ORIGINAL RESEARCH published: 18 June 2019 doi: 10.3389/fphys.2019.00717 Brain and Pituitary Response to Vaccination in Gilthead Seabream (Sparus aurata L.) X. H. Liu 1,2† , A. R. Khansari 1† , M. Teles 1 , G. Martínez-Rodríguez 3 , Y. G. Zhang 2 , J. M. Mancera 4 , F. E. Reyes-López 1* and L. Tort 1* 1 Department of Cell Biology, Physiology and Immunology, Universitat Autonoma de Barcelona, Barcelona, Spain, 2 Key Laboratory of Freshwater Fish Reproduction and Development (Ministry of Education), Key Laboratory of Aquatic Science of Chongqing, School of Life Sciences, Southwest University, Chongqing, China, 3 Instituto de Ciencias Marinas de Andalucia, Cádiz, Spain, 4 Department of Biology, Faculty of Marine and Environmental Sciences, Instituto Universitario de Investigación Marina (INMAR), Campus de Excelencia Internacional del Mar (CEI-MAR), University of Cádiz, Cádiz, Spain Vaccination is a widely used therapeutical strategy in aquaculture, but whether vaccination elicits stress responses in the central neuroendocrine system and enhances the crosstalk between the immune and endocrine systems in the brain or pituitary after Edited by: vaccination is unclear. To answer this question two experiments using two different Rui Rosa, vaccine exposure routes, i.e., bath or intraperitoneal (i.p.) injection, were carried out University of Lisbon, Portugal on gilthead seabream (Sparus aurata L.). In the first one, the stress responses of fish Reviewed by: subjected to waterborne Vibrio anguillarum bacterin were compared with responses Luis Vargas-Chacoff, Austral University of Chile, Chile after air exposure or their combination. In the second experiment, fish were subjected Kim Dawn Thompson, to an intraperitoneal injection of Lactococcus garvieae bacterin and we assessed the Moredun Research Institute, United Kingdom central stress response and also whether or not a significant immune response was *Correspondence: induced in brain and pituitary. In both experiments, blood, brain and pituitary tissues F. E. Reyes-López were collected at 1, 6, and 24 h post stress for plasma hormone determination and felipe.reyes@uab.cat gene expression analysis, respectively. Results indicated that bath vaccination induced L. Tort Lluis.Tort@uab.es a decreased central stress response compared to air exposure which stimulated both † These authors have contributed brain and pituitary stress genes. In the second experiment, injection vaccination kept equally to this work unchanged plasma stress hormones except cortisol that raised at 6 and 24 h. In Specialty section: agreement, non-significant or slight changes on the transcription of stress-related genes This article was submitted to were recorded, including the hormone genes of the hypothalamic pituitary interrenal Aquatic Physiology, (HPI) axis and other stress markers such as hsp70, hsp90, and mt genes in either brain a section of the journal Frontiers in Physiology or pituitary. Significant changes were observed, however, in crhbp and gr. In this second Received: 18 February 2019 experiment the immune genes il1β, cox2, and lys, showed a strong expression in both Accepted: 23 May 2019 brain and pituitary after vaccination, notably il1β which showed more than 10 fold raise. Published: 18 June 2019 Overall, vaccination procedures, although showing a cortisol response, did not induce Citation: Liu XH, Khansari AR, Teles M, other major stress response in brain or pituitary, regardless the administration route. Martínez-Rodríguez G, Zhang YG, Other than main changes, the alteration of crhbp and gr suggests that these genes Mancera JM, Reyes-López FE and could play a relevant role in the feedback regulation of HPI axis after vaccination. In Tort L (2019) Brain and Pituitary Response to Vaccination in Gilthead addition, from the results obtained in this work, it is also demonstrated that the immune Seabream (Sparus aurata L.). system maintains a high activity in both brain and pituitary after vaccine injection. Front. Physiol. 10:717. doi: 10.3389/fphys.2019.00717 Keywords: brain, pituitary, vaccination, immune response, stress response Frontiers in Physiology | www.frontiersin.org 1 June 2019 | Volume 10 | Article 717 Liu et al. Neuroendocrine Response in Vaccinated Seabream INTRODUCTION tissues of fish shortly after vaccination. Also, serum or tissue antibodies such as immunoglobulin M and immunoglobulin Stress is defined as a state of real or perceived challenge for T will increase at long-term after vaccination (Lamers et al., homeostasis that induces a response consisting in an array 1985; Mutoloki et al., 2015), together with some specific of biological reactions to compensate for the consequences immune responses, thus contributing to the increased of the threat created by the stressor (Tort and Teles, 2011; survival rate when fish are challenged a second time with Schreck and Tort, 2016). After the stressor is perceived, a pathogen (Rodgers, 1990; Figueras et al., 1998). Similarly, the neuroendocrine cells of the ventral parvocellular section the phagocytic activity of head kidney leucocytes isolated of the nucleus preopticus, secrete different neuroendocrine from turbot (Scophthalmus maximus L.) enhanced at 7 days players: Corticotropin Releasing Hormone (CRH), CRH Binding post vaccination, and such increase lasted as long as 42 days Peptide (CRHBP), Arginin Vasotoccin (AVT) and Thyroid (Figueras et al., 1998). Releasing Hormone (TRH) that control the production of There are several vaccine delivery methods, including oral, adrenocorticotropic hormone (ACTH) in corticotropic cells immersion and injection, of which injection often shows better of the anterior pituitary gland (Flik et al., 2006). The protection (Plant and LaPatra, 2011). However, the injection release of ACTH into the bloodstream and interaction with procedure can produce adverse reactions due to stress (Hastein the receptors of interrenal tissue, will subsequently induce et al., 2005), and this unavoidable stress is associated with cortisol release (Gorissen and Flik, 2016). Cortisol acts as short-term increase of plasma cortisol (Funk et al., 2004; a multifunctional hormone via binding to its receptors, the Skinner et al., 2010). Work on stress or immune effects of mineralocorticoid receptor (MR) and glucocorticoid receptors vaccine delivered by intraperitoneal injection has been previously (GR), which are ubiquitously expressed in almost all tissues reported and shown to be dose and temperature dependent (Sapolsky et al., 2000; Teles et al., 2013). During the stress (Martínez et al., 2018; Oyarzún et al., 2019). Nevertheless, response, cortisol will redirect energy utilization among various few data is available regarding the effects of vaccine on the organs in order to overcome the increased metabolic demand Hypothalamus-Pituitary-Interrenal (HPI) axis at the brain and imposed by the stressor challenge. As a consequence, some pituitary level. In a previous study of our research group, it processes such as immune response mechanisms may be has been shown that bacterin could elicit immune responses affected or delayed (Kaattari and Tripp, 1987; Padgett and in cultured pituitary cells of rainbow trout (Oncorhynchus Glaser, 2003; Kudielka and Kirschbaum, 2007). For instance, mykiss) (Liu et al., 2019), and so did when adding medium hypothalamic CRH may act as an anti-inflammatory via from cultured spleen cells to pituitary tissue preparations stimulation of glucocorticoids and catecholamines; peripheral (Liu et al., 2019). CRH acts as pro-inflammatory through direct action on Taking all the above into consideration, the goal of the immune cells (Karalis et al., 1997; Quintanar and Guzman- present study was to investigate the effect of vaccine in both Soto, 2013) and cortisol acts generally as immunosuppressor brain and pituitary through different vaccination routes. or immunomodulator (Tort, 2011). Besides, ACTH has been We hypothesized that: (1) bath vaccination might evoke a reported to present immunoreactive activity in the thymus significant stress response of the central neuroendocrine organs of goldfish (Carassius auratus) (Ottaviani et al., 1995). In of fish; and (2) the bacterin vaccines can induce both a stress addition, the expression of some immune genes in the and immune response in brain and pituitary. To test these central nervous system has been reported, and this suggests hypotheses, two experiments were performed: In the first a potential cross-interaction between brain immune and experiment, S. aurata individuals were vaccinated by bath neuroendocrine systems (Metz et al., 2006). Assuming that vaccine, subjected to air exposure stress or subjected to both brain and pituitary are the hierarchical onset organs of the (vaccine and air exposure). Plasma cortisol content as well stress reaction (Cerdá-Reverter and Canosa, 2009), other central as gene transcripts relevant to stress responses, specifically, interactions have been shown to occur at brain and pituitary crh, crhbp, pomca, pomcb, gr, trh, gh, prl, sl1, and sl2 were level, particularly the cortisol feed-back interaction via GR tested in the pituitary and/or brain at 1, 6, and 24 h post (Gorissen and Flik, 2016). treatments. In the second experiment, we tested whether a Vaccination is the most effective method used nowadays vaccine administered through intraperitoneal injection was in aquaculture to prevent diseases caused by pathogens able to elicit a central stress response. It was also evaluated (Plant and LaPatra, 2011). Available data indicates that 2 h whether brain and pituitary showed a significant immune after Vibrio anguillarum bacterin exposure, the expression response. As fish were taken out of the water for the injection, of both pro- and anti-inflammatory genes increase in the responses to vaccination were tested against the air-exposed gilthead seabream (Sparus aurata) head kidney primary mock group, thus allowing consistent comparisons with the cell culture (Khansari et al., 2017). Moreover, vaccination air exposure group from the first experiment. The air exposure by immersion leads to alteration of some immune genes stressor was selected for two reasons. One, because this is including complement c3, tumor necrosis factor alpha (tnfα), a previously used and validated type of stressor related to lysozyme (lys) or transforming-growth factor beta (tgfβ) in hypoxia or anoxia experiments (Skrzynska et al., 2018). Second, seabream mucosal tissues such as skin and gut (Khansari because we wanted to differentiate the response of the vaccine et al., 2018). Therefore, these previous results demonstrate itself compared to the response induced by a non-biotic that a non-specific immune response is elicited in immune physical stressor. Frontiers in Physiology | www.frontiersin.org 2 June 2019 | Volume 10 | Article 717 Liu et al. Neuroendocrine Response in Vaccinated Seabream MATERIALS AND METHODS and then they were quickly intraperitoneally injected with 1 mL sterilized PBS or 1 mL ICHTHIO-LG for the mock injection or Fish Husbandry and Experimental Design vaccination groups, respectively. After the injection, fish were Two batches of gilthead seabream (110.8 ± 13.4 g and immediately returned to the corresponding experimental tanks. 285.6 ± 30.2 g) were transported in March and September 2017, The whole operation lasted less than 3 min. Fish from both respectively, from Aquacultura Els Alfacs (Tarragona, north-east mock injection and vaccination groups were sampled at 1, 6, Spain). Fish were stocked in the indoor water circular tanks and 24 h post injection, and blood, pituitary and brain of 6 fish (2000 L) 20 days at the Universitat Autonoma de Barcelona fish from each group at each sampling time point were collected. facility (AQUAB), under a 12L: 12D photoperiod, 21.4 ± 0.6◦ C In brief, fish was anesthetized by an overdose of MS222, the temperature, and they were fed with a commercial diet (Skretting) blood of each fish was quickly collected from the caudal vein once per day at a maintenance ration (1.5% body weight). by using a 5 mL syringe, which was pre-rinsed with lithium During this period, no clinical signals of disease, malformation or heparin (Deltalab, Spain), and then transferred to a clean tube injuries were observed, nor altered behavior. Water parameters with one drop of lithium heparin. After fast blood collection, the including pH, NO2 , NO3 , NH4 /NH3 , temperature, and salinity pituitary gland and brain of each fish were excised, immediately were monitored every day. All experimental procedures were frozen in liquid nitrogen and stored under −80o C until use. submitted by the Ethical Committee of the Universitat Autonoma ICTHIO-LG Lactococosis (HIPRA, Spain) is a vaccine obtained de Barcelona (CEEAH), in accordance with the international from inactivated Lactococcus garvieae, a pathogenic agent for European Guiding Principles for Biomedical Research Involving both cultured freshwater and marine fish at water temperature Animals (EU2010/63) and authorized by the regional authority above 15◦ C. The composition consists of inactivated L. garvieae (Generalitat de Catalunya Procedure Ref. 10208). with RPS > 75%. Vaccines and Sample Collection Plasma Isolation and Test of Biochemical Experiment 1 Parameters Seabream were vaccinated with ICTHIOVAC R VR by immersion Plasma was separated by blood centrifugation at 1500 × g for according to guidelines recommended by the company (HIPRA). 10 min at 4◦ C. Then the isolated plasma of each fish was ICTHIOVAC R VR (HIPRA) is an inactivated commercial vaccine transferred to a clean tube and stored at −20◦ C until biochemical which is suitable for immersion delivery. The composition analyses. Plasma CRH and ACTH concentration were detected consists of inactivated V. anguillarum, serotype O1, O2α, and by using Fish CRH ELISA Kit (Cat: CK-E93386F, Yuan Ye O2β with relative percent survival RPS ≥ 60%, presenting all Biotechnology, Shanghai, China) and Fish ACTH ELISA Kit pathogenic serotypes of the bacterium, including the serogroup (Cat: CK-E 93337F, Yuan Ye Biotechnology, Shanghai, China) O2α that is the most pathogenic serogroup of the bacterium according to manufacturer instructions, respectively. These Elisa (Frans et al., 2011). The second stressor, air exposure, consisted in kits used in the present study showed sensitivities of about 3 min out of the water. To this end, four groups of fish (n = 18 fish 1.0 pg/mL. The intraassay coefficients of variation were <15% per group) were used for the experiment: (i) control group, fish for both two kits. Seabream plasma cortisol levels were measured treated with water free-vaccine in bucket, (ii) group treated with by radioimmunoassay (RIA) as described by Rotllant et al., the vaccine, (iii) group subjected to air exposure during 3 min, 2006 (antibody from MO bio-medical LLC, United States, final and (iv) group exposed to both air exposure and vaccine. There dilution 1:4500, lower detection limit of the cortisol assay: were two replicate tanks in each group. It is worth to mention that 0.16 ng/mL, 100% antibody cross-reactivity with cortisol). vaccination was performed 24 h before air-exposure stress since the preliminary result in systemic immune organs did not show Total RNA Extraction and Reverse any significant alteration by vaccine at early time of vaccination Transcription Quantitative Real-Time (data not shown). Fish were sampled after 1, 6 and 24 h. Fish were anesthetized by an overdose of tricaine methanosulphonate PCR (RT-qPCR) (MS222) and the blood from each fish was quickly collected from Total RNA of each tissue was extracted according to the the caudal vein by using a heparinized 2 mL syringe. After fast manufacturer’s instructions with TRI reagent (Sigma-Aldrich, blood collection, the pituitary gland and brain of each fish were United States). The RNA concentration of RNA (260 nm) and excised, immediately frozen in liquid nitrogen and stored under the purity ratio (A260/A280) was measured with NanoDrop −80◦ C until use. 2000 Spectrophotometer (Thermo Fisher Scientific Inc., United States). First-strand cDNA of each sample was Experiment 2 synthesized from 1 µg total RNA by using High-Capacity cDNA Before the start of the experiment, a total of 36 fish were randomly Reverse Transcription Kit (Applied Biosystems, United States) divided into 2 groups (with two replicate tanks per group) as for according to the user’s manual. mock injection and vaccination, and these fish were acclimatized RT-qPCR was performed using iTaqTM Universal for another 5 days in 200 L water circular tanks. During this SYBR Green Supermix (Bio-Rad, United States) in a CFX R period, water parameters and rearing conditions were kept the TouchTM Real-Time PCR Detection System (Bio-Rad, same as mentioned above. After 24 h fasting, all fish were slightly United States). In brief, a volume of 10 µL containing 0.4 µM of anesthetized by MS222 (0,1 g/L) Sigma-Aldrich, United States), each upstream and downstream primer (Table 1), 2 µL of cDNA Frontiers in Physiology | www.frontiersin.org 3 June 2019 | Volume 10 | Article 717 Liu et al. Neuroendocrine Response in Vaccinated Seabream TABLE 1 | Primer information used in the present study. genes Primer sequence (50 -30 ) Accession number Product size (bp) Efficiency Il1β F: TCAGCACCGCAGAAGAAAAC R: TAACACTCTCCACCCTCCAC AJ277166.2 115 1.97 cox2 F: GAGTACTGGAAGCCGAGCAC R: GATATCACTGCCGCCTGAGT AM296029.1 192 1.89 tnfα F: TCGTTCAGAGTCTCCTGCAG R:AAGAATTCTTAAAGTGCAAACACACCAAA AJ413189.2 320 2.24 c3 F: GTTCCACAACAACCCACAGC R:ACATACGCCATCCCATCCAC HM543456.1 183 1.91 lys F: TCATCGCTGCCATCATCTCC R:TGTTCCTCACTGTCCCATGC AM749959.1 154 2.08 tgfβ1 F: AGACCCTTCAGAACTGGCTC R:ACTGCTTTGTCTCCCCTACC AF424703.1 145 1.9 il10 F: GATCTGCTGGATGGACTGC R: GAGCGTGGAGGAATCTTTCAA JX976621.1 154 2.02 il6 F: ATCCCCTCACTTCCAGCAGA R: GCTCTTCGGCTCCTCTTTCT EU244588.1 129 2.04 hsp70 F: AGGTTGGGTCTGAAAGGAAC R: TGAACTCTGCGATGAAGTGG EU805481.1 174 1.96 hsp90 F: GTGGATTCTGAGGACCTGCC R: GAGAGTCTTCGTGGATGCCC DQ524994.1 196 1.96 mt F: CTCTAAGACTGGAACCTG R: GGGCAGCATGAGCAGGAG U93206.1 93 2.07 crh F: ATGGAGAGGGGAAGGAGGT R: ATCTTTGGCGGACTGGAAA KC195964.1 176 1.86 trh F: GAAACGCTTTTGGGATAACTCC R: CGGCGTGACTCTTGTTTATGTT KC196277.1 131 2.24 gh F: CGTCTCTTCTCAGCCGAT R: GCTGGTCCTCCGTCTGC U01301.1 131 1.79 prl F: TGACATCGGCGAGGACAACATT R: CGGCAGCGGAGGACTTTCAG AJ509807.1 111 1.84 crhbp F: GCAGCTTCTCCATCATCTACC R: ACGTGTCGATACCGCTTCC KC195965.1 147 1.95 pomca F: AGCCAGAAGAGAGAGCAGTGAT R: ATCGGGTCAGAAAACACTCA HM584909.1 120 1.92 pomcb F: AGCTCGCCAGTGAGCTGT R: CCTCCTGCATCACTTCCTG HM584910.1 81 2.07 gr F: TGCTGGCGGAGATCATCACCA R:GCAGGCCAAGCGAAGGCTTA DQ486890.1 182 2.01 18s F: ACCAGACAAATCGCTCCACC R: AGGAATTGACGGGAAGGGCAC AY587263.1 172 2.02 rpl27 F: AAGAGGAACACAACTCACTGCCCCAC AY188520.1 160 2.01 R: GCTTGCCTTTGCCCAGAACTTTGTAG product, 2.6 µl of MQ water, and 5 µL of 2 × iTaq Universal considered significant when P < 0.05. All results were expressed SYBR green Supermix were used for the RT-qPCR reaction. The as mean ± SEM. cycling condition consisted of an initial denaturation cycle for 5 min at 95◦ C, 40 cycles of 15 s at 95◦ C, 30 s at 60◦ C. A melting curve analysis was carried out after the completion of RT-qPCR RESULTS to verify no non-specific amplification. The reference genes 18S and RPL27 were used for normalization. The quantification Brain and Pituitary Stress Response to was performed according to Pfaffl method (Pfaffl, 2001) and Bath Vaccine corrected for the efficiency of each primer set. Value for each Figure 1 shows the levels of plasma cortisol after both stressors experimental condition was expressed as normalized relative and its combination at the respective time points. Cortisol did expression, calculated in relation to the values of control group and normalized against those of the reference gene 18S. The amplification efficiency and product size are listed in Table 1. Six biological replicates with two technical replicates were performed for the qPCR analysis. Statistics For the first experiment the statistical package for social science (SPSS, v20) software was used for the analysis. The Generalized Linear Model (GzLM) was utilized considering the stressors and time dynamics as a two between-subjects factor. This model is a more flexible statistical tool than the standard general linear model (GLM) in terms of types of distribution and different covariance structure of the repeated FIGURE 1 | Plasma cortisol concentration in gilthead seabream (Sparus measures does not require homogeneity of variance and it aurata L.) at 1, 6, and 24 h post challenge after air exposure and Vibrio admits missing values. After the main analysis, appropriate vaccine. Data are presented as mean ± SEM. Significant differences are pairwise comparisons were carried out. In the second indicated by numbers in air exposure group and by capital letters in vaccine plus air exposure group. Asterisk (∗ ) indicates significant difference vs. control experiment, we used either one-way ANOVA followed by and the absence of a symbol indicates no difference (P < 0.05; Fisher’s LSD post-hot test, or unpaired student’s t-test if the equal General-linear-Model test was performed for multiple comparison). variances were not assumed. Differences among groups were Frontiers in Physiology | www.frontiersin.org 4 June 2019 | Volume 10 | Article 717 Liu et al. Neuroendocrine Response in Vaccinated Seabream not show any significant response after bath vaccine treatment and 24 h post injection, respectively (P < 0.05). The compared to air exposure stress, which showed a classical acute differential cortisol increase of the vaccine-injected fish response dynamics with a peak at 1 h, still significantly higher compared to the mock-injected fish was apparent at all at 6 h, followed by further recovery of basal values at 24 h. The time points. Regarding time course, both injected vaccine dynamics of the vaccine plus air exposure was similar to that and mock groups presented the same cortisol dynamics, observed after air exposure, although the recovery took place later i.e., increases at 1 and 6 h and recovery at 24 h. However, on, indicating that the air exposure stressor was predominant in the vaccinated group showed higher levels at either time the cortisol response. compared to mock-injected group. The vaccine injected Regarding the response of the analyzed stress-related genes in group also showed higher resistance to recovery at 24 h. the brain, no relevant changes were observed after bath vaccine Regarding CRH or ACTH, no alteration of plasma content treatment, except for a decrease of crhbp at 1 h, whereas air in either group (mock or vaccination) was observed in exposure showed significant increases in crh, crhbp, and gr and none of different time points assessed 1, 6, and 24 h post a significant down-regulation of trh. When both stressors were injection (Figure 4). applied, trh was maintained down-regulated at 6 h and only crhbp In the second experiment, the expression of crh was almost increased significantly (Figure 2). unchanged at 1, 6, and 24 h post vaccination. Transcript of gr was In the pituitary, bath vaccination showed a differential not altered at 1 or 24 h, while there was a slight but significant up- induction of pomc genes at short time (1 h) whereas at 6 h prl regulation at 6 h post vaccination in the mock group. A similar and gh showed significant increases. Air exposure increased the trend can be observed in the heat shock proteins (HSP) hsp70 expression of pomcb, gr and sl1 at 1 h, and gr at 6 h. After and hsp90 in which a significant increase was also observed at the applying both stressors only slight changes were detected as for same time point (6 h). As a whole, few changes were observed in the reductions of pomcb at 6 h and sl1 at 1 h, and the increase of brain genes, and the changes were higher in mock-injected fish sl1 at 6 h (Figure 3). than in vaccine-injected fish (Figure 5). Similar than with the bath vaccine, the expression of stress Brain and Pituitary Stress and Immune genes in the pituitary showed a different pattern in which one Responses to Injected Vaccine gene, CRH binding protein (crhbp), substantially increased its Plasma cortisol values significantly raised by 2.2- and 6.4- expression (up to 15 fold at 6 h or up to 7 fold after 24 h) after fold compared to the corresponding mock groups at 6 vaccine injection. These increases contrast with the mock injected FIGURE 2 | qPCR quantification of specific mRNA accumulation in gilthead seabream (Sparus aurata L.) brain at 1, 6, and 24 h post challenge with Vibrio anguillarum exposure and air exposure. (A) crh; (B) crhbp; (C) gr; and (D) trh were shown as mRNA relative abundance. Data are presented as mean ± SEM. Significant differences are indicated by capital letters in vaccine group, by numbers in air exposure group, and by lowercase letters vaccine plus air exposure. Asterisk (∗ ) indicates significant difference versus control and the absence of a symbol indicates no difference (P < 0.05; General-linear-Model test was performed for multiple comparison). Frontiers in Physiology | www.frontiersin.org 5 June 2019 | Volume 10 | Article 717 Liu et al. Neuroendocrine Response in Vaccinated Seabream FIGURE 3 | qPCR quantification of specific mRNA accumulation in gilthead seabream (Sparus aurata L.) pituitary at 1, 6, and 24 h post challenge with air exposure and Vibrio anguillarum exposure. (A) pomca; (B) pomcb; (C) gr; (D) gh; (E) prl; (F) sl1; and (G) sl2 were shown as mRNA relative abundance. Data are presented as mean ± SEM. Significant differences are indicated by capital letters in vaccine group, by numbers in air exposure group, and by lowercase letters vaccine plus air exposure. Asterisk (∗ ) indicates significant difference versus control and the absence of a symbol indicates no difference (P < 0.05; General-linear-Model test was performed for multiple comparison). FIGURE 4 | Plasma CRH (A), ACTH (B), and cortisol (C) concentration in gilthead seabream (Sparus aurata L.) after Lactococcus bacterin or mock injection. Asterisk (∗ ) indicates significant difference between mock and vaccination groups of each time point (P < 0.05). fish in which the increase was moderate (between 3 and 5 fold), changes in brain and pituitary other than in stress-related though showing the same dynamics. A similar significant trend, genes. The results showed a very clear picture as not only but more moderate (over two fold increases), was observed for some cytokines increased their expression but the level of hsp70 but not for hsp90. The rest of the genes assessed, although induction was very strong. Thus, the main pro-inflammatory showing some variations, did not change significantly their cytokine il1β dramatically raised in the vaccination group expression except for gr in which a significant down-regulation at all three time points: 1, 6, and 24 h, by 12.0, 9.36, and was observed at 6 h (Figure 6). 7.44 fold, respectively. Similarly, cox2 was significantly up- regulated by 5.25, 7.77, and 3.46 fold in the vaccination group at 1, 6, and 24 h post injection, respectively. The mRNA Expression of Immune Genes in expression level of both il1β and cox2 peaked at 6 h post Brain and Pituitary vaccination group. Other pro-inflammatory gene transcripts In the second experiment it was intended to determine such as il6 raised significantly only 1.7 fold at 1 h post whether an injected vaccine induced immune gene expression vaccination (P < 0.01), and tnfα was kept almost unchanged. Frontiers in Physiology | www.frontiersin.org 6 June 2019 | Volume 10 | Article 717 Liu et al. Neuroendocrine Response in Vaccinated Seabream FIGURE 5 | mRNA expression of genes involved in the HPI axis in the brain of gilthead seabream (Sparus aurata L.) after Lactococcus bacterin or mock injection. (A) crh; (B) gr; (C) hsp70; (D) hsp90; and (E) mt. Asterisk (∗ ) indicates significant difference between mock and vaccination groups of each time point (P < 0.05). FIGURE 6 | mRNA expression of genes involved in the HPI axis in the pituitary of gilthead seabream (Sparus aurata L.) after Lactococcus bacterin or mock injection. (A) crhbp, (B) pomca, (C) pomcb; (D) gr; (E) hsp70; (F) hsp90; and (G) mt. Asterisk (∗ ) indicates significant difference between mock and vaccination groups of each time point (P < 0.05). Differently from the pro-inflammatory genes, the classical at 6 h post vaccination, although with just 1.61 fold, and anti-inflammatory genes tgfβ and il10 showed no significant a moderate raise was also observed at 24 h post injection. alteration in the vaccinated groups when compared with The transcript for the complement C3 component gene (c3) the corresponding mock injection groups. Nevertheless, showed a significant increase at 1 h post vaccination, by 2.35 the mean values showed a non-significant but apparent fold; however, it decreased at 6 and 24 h after vaccination increasing trend (Figure 7). The expression of lysozyme when compared with the corresponding mock injection gene (lys) significantly increased in the brain of seabream groups (Figure 7). Frontiers in Physiology | www.frontiersin.org 7 June 2019 | Volume 10 | Article 717 Liu et al. Neuroendocrine Response in Vaccinated Seabream FIGURE 7 | RNA expression of pro-inflammatory genes il1β (A), cox2 (B), il6 (C), tnfα (D), anti-inflammatory genes tgfβ (E), il10 (F) and some other immune components lys (G) and c3 (H) in the brain of gilthead seabream (Sparus aurata L.) after Lactococcus bacterin or mock injection. Asterisk (∗ ) indicates significant difference between mock and vaccination groups of each time point (P < 0.05). Regarding pituitary, the expression of genes related to the as primary stressors stimulating the hierarchical activation of immune responses are shown in Figure 8. The expression of HPI axis, although it would indirectly activate cortisol release pro-inflammatory gene il1β sharply and strongly increased at in the case of vaccine injection linked to the air exposition the three time points post vaccination, and it was significantly period during the injection procedure. In both experiments up-regulated by 20.65 and 2.94 fold at 1 and 24 h, respectively. cortisol presented an acute response dynamics, peaking at A similar alteration trend was observed for the expression 1 or 6 h and recovering at 24 h, in agreement with the of cox2 after vaccination, however, with less intensity. The studies previously reported for this species after subjecting cox2 transcript raised by 4.37, 3.16, and 2.52 fold in 1, 6, seabream to acute stressors such as air exposure (Arends et al., and 24 h vaccination groups, respectively, but significance 1999; Skrzynska et al., 2018). Similar increases of cortisol was observed only at 1 and 6 h time points. The tnfα concentration in rainbow trout treated by vaccine injection transcript was up-regulated at 1 and 6 h post vaccination, have been previously reported as well (Funk et al., 2004; and the significance was only observed in the early phase Skinner et al., 2010). However, in other works in which higher of vaccination (1 h), by 2.74 fold. The anti-inflammatory doses of bacteria were administered to Eleginops maclovinus gene tgfβ showed no alteration after vaccination, and il10 or S. maximus, increases of cortisol lasted for 7 days or presented a raising trend, although significant induction was even longer after injection (Rodríguez-Quiroga et al., 2017; only observed at 6 h. Compared to the mock injection, lys Oyarzún et al., 2019). showed comparable levels at 1 h post injection, while it Our results also suggest that vaccines do not clearly activate was distinctly up-regulated by 10.59 and 3.25 folds at 6 and the response of brain stress genes during the first hours. Thus, 24 h, respectively. neither crh nor crhbp or gr showed relevant modulation after bath vaccine and only slight changes were observed in hsp and gr after injection. Therefore, this suggests that vaccine DISCUSSION did not activate the central stress gene response unless a physical stressor (air exposure) was included, as observed in Brain and Pituitary Stress Response to the vaccine plus air exposure groups. This agrees with the Vaccines previously reported response of S. aurata to different stressors The combined results from the two vaccination experiments (Skrzynska et al., 2018). indicate that fish perceives the vaccine as a stressor but at On the contrary, in the pituitary, vaccine did induce the gene a limited extent. Thus, bath vaccine did not induce plasma expression of stress-related hormones like prl, gh at 6 h and pomca cortisol rise, while injection vaccine did produce a differential and pomcb peptides at 24 h. Therefore, it seems that the pituitary cortisol response compared to mock injection. In addition, was more sensitive than brain to immune stimulation, although neither plasma CRH nor ACTH values showed important at later time points (6 and 24 h). This may indicate, other alterations after vaccine injection. Therefore, in terms of plasma than a higher sensitivity, that the pituitary stimulation could be hormones, it seems that fish would not perceive vaccines not a direct effect, but resulting from the interaction through Frontiers in Physiology | www.frontiersin.org 8 June 2019 | Volume 10 | Article 717 Liu et al. Neuroendocrine Response in Vaccinated Seabream FIGURE 8 | mRNA expression of pro-inflammatory genes il1β (A), cox2 (B), tnfα (C), anti-inflammatory genes tgfβ (D), il10 (E) and other soluble immune regulators lys (F), c3 (G) in the pituitary of gilthead seabream (Sparus aurata L.) after Lactococcus bacterin or mock injection. Asterisk (∗ ) indicates significant difference between mock and vaccination groups of each time point (P < 0.05). biological messengers such as cytokines. This would be supported Besides the role of GR in mediating the glucocorticoid effect by the fact that both brain and pituitary showed a robust pro- of cortisol in target tissues, some other factors such as CRH inflammatory cytokine response to vaccine (see Figures 7, 8). At and CRHBP could serve as potential feedback agents in the this point, the research has not gone further as receptors for pomc HPI axis. CRH is an ancient stress neuropeptide which is have not yet been cloned in seabream, although attempts have essential for facilitating the adaptive response to environmental been made by several laboratories. The results for trh seem to stressors (Denver, 1999). Binding of CRH with its receptors in follow a similar trend than crh, i.e., reduced activation of the stress pituitary cells stimulates ACTH production. With a high affinity axis, showing a small variation as a response to bath vaccine. At to CRH, CRHBP can sequester CRH in the circulation and thus 1 h, levels were higher than at 6 h which matches with previous modulate its bioavailability (Huising et al., 2004). Normally, a results of Ruiz-Jarabo et al. (2017) and Skrzynska et al. (2018). large proportion of total circulating CRH is complexed with This response could also be related to an inhibition of the thyroid CRHBP, and therefore the availability for receptor activation is hormone axis modulating energetic responses, thus contributing low (Behan et al., 1997). Thus, CRHBP would act as another to save energy resources. This moderate response is also linked potential negative feedback agent of HPI axis as suggested to the expression of both pomc genes. Thus, pomcb showed a by the up-regulation of crhbp in the pituitary of seabream decrease of its expression at 6 h as trh, whereas pomca and crh after vaccination. This agrees with such a proposed role of maintained unaltered levels. CRHBP during acute stress in S. aurata in previous works It is worth to note that vaccination caused a raise of (Martos-Sitcha et al., 2014). cortisol together with some alteration of both hsp and mt Combining the results of gr expression and crhbp with in brain and pituitary. Metallothioneins, similarly than HSP the plasma cortisol content, we could speculate that after are involved in stress response, and their expression can be cortisol increase, up-regulation of crhbp and down-regulation induced by cortisol in fish (Hyllner et al., 1989) as a result of of gr constitute two feedback factors of HPI axis. They would both abiotic and biotic stressors (Iwama et al., 1999; Roberts indirectly inhibit the bioavailability of circulating CRH and et al., 2010; Yamashita et al., 2010). In addition, our recent then suppress the new production of cortisol, reducing the data in skin mucus showed both an increment of cortisol binding of cortisol with GR and finally leading to the descent induced by V. anguillarum vaccine and also a significant bioactivity of cortisol. Besides, induction of inflammation rise of hsp70 (Khansari et al., 2018). During stress, global may help to eliminate potential invading pathogens and RNA translation is supposed to be reduced to save energy, dead cells. On the other hand, prolonged hyperactivation while a selective translation is up-regulated, which facilitates of the immune response may be detrimental and therefore coping with challenges (Holcik and Sonenberg, 2005; Tort and anti-inflammatory cytokines would help to regulate this Teles, 2011). Thus, after vaccination, a decreased expression activation process, which matches with the increase of il10 of some stress genes together with the enhancement of other observed both in brain and pituitary. Thus, the simultaneous key response genes might be associated to energy savings, alteration of plasma cortisol, decreased expression of gr, and thus protective immunity responses could be maintained up-regulated expression of crhbp and pro-inflammatory (Pulendran and Ahmed, 2011). genes, and the down-regulation of anti-inflammatory genes Frontiers in Physiology | www.frontiersin.org 9 June 2019 | Volume 10 | Article 717 Liu et al. Neuroendocrine Response in Vaccinated Seabream could constitute a beneficial picture for homeostasis and response of trout pituitary (Liu et al., 2019). Thus, the immune recovery of fish. response in the central neuroendocrine system might be Overall, in terms of the effect of the vaccine (route of regulated by some mediators produced and released into the vaccination or the bacterial species) the comparison between bloodstream by lymphoid organs as a response to the bacterin both experiments indicates that the stress response to vaccines delivered by intraperitoneal injection. Further studies will focuses more in pituitary or head kidney (associated to the be necessary to precise the mechanisms that can confirm increase of cortisol) than in the brain. As mentioned before, while this hypothesis. slight changes are recorded in either plasma hormones or genes Although both brain and pituitary present a robust immune in brain, in pituitary bath vaccine did modify pomca, pomcb reaction, it is worth noting that the expression trends of expression at 1 h and pomcb at 6 h. In addition, gr increases at immune genes are different between these organs, and this 6 h after bath and decreases after injection vaccination. may be related to the respective tissue architecture. Brain is constituted by neurons and also glia which account for an abundant portion of the brain cell population, acting as the Immune Gene Response in Brain and primary resident macrophages to elicit both innate and adaptive Pituitary After Vaccine Injection immune responses (Yang et al., 2010; Schwartz et al., 2013; Immune responses in fish such as inflammatory and antibody Lenz and Nelson, 2018). Thus, while pituitary have endocrine response elicited by bacteria or pathogen-associated molecular cells as the predominant population, just some stellate cells are patterns (PAMPs) including LPS, poly (I:C), can be detected hypothetically the functional immune cells (Glennon et al., 2015). notably in immune organs like spleen and head kidney (Cvitanich In brain, the participation of glial cells in immune response could et al., 1991; Reyes-Cerpa et al., 2012; Martínez et al., 2018; Sheng be quantitatively rather higher. Therefore, we can hypothesize et al., 2019). A relevant result of the present study is the strong that alterations in the transcription levels of immune genes in immune response occurring both in brain and pituitary after response to intraperitoneal vaccine injection might result from vaccination regardless the overall stress response. Thus, very the different architecture and cell composition of these two significant alterations of il1β, cox2, lys, and c3 were observed organs, thus leading to different signaling elements involved in in the brain and pituitary of vaccinated seabream. IL1β is the immune response. In the case of L. garvieae, it is also possible one of the first cytokines produced at the inflammation site that the strong induction of the pro-inflammatory response could that contributes to induce the expression of other cytokines be associated to the pathogenic neurodegenerative effect of the including TNFα, IL1α, IL6, IL8, COX2, MCP1 (Weber et al., L. garvieae that has been shown to produce brain damage in fish 2010; Zou and Secombes, 2016). Cox2 is a potent mediator of (Vendrell et al., 2006). Moreover, although these hypotheses need inflammation encoding a prostaglandin-endoperoxide synthase further investigation, our findings support the fact that fish brain 2, which is a rate limiting enzyme for formation of prostaglandins is capable of inducing a strong inflammatory response. (PG) functioning under a wide variety of challenging conditions (Smith et al., 1996; Ricciotti and FitzGerald, 2011). The significant raise of pro-inflammatory signaling genes observed in brain CONCLUSION and pituitary suggests that vaccines induced inflammation in these two tissues. It can also be speculated that stimulation of Vaccination, either via bath or injection did not involve a cortisol by the vaccine may be associated with an interaction significant induction of brain-pituitary stress response, although of il1β expression at the pituitary, as previously proposed (see cortisol showed a moderate increase. Other than assuming Tort and Teles, 2011). Moreover, the increased expression of c3, that such antigen stimulus does not involve a direct and responsible for the complement protein C3, and even more the high central perception response, the observed reaction could dramatic raise of lys, responsible for the bacteriolytic protein be also associated to the altered feedback genes of the HPI lysozyme (Sunyer et al., 1997; Hernández and Tort, 2003; Saurabh axis gr and crhbp that may have played a relevant role and Sahoo, 2008), indicates an effective activation of innate in preventing the maintenance of higher cortisol levels in immune responses in the central neuroendocrine tissues after the brain and pituitary and therefore also preventing cortisol intraperitoneal vaccination. The combination of the alteration immunosuppressive consequences. Such a mechanism could of inflammatory genes plus the increase of the immune innate modulate the initial stress response and the pleiotropic cortisol genes supports the occurrence of a significant immune response action, thus helping to prevent the putative suppression of an in the pituitary. active immune response in the neuroendocrine centers. Thus, There is not precisely known what are the precise mechanisms the raise of cortisol caused by the vaccination would not be of interaction between hormone elements and immune achieved through the initial activation of the central brain- agents. Normally, due to the protection of the blood brain pituitary axis elements. Besides, a robust immune response was barrier, pathogens can hardly access to the brain or pituitary. elicited both in brain and pituitary regardless the route of However, some mediators such as cytokines can play a administration, bath or injection, as shown by the up-regulation role of connecting antigens and response (Banks et al., of cytokines and innate response genes. Thus, results suggest 1995). In our previous works we observed that both the an active and direct immune action of the vaccine components medium from the in vitro cultured spleen and recombinant in brain and pituitary tissues uncoupled from the initial stress IL1β presented a significant effect on the in vitro immune HPI axis response. Frontiers in Physiology | www.frontiersin.org 10 June 2019 | Volume 10 | Article 717 Liu et al. Neuroendocrine Response in Vaccinated Seabream DATA AVAILABILITY the manuscript. All authors read, corrected and approved the final manuscripts. All datasets for this study are included in the manuscript and the supplementary files. FUNDING ETHICS STATEMENT This research was funded by projects AGL2016-76069- C2 and AGL2016-81808-REDT of MICINN (Spain) All experimental procedures were submitted by the Ethical with the support of FEDER funds (European Union). Committee of the Universitat Autonoma de Barcelona XL was recipient of grants named Major program (CEEAH), in accordance with the international European of science and technology commission foundation of Guiding Principles for Biomedical Research Involving Animals Chongqing (cstc2014yykfc80001), and Doctoral Fund of (EU2010/63) and authorized by the regional authority Southwest University (SWU119006). AK was recipient of (Generalitat de Catalunya Procedure Ref. 10208). a grant from the Iran Ministry of Science, Research and Technology. LT and FR-L are members of the Xarxa AUTHOR CONTRIBUTIONS d’Aquicultura de Catalunya. LT, JM, and FR-L conceived and designed the experiments. XL, AK, MT, and FR-L performed the experiments. XL, AK, ACKNOWLEDGMENTS GM-R, LT, and FR-L analyzed the data. YZ, GM-R, JM, and FR-L contributed the reagents and materials. XL, AK, MT, Thanks are given to Irene Brandts and Aleix Castellvi for their YZ, JM, GM-R, FR-L, and LT contributed to the writing of assistance in the sample collection. REFERENCES susceptibility to kudoa thyrsites in Atlantic salmon (Salmo salar L.). Fish Shellfish Immunol. 17, 375–387. doi: 10.1016/j.fsi.2004.04.014 Arends, R. J., Mancera, J. M., Muñoz, J. L., Wendelaar Bonga, S. E., and Flik, G. Glennon, E., Kaunzner, U. W., Gagnidze, K., McEwen, B. S., and Bulloch, K. (2015). (1999). The stress response of the gilthead sea bream (Sparus aurata L.) to Pituitary dendritic cells communicate immune pathogenic signals. Brain Behav. air exposure and confinement. J. Endocrinol. 163, 149–157. doi: 10.1677/joe. Immun. 50, 232–240. doi: 10.1016/j.bbi.2015.07.007 0.1630149 Gorissen, M., and Flik, G. (2016). “The endocrinology of the stress response in fish: Banks, W. A., Kastin, A. J., and Broadwell, R. D. (1995). Passage of cytokines across an adaptation-physiological view,” in Biology of Stress in Fish, eds C. Schreck, the blood-brain barrier. Neuroimmunomodulation 2, 241–248. doi: 10.1159/ L. Tort, A. P. Farrell, and C. B. Brauner (Cambridge, MA: Academic Press), 000097202 75–111. doi: 10.1016/b978-0-12-802728-8.00003-5 Behan, D. P., Khongsaly, O., Owens, M. J., Chung, H. D., Nemeroff, C. B., and Hastein, T., Gudding, R., and Evensen, O. (2005). Bacterial vaccines for fish-an De Souza, E. B. (1997). Corticotropin-releasing factor (CRF), CRF-binding update of the current situation worldwide. Dev. Biol. 121, 55–74. protein (CRF-BP), and CRF/CRF-BP complex in Alzheimer’s disease and Hernández, A., and Tort, L. (2003). Annual variation of complement, lysozyme control postmortem human brain. J. Neurochem. 68, 2053–2060. doi: 10.1007/ and agglutination in serum of the gilthead seabram Sparus aurata. Fish Shellfish BF03347284 Immunol. 15, 479–481. doi: 10.1016/s1050-4648(03)00024-x Cerdá-Reverter, J. M., and Canosa, L. F. (2009). “Neuroendocrine systems of the Holcik, M., and Sonenberg, N. (2005). Translational control in stress and apoptosis. fish brain,” in Fish Neuroendocrinology, Vol. 28, eds N. J. Bernier, G. Van Der Nat. Rev. Mol. Cell Biol. 6, 318–327. doi: 10.1038/nrm1618 Kraak, A. P. Farrell, and C. J. Brauner (Cambridge, MA: Academic Press), 3–74. Huising, M. O., Metz, J. R., van Schooten, C., Taverne-Thiele, A. J., Hermsen, T., doi: 10.1016/s1546-5098(09)28001-0 Verburg-van Kemenade, B. M. L., et al. (2004). Structural characterisation of Cvitanich, J. D., Garaten, O., and Smith, C. E. (1991). The isolation of a rickettsia- a cyprinid (Cyprinus carpio L.) CRH, CRH-BP and CRH-R1, and the role of like organism causing disease and mortality in chilean salmonids and its these proteins in the acute stress response. J. Mol. Endocrinol. 32, 627–648. confirmation by koch’s postulate. J. Fish Dis. 14, 121–145. doi: 10.1111/j.1365- doi: 10.1677/jme.0.0320627 2761.1991.tb00584.x Hyllner, S. J., Andersson, T., Haux, C., and Olsson, P. E. (1989). Cortisol induction Denver, R. J. (1999). Evolution of the corticotropin-releasing hormone of metallothionein in primary culture of rainbow trout hepatocytes. J. Cell signaling system and its role in stress-induced phenotypic plasticity. Physiol. 139, 24–28. doi: 10.1002/jcp.1041390105 Ann. N. Y. Acad. Sci. 897, 46–53. doi: 10.1111/j.1749-6632.1999.tb07 Iwama, G. K., Vijayan, M. M., Forsyth, R. B., and Ackerman, P. A. (1999). 877.x Heat shock proteins and physiological stress in fish. Am. Zool. 39, 901–909. Figueras, A., Santarem, M. M., and Novoa, B. (1998). Influence of the sequence doi: 10.2307/3884400 of administration of beta-glucans and a vibrio damsela vaccine on the immune Kaattari, S. L., and Tripp, R. A. (1987). Cellular mechanisms of glucocorticoid response of turbot (Scophthalmus maximus L.). Vet. Immunol. Immunopathol. immunosuppression in salmon. J. Fish Biol. 31, 129–132. doi: 10.1111/j.1095- 64, 59–68. doi: 10.1016/s0165-2427(98)00114-7 8649.1987.tb05304.x Flik, G., Peter, H. M., Klaren, P. H. M., Erwin, H., Van den Burg, J. R., and Huising, Karalis, K., Louis, J. M., Bae, D., Hilderbrand, H., and Majzoub, J. A. (1997). CRH M. O. (2006). CRF and stress in fish. Gen. Comp. Endocrinol. 146, 36–44. and the immune system. J. Neuroimmunol. 72, 131–136. doi: 10.1016/s0165- doi: 10.1016/j.ygcen.2005.11.005 5728(96)00178-6 Frans, I., Michels, C. W., Bossier, P., Willems, K. A., Lievens, B., and Rieders, Khansari, A. R., Balasch, J. C., Vallejos-Vidal, E., Parra, D., Reyes-Lopez, H. (2011). Vibrio anguillarum as a fish pathogen: virulence factors, diagnosis F. E., and Tort, L. (2018). Comparative immune- and stress-related and prevention. J. Fish Dis. 34, 643–666. doi: 10.1111/j.1365-2761.2011.01 transcript response induced by air exposure and Vibrio anguillarum bacterin 279.x in rainbow trout (Oncorhynchus mykiss) and Gilthead seabream (Sparus Funk, V. A., Jones, S. R., Kim, E., Kreiberg, H., Taylor, K., Wu, S., et al. (2004). aurata) mucosal surfaces. Front. Immunol. 9:856. doi: 10.3389/fimmu.2018. The effect of vaccination and sea water entry on immunocompetence and 00856 Frontiers in Physiology | www.frontiersin.org 11 June 2019 | Volume 10 | Article 717 Liu et al. Neuroendocrine Response in Vaccinated Seabream Khansari, A. R., Parra, D., Reyes-Lopez, F. E., and Tort, L. (2017). Modulatory Ricciotti, E., and FitzGerald, G. A. (2011). Prostaglandins and inflammation. in vitro effect of stress hormones on the cytokine response of rainbow trout Arterioscler. Thromb. Vasc. Biol. 31, 986–1000. doi: 10.1161/ATVBAHA.110. and gilthead seabream head kidney stimulated with Vibrio anguillarum 207449 bacterin. Fish Shellfish Immun. 70, 736–749. doi: 10.1016/j.fsi.2017. Roberts, R. J., Agius, C., Saliba, C., Bossier, P., and Sung, Y. Y. (2010). Heat shock 09.009 proteins (chaperones) in fish and shellfish and their potential role in relation Kudielka, B. M., and Kirschbaum, C. (2007). “Biological bases of the stress to fish health: a review. J. Fish Dis. 33, 789–801. doi: 10.1111/j.1365-2761.2010. response,” in Stress and Addiction: Biological and Psychological Mechanisms, 01183.x ed. M. E. Al’Absi (San Diego, CA: Academic Press), 3–19. doi: 10.1016/b978- Rodgers, C. J. (1990). Immersion vaccination for control of fish 012370632-4/50004-8 furunculosis. Dis. Aquat. Organ. 8, 69–72. doi: 10.3354/dao00 Lamers, C. H. J., Dehaas, M. J. H., and Vanmuiswinkel, W. B. (1985). The reaction 8069 of the immune system of fish to vaccination - development of immunological Rodríguez-Quiroga, J. J., Otero-Rodiño, C., Suárez, P., Nieto, T. P., García Estévez, memory in carp, Cyprinus carpio L, following direct immersion in Aeromonas J. M., San Juan, F., et al. (2017). Differential effects of exposure to parasites and hydrophila bacterin. J. Fish Dis. 8, 253–262. doi: 10.1111/j.1365-2761.1985. bacteria on stress response in turbot Scophthalmus maximus simultaneously tb00941.x stressed by low water depth. J. Fish Biol. 91, 242–259. doi: 10.1111/jfb.1 Lenz, K. M., and Nelson, L. H. (2018). Microglia and beyond: 3338 innate immune cells as regulators of brain development and Rotllant, J., Ruane, N. M., Dinis, M. T., Canarion, A. V. M., and Power, D. M. behavioral function. Front. Immunol. 9:698. doi: 10.3389/fimmu.2018. (2006). Intra-adrenal interactions in fish: catecholamine stimulated cortisol 00698 release in sea bass (Dicentrarchus labrax L.). Comp. Biochem. Physiol. A. 143, Liu, X., Khansari, A. R., and Tort, L. (2019). Fish pituitary show 375–381. doi: 10.1016/j.cbpa.2005.12.027 an active immune response after in vitro stimulation with vibrio Ruiz-Jarabo, I., Klaren, P. H. M., Louro, B., Martos-Sitcha, J. A., Pinto, P. I. S., bacterin. Gen. Comp. Endocrinol. 275, 65–72. doi: 10.1016/j.ygcen.2019. Vargas-Chacoff, L., et al. (2017). Characterization of the peripheral thyroid 02.011 system of gilthead seabream acclimated to different ambient salinities. Comp. Martínez, D., Vargas-Lagos, C., Oyarzún, R., Loncoman, C. A., Pontigo, J. P., Biochem. Physiol. A Mol. Integr. Physiol. 203, 24–31. doi: 10.1016/j.cbpa.2016. Yáñez, A. J., et al. (2018). Temperature modulates the immunological response 08.013 of the sub-antarctic notothenioid fish Eleginops maclovinus injected with Sapolsky, R. M., Romero, L. M., and Munck, A. U. (2000). How do Piscirickettsia salmonis. Fish Shellfish Immunol. 82, 492–503. doi: 10.1016/j.fsi. glucocorticoids influence stress responses? Integrating permissive, suppressive, 2018.08.042 stimulatory, and preparative actions. Endocr. Rev. 21, 55–89. doi: 10.1210/er. Martos-Sitcha, J. A., Wunderink, Y. S., Straatjes, J., Skrzynska, A. K., Mancera, 21.1.55 J. M., and Martínez-Rodríguez, G. (2014). Different stressors induce differential Saurabh, S., and Sahoo, P. K. (2008). Lysozyme: an important defence molecule of responses of the CRH-stress system in the gilthead sea bream (Sparus aurata). fish innate immune system. Aquac. Res. 39, 223–239. doi: 10.1111/j.1365-2109. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 177, 49–61. doi: 10.1016/j.cbpa. 2007.01883.x 2014.07.021 Schreck, C. B., and Tort, L. (2016). “The concept of stress in fish,” in Biology Metz, J. R., Huising, M. O., Leon, K., Verburg-van Kemenade, B. M. L., and of Stress in Fish. Fish Physiology Series, Vol. 35, eds C. B. Schreck, L. Flik, G. (2006). Central and peripheral interleukin-1 beta and interleukin- Tort, A. T. Farrell, and C. J. Brauner (Cambridge, MA: Academic Press), 1 receptor I expression and their role in the acute stress response of 2–34. common carp Cyprinus carpio L. J. Endocrinol. 191, 25–35. doi: 10.1677/joe.1.0 Schwartz, M., Kipnis, J., Rivest, S., and Prat, A. (2013). How do 6640 immune cells support and shape the brain in health, disease, and Mutoloki, S., Munang’andu, H. M., and Evensen, O. (2015). Oral vaccination of aging? J. Neurosci. 33, 17587–17596. doi: 10.1523/Jneurosci.3241-13. fish – antigen preparations, uptake, and immune induction. Front. Immunol. 2013 6:519. doi: 10.3389/fimmu.2015.00519 Sheng, X. Z., Chai, B. H., Wang, Z. F., Tang, X. Q., Xiang, J., and Zhan, W. B. (2019). Ottaviani, E., Franchini, A., and Franceschi, C. (1995). Evidence for the presence Polymeric immunoglobulin receptor and mucosal IgM responses elicited by of immunoreactive pomc-derived peptides and cytokines in the thymus of immersion and injection vaccination with inactivated Vibrio anguillarum the goldfish (Carassius auratus). Histochem. J. 27, 597–601. doi: 10.1007/ in flounder (Paralichthys olivaceus). Aquaculture 505, 1–11. doi: 10.1016/j. bf00173096 aquaculture.2019.02.045 Oyarzún, R., Vargas-Lagos, C., Martínez, D., Muñoz, J. L. P., Dantagnan, L. P., Skinner, L. A., LaPatra, S. E., Adams, A., Thompson, K. D., Balfry, S. K., McKinley, and Vargas-Chacoff, L. (2019). The effects of intraperitoneal administration R. S., et al. (2010). Supra-physiological levels of cortisol suppress lysozyme of Francisella noatunensis subsp. noatunensis on hepatic intermediary but not the antibody response in Atlantic salmon, Salmo salar L., following metabolism and indicators of stress in Patagonian blennie Eleginops maclovinus. vaccine injection. Aquaculture 300, 223–230. doi: 10.1016/j.aquaculture.2010. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 230, 48–56. doi: 10.1016/j.cbpb. 01.002 2019.01.013 Skrzynska, A. K., Maiorano, E., Bastaroli, M., Naderi, F., Míguez, J. M., Martínez- Padgett, D. A., and Glaser, R. (2003). How stress influences the immune Rodríguez, G., et al. (2018). Impact of air exposure on vasotocinergic response. Trends Immunol. 24, 444–448. doi: 10.1016/S1471-4906(03)00 and isotocinergic systems in gilthead sea bream (Sparus aurata): new 173-X insights on fish stress response. Front. Physiol. 9:96. doi: 10.3389/fphys.2018.0 Pfaffl, M. W. (2001). A new mathematical model for relative quantification in 0096 real-time RT-PCR. Nucleic Acids Res. 29:e45. doi: 10.1093/nar/29.9.e45 Smith, W. L., Garavito, R. M., and DeWitt, D. L. (1996). Prostaglandin Plant, K. P., and LaPatra, S. E. (2011). Advances in fish vaccine delivery. Dev. Comp. endoperoxide H synthases (cyclooxygenases)-1 and -2. J. Biol. Chem. 271, Immunol. 35, 1256–1262. doi: 10.1016/j.dci.2011.03.007 33157–33160. doi: 10.1074/jbc.271.52.33157 Pulendran, B., and Ahmed, R. (2011). Immunological mechanisms of vaccination. Sunyer, J. O., Tort, L., and Lambris, J. D. (1997). Strutural C3 diversity in Nat. Immunol. 12, 509–517. doi: 10.1038/ni.2039 fish: characterization of five forms of C3 in the diploid fish Sparus aurata. Quintanar, J. L., and Guzman-Soto, I. (2013). Hypothalamic neurohormones J. Immunol. 158, 2813–2821. and immune responses. Front. Integr. Neurosci. 7:56. doi: 10.3389/fnint.2013. Teles, M., Boltaña, S., Reyes-López, F., Santos, M. A., Mackenzie, S., and Tort, L. 00056 (2013). Effects of chronic cortisol administration on global expression of GR Reyes-Cerpa, S., Reyes-López, F. E., Toro-Ascuy, D., Ibañez, J., Maisey, K., Sandino, and the liver transcriptome in Sparus aurata. Mar. Biotechnol. 15, 104–114. doi: A. M., et al. (2012). IPNV modulation of pro and anti-inflammatory cytokine 10.1007/s10126-012-9467-y expression in Atlantic salmon might help the establishment of infection Tort, L. (2011). Stress and immune modulation in fish. Develop. and persistence. Fish Shellfish Immunol. 32, 291–300. doi: 10.1016/j.fsi.2011. Comp. Immunol. 35, 1366–1375. doi: 10.1016/j.dci.2011. 11.018 07.002 Frontiers in Physiology | www.frontiersin.org 12 June 2019 | Volume 10 | Article 717 Liu et al. Neuroendocrine Response in Vaccinated Seabream Tort, L., and Teles, M. (2011). “The endocrine response to stress - a comparative Zou, J., and Secombes, C. J. (2016). The function of fish cytokines. Biology 5:23. view,” in Basic and Clinical Endocrinology Up-To-Date, ed. A. Fulya (London: doi: 10.3390/biology5020023 InTech Press), 263–286. Vendrell, D., Balcázar, J. L., Ruiz-Zarzuela, I., de Blas, I., Gironés, O., and Conflict of Interest Statement: The authors declare that the research was Múzquiz, J. L. (2006). Lactococcus garvieae in fish: a review. Comp. conducted in the absence of any commercial or financial relationships that could Immunol. Microbiol. Infect. Dis. 29, 177–198. doi: 10.1016/j.cimid.2006. be construed as a potential conflict of interest. 06.003 Weber, A., Wasiliew, P., and Kracht, M. (2010). Interleukin-1 (IL-1) pathway. Sci. Copyright © 2019 Liu, Khansari, Teles, Martínez-Rodríguez, Zhang, Mancera, Signal. 3:cm1. doi: 10.1126/scisignal.3105cm1 Reyes-López and Tort. This is an open-access article distributed under the terms Yamashita, M., Yabu, T., and Ojima, N. (2010). Stress protein hsp70 in fish. Aqua of the Creative Commons Attribution License (CC BY). The use, distribution or Biosci. Monogr. 3, 111–141. doi: 10.5047/absm.2010.00304.0111 reproduction in other forums is permitted, provided the original author(s) and the Yang, I., Han, S. J., Kaur, G., Crane, C., and Parsa, A. T. (2010). The role of microglia copyright owner(s) are credited and that the original publication in this journal in central nervous system immunity and glioma immunology. J. Clin. Neurosci. is cited, in accordance with accepted academic practice. No use, distribution or 17, 6–10. doi: 10.1016/j.jocn.2009.05.006 reproduction is permitted which does not comply with these terms. Frontiers in Physiology | www.frontiersin.org 13 June 2019 | Volume 10 | Article 717