - 0.0682 - - - 6 86010493 C T 1082.77 intron_variant MODIFIER c.211-582G>A 0.3208 0.5750 0.3182 0.2727 0.2424 0.2250 6 86010521 T C 1231.77 intron_variant MODIFIER c.211-610A>G 0.3113 0.5750 0.3182 0.2727 0.1970 0.2500 6 86010529 A G 221.77 intron_variant MODIFIER c.211-618T>C 0.0047 0.0250 - - - - 6 86010553 A G 72.77 intron_variant MODIFIER c.211-642T>C 0.0094 - - - 0.0303 - 6 86010583 C G 334.78 intron_variant MODIFIER c.211-672G>C 0.0377 - - - 0.0758 0.0750 6 86010628 C G 302.77 intron_variant MODIFIER c.211-717G>C 0.0047 0.0250 - - - - 6 86010629 G A 410.77 intron_variant MODIFIER c.211-718C>T 0.0377 0.1500 - - - 0.0500 6 86010665 C T 382.77 intron_variant MODIFIER c.211-754G>A 0.0189 0.0250 - 0.1364 - - 6 86010669 C T 126.77 intron_variant MODIFIER c.211-758G>A 0.0094 - 0.0455 - - - 6 86010683 A C 220.84 intron_variant MODIFIER c.211-772T>G 0.0472 0.1500 - 0.0455 - 0.0750 6 86010699 G A 25.78 intron_variant MODIFIER c.211-788C>T 0.0047 - 0.0227 - - - 6 86010705 G C 690.77 intron_variant MODIFIER c.211-794C>G 0.0283 - 0.0682 - 0.0303 0.0250 6 86010731 T C 280.77 intron_variant MODIFIER c.211-820A>G 0.0991 0.1500 0.1136 - 0.0758 0.1250 6 86010735 G A 270.77 intron_variant MODIFIER c.211-824C>T 0.0094 - - - 0.0303 - 6 86010811 A T 337.77 intron_variant MODIFIER c.211-900T>A 0.0094 - - - - 0.0500 6 86010832 T G 69.77 intron_variant MODIFIER c.211-921A>C 0.0047 0.0250 - - - - 6 86010838 C G 116.77 intron_variant MODIFIER c.211-927G>C 0.0094 - - - 0.0303 - 6 86010846 C T 96.77 intron_variant MODIFIER c.211-935G>A 0.0189 0.0250 0.0682 - - - 6 86010893 C T 324.78 intron_variant MODIFIER c.211-982G>A 0.0425 0.1500 - - - 0.0750 SNP 6 86010894 G A 123.78 intron_variant MODIFIER c.211-983C>T 0.0142 - 0.0682 - - - 6 86010904 T C 286.8 intron_variant MODIFIER c.211-993A>G 0.0896 0.1500 0.0682 - 0.0606 0.1500 6 86010920 C A 113.77 intron_variant MODIFIER c.211-1009G>T 0.0094 - - - 0.0303 - 6 86010978 T C 276.8 intron_variant MODIFIER c.211-1067A>G 0.0330 0.1750 - - - - 6 86010979 C T 321.78 intron_variant MODIFIER c.211-1068G>A 0.0943 0.2750 0.0909 0.1364 0.0303 - 6 86010981 T G 286.8 intron_variant MODIFIER c.211-1070A>C 0.0943 0.2750 0.0909 0.1364 0.0303 - 6 86010983 A G 241.84 intron_variant MODIFIER c.211-1072T>C 0.0943 0.2750 0.0909 0.1364 0.0303 - 6 86011097 T A 736.77 intron_variant MODIFIER c.210+1162A>T 0.1226 0.3500 - 0.3182 0.0303 0.0750 6 86011103 C G 845.77 intron_variant MODIFIER c.210+1156G>C 0.2925 0.5750 0.2727 0.3182 0.1667 0.2250 6 86011216 G A 630.77 intron_variant MODIFIER c.210+1043C>T 0.0755 - 0.1591 - 0.0909 0.0750 6 86011247 C T 685.77 intron_variant MODIFIER c.210+1012G>A 0.1321 0.1750 0.2500 - 0.0606 0.1500 6 86011291 G A 796.77 intron_variant MODIFIER c.210+968C>T 0.8113 0.9500 0.8409 0.8182 0.5909 1.0000 6 86011335 T G 412.77 intron_variant MODIFIER c.210+924A>C 0.1934 0.4500 0.1591 0.2273 0.0909 0.1250 6 86011358 A G 419.77 intron_variant MODIFIER c.210+901T>C 0.2217 0.5250 0.1818 0.2273 0.0606 0.2250 6 86011385 G A 556.77 intron_variant MODIFIER c.210+874C>T 0.2642 0.5250 0.3182 0.1818 0.1061 0.2500 6 86011390 T C 598.77 intron_variant MODIFIER c.210+869A>G 0.2594 0.5250 0.3182 0.1818 0.0909 0.2500 6 86011405 T C 677.77 intron_variant MODIFIER c.210+854A>G 0.2642 0.5500 0.3182 0.1818 0.0909 0.2500 6 86011501 A G 46.77 intron_variant MODIFIER c.210+758T>C 0.0047 - 0.0227 - - - 6 86011518 A G,T 1159.77 intron_variant MODIFIER c.210+741T>C 0.3066 0.5750 0.2727 0.3182 0.2121 0.2250 6 86011549 A C 840.77 intron_variant MODIFIER c.210+710T>G 0.3302 0.5750 0.2955 0.3182 0.2576 0.2500 6 86011552 A G 826.77 intron_variant MODIFIER c.210+707T>C 0.3302 0.5750 0.2955 0.3182 0.2576 0.2500 6 86011575 C T 234.77 intron_variant MODIFIER c.210+684G>A 0.0094 - 0.0455 - - - 6 86011642 T G 52.77 intron_variant MODIFIER c.210+617A>C 0.0047 - - - 0.0152 - 6 86011654 T C 1026.77 intron_variant MODIFIER c.210+605A>G 0.0377 0.0500 0.0455 - 0.0152 0.0750 6 86011668 T C 11.12 intron_variant MODIFIER c.210+591A>G 0.0047 - - - 0.0152 - 6 86011744 A G 285.77 intron_variant MODIFIER c.210+515T>C 0.0047 - - - - 0.0250 6 86011787 A G 655.77 intron_variant MODIFIER c.210+472T>C 0.0142 - 0.0682 - - - 6 86011815 T C 925.77 intron_variant MODIFIER c.210+444A>G 0.3160 0.5750 0.2500 0.3182 0.2424 0.2500 6 86011926 A G 812.77 intron_variant MODIFIER c.210+333T>C 0.1368 0.3250 0.0682 0.2273 0.0758 0.0750 6 86011943 A T 375.77 intron_variant MODIFIER c.210+316T>A 0.0047 - - - - 0.0250 6 86011982 A G 948.77 intron_variant MODIFIER c.210+277T>C 0.2925 0.4000 0.1818 0.2727 0.3636 0.2000 6 86012065 G T 707.77 intron_variant MODIFIER c.210+194C>A 0.2264 0.1250 - - 0.3485 0.5000 6 86012077 T C 360.77 intron_variant MODIFIER c.210+182A>G 0.0283 0.0250 - - 0.0758 - 6 86012090 A G 917.77 intron_variant MODIFIER c.210+169T>C 0.0755 - 0.1136 - 0.1212 0.0750 6 86012110 A G 343.77 intron_variant MODIFIER c.210+149T>C 0.0189 0.0250 - - 0.0152 0.0500 6 86012118 G C 515.77 intron_variant MODIFIER c.210+141C>G 0.1368 0.3750 - 0.2727 0.0455 0.1250 6 86012129 G T 73.77 intron_variant MODIFIER c.210+130C>A 0.0189 - - - 0.0606 - 6 86012351 T C 708.77 intron_variant MODIFIER c.183+47A>G 0.0519 0.2250 - - - 0.0500 6 86012355 T G 519.77 intron_variant MODIFIER c.183+43A>C 0.0519 0.1750 - - - 0.1000 6 86012368 A G 33.77 intron_variant MODIFIER c.183+30T>C 0.0047 - - - - 0.0250 6 86012431 G A 1176.77 splice_region_variant LOW c.157-7C>T 0.2406 0.5750 0.2955 0.3182 0.0152 0.1750 6 86012436 G A 13.95 intron_variant MODIFIER c.157-12C>T 0.0047 - - - 0.0152 - 6 86012439 A G 1127.77 intron_variant MODIFIER c.157-15T>C 0.1132 0.3250 - 0.3182 0.0152 0.0750 6 86012441 A G,C 205.77 intron_variant MODIFIER c.157-17T>G 0.0189 - 0.0682 - - 0.0250 6 86012462 T C 731.77 intron_variant MODIFIER c.157-38A>G 0.0189 0.0250 - 0.1364 - - 6 86012488 T C 576.77 intron_variant MODIFIER c.157-64A>G 0.0377 - - - 0.0758 0.0750 6 86012664 G A 451.77 intron_variant MODIFIER c.157-240C>T 0.0472 - - - 0.1061 0.0750 6 86012714 G T 357.77 intron_variant MODIFIER c.157-290C>A 0.0377 - 0.1818 - - - 6 86012742 G T 439.77 intron_variant MODIFIER c.157-318C>A 0.0047 0.0250 - - - - 6 86012832 G A 288.77 intron_variant MODIFIER c.156+326C>T 0.0189 0.0500 - - - 0.0500 6 86012892 G A 338.77 intron_variant MODIFIER c.156+266C>T 0.1179 0.0750 0.3182 - 0.1212 - 6 86012919 T A 112.77 intron_variant MODIFIER c.156+239A>T 0.0094 - - - 0.0303 - 6 86013088 T C 971.77 intron_variant MODIFIER c.156+70A>G 0.1274 0.1500 0.0909 0.4091 0.0606 0.1000 6 86013093 T C 1008.77 intron_variant MODIFIER c.156+65A>G 0.1274 0.1500 0.0909 0.4091 0.0606 0.1000 6 86013149 T A 666.77 intron_variant MODIFIER c.156+9A>T 0.0991 0.1250 0.0909 0.4091 0.0152 0.0500 6 86013169 T G 826.77 missense_variant MODERATE c.145A>C p.Ile49Leu 0.1226 1 2.99 TOLERATED 0.1500 0.0909 0.4091 0.0455 0.1000 6 86013252 T G 765.77 intron_variant MODIFIER c.94-32A>C 0.1226 0.1500 0.0909 0.4091 0.0455 0.1000 6 86013310 G T 201.77 intron_variant MODIFIER c.94-90C>A 0.0047 - - - - 0.0250 6 86013325 A T 75.77 intron_variant MODIFIER c.94-105T>A 0.0094 - 0.0455 - - - 6 86013334 A G 442.77 intron_variant MODIFIER c.94-114T>C 0.0519 0.1750 - - - 0.1000 6 86013355 G A 295.77 intron_variant MODIFIER c.94-135C>T 0.0425 - 0.2045 - - - 6 86013356 T C 605.77 intron_variant MODIFIER c.94-136A>G 0.1226 0.1500 0.0909 0.3182 0.0758 0.1000 6 86013357 G A 169.77 intron_variant MODIFIER c.94-137C>T 0.0094 - - - 0.0303 - 6 86013427 C T 515.77 intron_variant MODIFIER c.94-207G>A 0.1226 0.1500 0.1136 0.3636 0.0455 0.1000 6 86013443 G A 591.77 intron_variant MODIFIER c.94-223C>T 0.1132 0.1500 0.1136 0.3636 0.0152 0.1000 6 86013515 A G 593.77 intron_variant MODIFIER c.94-295T>C 0.0519 0.1750 - - - 0.1000 6 86013561 T C 673.77 intron_variant MODIFIER c.94-341A>G 0.1226 0.1500 0.1136 0.4091 0.0303 0.1000 6 86013570 T G 135.77 intron_variant MODIFIER c.94-350A>C 0.0047 - 0.0227 - - - 6 86013702 G A 240.77 intron_variant MODIFIER c.94-482C>T 0.0047 0.0250 - - - - 6 86013703 C T 414.77 intron_variant MODIFIER c.94-483G>A 0.0283 0.0250 - - 0.0758 - 6 86013727 G A 633.77 intron_variant MODIFIER c.94-507C>T 0.1038 0.1500 0.0909 0.3182 0.0152 0.1000 6 86013784 G A 399.77 intron_variant MODIFIER c.94-564C>T 0.0472 - - - 0.1061 0.0750 6 86013800 T C 175.77 intron_variant MODIFIER c.94-580A>G 0.0047 - - - 0.0152 - 6 86013811 A T 18.59 intron_variant MODIFIER c.94-591T>A 0.0094 - - - 0.0303 - 6 86013835 A G 1129.77 intron_variant MODIFIER c.94-615T>C 0.8632 0.9250 0.9545 0.9545 0.6667 0.9750 6 86014076 A T,C 728.77 intron_variant MODIFIER c.94-856T>G 0.0613 0.0250 0.0909 0.0455 0.0758 0.0500 6 86014126 C T 129.77 intron_variant MODIFIER c.94-906G>A 0.0094 - - - 0.0303 - 6 86014202 T C 400.77 intron_variant MODIFIER c.94-982A>G 0.0755 0.0500 0.2500 - 0.0455 - 6 86014228 A C 119.77 intron_variant MODIFIER c.93+988T>G 0.0094 - - - 0.0303 - 6 86014300 T G 330.77 intron_variant MODIFIER c.93+916A>C 0.0566 - 0.2727 - - - 6 86014301 T G 994.77 intron_variant MODIFIER c.93+915A>C 0.5708 0.5500 0.4545 0.5455 0.5455 0.7750 6 86014358 C T 150.03 intron_variant MODIFIER c.93+858G>A 0.0142 - - - 0.0455 - 6 86014420 T G 375.77 intron_variant MODIFIER c.93+796A>C 0.0047 0.0250 - - - - 6 86014441 A T 726.77 intron_variant MODIFIER c.93+775T>A 0.1179 0.1500 0.0909 0.4091 0.0303 0.1000 6 86014611 C G 247.77 intron_variant MODIFIER c.93+605G>C 0.0047 - - 0.0455 - - 6 86014682 T C 167.77 intron_variant MODIFIER c.93+534A>G 0.0094 - - - 0.0303 - 6 86014735 A G 530.77 intron_variant MODIFIER c.93+481T>C 0.0519 0.1750 - - - 0.1000 6 86014797 A C 87.77 intron_variant MODIFIER c.93+419T>G 0.0094 - - - 0.0303 - 6 86014810 C A 146.77 intron_variant MODIFIER c.93+406G>T 0.0047 - - - - 0.0250 6 86014864 A C 346.77 intron_variant MODIFIER c.93+352T>G 0.0189 0.0250 - - 0.0152 0.0500 6 86014866 G T 637.77 intron_variant MODIFIER c.93+350C>A 0.1604 0.2500 0.2727 - 0.1212 0.1000 6 86014979 A G 349.77 intron_variant MODIFIER c.93+237T>C 0.0047 0.0250 - - - - 6 86015172 A T 416.77 intron_variant MODIFIER c.93+44T>A 0.0472 - - - 0.1061 0.0750 6 86015175 A G 244.77 intron_variant MODIFIER c.93+41T>C 0.0142 - - - 0.0303 0.0250 6 86015185 G A 441.77 intron_variant MODIFIER c.93+31C>T 0.0425 - 0.2045 - - - 6 86015270 C T 334.77 synonymous_variant LOW c.39G>A p.Gln13Gln 0.0094 - - - 0.0303 - 6 86015278 G C 335.77 missense_variant MODERATE c.31C>G p.Leu11Val 0.0094 0 4.32 DELETERIOUS - - - 0.0303 - 6 86007152 C CAG 286.73 intron_variant MODIFIER c.769-580_769-579insCT 0.0047 - - - - 0.0250 6 86007352 T TA 633.73 intron_variant MODIFIER c.768+575_768+576insT 0.2830 0.5500 0.2955 0.3182 0.1364 0.2250 6 86007847 A AT 895.73 intron_variant MODIFIER c.768+80_768+81insA 0.2736 0.5750 0.2727 0.2727 0.1212 0.2250 6 86007903 GCA G 244.73 intron_variant MODIFIER c.768+23_768+24delTG 0.0047 - - - 0.0152 - 6 86009237 A AG 931.73 intron_variant MODIFIER c.276+511_276+512insC 0.3396 0.6250 0.2727 0.3636 0.2273 0.3000 6 86009273 TGTGTGCCA T 73.73 intron_variant MODIFIER c.276+468_276+475delTGGCACAC 0.0047 - - - 0.0152 - 6 86009795 TAAAA T,TA,TAAA,TAAAAA,TAA,TAAAAAA735.73 splice_region_variant LOW c.235-9_235-6delTTTT 0.3962 0.6250 0.3409 0.6364 0.2273 0.3750 6 86009980 G GA 567.73 intron_variant MODIFIER c.211-70_211-69insT 0.3255 0.5750 0.2955 0.2727 0.2727 0.2250 6 86010083 TA T,TAA 442.73 intron_variant MODIFIER c.211-173delT 0.3066 0.5750 0.2273 0.3182 0.2576 0.2000 6 86011232 G GGC 885.73 intron_variant MODIFIER c.210+1026_210+1027insGC 0.1368 0.1500 0.2727 - 0.0909 0.1250 6 86011410 TAGC T 352.74 intron_variant MODIFIER c.210+846_210+848delGCT 0.0472 - 0.2273 - - - ATTGCTGGTATAATAATAAAATATGTCCATTTGCATGTCTGCCC 6 86011593 A 34.73 intron_variant MODIFIER c.210+623_210+665delGGGCAGACATGCAAATGGACATATTTTATTATTATACCAGCAA 0.0047 - - - 0.0152 - INDEL 6 86011639 ACT A 40.73 intron_variant MODIFIER c.210+618_210+619delAG 0.0047 - - - 0.0152 - 6 86011645 CAA C 43.73 intron_variant MODIFIER c.210+612_210+613delTT 0.0047 - - - 0.0152 - 6 86011650 TGCATC T 43.73 intron_variant MODIFIER c.210+604_210+608delGATGC 0.0047 - - - 0.0152 - 6 86011664 CAGTTTGTACT C 851.73 intron_variant MODIFIER c.210+585_210+594delAGTACAAACT 0.3160 0.5750 0.3182 0.3182 0.1970 0.2500 6 86011741 CAG C 929.73 intron_variant MODIFIER c.210+516_210+517delCT 0.3255 0.5750 0.2955 0.2727 0.2576 0.2500 6 86012436 GA G,GAAA,GAA 1201.73 intron_variant MODIFIER c.157-13delT 0.1557 0.3250 0.0909 0.3182 0.0606 0.1250 6 86012437 A AG 288.73 intron_variant MODIFIER c.157-14_157-13insC 0.0047 0.0250 - - - - 6 86012625 TTTATGGCTAACAGAAAAGGAG T 397.73 intron_variant MODIFIER c.157-222_157-202delCTCCTTTTCTGTTAGCCATAA 0.0377 - 0.1818 - - - 6 86013668 AT A 1035.73 intron_variant MODIFIER c.94-449delA 0.8019 0.9500 0.9091 0.8636 0.5152 0.9750 6 86013800 TGAA T 682.73 intron_variant MODIFIER c.94-583_94-581delTTC 0.0472 0.1500 - - - 0.1000 6 86013811 A AT 344.74 intron_variant MODIFIER c.94-592_94-591insA 0.0189 0.0250 - - 0.0455 - 6 86014176 CA C 407.73 intron_variant MODIFIER c.94-957delT 0.0472 0.1750 - - - 0.0750 6 86015234 GAGA G 354.73 disruptive_inframe_deletion MODERATE c.72_74delTCT 0.0047 0.0250 - - - - Supplementary Table S2. Polymorphisms (SNPs in black, INDEL in red) detected in the goat casein genes (CSN1S2) Chromosome Position Ref allele Alt_allele QUAL Variant_type Effect Nucleotide substitution AA substitution subst. literature Alt_freq SIFT_score SIFT_median SIFT_prediction AF BE EU FE NE 6 86076861 T G 777.77 5_prime_UTR_variant MODIFIER c.-76T>G 0.2972 0.2000 0.4773 0.2727 0.1515 0.4500 6 86076886 C T 718.77 5_prime_UTR_variant MODIFIER c.-51C>T 0.2972 0.2000 0.4545 0.3182 0.1515 0.4500 6 86076980 C T 495.77 upstream_gene_variant MODIFIER c.-2108C>T 0.1792 0.0250 0.0909 0.0455 0.3788 0.1750 6 86077054 T C 178.77 upstream_gene_variant MODIFIER c.-2034T>C 0.0047 - - 0.0455 - - 6 86077055 T C 188.77 upstream_gene_variant MODIFIER c.-2033T>C 0.0047 - - 0.0455 - - 6 86077057 G T 25.78 upstream_gene_variant MODIFIER c.-2031G>T 0.0047 - - - 0.0152 - 6 86077186 G A 268.77 upstream_gene_variant MODIFIER c.-1902G>A 0.0283 - 0.0455 - 0.0455 0.0250 6 86077193 G C 84.77 upstream_gene_variant MODIFIER c.-1895G>C 0.0047 - 0.0227 - - - 6 86077343 G A 242.77 upstream_gene_variant MODIFIER c.-1745G>A 0.0047 - 0.0227 - - - 6 86077378 C T 620.77 upstream_gene_variant MODIFIER c.-1710C>T 0.3113 0.2250 0.4318 0.3182 0.1818 0.4750 6 86077496 C T 10.2 intron_variant MODIFIER c.-13+572C>T 0.0047 - - - 0.0152 - 6 86077505 C G 545.77 intron_variant MODIFIER c.-13+581C>G 0.0943 0.2500 - 0.2727 0.0455 0.0250 6 86077654 A G 157.77 intron_variant MODIFIER c.-13+730A>G 0.0236 - 0.0455 - 0.0303 0.0250 6 86077666 A C 280.77 intron_variant MODIFIER c.-13+742A>C 0.0047 - 0.0227 - - - 6 86077672 A G 894.77 intron_variant MODIFIER c.-13+748A>G 0.2972 0.2250 0.4318 0.3182 0.1364 0.4750 6 86077862 G A 188.77 intron_variant MODIFIER c.-13+938G>A 0.0189 - - - 0.0303 0.0500 6 86077879 A T 869.77 intron_variant MODIFIER c.-13+955A>T 0.2925 0.2000 0.4318 0.3182 0.1364 0.4750 6 86077932 C T 97.77 intron_variant MODIFIER c.-13+1008C>T 0.0047 - - 0.0455 - - 6 86077956 C T 350.77 intron_variant MODIFIER c.-13+1032C>T 0.0047 - 0.0227 - - - 6 86078007 A G 549.77 intron_variant MODIFIER c.-12-1069A>G 0.3774 0.3250 0.3864 0.4091 0.4545 0.2750 6 86078043 C A 29.77 intron_variant MODIFIER c.-12-1033C>A 0.0047 - - 0.0455 - - 6 86078062 C T 261.77 intron_variant MODIFIER c.-12-1014C>T 0.0094 - 0.0227 - - 0.0250 6 86078137 A G 108.77 intron_variant MODIFIER c.-12-939A>G 0.0047 - - - 0.0152 - 6 86078216 A T 397.77 intron_variant MODIFIER c.-12-860A>T 0.0047 0.0250 - - - - 6 86078217 C T 732.77 intron_variant MODIFIER c.-12-859C>T 0.3113 0.2250 0.4773 0.3182 0.1515 0.4750 6 86078276 T C 760.77 intron_variant MODIFIER c.-12-800T>C 0.0236 - 0.0682 - - 0.0500 6 86078336 C T 398.77 intron_variant MODIFIER c.-12-740C>T 0.0047 - 0.0227 - - - 6 86078369 G C 401.77 intron_variant MODIFIER c.-12-707G>C 0.0094 - 0.0455 - - - 6 86078370 G A 724.77 intron_variant MODIFIER c.-12-706G>A 0.3066 0.2250 0.4318 0.3182 0.1667 0.4750 6 86078373 G T 18.59 intron_variant MODIFIER c.-12-703G>T 0.0094 - - - 0.0303 - 6 86078400 T C 421.77 intron_variant MODIFIER c.-12-676T>C 0.1745 0.1500 0.1136 0.1364 0.0758 0.4500 6 86078677 T A 159.77 intron_variant MODIFIER c.-12-399T>A 0.0094 - - - 0.0303 - 6 86078872 G A 58.74 intron_variant MODIFIER c.-12-204G>A 0.0094 - - - 0.0303 - 6 86078947 T C 620.77 intron_variant MODIFIER c.-12-129T>C 0.2217 0.0500 0.2955 0.0455 0.3636 0.1750 6 86078967 T C 865.77 intron_variant MODIFIER c.-12-109T>C 0.3160 0.2250 0.4773 0.3182 0.1667 0.4750 6 86078991 A G 486.77 intron_variant MODIFIER c.-12-85A>G 0.1132 0.2750 - 0.4091 0.0303 0.0500 6 86079078 C A 254.77 splice_region_variant LOW c.-10C>A 0.0094 0.0250 - - - 0.0250 6 86079086 G A 1141.77 5_prime_UTR_variant MODIFIER c.-2G>A 0.7500 0.5500 0.9773 0.7727 0.6818 0.8000 6 86079087 T C 1141.77 5_prime_UTR_variant MODIFIER c.-1T>C 0.7500 0.5500 0.9773 0.7727 0.6818 0.8000 6 86079098 T C 395.77 missense_variant MODERATE c.11T>C p.Phe4Ser 0.2358 0 2.59 DELETERIOUS 0.0500 0.3182 0.0455 0.3939 0.1750 6 86079121 G A 405.77 missense_variant MODERATE c.34G>A p.Val12Ile 0.0094 0.07 2.55 TOLERATED - - - - 0.0500 6 86079145 A C 533.77 splice_region_variant LOW c.51+7A>C 0.1132 0.2750 - 0.3636 0.0455 0.0500 6 86079206 A G 348.77 intron_variant MODIFIER c.51+68A>G 0.2264 0.0500 0.3182 - 0.3788 0.1750 6 86079307 A G 254.77 intron_variant MODIFIER c.51+169A>G 0.0047 - - - - 0.0250 6 86079355 G A 85.77 intron_variant MODIFIER c.51+217G>A 0.0283 - - - 0.0606 0.0500 6 86079432 G T,A 222.77 intron_variant MODIFIER c.51+294G>A 0.0094 - 0.0455 - - - 6 86079506 A G 710.77 intron_variant MODIFIER c.51+368A>G 0.5708 0.2750 0.7955 0.3182 0.6364 0.6500 6 86079521 C T 388.77 intron_variant MODIFIER c.51+383C>T 0.0047 0.0250 - - - - 6 86079607 A G 217.77 intron_variant MODIFIER c.51+469A>G 0.0189 0.0250 - 0.0455 0.0152 0.0250 6 86079749 A G 119.77 intron_variant MODIFIER c.51+611A>G 0.0094 - - 0.0455 - 0.0250 6 86079850 A T 836.77 intron_variant MODIFIER c.51+712A>T 0.9858 1.0000 0.9773 1.0000 0.9848 0.9750 6 86079970 T C 566.77 intron_variant MODIFIER c.51+832T>C 0.0802 0.1250 0.0455 0.2273 0.0455 0.0500 6 86080015 G A 861.77 intron_variant MODIFIER c.51+877G>A 0.2925 0.1500 0.4545 0.3182 0.1667 0.4500 6 86080077 C T 814.77 intron_variant MODIFIER c.52-880C>T 0.1415 0.3000 0.0455 - 0.1364 0.1750 6 86080096 T G 943.77 intron_variant MODIFIER c.52-861T>G 0.9340 1.0000 0.9091 0.9091 0.8788 1.0000 6 86080198 C T 265.77 intron_variant MODIFIER c.52-759C>T 0.0094 - 0.0227 - - 0.0250 6 86080224 C T 651.77 intron_variant MODIFIER c.52-733C>T 0.0802 - 0.0682 - 0.1818 0.0500 6 86080225 G A 453.77 intron_variant MODIFIER c.52-732G>A 0.1226 0.0500 0.2955 - 0.0909 0.1250 6 86080248 C T 316.77 intron_variant MODIFIER c.52-709C>T 0.0519 0.0250 0.0455 - 0.0606 0.1000 6 86080262 C T 578.77 intron_variant MODIFIER c.52-695C>T 0.0236 - - - 0.0758 - 6 86080294 C T 227.77 intron_variant MODIFIER c.52-663C>T 0.0142 0.0250 - - - 0.0500 6 86080380 A T 86.77 intron_variant MODIFIER c.52-577A>T 0.0283 - 0.0227 - 0.0758 - 6 86080424 G A 218.77 intron_variant MODIFIER c.52-533G>A 0.0047 0.0250 - - - - 6 86080481 T G 618.77 intron_variant MODIFIER c.52-476T>G 0.2453 0.0500 0.3636 0.2273 0.3485 0.1500 6 86080520 T C 227.8 intron_variant MODIFIER c.52-437T>C 0.0047 - - - 0.0152 - 6 86080539 C G 78.77 intron_variant MODIFIER c.52-418C>G 0.0047 - - - 0.0152 - 6 86080574 C A 1053.77 intron_variant MODIFIER c.52-383C>A 0.6415 0.8250 0.2273 0.5000 0.7273 0.8500 6 86080578 G A 1117.77 intron_variant MODIFIER c.52-379G>A 0.7217 0.6250 0.8182 1.0000 0.5909 0.7750 6 86080602 A G 440.77 intron_variant MODIFIER c.52-355A>G 0.0142 - 0.0682 - - - 6 86080610 A C 295.77 intron_variant MODIFIER c.52-347A>C 0.0094 - 0.0455 - - - 6 86080612 T A 954.77 intron_variant MODIFIER c.52-345T>A 0.5708 0.3250 0.8409 0.5909 0.4394 0.7250 6 86080651 A C 998.77 intron_variant MODIFIER c.52-306A>C 0.7453 0.8250 0.6591 0.9091 0.8182 0.5500 6 86080664 C T 318.77 intron_variant MODIFIER c.52-293C>T 0.0047 - 0.0227 - - - 6 86080714 A G 347.77 intron_variant MODIFIER c.52-243A>G 0.0330 - 0.0227 - 0.0758 0.0250 6 86080760 G C 948.77 intron_variant MODIFIER c.52-197G>C 0.1415 0.3500 0.0682 - 0.0909 0.1750 6 86080782 T A 198.77 intron_variant MODIFIER c.52-175T>A 0.0142 - 0.0682 - - - 6 86080855 C A 221.84 intron_variant MODIFIER c.52-102C>A 0.0377 - - - 0.0758 0.0750 6 86080886 C T 430.77 intron_variant MODIFIER c.52-71C>T 0.2075 0.1500 0.3409 0.2727 0.1515 0.1750 6 86080905 G A 447.77 intron_variant MODIFIER c.52-52G>A 0.0519 - 0.2500 - - - 6 86080919 G A 835.77 intron_variant MODIFIER c.52-38G>A 0.4717 0.5000 0.4773 0.6364 0.4848 0.3250 6 86080927 A G 351.77 intron_variant MODIFIER c.52-30A>G 0.0047 - - - - 0.0250 6 86080943 G A 172.78 intron_variant MODIFIER c.52-14G>A 0.0094 - - - 0.0303 - 6 86080969 G A 665.77 missense_variant MODERATE c.64G>A p.Val22Ile p.Val7Ile 0.1321 0.4 2.65 TOLERATED 0.1250 0.2273 0.2727 0.0455 0.1000 6 86080994 C T 289.77 intron_variant MODIFIER c.78+11C>T 0.0330 - - - 0.0606 0.0750 6 86080999 G T 1089.77 intron_variant MODIFIER c.78+16G>T 0.9009 1.0000 0.8409 0.9545 0.8030 1.0000 6 86081022 T G 467.77 intron_variant MODIFIER c.78+39T>G 0.0283 0.0250 - 0.1818 - 0.0250 6 86081049 A G 79.77 intron_variant MODIFIER c.78+66A>G 0.0047 - 0.0227 - - - 6 86081080 C T 1205.77 intron_variant MODIFIER c.78+97C>T 0.7123 0.8750 0.5682 0.8182 0.7121 0.6500 6 86081134 A G 202.77 intron_variant MODIFIER c.78+151A>G 0.0047 - - - 0.0152 - 6 86081135 T G 819.77 intron_variant MODIFIER c.78+152T>G 0.5000 0.4750 0.5227 0.6818 0.5606 0.3000 6 86081164 C T 31.77 intron_variant MODIFIER c.78+181C>T 0.0047 - - - 0.0152 - 6 86081202 C A 147.77 intron_variant MODIFIER c.78+219C>A 0.0142 - - - 0.0455 - 6 86081216 A G 250.77 intron_variant MODIFIER c.78+233A>G 0.0094 0.0250 - - - 0.0250 6 86081280 T C 289.77 intron_variant MODIFIER c.78+297T>C 0.0094 0.0250 - - - 0.0250 6 86081283 G A 1029.77 intron_variant MODIFIER c.78+300G>A 0.5236 0.7500 0.3409 0.5909 0.5455 0.4250 6 86081383 A G 721.77 intron_variant MODIFIER c.79-391A>G 0.2972 0.2500 0.3409 0.3182 0.1970 0.4500 6 86081390 T C 579.77 intron_variant MODIFIER c.79-384T>C 0.2406 0.1500 0.2955 0.0909 0.1818 0.4500 6 86081416 G A 19.81 intron_variant MODIFIER c.79-358G>A 0.0047 - - - 0.0152 - 6 86081439 A G 661.77 intron_variant MODIFIER c.79-335A>G 0.0802 0.2500 - 0.1818 0.0303 0.0250 6 86081441 A G 308.77 intron_variant MODIFIER c.79-333A>G 0.0849 0.0250 0.1136 - 0.1061 0.1250 6 86081450 A G 317.78 intron_variant MODIFIER c.79-324A>G 0.1132 - 0.2045 - 0.1818 0.0750 6 86081493 A G 304.77 intron_variant MODIFIER c.79-281A>G 0.0283 0.0250 0.0682 - - 0.0500 6 86081581 T A 620.77 intron_variant MODIFIER c.79-193T>A 0.0708 - - - 0.1515 0.1250 6 86081651 T C 326.78 intron_variant MODIFIER c.79-123T>C 0.0377 - 0.1818 - - - 6 86081728 G A 227.77 intron_variant MODIFIER c.79-46G>A 0.0047 - - - - 0.0250 6 86081865 A T 176.77 intron_variant MODIFIER c.103-21A>T 0.0047 - 0.0227 - - - 6 86081932 A G 419.77 splice_region_variant LOW c.144+5A>G 0.0094 - - - - 0.0500 6 86081940 T G 79.77 intron_variant MODIFIER c.144+13T>G 0.0047 - - - - 0.0250 6 86081947 G A 804.77 intron_variant MODIFIER c.144+20G>A 0.2877 0.4000 0.3182 0.5909 0.1667 0.1750 6 86082011 C A 46.77 intron_variant MODIFIER c.144+84C>A 0.0047 - - - 0.0152 - 6 86082099 G A 826.77 intron_variant MODIFIER c.144+172G>A 0.1557 0.3250 0.0227 - 0.1818 0.1750 6 86082170 G T 222.77 intron_variant MODIFIER c.145-142G>T 0.0047 - 0.0227 - - - 6 86082213 A G 1146.77 intron_variant MODIFIER c.145-99A>G 0.9811 1.0000 1.0000 1.0000 0.9394 1.0000 6 86082469 A G 23.79 intron_variant MODIFIER c.171+131A>G 0.0047 - - - 0.0152 - 6 86082493 C T 975.77 intron_variant MODIFIER c.171+155C>T 0.4057 0.4000 0.4091 0.0455 0.5758 0.3250 6 86082578 G A 292.77 intron_variant MODIFIER c.171+240G>A 0.0047 0.0250 - - - - 6 86082708 C T 85.77 intron_variant MODIFIER c.171+370C>T 0.0283 - - - 0.0909 - 6 86082752 T A 863.77 intron_variant MODIFIER c.172-384T>A 0.5708 0.5500 0.5455 0.5000 0.7121 0.4250 6 86082774 A G 542.77 intron_variant MODIFIER c.172-362A>G 0.1415 0.3250 0.0682 0.4091 0.0455 0.0500 6 86083035 A G 252.77 intron_variant MODIFIER c.172-101A>G 0.0094 - 0.0455 - - - 6 86083274 C T 636.77 intron_variant MODIFIER c.198+112C>T 0.2358 0.3250 0.0909 0.4545 0.2879 0.1000 6 86083302 T C 768.77 intron_variant MODIFIER c.198+140T>C 0.1698 0.1250 0.3182 0.0909 - 0.3750 6 86083375 A T 190.77 intron_variant MODIFIER c.198+213A>T 0.0047 - 0.0227 - - - 6 86083446 C G 390.77 intron_variant MODIFIER c.199-166C>G 0.0142 - 0.0455 - - 0.0250 6 86083468 T C 1023.77 intron_variant MODIFIER c.199-144T>C 0.4245 0.5250 0.5000 0.4545 0.3636 0.3250 6 86083573 G C 201.77 intron_variant MODIFIER c.199-39G>C 0.0047 - - - - 0.0250 6 86083659 A T 506.77 intron_variant MODIFIER c.225+21A>T 0.0142 - 0.0455 - 0.0152 - 6 86083669 G A 471.77 intron_variant MODIFIER c.225+31G>A 0.0377 - 0.1818 - - - 6 86083904 C T 500.77 intron_variant MODIFIER c.225+266C>T 0.1226 0.1250 0.1136 0.0909 - 0.3500 6 86083934 C A 901.77 intron_variant MODIFIER c.225+296C>A 0.4434 0.5250 0.4318 0.4545 0.4242 0.4000 6 86084055 G A 899.77 intron_variant MODIFIER c.225+417G>A 0.4811 0.5250 0.4773 0.4545 0.5000 0.4250 6 86084117 C G 953.77 intron_variant MODIFIER c.225+479C>G 0.1038 0.1000 0.0682 0.0909 - 0.3250 6 86084134 G A 950.77 intron_variant MODIFIER c.225+496G>A 0.9906 1.0000 1.0000 1.0000 0.9697 1.0000 6 86084271 T C 530.77 intron_variant MODIFIER c.226-478T>C 0.1179 0.1250 0.1136 0.0909 - 0.3250 6 86084300 T C 582.77 intron_variant MODIFIER c.226-449T>C 0.1132 0.1000 0.1136 0.0909 - 0.3250 6 86084309 C T 446.77 intron_variant MODIFIER c.226-440C>T 0.2311 0.3500 0.1136 0.3182 0.3030 0.0750 6 86084333 T G 451.77 intron_variant MODIFIER c.226-416T>G 0.1132 0.1250 0.0909 0.0909 - 0.3250 6 86084339 G A 731.77 intron_variant MODIFIER c.226-410G>A 0.0283 - 0.1136 - - 0.0250 6 86084492 A C 447.77 intron_variant MODIFIER c.226-257A>C 0.0283 - 0.0227 - 0.0606 0.0250 6 86084621 C T 519.77 splice_region_variant LOW c.199-8C>T 0.0094 - - - - 0.0500 6 86084638 G A 410.77 missense_variant MODERATE c.208G>A p.Glu79Lys p.Glu64Lys 0.0566 0.13 2.56 TOLERATED - 0.0227 - 0.1667 - 6 86084692 C T 136.77 intron_variant MODIFIER c.226-57C>T 0.0142 - 0.0682 - - - 6 86084847 T C 297.77 intron_variant MODIFIER c.270+54T>C 0.0094 - 0.0455 - - - 6 86084942 A G 184.77 intron_variant MODIFIER c.271-113A>G 0.0047 0.0250 - - - - 6 86084950 T A 355.77 intron_variant MODIFIER c.271-105T>A 0.0094 - - - 0.0303 - 6 86084966 T G 737.77 intron_variant MODIFIER c.271-89T>G 0.1179 0.1250 0.1136 0.0909 - 0.3250 SNP 6 86084994 T G 829.77 intron_variant MODIFIER c.271-61T>G 0.1179 0.1250 0.1136 0.0909 - 0.3250 6 86085104 C T 115.77 missense_variant MODERATE c.320C>T p.Pro115Leu 0.0142 0.8 2.64 TOLERATED - - 0.0455 0.0303 - 6 86085160 G C 1016.77 missense_variant MODERATE c.376G>C p.Ala134Pro 0.9623 1 2.7 TOLERATED 1.0000 1.0000 1.0000 0.8788 1.0000 6 86085212 T G 150.41 intron_variant MODIFIER c.393+35T>G 0.0094 - - - 0.0303 - 6 86085213 A T 482.77 intron_variant MODIFIER c.393+36A>T 0.0519 0.0500 0.0455 0.0455 0.0758 0.0250 6 86085224 C T 175.77 intron_variant MODIFIER c.393+47C>T 0.0566 0.1500 0.0227 0.1364 0.0303 - 6 86085320 G A 60.74 intron_variant MODIFIER c.393+143G>A 0.0094 - - - 0.0303 - 6 86085388 A G 505.77 intron_variant MODIFIER c.393+211A>G 0.0425 - 0.2045 - - - 6 86085509 C T 1021.77 intron_variant MODIFIER c.394-199C>T 0.4670 0.5250 0.4318 0.5000 0.4545 0.4500 6 86085537 A G 1173.77 intron_variant MODIFIER c.394-171A>G 0.9292 1.0000 0.9545 1.0000 0.8788 0.8750 6 86085554 A G 951.77 intron_variant MODIFIER c.394-154A>G 0.3726 0.4500 0.2500 0.5455 0.3485 0.3750 6 86085602 C T 990.77 intron_variant MODIFIER c.394-106C>T 0.2311 0.1250 0.2500 0.1364 0.2273 0.3750 6 86085705 T C 103.28 splice_region_variant LOW c.394-3T>C 0.0142 - - - 0.0455 - 6 86085714 G A 140.77 missense_variant MODERATE c.400G>A p.Glu142Lys 0.0094 0.14 2.67 TOLERATED - - - - 0.0500 6 86085800 C T 786.77 intron_variant MODIFIER c.420+66C>T 0.1038 0.0750 0.0909 0.0909 - 0.3250 6 86085937 C T 398.77 intron_variant MODIFIER c.420+203C>T 0.0425 - 0.2045 - - - 6 86085957 T C 514.77 intron_variant MODIFIER c.420+223T>C 0.1934 0.3500 0.2273 0.3182 0.0758 0.1250 6 86086078 G A 328.77 intron_variant MODIFIER c.420+344G>A 0.0377 - - - 0.0606 0.1000 6 86086173 A G 1078.77 intron_variant MODIFIER c.420+439A>G 0.1698 0.1750 0.1136 0.5000 0.1212 0.1250 6 86086263 T C 655.77 intron_variant MODIFIER c.421-444T>C 0.1226 0.1500 0.0227 0.5000 0.0606 0.1000 6 86086327 C T 195.77 intron_variant MODIFIER c.421-380C>T 0.0047 - - - - 0.0250 6 86086472 A G 147.03 intron_variant MODIFIER c.421-235A>G 0.0142 - 0.0227 - 0.0303 - 6 86086494 A T 1050.77 intron_variant MODIFIER c.421-213A>T 0.2736 0.4250 0.1136 0.0909 0.2273 0.4750 6 86086535 C T 216.77 intron_variant MODIFIER c.421-172C>T 0.0047 - 0.0227 - - - 6 86086636 T C 557.77 intron_variant MODIFIER c.421-71T>C 0.3538 0.1000 0.6591 0.0455 0.4242 0.3250 6 86086777 C T 897.77 intron_variant MODIFIER c.447+44C>T 0.0755 0.1250 - 0.5000 - - 6 86086880 T C 767.77 intron_variant MODIFIER c.447+147T>C 0.1226 0.1500 0.0682 0.5455 0.0152 0.1000 6 86087089 G T 118.77 intron_variant MODIFIER c.447+356G>T 0.0047 - 0.0227 - - - 6 86087198 T A 334.78 intron_variant MODIFIER c.447+465T>A 0.0377 - 0.1818 - - - 6 86087279 C T 753.77 intron_variant MODIFIER c.447+546C>T 0.1462 0.1500 0.0682 0.5000 0.1061 0.1000 6 86087295 A G 620.77 intron_variant MODIFIER c.447+562A>G 0.1368 0.1500 0.0682 0.5000 0.0758 0.1000 6 86087421 A C 1051.77 intron_variant MODIFIER c.447+688A>C 0.9528 1.0000 0.9545 1.0000 0.9091 0.9500 6 86087422 A T 1051.77 intron_variant MODIFIER c.447+689A>T 0.9528 1.0000 0.9545 1.0000 0.9091 0.9500 6 86087434 G T 1007.77 intron_variant MODIFIER c.447+701G>T 0.9623 1.0000 0.9545 1.0000 0.9394 0.9500 6 86087527 C T 767.77 intron_variant MODIFIER c.447+794C>T 0.1415 0.1500 0.0227 0.5455 0.1061 0.1000 6 86087647 A G 156.77 intron_variant MODIFIER c.448-786A>G 0.0047 - 0.0227 - - - 6 86087692 C T 347.78 intron_variant MODIFIER c.448-741C>T 0.0094 - 0.0455 - - - 6 86087723 C T 598.77 intron_variant MODIFIER c.448-710C>T 0.1321 0.1500 0.0682 0.4545 0.0758 0.1000 6 86087749 T C 826.77 intron_variant MODIFIER c.448-684T>C 0.1415 0.1500 0.0682 0.4545 0.1061 0.1000 6 86087772 C A 856.77 intron_variant MODIFIER c.448-661C>A 0.1415 0.1500 0.0682 0.5000 0.0909 0.1000 6 86087822 C T 882.77 intron_variant MODIFIER c.448-611C>T 0.3160 0.0750 0.4318 0.0455 0.4848 0.3000 6 86087879 G A 871.77 intron_variant MODIFIER c.448-554G>A 0.2547 0.4250 0.1136 0.0455 0.1667 0.5000 6 86087888 C T 679.77 intron_variant MODIFIER c.448-545C>T 0.1179 0.3250 0.0455 0.3182 0.0303 0.0250 6 86088001 A G 728.77 intron_variant MODIFIER c.448-432A>G 0.1321 0.1500 0.0682 0.4091 0.0909 0.1000 6 86088079 G A 131.77 intron_variant MODIFIER c.448-354G>A 0.0047 - 0.0227 - - - 6 86088144 A C 581.77 intron_variant MODIFIER c.448-289A>C 0.1415 0.1500 0.0682 0.4545 0.1061 0.1000 6 86088167 A C 592.77 intron_variant MODIFIER c.448-266A>C 0.1085 0.3250 - 0.3182 0.0303 0.0250 6 86088181 T C 612.77 intron_variant MODIFIER c.448-252T>C 0.0849 - 0.0455 0.0455 0.1970 0.0500 6 86088315 G A 887.77 intron_variant MODIFIER c.448-118G>A 0.1321 0.1250 0.0682 0.4091 0.1061 0.1000 6 86088407 T G 507.77 intron_variant MODIFIER c.448-26T>G 0.1745 0.0750 0.3182 - 0.1515 0.2500 6 86088555 C T 564.77 synonymous_variant LOW c.481C>T p.Leu169Leu 0.0896 - 0.0455 0.0455 0.2121 0.0500 6 86088596 T C 492.77 splice_region_variant LOW c.516+6T>C 0.1179 0.3250 0.0682 0.3182 0.0152 0.0250 6 86088658 C T 935.77 intron_variant MODIFIER c.516+68C>T 0.9387 1.0000 1.0000 0.9091 0.8636 0.9500 6 86088676 A T 11.12 intron_variant MODIFIER c.516+86A>T 0.0047 - - - 0.0152 - 6 86088680 A C 63.41 intron_variant MODIFIER c.516+90A>C 0.0094 - - - 0.0303 - 6 86088687 G C 858.77 intron_variant MODIFIER c.516+97G>C 0.7925 0.6750 0.8636 0.5909 0.8030 0.9250 6 86088716 G A 808.77 intron_variant MODIFIER c.516+126G>A 0.1321 0.1500 0.0227 0.4091 0.1212 0.1000 6 86088736 A G 414.77 intron_variant MODIFIER c.516+146A>G 0.0094 - 0.0455 - - - 6 86088752 C A 887.77 upstream_gene_variant MODIFIER c.-16620C>A 0.8349 0.6750 0.8864 0.5909 0.9242 0.9250 6 86088766 T C 145.03 upstream_gene_variant MODIFIER c.-16606T>C 0.0094 - - - 0.0303 - 6 86088978 C T 735.77 upstream_gene_variant MODIFIER c.-16394C>T 0.1462 0.1500 0.0682 0.5000 0.1061 0.1000 6 86089078 A G 924.77 upstream_gene_variant MODIFIER c.-16294A>G 0.1321 0.1500 0.0682 0.4545 0.0758 0.1000 6 86089096 C T 496.77 upstream_gene_variant MODIFIER c.-16276C>T 0.1132 0.1250 0.0909 0.0909 - 0.3250 6 86089185 C A 112.77 upstream_gene_variant MODIFIER c.-16187C>A 0.0047 - - - 0.0152 - 6 86089260 A G 449.77 upstream_gene_variant MODIFIER c.-16112A>G 0.1085 0.0750 0.2500 - 0.0606 0.1250 6 86089401 A T 1065.77 missense_variant MODERATE c.521A>T p.Lys182Ile p.Lys167Ile 0.2783 0.07 2.77 TOLERATED 0.4250 0.1136 0.0909 0.2273 0.5000 6 86089408 C G 244.77 missense_variant MODERATE c.528C>G p.Ser184Arg 0.0047 0.12 2.77 TOLERATED - - - - 0.0250 6 86089479 C G 379.77 missense_variant MODERATE c.599C>G p.Pro208Arg p.Pro193Arg 0.0236 0 2.64 DELETERIOUS - 0.0455 - 0.0455 - 6 86089508 C G 63.77 missense_variant MODERATE c.628C>G p.Pro218Ala 0.0094 0.03 2.72 DELETERIOUS - - - 0.0303 - 6 86089935 G T 565.77 upstream_gene_variant MODIFIER c.-15437G>T 0.3821 0.2250 0.6364 0.0909 0.3333 0.5000 6 86089942 T G 538.77 upstream_gene_variant MODIFIER c.-15430T>G 0.1321 0.3250 0.0682 0.4545 0.0152 0.0250 6 86089950 G T 174.77 upstream_gene_variant MODIFIER c.-15422G>T 0.0142 - - - 0.0303 0.0250 6 86090047 A G 1117.77 upstream_gene_variant MODIFIER c.-15325A>G 0.9292 1.0000 0.9545 1.0000 0.8333 0.9500 6 86090061 G A 1003.77 upstream_gene_variant MODIFIER c.-15311G>A 0.1085 0.3000 - - 0.0758 0.1500 6 86090095 T A 535.77 upstream_gene_variant MODIFIER c.-15277T>A 0.0377 - 0.1818 - - - 6 86090113 T A 142.77 upstream_gene_variant MODIFIER c.-15259T>A 0.0047 - 0.0227 - - - 6 86090117 G A 757.77 upstream_gene_variant MODIFIER c.-15255G>A 0.1321 0.1500 0.0682 0.5000 0.0606 0.1000 6 86090195 G A 484.77 upstream_gene_variant MODIFIER c.-15177G>A 0.0519 - 0.2500 - - - 6 86090253 G T 213.77 upstream_gene_variant MODIFIER c.-15119G>T 0.0094 0.0250 - - - 0.0250 6 86090351 C G 172.78 upstream_gene_variant MODIFIER c.-15021C>G 0.0094 - - - 0.0303 - 6 86090378 T C 308.77 upstream_gene_variant MODIFIER c.-14994T>C 0.0094 - 0.0455 - - - 6 86090502 T G 290.77 upstream_gene_variant MODIFIER c.-14870T>G 0.0047 0.0250 - - - - 6 86090539 C T 684.77 upstream_gene_variant MODIFIER c.-14833C>T 0.1132 0.3250 - 0.3636 0.0303 0.0250 6 86090567 G A 43.77 upstream_gene_variant MODIFIER c.-14805G>A 0.0094 - 0.0455 - - - 6 86090578 T A 408.77 upstream_gene_variant MODIFIER c.-14794T>A 0.0943 - 0.0455 0.0909 0.2121 0.0500 6 86090594 A C 647.77 upstream_gene_variant MODIFIER c.-14778A>C 0.1179 0.3000 0.0455 0.3636 0.0303 0.0250 6 86090598 A G 620.77 upstream_gene_variant MODIFIER c.-14774A>G 0.1321 0.1500 0.0682 0.4545 0.0758 0.1000 6 86090619 A C 69.77 upstream_gene_variant MODIFIER c.-14753A>C 0.0047 - - - 0.0152 - 6 86090620 C T 660.77 upstream_gene_variant MODIFIER c.-14752C>T 0.1321 0.1500 0.0455 0.4545 0.0909 0.1000 6 86090729 C G 1045.77 upstream_gene_variant MODIFIER c.-14643C>G 0.8160 0.6750 0.8864 0.5909 0.8636 0.9250 6 86090733 G A,T 1045.77 upstream_gene_variant MODIFIER c.-14639G>A 0.3160 0.4500 0.1591 0.0909 0.2879 0.5250 6 86090785 A G 18.59 upstream_gene_variant MODIFIER c.-14587A>G 0.0094 - 0.0455 - - - 6 86090896 T G 37.77 upstream_gene_variant MODIFIER c.-14476T>G 0.0047 0.0250 - - - - 6 86090899 A G 28.77 upstream_gene_variant MODIFIER c.-14473A>G 0.0047 0.0250 - - - - 6 86090996 T C 19.81 upstream_gene_variant MODIFIER c.-14376T>C 0.0047 - - 0.0455 - - 6 86091022 T C 152.03 upstream_gene_variant MODIFIER c.-14350T>C 0.0283 - 0.0227 - 0.0758 - 6 86091038 A T 294.77 upstream_gene_variant MODIFIER c.-14334A>T 0.0189 - - - 0.0303 0.0500 6 86091040 A T 62.74 upstream_gene_variant MODIFIER c.-14332A>T 0.0189 - - - 0.0606 - 6 86091046 T A 231.84 upstream_gene_variant MODIFIER c.-14326T>A 0.0283 - 0.0455 - 0.0606 - 6 86091057 A T 1277.77 upstream_gene_variant MODIFIER c.-14315A>T 0.2264 0.4000 0.1136 0.0909 0.0758 0.5000 6 86091066 A C 1006.77 upstream_gene_variant MODIFIER c.-14306A>C 0.1226 0.1250 0.0227 0.5000 0.0758 0.1000 6 86091082 A G 303.77 upstream_gene_variant MODIFIER c.-14290A>G 0.0802 0.2500 - 0.1818 0.0303 0.0250 6 86091085 C T 61.74 upstream_gene_variant MODIFIER c.-14287C>T 0.0094 - - - 0.0303 - 6 86091086 G C 1006.77 upstream_gene_variant MODIFIER c.-14286G>C 0.1274 0.1500 0.0227 0.5000 0.0606 0.1250 6 86091126 A G 27.77 upstream_gene_variant MODIFIER c.-14246A>G 0.0047 - - - 0.0152 - 6 86091181 G A 906.77 upstream_gene_variant MODIFIER c.-14191G>A 0.9811 1.0000 1.0000 1.0000 0.9394 1.0000 6 86091318 G T 785.77 upstream_gene_variant MODIFIER c.-14054G>T 0.1462 0.1500 0.0682 0.4545 0.1212 0.1000 6 86091366 A G 166.77 upstream_gene_variant MODIFIER c.-14006A>G 0.0094 - 0.0455 - - - 6 86091409 A G 1253.77 upstream_gene_variant MODIFIER c.-13963A>G 0.2689 0.4250 0.1136 0.0909 0.1970 0.5000 6 86091437 A G 214.77 upstream_gene_variant MODIFIER c.-13935A>G 0.0094 - 0.0455 - - - 6 86091489 C G 46.77 upstream_gene_variant MODIFIER c.-13883C>G 0.0047 - - - 0.0152 - 6 86091746 A G 357.77 upstream_gene_variant MODIFIER c.-13626A>G 0.0094 0.0250 - - - 0.0250 6 86091875 G T 756.77 upstream_gene_variant MODIFIER c.-13497G>T 0.1368 0.1500 0.0682 0.5000 0.0758 0.1000 6 86091883 A G 72.77 upstream_gene_variant MODIFIER c.-13489A>G 0.0047 - 0.0227 - - - 6 86091990 A G 1025.77 upstream_gene_variant MODIFIER c.-13382A>G 0.8443 0.6750 0.9318 0.6364 0.9091 0.9250 6 86091991 C T 691.77 upstream_gene_variant MODIFIER c.-13381C>T 0.1462 0.1500 0.0682 0.5000 0.1061 0.1000 6 86092101 T C 272.77 upstream_gene_variant MODIFIER c.-13271T>C 0.0377 - 0.0455 - 0.0909 - 6 86092122 T C 663.77 upstream_gene_variant MODIFIER c.-13250T>C 0.3821 0.1000 0.7045 0.0455 0.4848 0.3250 6 86092123 G A 535.77 upstream_gene_variant MODIFIER c.-13249G>A 0.0377 - - - 0.0758 0.0750 6 86092199 A G 705.77 upstream_gene_variant MODIFIER c.-13173A>G 0.2877 0.4250 0.1364 0.0909 0.2273 0.5250 6 86092271 A G 460.77 upstream_gene_variant MODIFIER c.-13101A>G 0.1132 0.1000 0.1136 0.0909 - 0.3250 6 86092314 A G 571.77 upstream_gene_variant MODIFIER c.-13058A>G 0.3349 0.1000 0.6818 0.0455 0.3485 0.3250 6 86092351 T A 358.77 upstream_gene_variant MODIFIER c.-13021T>A 0.1132 0.1500 0.0227 0.4091 0.0606 0.1000 6 86092432 G A 556.77 upstream_gene_variant MODIFIER c.-12940G>A 0.1179 0.1500 0.0227 0.3636 0.0909 0.1000 6 86092435 C T 556.77 upstream_gene_variant MODIFIER c.-12937C>T 0.1179 0.1500 0.0227 0.3636 0.0909 0.1000 6 86092456 C T 226.84 upstream_gene_variant MODIFIER c.-12916C>T 0.0425 - 0.2045 - - - 6 86092457 C T 507.77 upstream_gene_variant MODIFIER c.-12915C>T 0.2736 0.4250 0.1591 0.0909 0.1818 0.5000 6 86092490 A C 565.77 upstream_gene_variant MODIFIER c.-12882A>C 0.2547 0.4250 0.1364 0.0909 0.1364 0.5000 6 86092506 A G 848.77 upstream_gene_variant MODIFIER c.-12866A>G 0.9245 1.0000 0.9545 1.0000 0.7879 1.0000 6 86092551 C T 389.77 upstream_gene_variant MODIFIER c.-12821C>T 0.0519 0.0750 0.0682 - 0.0152 0.1000 6 86092557 A T 127.03 upstream_gene_variant MODIFIER c.-12815A>T 0.0189 - - - 0.0606 - 6 86092634 A G 727.77 upstream_gene_variant MODIFIER c.-12738A>G 0.2311 0.4250 0.0909 0.0909 0.1061 0.4750 6 86092671 C T 337.77 upstream_gene_variant MODIFIER c.-12701C>T 0.0330 - 0.0455 - 0.0758 - 6 86092746 C G 294.77 upstream_gene_variant MODIFIER c.-12626C>G 0.0236 - - - 0.0303 0.0750 6 86092851 A G 30.77 upstream_gene_variant MODIFIER c.-12521A>G 0.0047 - - 0.0455 - - 6 86092858 G A 724.77 upstream_gene_variant MODIFIER c.-12514G>A 0.1604 0.1500 0.0909 0.5000 0.1364 0.1000 6 86092887 T C 111.77 upstream_gene_variant MODIFIER c.-12485T>C 0.0094 - 0.0455 - - - 6 86092891 A G 204.77 upstream_gene_variant MODIFIER c.-12481A>G 0.0047 0.0250 - - - - 6 86092917 T A 267.77 upstream_gene_variant MODIFIER c.-12455T>A 0.0047 0.0250 - - - - 6 86093184 A G 1196.77 upstream_gene_variant MODIFIER c.-12188A>G 0.8443 0.6750 0.9091 0.6364 0.9242 0.9250 6 86093225 C A 1178.77 upstream_gene_variant MODIFIER c.-12147C>A 0.2925 0.4250 0.1591 0.0909 0.2424 0.5000 6 86093330 G C 1032.77 3_prime_UTR_variant MODIFIER c.*91G>C 0.9811 1.0000 0.9545 1.0000 0.9697 1.0000 6 86093348 T C 482.77 3_prime_UTR_variant MODIFIER c.*109T>C 0.1274 0.1500 0.0227 0.5000 0.0758 0.1000 6 86093378 G C 521.77 3_prime_UTR_variant MODIFIER c.*139G>C 0.1462 0.1500 0.0682 0.5000 0.1061 0.1000 6 86093399 C T 711.77 3_prime_UTR_variant MODIFIER c.*160C>T 0.2783 0.4750 0.1364 0.8636 0.1515 0.1250 6 86093465 T C 85.77 3_prime_UTR_variant MODIFIER c.*226T>C 0.0047 - 0.0227 - - - 6 86078000 T TC 730.75 intron_variant MODIFIER c.-13+1076_-12-1075insC 0.3208 0.2250 0.5000 0.3182 0.1667 0.4750 6 86078390 ATCT A 673.73 intron_variant MODIFIER c.-12-685_-12-683delTCT 0.1274 0.2750 0.0682 0.4091 0.0303 0.0500 6 86078422 A ATT 720.73 intron_variant MODIFIER c.-12-654_-12-653insTT 0.0236 - 0.0682 - - 0.0500 6 86078654 T TA 605.73 intron_variant MODIFIER c.-12-422_-12-421insA 0.8821 0.9750 0.8409 0.9545 0.8485 0.8500 6 86078661 A AT 341.73 intron_variant MODIFIER c.-12-415_-12-414insT 0.0142 0.0250 - - - 0.0500 6 86078883 ATGTTG A 851.73 intron_variant MODIFIER c.-12-192_-12-188delTGTTG 0.3066 0.2250 0.4318 0.3182 0.1667 0.4750 6 86078914 CGTT C 627.73 intron_variant MODIFIER c.-12-161_-12-159delGTT 0.0236 - 0.0682 - - 0.0500 6 86078941 AATGAATCTACTTTTA 112.73 intron_variant MODIFIER c.-12-134_-12-121delATGAATCTACTTTT 0.0047 - 0.0227 - - - 6 86080908 AT A 13.91 intron_variant MODIFIER c.52-48delT 0.0047 - - - 0.0152 - 6 86080975 TCCAGTGA T 28.74 frameshift_variant HIGH c.71_77delCCAGTGA 0.0047 - - - 0.0152 - 6 TAAGATACTCTTAGGATCAACA 86080985 T 25.74 splice_region_variant LOW c.78+3_78+23delAAGATACTCTTAGGATCAACA 0.0047 - - - 0.0152 - 6 86080993 TC T 310.75 intron_variant MODIFIER c.78+11delC 0.0566 - 0.2727 - - - 6 86081053 TC T 31.73 intron_variant MODIFIER c.78+71delC 0.0047 - - - 0.0152 - 6 86081060 A AG 28.74 intron_variant MODIFIER c.78+77_78+78insG 0.0047 - - - 0.0152 - 6 86081065 TTTTTCACC T 28.74 intron_variant MODIFIER c.78+83_78+90delTTTTCACC 0.0047 - - - 0.0152 - 6 86081076 TGAGCCTAGAACTATAGAA T 31.73 intron_variant MODIFIER c.78+94_78+111delGAGCCTAGAACTATAGAA 0.0047 - - - 0.0152 - 6 86081098GAGAAAATT G 37.73 intron_variant MODIFIER c.78+116_78+123delAGAAAATT 0.0047 - - - 0.0152 - 6 86081473 G GA,GAA 334.73 intron_variant MODIFIER c.79-301_79-300insA 0.1509 0.0500 0.3182 0.1818 0.1061 0.1250 6 86081842 CTTTA C 367.74 intron_variant MODIFIER c.103-43_103-40delTTTA 0.0566 0.0250 0.2273 - - 0.0250 6 86085171 C CA 153.73 frameshift_variant HIGH c.388dupA 0.0047 - - - - 0.0250 6 86085209 G GTTT,GTT,GT 258.73 intron_variant MODIFIER c.393+32_393+33insT 0.0236 0.0250 0.0455 0.0455 0.0152 - 6 86085210 T TTG 113.73 intron_variant MODIFIER c.393+33_393+34insTG 0.0047 - - - 0.0152 - 6 86085212 TA T 46.73 intron_variant MODIFIER c.393+36delA 0.0047 - 0.0227 - - - 6 86085213 AT A 706.73 intron_variant MODIFIER c.393+37delT 0.4292 0.3250 0.5000 0.4545 0.4242 0.4500 6 86085223 TC T 37.73 intron_variant MODIFIER c.393+47delC 0.0047 - 0.0227 - - - 6 86085227 TCTG T 163.73 intron_variant MODIFIER c.393+51_393+53delCTG 0.0236 0.0750 - 0.0909 - - 6 86085531 C CA 35.73 intron_variant MODIFIER c.394-177_394-176insA 0.0047 - - - - 0.0250 6 86085679 CTTTTTTTT C,CTTTTTTT 70.73 intron_variant MODIFIER c.394-28_394-21delTTTTTTTT 0.0142 0.0250 - - - 0.0500 6 86086829 AAT A 720.73 intron_variant MODIFIER c.447+97_447+98delAT 0.3443 0.1000 0.6136 0.0455 0.4242 0.3250 INDEL 6 86086982 CT C 450.73 intron_variant MODIFIER c.447+250delT 0.3208 0.1000 0.6818 0.0455 0.3485 0.2500 6 86087843 AAC A 264.73 intron_variant MODIFIER c.448-589_448-588delAC 0.0094 - - - 0.0303 - 6 86088414 CTT C,CT,CTTT 498.73 intron_variant MODIFIER c.448-18_448-17delTT 0.3632 0.2000 0.3864 0.5455 0.3485 0.4250 6 86088598 T TA 28.74 intron_variant MODIFIER c.516+8_516+9insA 0.0047 - - - 0.0152 - 6 86089298 CTGTT C 112.73 upstream_gene_variant MODIFIER c.-16073_-16070delTGTT 0.0094 - - - - 0.0500 6 86089579 AG A 182.73 upstream_gene_variant MODIFIER c.-15792delG 0.0094 - - - - 0.0500 6 86089875 T TA 675.73 upstream_gene_variant MODIFIER c.-15497_-15496insA 0.2689 0.4250 0.1136 0.0909 0.2121 0.4750 6 86089925 ATGTT A 682.73 upstream_gene_variant MODIFIER c.-15446_-15443delTGTT 0.1132 0.1500 0.0227 0.4091 0.0606 0.1000 6 86089933 TG T 787.73 upstream_gene_variant MODIFIER c.-15438delG 0.2217 0.4500 0.0909 0.4545 0.1061 0.2000 6 86089934 GGTTTT G,GT,GTTGTTTT,GTGTTTT 682.73 upstream_gene_variant MODIFIER c.-15438_-15437insT 0.1698 0.1750 0.2500 0.4091 0.0758 0.1000 6 86089935 GTTTTT G 140.73 upstream_gene_variant MODIFIER c.-15436_-15432delTTTTT 0.0047 - - - - 0.0250 6 86089939 T TTG 342.73 upstream_gene_variant MODIFIER c.-15433_-15432insTG 0.1226 0.0750 0.2727 - 0.0909 0.1250 6 86089949TGGAAATGTA TGAAATGTA,T 72.73 upstream_gene_variant MODIFIER c.-15422_-15414delGGAAATGTA 0.0142 - - - 0.0303 0.0250 6 86090203 A AT 584.73 upstream_gene_variant MODIFIER c.-15169_-15168insT 0.1179 0.1500 0.0227 0.5000 0.0455 0.1000 6 86090586 AC A 326.74 upstream_gene_variant MODIFIER c.-14785delC 0.0189 0.0250 0.0455 - - 0.0250 6 86090836 T TAA 197.73 upstream_gene_variant MODIFIER c.-14536_-14535insAA 0.0047 - 0.0227 - - - 6 86090894 G GGGAGA 28.74 upstream_gene_variant MODIFIER c.-14478_-14477insGGAGA 0.0047 0.0250 - - - - 6 86090895GGAGAGGGAGAGGGTGGGATGATT G 34.73 upstream_gene_variant MODIFIER c.-14477_-14476insGAGAGGGAGAGGGTGGGATGATT 0.0047 0.0250 - - - - 6 86091013 TTGACA T 149.73 upstream_gene_variant MODIFIER c.-14358_-14354delTGACA 0.0330 - 0.0455 - 0.0758 - 6 86091017CATTTTATTTT C,CTTTTATTTT270.73 upstream_gene_variant MODIFIER c.-14354delA 0.0283 - - 0.0455 - 0.1250 6 86091019TTTTATTTTA T 270.73 upstream_gene_variant MODIFIER c.-14352_-14344delTTTATTTTA 0.0142 0.0250 - - - 0.0500 6 86091020 TTTATTTTA T 98.25 upstream_gene_variant MODIFIER c.-14351_-14344delTTATTTTA 0.0094 - - - 0.0303 - 6 86091022 TATTTTA T 1185.73 upstream_gene_variant MODIFIER c.-14349_-14344delATTTTA 0.4858 0.5000 0.8182 0.0909 0.2727 0.6750 ATTTTATTTTTTTTTAAATTTTTTATTTTTTTTTAAATTTT 6 86091023 A 867.73 upstream_gene_variant MODIFIER c.-14348_-14309delTTTTATTTTTTTTTAAATTTTTTATTTTTTTTTAAATTTT 0.1226 0.1250 0.0227 0.5000 0.0758 0.1000 6 86091027 TA T 187.87 upstream_gene_variant MODIFIER c.-14344delA 0.0377 - 0.0455 - 0.0909 - 6 86091034 TTTTA T 704.73 upstream_gene_variant MODIFIER c.-14337_-14334delTTTA 0.3113 0.2000 0.7273 0.0909 0.1061 0.4250 6 86091035 TTTA T 1130.73 upstream_gene_variant MODIFIER c.-14336_-14334delTTA 0.1745 0.3000 0.1136 - 0.1818 0.2000 6 86091068 TCTTTAATTCTTACAT 997.73 upstream_gene_variant MODIFIER c.-14303_-14290delCTTTAATTCTTACA 0.1179 0.1250 0.0227 0.5000 0.0606 0.1000 6 86091088 TCCCA T 1000.73 upstream_gene_variant MODIFIER c.-14283_-14280delCCCA 0.1179 0.1250 0.0227 0.5000 0.0606 0.1000 6 86091655 GA G 563.73 upstream_gene_variant MODIFIER c.-13716delA 0.5330 0.2500 0.8409 0.5455 0.5909 0.3750 Supplementary Table S2. Polymorphisms (SNPs in black, INDEL in red) detected in the goat casein genes (CSN3) Chromosome Position Ref allele Alt_allele QUAL Variant_type Effect Nucleotide substitution AA substitution subst. literature Alt_freq SIFT_score SIFT_median SIFT_prediction AF BE EU FE NE 6 86197357 G C 274.77 intron_variant MODIFIER c.-6+47G>C 0.0047 0.0250 - - - - 6 86197402 C A 208.78 intron_variant MODIFIER c.-6+92C>A 0.0047 - 0.0227 - - - 6 86197531 T G 660.28 intron_variant MODIFIER c.-6+221T>G 0.5519 0.5500 0.5909 0.3636 0.5455 0.6250 6 86197697 C T 313.77 intron_variant MODIFIER c.-6+387C>T 0.0094 - 0.0455 - - - 6 86197703 T C 944.77 intron_variant MODIFIER c.-6+393T>C 0.1604 0.4500 - - 0.0758 0.2750 6 86197766 A G 624.77 intron_variant MODIFIER c.-6+456A>G 0.0330 - 0.0227 0.2727 - - 6 86197775 T C 851.77 intron_variant MODIFIER c.-6+465T>C 0.0094 0.0500 - - - - 6 86197776 C T 750.77 intron_variant MODIFIER c.-6+466C>T 0.1840 0.0750 0.2727 0.3182 0.1061 0.2500 6 86197903 G T 590.77 intron_variant MODIFIER c.-6+593G>T 0.0236 - - 0.2273 - - 6 86197933 G A 678.77 intron_variant MODIFIER c.-6+623G>A 0.0330 - 0.0227 0.2727 - - 6 86198001 T C 657.77 intron_variant MODIFIER c.-6+691T>C 0.2170 0.0750 0.2955 0.3182 0.1818 0.2750 6 86198097 A G 1193.77 intron_variant MODIFIER c.-6+787A>G 0.0943 0.4000 - - 0.0303 0.0500 6 86198114 A G 1039.77 intron_variant MODIFIER c.-6+804A>G 0.0377 - 0.0455 0.2727 - - 6 86198175 T C 260.77 intron_variant MODIFIER c.-6+865T>C 0.0283 - 0.1364 - - - 6 86198178 A G 709.77 intron_variant MODIFIER c.-6+868A>G 0.1226 0.0500 0.2273 - 0.0758 0.2250 6 86198192 T C 125.77 intron_variant MODIFIER c.-6+882T>C 0.0047 - 0.0227 - - - 6 86198214 A G 152.77 intron_variant MODIFIER c.-6+904A>G 0.0283 - 0.1364 - - - 6 86198239 A G 266.77 intron_variant MODIFIER c.-6+929A>G 0.0047 - - - - 0.0250 6 86198253 C T 88.77 intron_variant MODIFIER c.-6+943C>T 0.0047 - 0.0227 - - - 6 86198254 A G 88.77 intron_variant MODIFIER c.-6+944A>G 0.0047 - 0.0227 - - - 6 86198298 A G 989.77 intron_variant MODIFIER c.-6+988A>G 0.7972 0.6000 0.8409 0.6818 0.8636 0.9000 6 86198325 A G 745.03 intron_variant MODIFIER c.-6+1015A>G 0.1509 0.0250 - - 0.3030 0.2750 6 86198344 G A 313.77 intron_variant MODIFIER c.-6+1034G>A 0.0094 - 0.0455 - - - 6 86198436 G A 159.77 intron_variant MODIFIER c.-6+1126G>A 0.0283 - 0.1364 - - - 6 86198500 C T 586.77 intron_variant MODIFIER c.-6+1190C>T 0.2028 0.0750 0.2727 0.3182 0.1515 0.2750 6 86198520 C A 241.77 intron_variant MODIFIER c.-6+1210C>A 0.0047 - - - - 0.0250 6 86198530 C T 574.77 intron_variant MODIFIER c.-5-1214C>T 0.2453 0.0750 0.2955 0.5909 0.1818 0.2750 6 86198606 A G 629.77 intron_variant MODIFIER c.-5-1138A>G 0.2217 0.0750 0.2955 0.5909 0.1061 0.2750 6 86198725 C T 61.77 intron_variant MODIFIER c.-5-1019C>T 0.0047 - 0.0227 - - - 6 86198726 G C 949.77 intron_variant MODIFIER c.-5-1018G>C 0.7547 0.6250 0.8864 0.6818 0.6818 0.9000 6 86198899 G A 635.77 intron_variant MODIFIER c.-5-845G>A 0.2358 0.0750 0.2955 0.5909 0.1515 0.2750 6 86198906 T C 221.77 intron_variant MODIFIER c.-5-838T>C 0.0047 - 0.0227 - - - 6 86198964 C A 568.77 intron_variant MODIFIER c.-5-780C>A 0.0236 - - - - 0.1250 6 86199016 T C 387.77 intron_variant MODIFIER c.-5-728T>C 0.0755 - 0.0682 - 0.1970 - 6 86199111 G A 238.77 intron_variant MODIFIER c.-5-633G>A 0.0142 - 0.0682 - - - 6 86199195 T C 1052.77 intron_variant MODIFIER c.-5-549T>C 0.2358 0.0750 0.3182 0.5909 0.1364 0.2750 6 86199227 G A 573.77 intron_variant MODIFIER c.-5-517G>A 0.0613 0.0250 0.0455 0.3182 0.0152 0.0500 6 86199247 G A 293.77 intron_variant MODIFIER c.-5-497G>A 0.0047 - - - - 0.0250 6 86199257 A G 35.77 intron_variant MODIFIER c.-5-487A>G 0.0047 - - - 0.0152 - 6 86199315 T C 160.77 intron_variant MODIFIER c.-5-429T>C 0.0047 - 0.0227 - - - 6 86199401 G A 846.77 intron_variant MODIFIER c.-5-343G>A 0.0943 0.4000 - - 0.0303 0.0500 6 86199471 G A 527.77 intron_variant MODIFIER c.-5-273G>A 0.0283 - 0.0227 0.2273 - - 6 86199526 T C 883.77 intron_variant MODIFIER c.-5-218T>C 0.1179 0.3750 - 0.3182 0.0152 0.0500 6 86199543 A G 199.77 intron_variant MODIFIER c.-5-201A>G 0.0047 - 0.0227 - - - 6 86199548 A G 199.77 intron_variant MODIFIER c.-5-196A>G 0.0047 - 0.0227 - - - 6 86199577 C T 1017.77 intron_variant MODIFIER c.-5-167C>T 0.0377 - 0.1818 - - - 6 86199578 G A 345.78 intron_variant MODIFIER c.-5-166G>A 0.0330 - 0.1591 - - - 6 86199773 G A 58.77 missense_variant MODERATE c.25G>A p.Val9Met 0.0047 0.07 2.7 TOLERATED - 0.0227 - - - 6 86199914 A G 757.77 intron_variant MODIFIER c.57+109A>G 0.1745 0.0750 0.2955 0.3182 0.0455 0.2750 6 86200043 T G 460.77 intron_variant MODIFIER c.57+238T>G 0.0283 - - 0.2727 - - 6 86200086 A T 357.77 intron_variant MODIFIER c.57+281A>T 0.0566 0.0250 0.0682 0.2273 0.0152 0.0500 6 86200140 C T 298.77 intron_variant MODIFIER c.57+335C>T 0.0377 - - 0.0455 0.0455 0.1000 6 86200141 G A 322.78 intron_variant MODIFIER c.57+336G>A 0.0330 - 0.1591 - - - 6 86200156 T C 562.77 intron_variant MODIFIER c.57+351T>C 0.0472 - 0.1818 - 0.0303 - 6 86200169 C A 573.77 intron_variant MODIFIER c.57+364C>A 0.1698 0.0750 0.2955 0.3182 0.0303 0.2750 6 86200190 T C 601.77 intron_variant MODIFIER c.57+385T>C 0.0377 - 0.1818 - - - 6 86200192 A G 646.77 intron_variant MODIFIER c.57+387A>G 0.0377 - 0.1818 - - - 6 86200199 G T 30.77 intron_variant MODIFIER c.57+394G>T 0.0047 - - 0.0455 - - 6 86200202 C A 767.77 intron_variant MODIFIER c.57+397C>A 0.0896 0.0500 0.1818 - 0.0152 0.2000 6 86200203 T C 767.77 intron_variant MODIFIER c.57+398T>C 0.0896 0.0500 0.1818 - 0.0152 0.2000 6 86200217 A G 612.77 intron_variant MODIFIER c.57+412A>G 0.0283 - - 0.2727 - - 6 86200239 T C 196.77 intron_variant MODIFIER c.57+434T>C 0.0142 - - - - 0.0750 6 86200242 T A 789.77 intron_variant MODIFIER c.57+437T>A 0.2028 0.0750 0.3182 0.5909 0.0303 0.2750 6 86200313 C T 699.77 intron_variant MODIFIER c.57+508C>T 0.2500 0.1000 0.4318 0.3182 0.1515 0.3250 6 86200373 C G 306.77 intron_variant MODIFIER c.57+568C>G 0.0660 - 0.0682 - 0.1667 - 6 86200420 T A 258.8 intron_variant MODIFIER c.57+615T>A 0.0094 - 0.0455 - - - 6 86200441 T C 902.77 intron_variant MODIFIER c.57+636T>C 0.3255 0.1000 0.4318 0.3182 0.3788 0.3500 6 86200590 G A 538.77 intron_variant MODIFIER c.57+785G>A 0.0283 - - 0.2727 - - 6 86200700 C T 281.77 intron_variant MODIFIER c.57+895C>T 0.0047 - - - - 0.0250 6 86200725 T C 422.77 intron_variant MODIFIER c.57+920T>C 0.1415 0.0750 0.0909 0.2727 0.0909 0.2750 6 86200781 A T 255.77 intron_variant MODIFIER c.57+976A>T 0.0236 0.0500 - - - 0.0750 6 86200839 C T 1009.77 intron_variant MODIFIER c.57+1034C>T 0.0377 - 0.1818 - - - 6 86200921 T C 618.77 intron_variant MODIFIER c.57+1116T>C 0.1415 0.0500 - - 0.2727 0.2500 6 86200971 A G 647.77 intron_variant MODIFIER c.57+1166A>G 0.1698 0.4500 0.0227 - 0.0909 0.2750 6 86201166 A G 191.77 intron_variant MODIFIER c.57+1361A>G 0.0330 - 0.1591 - - - 6 86201245 C T 839.77 intron_variant MODIFIER c.57+1440C>T 0.1604 0.4500 - - 0.0758 0.2750 6 86201279 A G 429.77 intron_variant MODIFIER c.57+1474A>G 0.0236 0.0500 - - - 0.0750 6 86201298 G A 1004.77 intron_variant MODIFIER c.57+1493G>A 0.0094 0.0500 - - - - 6 86201317 A G 201.77 intron_variant MODIFIER c.57+1512A>G 0.0283 - - 0.2727 - - 6 86201340 A G 853.77 intron_variant MODIFIER c.57+1535A>G 0.8019 0.6250 0.8864 0.6818 0.8333 0.9000 6 86201393 A C 234.77 intron_variant MODIFIER c.57+1588A>C 0.0047 - 0.0227 - - - 6 86201434 G A 583.77 intron_variant MODIFIER c.57+1629G>A 0.0330 - 0.1591 - - - 6 86201469 C A 511.77 intron_variant MODIFIER c.57+1664C>A 0.0283 - - 0.2727 - - 6 86201470 G A 881.77 intron_variant MODIFIER c.57+1665G>A 0.4528 0.5000 0.6364 0.3182 0.4091 0.3500 6 86201532 G T 835.77 intron_variant MODIFIER c.57+1727G>T 0.3019 0.1250 0.2727 0.3182 0.2727 0.5500 6 86201554 A C 880.77 intron_variant MODIFIER c.57+1749A>C 0.7877 0.6000 0.9318 0.6364 0.7879 0.9000 6 86201589 T G 378.77 intron_variant MODIFIER c.57+1784T>G 0.0047 0.0250 - - - - 6 86201710 C T 475.77 intron_variant MODIFIER c.57+1905C>T 0.0047 - - - - 0.0250 6 86201775 T C 361.77 intron_variant MODIFIER c.57+1970T>C 0.0896 0.0250 0.1136 - 0.1515 0.0750 6 86201829 G A 430.77 intron_variant MODIFIER c.57+2024G>A 0.0330 - 0.0227 0.2727 - - 6 86201843 T C,A 948.77 intron_variant MODIFIER c.57+2038T>A 0.8113 0.6250 0.8182 0.6818 0.9091 0.9000 6 86201870 C T 564.77 intron_variant MODIFIER c.57+2065C>T 0.0047 - 0.0227 - - - 6 86202017 C T 360.77 intron_variant MODIFIER c.57+2212C>T 0.0236 0.0250 0.0227 0.1364 - - 6 86202049 G C 475.77 intron_variant MODIFIER c.57+2244G>C 0.0330 - 0.1591 - - - 6 86202103 G T 539.77 intron_variant MODIFIER c.57+2298G>T 0.2406 0.0500 0.2273 0.6364 0.3030 0.1250 6 86202104 G T 539.77 intron_variant MODIFIER c.57+2299G>T 0.2406 0.0500 0.2273 0.6364 0.3030 0.1250 6 86202115 C T 740.77 intron_variant MODIFIER c.57+2310C>T 0.2453 0.1000 0.1818 - 0.3030 0.5000 6 86202210 C T 172.77 intron_variant MODIFIER c.57+2405C>T 0.0047 - 0.0227 - - - 6 86202369 T A 265.77 intron_variant MODIFIER c.57+2564T>A 0.0047 - 0.0227 - - - 6 86202401 C A 493.77 intron_variant MODIFIER c.57+2596C>A 0.0283 - - 0.2727 - - 6 86202439 C A 67.77 intron_variant MODIFIER c.57+2634C>A 0.0047 - 0.0227 - - - 6 86202473 C G 626.77 intron_variant MODIFIER c.57+2668C>G 0.2170 0.1000 0.2045 - 0.2121 0.4750 6 86202519 C T 158.77 intron_variant MODIFIER c.57+2714C>T 0.0047 - 0.0227 - - - 6 86202532 C A 670.77 intron_variant MODIFIER c.57+2727C>A 0.2264 0.1000 0.1818 - 0.2424 0.5000 6 86202547 A G 861.77 intron_variant MODIFIER c.57+2742A>G 0.8066 0.6250 0.9318 0.6818 0.8333 0.8750 6 86202557 T A 316.77 intron_variant MODIFIER c.57+2752T>A 0.0142 0.0250 - 0.0909 - - 6 86202654 C T 892.77 intron_variant MODIFIER c.57+2849C>T 0.2123 0.0500 0.2045 - 0.2576 0.4250 6 86202749 G A 1027.77 intron_variant MODIFIER c.57+2944G>A 0.3632 0.4750 0.2045 0.3636 0.2879 0.5500 6 86202766 A G 325.77 intron_variant MODIFIER c.57+2961A>G 0.0236 0.0500 - - - 0.0750 6 86202774 T A,C 668.77 intron_variant MODIFIER c.57+2969T>A 0.3538 0.1250 0.3182 - 0.5000 0.5750 6 86202785 A C 151.03 intron_variant MODIFIER c.57+2980A>C 0.0189 - - - 0.0606 - 6 86202816 T A 431.77 intron_variant MODIFIER c.57+3011T>A 0.0142 0.0250 - 0.0909 - - 6 86202819 C T 826.77 intron_variant MODIFIER c.57+3014C>T 0.4953 0.1500 0.4318 0.5909 0.6515 0.6000 6 86202834 T G 859.77 intron_variant MODIFIER c.57+3029T>G 0.2547 0.0750 0.2045 - 0.3333 0.5000 6 86202839 A G 323.77 intron_variant MODIFIER c.57+3034A>G 0.1038 0.0250 0.0682 - 0.2424 0.0500 6 86202890 A C 941.77 intron_variant MODIFIER c.57+3085A>C 0.3113 0.4750 0.5000 0.0909 0.1818 0.2750 6 86202910 T G 249.77 intron_variant MODIFIER c.57+3105T>G 0.0047 - - - - 0.0250 6 86202932 A C 430.77 intron_variant MODIFIER c.57+3127A>C 0.0283 - - 0.2727 - - 6 86202947 G A 315.77 intron_variant MODIFIER c.57+3142G>A 0.0094 - 0.0227 - - 0.0250 6 86202971 C T 912.77 intron_variant MODIFIER c.57+3166C>T 0.1179 0.3750 - 0.3182 0.0152 0.0500 6 86203026 T C 849.77 intron_variant MODIFIER c.57+3221T>C 0.2358 0.0750 0.1818 - 0.3182 0.4500 6 86203045 C T 699.77 intron_variant MODIFIER c.57+3240C>T 0.2406 0.0750 0.2045 - 0.3182 0.4500 6 86203194 T A 124.77 intron_variant MODIFIER c.57+3389T>A 0.0047 - 0.0227 - - - 6 86203231 T A 418.77 intron_variant MODIFIER c.57+3426T>A 0.0377 - 0.1818 - - - 6 86203242 A G 781.77 intron_variant MODIFIER c.57+3437A>G 0.4623 0.1000 0.4318 0.5455 0.6212 0.5500 6 86203257 G A 36.77 intron_variant MODIFIER c.57+3452G>A 0.0047 - - 0.0455 - - 6 86203336 A G 691.77 intron_variant MODIFIER c.58-3423A>G 0.0283 - - 0.2727 - - 6 86203518 G A 278.77 intron_variant MODIFIER c.58-3241G>A 0.0047 - 0.0227 - - - 6 86203557 T C 166.77 intron_variant MODIFIER c.58-3202T>C 0.0142 - 0.0682 - - - 6 86203558 G T 166.77 intron_variant MODIFIER c.58-3201G>T 0.0142 - 0.0682 - - - 6 86203575 A C 184.84 intron_variant MODIFIER c.58-3184A>C 0.0142 - 0.0682 - - - 6 86203584 A G 181.77 intron_variant MODIFIER c.58-3175A>G 0.0189 - - - 0.0606 - 6 86203623 A C 749.77 intron_variant MODIFIER c.58-3136A>C 0.2311 0.0750 0.2045 - 0.2576 0.5000 6 86203734 T C 449.77 intron_variant MODIFIER c.58-3025T>C 0.0236 0.0250 - 0.1818 - - 6 86203810 A T 701.77 intron_variant MODIFIER c.58-2949A>T 0.0236 - - 0.2273 - - 6 86203868 A C 279.77 intron_variant MODIFIER c.58-2891A>C 0.0047 0.0250 - - - - 6 86203931 C G 41.77 intron_variant MODIFIER c.58-2828C>G 0.0047 - - - 0.0152 - 6 86203933 T C 682.77 intron_variant MODIFIER c.58-2826T>C 0.1745 0.0500 0.1818 0.2727 0.2424 0.1250 6 86203934 C T 781.77 intron_variant MODIFIER c.58-2825C>T 0.2594 0.1000 0.1818 - 0.3485 0.5000 6 86203953 A T 691.77 intron_variant MODIFIER c.58-2806A>T 0.0283 - - 0.2727 - - SNP 6 86203961 C T 691.77 intron_variant MODIFIER c.58-2798C>T 0.2217 0.0500 0.2045 0.5455 0.2879 0.1250 6 86204053 C T 693.77 intron_variant MODIFIER c.58-2706C>T 0.2358 0.1000 0.2045 - 0.2576 0.5000 6 86204125 T A 442.77 intron_variant MODIFIER c.58-2634T>A 0.0330 - - 0.3182 - - 6 86204129 A T 107.28 intron_variant MODIFIER c.58-2630A>T 0.0330 0.0250 0.0455 - 0.0303 0.0500 6 86204131 T C 107.28 intron_variant MODIFIER c.58-2628T>C 0.0189 - 0.0455 - 0.0303 - 6 86204137 C G 62.74 intron_variant MODIFIER c.58-2622C>G 0.0283 0.0250 0.0455 - 0.0303 0.0250 6 86204138 T G 62.74 intron_variant MODIFIER c.58-2621T>G 0.0283 0.0250 0.0455 - 0.0303 0.0250 6 86204142 T A 266.77 intron_variant MODIFIER c.58-2617T>A 0.0047 - 0.0227 - - - 6 86204257 T C 247.77 intron_variant MODIFIER c.58-2502T>C 0.0142 - 0.0682 - - - 6 86204339 C T 183.1 intron_variant MODIFIER c.58-2420C>T 0.1321 0.0500 0.2045 0.4545 - 0.1750 6 86204380 G A 197.84 intron_variant MODIFIER c.58-2379G>A 0.1840 0.3500 0.1818 - 0.0303 0.3750 6 86204408 G A 263.78 intron_variant MODIFIER c.58-2351G>A 0.3538 0.4500 0.6136 0.2727 0.0909 0.4500 6 86204433 C T 84.77 intron_variant MODIFIER c.58-2326C>T 0.0047 0.0250 - - - - 6 86204739 C T 319.78 intron_variant MODIFIER c.58-2020C>T 0.0425 - 0.2045 - - - 6 86204909 G T 218.84 intron_variant MODIFIER c.58-1850G>T 0.3208 0.8250 0.2273 0.1818 0.1515 0.2750 6 86205444 T G 57.74 intron_variant MODIFIER c.58-1315T>G 0.0094 - 0.0455 - - - 6 86205468 C T 12.05 intron_variant MODIFIER c.58-1291C>T 0.0047 0.0250 - - - - 6 86205537 G C 13.95 intron_variant MODIFIER c.58-1222G>C 0.0047 0.0250 - - - - 6 86205592 C T 49.77 intron_variant MODIFIER c.58-1167C>T 0.0047 - - - 0.0152 - 6 86205593 G A 145.9 intron_variant MODIFIER c.58-1166G>A 0.0425 0.0500 0.0682 0.0909 - 0.0500 6 86205602 T C 52.74 intron_variant MODIFIER c.58-1157T>C 0.0142 - 0.0682 - - - 6 86205621 A C 53.9 intron_variant MODIFIER c.58-1138A>C 0.0047 - - - 0.0152 - 6 86205628 T C 196.9 intron_variant MODIFIER c.58-1131T>C 0.0236 - - 0.2273 - - 6 86205629 G A 196.9 intron_variant MODIFIER c.58-1130G>A 0.0236 - - 0.2273 - - 6 86205641 C T 47.88 intron_variant MODIFIER c.58-1118C>T 0.0047 - 0.0227 - - - 6 86205657 A G 134.77 intron_variant MODIFIER c.58-1102A>G 0.0094 - 0.0227 - 0.0152 - 6 86205745 A T 44.77 intron_variant MODIFIER c.58-1014A>T 0.0047 - 0.0227 - - - 6 86205753 T C 390.77 intron_variant MODIFIER c.58-1006T>C 0.0519 0.0250 0.0455 0.2727 - 0.0500 6 86205782 C T 248.8 intron_variant MODIFIER c.58-977C>T 0.0283 - - 0.2727 - - 6 86206019 C T,G 200.8 intron_variant MODIFIER c.58-740C>G 0.1698 0.3500 0.2500 - 0.0303 0.2250 6 86206112 A G 27.78 intron_variant MODIFIER c.58-647A>G 0.0047 - 0.0227 - - - 6 86206133 T G 91.03 intron_variant MODIFIER c.58-626T>G 0.0189 - 0.0455 - - 0.0500 6 86206183 T C 49.74 intron_variant MODIFIER c.58-576T>C 0.0094 - - - - 0.0500 6 86206218 C T 50.74 intron_variant MODIFIER c.58-541C>T 0.0094 - - - - 0.0500 6 86206269 G A 321.78 intron_variant MODIFIER c.58-490G>A 0.3774 0.9000 0.3182 0.4545 0.1212 0.3000 6 86206299 G A 115.9 intron_variant MODIFIER c.58-460G>A 0.0708 0.0500 0.1364 0.2273 0.0303 - 6 86206413 A G 442.77 intron_variant MODIFIER c.58-346A>G 0.1745 0.4250 - - 0.0909 0.3500 6 86206557 G A 275.77 intron_variant MODIFIER c.58-202G>A 0.0047 - 0.0227 - - - 6 86206570 C T 333.03 intron_variant MODIFIER c.58-189C>T 0.0236 0.0500 - - - 0.0750 6 86206606 G C 142.77 intron_variant MODIFIER c.58-153G>C 0.0047 - 0.0227 - - - 6 86206632 A G 849.77 intron_variant MODIFIER c.58-127A>G 0.1557 0.0500 0.2045 0.3182 0.1667 0.1000 6 86206637 A T 310.77 intron_variant MODIFIER c.58-122A>T 0.0094 - 0.0227 - - 0.0250 6 86206785 A G 1020.77 synonymous_variant LOW c.84A>G p.Gln28Gln 0.3066 0.4750 0.4545 0.0909 0.1970 0.2750 6 86206804 C T 1007.77 intron_variant MODIFIER c.90+13C>T 0.2500 0.4750 0.2727 0.0455 0.1515 0.2750 6 86206829 T C 425.77 intron_variant MODIFIER c.90+38T>C 0.0047 - 0.0227 - - - 6 86206836 C T 811.77 intron_variant MODIFIER c.90+45C>T 0.1226 0.3750 - 0.3182 0.0303 0.0500 6 86206854 G T 894.77 intron_variant MODIFIER c.90+63G>T 0.4575 0.1500 0.4091 0.5909 0.5303 0.6250 6 86206912 T A 167.77 intron_variant MODIFIER c.90+121T>A 0.0047 0.0250 - - - - 6 86206915 T C 391.77 intron_variant MODIFIER c.90+124T>C 0.0236 0.0500 - - - 0.0750 6 86206948 G A 767.9 intron_variant MODIFIER c.90+157G>A 0.2500 0.1000 0.1818 - 0.3182 0.5000 6 86206984 G A 746.77 intron_variant MODIFIER c.90+193G>A 0.2500 0.1000 0.2045 - 0.3030 0.5000 6 86207029 G A 764.77 intron_variant MODIFIER c.90+238G>A 0.2358 0.0500 0.2045 - 0.3333 0.4250 6 86207133 C T 123.77 intron_variant MODIFIER c.90+342C>T 0.0047 0.0250 - - - - 6 86207177 A G 53.74 intron_variant MODIFIER c.90+386A>G 0.0094 - 0.0455 - - - 6 86207335 G T 556.77 intron_variant MODIFIER c.90+544G>T 0.0849 0.0500 - - 0.0303 0.3500 6 86207344 G A 601.77 intron_variant MODIFIER c.90+553G>A 0.3396 0.1500 0.5909 0.5909 0.0909 0.5250 6 86207355 T C 11.12 intron_variant MODIFIER c.90+564T>C 0.0047 - 0.0227 - - - 6 86207376 T A 769.77 intron_variant MODIFIER c.90+585T>A 0.5708 0.6250 0.8864 0.6818 0.1212 0.8500 6 86207426 T C 232.77 intron_variant MODIFIER c.90+635T>C 0.0236 0.0500 - - - 0.0750 6 86207440 A C 742.77 intron_variant MODIFIER c.90+649A>C 0.5189 0.6000 0.8864 0.3636 0.0606 0.8750 6 86207488 A G 112.77 intron_variant MODIFIER c.90+697A>G 0.0047 0.0250 - - - - 6 86207502 A G 401.28 intron_variant MODIFIER c.90+711A>G 0.1226 0.0750 0.1136 - 0.0152 0.4250 6 86207524 A C 378.77 intron_variant MODIFIER c.90+733A>C 0.0283 0.0500 - - - 0.1000 6 86207577 G A 452.77 intron_variant MODIFIER c.90+786G>A 0.1462 0.1000 0.1818 - - 0.4750 6 86207588 T C 165.77 intron_variant MODIFIER c.90+797T>C 0.0047 - 0.0227 - - - 6 86207619 C T 68.77 intron_variant MODIFIER c.90+828C>T 0.0047 0.0250 - - - - 6 86207639 A G 543.77 intron_variant MODIFIER c.90+848A>G 0.2547 0.1500 0.3864 0.2727 0.0455 0.5500 6 86207698 A T 164.77 intron_variant MODIFIER c.90+907A>T 0.0094 - 0.0227 - - 0.0250 6 86207759 G A 50.77 intron_variant MODIFIER c.90+968G>A 0.0047 - 0.0227 - - - 6 86207828 C T 28.77 intron_variant MODIFIER c.91-1029C>T 0.0047 - 0.0227 - - - 6 86207832 A G 180.77 intron_variant MODIFIER c.91-1025A>G 0.0047 - 0.0227 - - - 6 86207856 C T 80.77 intron_variant MODIFIER c.91-1001C>T 0.0047 - 0.0227 - - - 6 86207858 G A 101.77 intron_variant MODIFIER c.91-999G>A 0.0047 - 0.0227 - - - 6 86207875 G T 339.77 intron_variant MODIFIER c.91-982G>T 0.0047 - 0.0227 - - - 6 86207913 A C 51.74 intron_variant MODIFIER c.91-944A>C 0.0094 - - - 0.0303 - 6 86207931 G A 541.77 intron_variant MODIFIER c.91-926G>A 0.0991 0.3750 - 0.1818 - 0.0500 6 86208015 T G 826.77 intron_variant MODIFIER c.91-842T>G 0.1415 0.4500 - - 0.0152 0.2750 6 86208019 G A 1112.77 intron_variant MODIFIER c.91-838G>A 0.7217 1.0000 0.8864 0.8182 0.2727 0.9500 6 86208022 A G 206.77 intron_variant MODIFIER c.91-835A>G 0.0047 - 0.0227 - - - 6 86208101 A T 892.77 intron_variant MODIFIER c.91-756A>T 0.6321 0.6000 0.8864 0.5909 0.3788 0.8250 6 86208220 T C 41.77 intron_variant MODIFIER c.91-637T>C 0.0047 - 0.0227 - - - 6 86208320 T G 178.77 intron_variant MODIFIER c.91-537T>G 0.0236 - 0.0682 - - 0.0500 6 86208350 G A 219.77 intron_variant MODIFIER c.91-507G>A 0.0094 - 0.0227 - - 0.0250 6 86208373 T C 1067.77 intron_variant MODIFIER c.91-484T>C 0.1651 0.4250 0.0682 0.3182 0.0606 0.1000 6 86208414 T C 504.77 intron_variant MODIFIER c.91-443T>C 0.0236 0.0500 - - - 0.0750 6 86208422 T C 36.77 intron_variant MODIFIER c.91-435T>C 0.0047 - - - 0.0152 - 6 86208434 C T 763.77 intron_variant MODIFIER c.91-423C>T 0.0189 - - - - 0.1000 6 86208501 A T 267.77 intron_variant MODIFIER c.91-356A>T 0.0330 - 0.1591 - - - 6 86208636 G T 712.77 intron_variant MODIFIER c.91-221G>T 0.1226 0.4000 - 0.3182 - 0.0750 6 86208637 A T 351.77 intron_variant MODIFIER c.91-220A>T 0.0047 - - - - 0.0250 6 86208685 T C 275.77 intron_variant MODIFIER c.91-172T>C 0.0047 - - - - 0.0250 6 86208747 T G 1103.77 intron_variant MODIFIER c.91-110T>G 0.4198 0.5500 0.2045 - 0.4242 0.7500 6 86208815 G A 740.77 intron_variant MODIFIER c.91-42G>A 0.2358 0.1000 0.2045 - 0.2879 0.4500 6 86208826 C G 820.77 intron_variant MODIFIER c.91-31C>G 0.2075 0.0500 0.2045 - 0.2727 0.3750 6 86208883 C T 360.77 synonymous_variant LOW c.117C>T p.Phe39Phe p.Phe18Phe 0.0189 0.0750 - - 0.0152 - 6 86208958 T C 895.77 synonymous_variant LOW c.192T>C p.Tyr64Tyr p.Tyr43Tyr 0.2594 0.1000 0.2045 - 0.3636 0.4500 6 86208960 A G 646.77 missense_variant MODERATE c.194A>G p.Gln65Arg p.Gln44Arg 0.1745 0.14 2.76 TOLERATED 0.0500 - - 0.3636 0.2750 6 86208977 C A 175.77 missense_variant MODERATE c.211C>A p.Leu71Ile 0.0047 0.11 2.76 TOLERATED 0.0250 - - - - 6 86208987 A G 530.77 missense_variant MODERATE c.221A>G p.Asn74Ser p.Asn53Ser 0.0802 0.21 2.82 TOLERATED - 0.0682 - 0.2121 - 6 86208997 G A 203.77 synonymous_variant LOW c.231G>A p.Leu77Leu p.Leu56Leu 0.0094 - 0.0227 - - 0.0250 6 86209022 G A 697.77 missense_variant MODERATE c.256G>A p.Val86Ile p.Val65Ile 0.2123 0.17 2.77 TOLERATED 0.0500 0.2045 - 0.2879 0.3750 6 86209097 G A 213.77 missense_variant MODERATE c.331G>A p.Asp111Asn p.Asp90Asn 0.0236 0.36 3.09 TOLERATED 0.0500 - - - 0.0750 6 86209184 A G 807.77 missense_variant MODERATE c.418A>G p.Ile140Val p.Ile119Val 0.2642 0.17 2.75 TOLERATED 0.4750 0.2500 0.0455 0.1970 0.3000 6 86209263 T C 206.77 missense_variant MODERATE c.497T>C p.Val166Ala p.Val145Ala 0.0236 0.21 2.78 TOLERATED 0.0500 - - - 0.0750 6 86209304 T C 410.77 missense_variant MODERATE c.538T>C p.Ser180Pro p.Ser159Pro 0.2028 1 2.78 TOLERATED 0.0750 0.1364 - 0.2424 0.4500 6 86209404 C A 62.74 intron_variant MODIFIER c.*34+25C>A 0.0094 - - - 0.0303 - 6 86209492 G T 517.77 intron_variant MODIFIER c.*34+113G>T 0.1981 0.0500 0.1818 - 0.2727 0.3500 6 86209519 C T 759.77 intron_variant MODIFIER c.*34+140C>T 0.1745 0.0500 0.1136 0.2727 0.3333 0.0500 6 86209526 A T 40.77 intron_variant MODIFIER c.*34+147A>T 0.0047 - - - - 0.0250 6 86209547 C T 561.77 intron_variant MODIFIER c.*34+168C>T 0.2123 0.0500 0.1818 - 0.3030 0.3750 6 86209594 T C 194.77 intron_variant MODIFIER c.*34+215T>C 0.0047 - 0.0227 - - - 6 86209600 G A 554.77 intron_variant MODIFIER c.*34+221G>A 0.2406 0.0750 0.2045 - 0.3182 0.4500 6 86209676 C A 673.77 intron_variant MODIFIER c.*34+297C>A 0.2311 0.1000 0.1818 - 0.2879 0.4500 6 86209704 C G 289.77 intron_variant MODIFIER c.*34+325C>G 0.0047 - - - - 0.0250 6 86209768 A G 697.77 intron_variant MODIFIER c.*34+389A>G 0.1274 0.3750 - 0.3182 0.0152 0.1000 6 86209797 A C 76.77 intron_variant MODIFIER c.*34+418A>C 0.0047 - 0.0227 - - - 6 86209968 T C 202.77 intron_variant MODIFIER c.*34+589T>C 0.0047 0.0250 - - - - 6 86209997 T C 1109.77 intron_variant MODIFIER c.*34+618T>C 0.1274 0.3750 - 0.3182 0.0152 0.1000 6 86210032 G A 980.77 intron_variant MODIFIER c.*34+653G>A 0.4198 0.1500 0.3409 0.5909 0.5303 0.5000 6 86210141 G A 355.77 intron_variant MODIFIER c.*34+762G>A 0.0708 - 0.1591 - 0.1212 - 6 86210163 A C 828.77 intron_variant MODIFIER c.*34+784A>C 0.2453 0.1000 0.2045 - 0.3182 0.4500 6 86210290 G C 100.77 intron_variant MODIFIER c.*34+911G>C 0.0047 - 0.0227 - - - 6 86210384 T C 283.77 intron_variant MODIFIER c.*35-833T>C 0.0613 - 0.2273 - 0.0152 0.0500 6 86210410 A G 284.77 intron_variant MODIFIER c.*35-807A>G 0.0094 - - 0.0909 - - 6 86210563 T C 790.77 intron_variant MODIFIER c.*35-654T>C 0.2264 0.0750 0.1818 - 0.2879 0.4500 6 86210710 C T 878.77 intron_variant MODIFIER c.*35-507C>T 0.2170 0.0500 0.2045 - 0.3030 0.3750 6 86210763 A G 813.77 intron_variant MODIFIER c.*35-454A>G 0.2311 0.1000 0.1818 - 0.2879 0.4500 6 86210814 A G 123.78 intron_variant MODIFIER c.*35-403A>G 0.0047 - 0.0227 - - - 6 86210899 G C 150.77 intron_variant MODIFIER c.*35-318G>C 0.0236 - 0.1136 - - - 6 86210947 C T 428.77 intron_variant MODIFIER c.*35-270C>T 0.0236 0.0500 - - - 0.0750 6 86210964 C G 638.41 intron_variant MODIFIER c.*35-253C>G 0.2264 0.1000 0.2045 - 0.2576 0.4500 6 86211014 G T 356.77 intron_variant MODIFIER c.*35-203G>T 0.0377 - 0.1818 - - - 6 86211031 G C 556.77 intron_variant MODIFIER c.*35-186G>C 0.1698 0.0500 - - 0.3030 0.3500 6 86211050 T C 923.77 intron_variant MODIFIER c.*35-167T>C 0.1321 0.4500 - - 0.0303 0.2000 6 86211074 A G 202.77 intron_variant MODIFIER c.*35-143A>G 0.0047 - 0.0227 - - - 6 86211075 T C 243.77 intron_variant MODIFIER c.*35-142T>C 0.0330 - 0.1591 - - - 6 86211096 A T 792.77 intron_variant MODIFIER c.*35-121A>T 0.1887 0.4500 - - 0.1364 0.3250 6 86211128 T G 672.77 intron_variant MODIFIER c.*35-89T>G 0.2075 0.0500 0.1818 - 0.2879 0.3750 6 86211321 C T 334.78 3_prime_UTR_variant MODIFIER c.*139C>T 0.0377 - 0.1818 - - - 6 86211337 T C 237.77 3_prime_UTR_variant MODIFIER c.*155T>C 0.0330 - 0.1591 - - - 6 86197576 TAAAA TAAA,TAA,TA,T 477.82 intron_variant MODIFIER c.-6+267_-6+270delAAAA 0.3538 0.575 0.45455 0.63636 0.04546 0.375 6 86198350 ACAAT A 637.73 intron_variant MODIFIER c.-6+1041_-6+1044delCAAT 0.2170 0.075 0.29546 0.31818 0.18182 0.275 6 86198648 TA T 298.73 intron_variant MODIFIER c.-5-1095delA 0.0330 - 0.02273 0.27273 - - 6 86198978 CAAG C 547.73 intron_variant MODIFIER c.-5-765_-5-763delAAG 0.0330 - 0.02273 0.27273 - - 6 86199535 A ATTC 772.73 intron_variant MODIFIER c.-5-209_-5-208insTTC 0.1179 0.05 0.22727 - 0.06061 0.225 6 86200085 TA T 265.73 intron_variant MODIFIER c.57+281delA 0.0142 0.075 - - - - 6 86200532 TCAGATGTTTATTTTC T 115.73 intron_variant MODIFIER c.57+728_57+742delCAGATGTTTATTTTC 0.0047 - - - - 0.025 6 86201431 GC G 337.74 intron_variant MODIFIER c.57+1627delC 0.0236 0.025 - 0.18182 - - 6 86203237 TA T 831.73 intron_variant MODIFIER c.57+3433delA 0.9387 1 0.95455 1 0.84849 0.975 6 86203503 CTT C 372.73 intron_variant MODIFIER c.58-3255_58-3254delTT 0.0377 0.075 - 0.09091 - 0.075 6 86203515 AG A 109.74 intron_variant MODIFIER c.58-3243delG 0.0094 - 0.02273 - 0.01515 - 6 86203670 CTATT C 289.73 intron_variant MODIFIER c.58-3088_58-3085delTATT 0.0047 - 0.02273 - - - 6 86203859 CA C 762.73 intron_variant MODIFIER c.58-2899delA 0.2123 0.05 0.20455 - 0.27273 0.4 6 86203928 TCTC T 136.73 intron_variant MODIFIER c.58-2830_58-2828delCTC 0.0047 - - - - 0.025 6 86204116 ATT AT,A 533.73 intron_variant MODIFIER c.58-2642_58-2641delTT 0.5472 0.525 0.77273 0.63636 0.39394 0.525 6 86204120 T TAGTTAGCATGTATCTGTCA,TAG,TAGTTAGCATGTATCTG 145.73 intron_variant MODIFIER c.58-2639_58-2638insAG 0.0849 0.05 0.06818 - 0.06061 0.225 6 86204122 T TAGCA 145.73 intron_variant MODIFIER c.58-2637_58-2636insAGCA 0.0519 0.025 0.04546 - 0.0303 0.15 6 86204126 A ATCTGTC 98.25 intron_variant MODIFIER c.58-2633_58-2632insTCTGTC 0.0377 0.025 0.04546 - 0.0303 0.075 6 86204245 CTT CT,CTTT,C,CTTTT 574.73 intron_variant MODIFIER c.58-2513_58-2512delTT 0.2217 0.325 0.20455 0.27273 0.07576 0.35 6 86204257 T TC 127.87 intron_variant MODIFIER c.58-2502_58-2501insC 0.0330 - 0.15909 - - - 6 86204283 T TA 461.73 intron_variant MODIFIER c.58-2476_58-2475insA 0.1415 0.05 0.18182 0.5 0.0303 0.175 6 86205991 A ACT 86.25 intron_variant MODIFIER c.58-768_58-767insCT 0.0094 - 0.04546 - - - 6 86206433 T TTC 412.74 intron_variant MODIFIER c.58-326_58-325insTC 0.1651 0.05 0.18182 0.54546 0.12121 0.125 6 86206436 AAG A 445.73 intron_variant MODIFIER c.58-322_58-321delAG 0.1651 0.05 0.18182 0.54546 0.12121 0.125 INDEL 6 86206659 C CT 618.73 intron_variant MODIFIER c.58-100_58-99insT 0.1887 0.05 0.22727 0.59091 0.16667 0.1 6 86207321 A ATAT 664.73 intron_variant MODIFIER c.90+530_90+531insTAT 0.5660 0.6 0.79546 0.63636 0.21212 0.825 6 86207322 TA T 38.7 intron_variant MODIFIER c.90+532delA 0.0189 - - - 0.06061 - 6 86207364 A AATATT 682.73 intron_variant MODIFIER c.90+573_90+574insATATT 0.2736 0.15 0.40909 0.59091 - 0.525 6 86207410 AAT A 220.73 intron_variant MODIFIER c.90+620_90+621delAT 0.0236 0.05 - - - 0.075 6 86207495 GATATATATC G 592.73 intron_variant MODIFIER c.90+705_90+713delATATATATC 0.1981 0.45 0.36364 - - 0.2 6 86207560 TA T 49.73 intron_variant MODIFIER c.90+770delA 0.0047 - - - - 0.025 6 86207657 T TTATATAATTA 288.73 intron_variant MODIFIER c.90+866_90+867insTATATAATTA 0.0047 - 0.02273 - - - 6 86207982 ATATAT A 435.73 intron_variant MODIFIER c.91-874_91-870delTATAT 0.0047 0.025 - - - - 6 86207983 TATA T 316.73 intron_variant MODIFIER c.91-873_91-871delATA 0.0236 0.05 - - - 0.075 6 86208138 C CATATA 682.73 intron_variant MODIFIER c.91-719_91-718insATATA 0.2642 0.475 0.40909 0.09091 0.10606 0.25 6 86208142 T TAATAC 736.73 intron_variant MODIFIER c.91-715_91-714insAATAC 0.1792 0.1 0.22727 - 0.09091 0.45 6 86208262 G GA 137.73 intron_variant MODIFIER c.91-595_91-594insA 0.0094 - 0.04546 - - - 6 86208410 CAT CATAT,CCTAT,CCTATAT,C 530.19 intron_variant MODIFIER c.91-447_91-446insCT 0.1934 0.075 0.13636 0.09091 0.25758 0.325 6 86208422 T TATATAC,TATATATATAC,TATAC 692.73 intron_variant MODIFIER c.91-435_91-434insATAC 0.1462 0.025 0.20455 - 0.12121 0.325 6 86208428 T TAC 199.73 intron_variant MODIFIER c.91-429_91-428insAC 0.0047 - - - - 0.025 6 86208432 TAC TACAC,T 646.73 intron_variant MODIFIER c.91-424_91-423delAC 0.1887 0.375 0.11364 0.13636 0.15152 0.175 6 86208470 T TAC 849.73 intron_variant MODIFIER c.91-387_91-386insAC 0.1981 0.075 0.18182 - 0.19697 0.45 6 86208472 GT G 101.73 intron_variant MODIFIER c.91-384delT 0.0047 - 0.02273 - - - 6 86208627 AT A 359.73 intron_variant MODIFIER c.91-229delT 0.1792 0.05 0.15909 0.54546 0.22727 0.05 6 86208635 TG T 342.73 intron_variant MODIFIER c.91-221delG 0.0047 - - - - 0.025 6 86208674 TGGAA T 193.73 intron_variant MODIFIER c.91-182_91-179delGGAA 0.0047 - 0.02273 - - - 6 86209704 CATG C 817.73 intron_variant MODIFIER c.*34+326_*34+328delATG 0.1934 0.05 0.15909 0.54546 0.27273 0.05 6 86210002 AAT A 637.73 intron_variant MODIFIER c.*34+624_*34+625delAT 0.2075 0.05 0.18182 - 0.28788 0.375 6 86210754 A AATAGGACATCTGGTAAG 902.73 intron_variant MODIFIER c.*35-463_*35-462insATAGGACATCTGGTAAG 0.2311 0.1 0.18182 - 0.28788 0.45