ORIGINAL RESEARCH published: 09 May 2019 doi: 10.3389/fimmu.2019.01058 Myo1f, an Unconventional Long-Tailed Myosin, Is a New Partner for the Adaptor 3BP2 Involved in Mast Cell Migration Arnau Navinés-Ferrer 1,2 , Erola Ainsua-Enrich 1,2 , Eva Serrano-Candelas 1,2 , Joan Sayós 3 and Margarita Martin 1,2* 1 Biochemistry Unit, Biomedicine Department, Faculty of Medicine, University of Barcelona, Barcelona, Spain, 2 Laboratory of Clinic and Experimental Immunoallergy, IDIBAPS, Barcelona, Spain, 3 Immune Regulation and Immunotherapy Group, CIBBIM-Nanomedicine, Vall d’Hebron University Hospital, Research Institute (VHIR), Autonomous University of Barcelona, Edited by: Barcelona, Spain Carlo Pucillo, University of Udine, Italy Reviewed by: Mast cell chemotaxis is essential for cell recruitment to target tissues, where these Petr Draber, cells play an important role in adaptive and innate immunity. Stem cell factor (SCF) is Institute of Molecular Genetics a major chemoattractant for mast cells. SCF binds to the KIT receptor, thereby triggering (ASCR), Czechia Lubica Draberova, tyrosine phosphorylation in the cytoplasmic domain and resulting in docking sites for Institute of Molecular Genetics SH2 domain-containing molecules, such as Lyn and Fyn, and the subsequent activation (ASCR), Czechia Wahn Soo Choi, of the small GTPases Rac that are responsible for cytoskeletal reorganization and mast Konkuk University, South Korea cell migration. In previous works we have reported the role of 3BP2, an adaptor molecule, *Correspondence: in mast cells. 3BP2 silencing reduces FcεRI-dependent degranulation, by targeting Lyn Margarita Martin and Syk phosphorylation, as well as SCF-dependent cell survival. This study examines martin_andorra@ub.edu its role in SCF-dependent migration and reveals that 3BP2 silencing in human mast cell Specialty section: line (LAD2) impairs cell migration due to SCF and IgE. In that context we found that This article was submitted to 3BP2 silencing decreases Rac-2 and Cdc42 GTPase activity. Furthermore, we identified Molecular Innate Immunity, a section of the journal Myo1f, an unconventional type-I myosin, as a new partner for 3BP2. This protein, Frontiers in Immunology whose functions have been described as critical for neutrophil migration, remained Received: 04 February 2019 elusive in mast cells. Myo1f is expressed in mast cells and colocalizes with cortical Accepted: 25 April 2019 Published: 09 May 2019 actin ring. Interestingly, Myo1f-3BP2 interaction is modulated by KIT signaling. Moreover, Citation: SCF dependent adhesion and migration through fibronectin is decreased after Myo1f Navinés-Ferrer A, Ainsua-Enrich E, silencing. Furthermore, Myo1f silencing leads to downregulation of β1 and β7 integrins Serrano-Candelas E, Sayós J and on the mast cell membrane. Overall, Myo1f is a new 3BP2 ligand that connects the Martin M (2019) Myo1f, an Unconventional Long-Tailed Myosin, Is adaptor to actin cytoskeleton and both molecules are involved in SCF dependent mast a New Partner for the Adaptor 3BP2 cell migration. Involved in Mast Cell Migration. Front. Immunol. 10:1058. Keywords: adaptor molecules, unconventional myosins, KIT signaling, mast cells, cell migration and adhesion, doi: 10.3389/fimmu.2019.01058 cytoske leton Frontiers in Immunology | www.frontiersin.org 1 May 2019 | Volume 10 | Article 1058 Navinés-Ferrer et al. 3BP2 and Myo1f in Mast Cell Migration INTRODUCTION (amoeboid) forms (Myo1e and f). All class I myosins consist of an N-terminal motor domain, light-chain-binding IQ motifs Mast cell recruitment into connective tissue in a healthy or (calmodulin binding) and a basic tail homology 1 (TH1) domain pathological situation requires cell adhesion, spreading and thought to affect interactions with membranes. Long-tailed class I migration, and these events are transduced from external stimuli myosins have an additional proline-rich TH2 domain and a TH3 to cytoskeleton rearrangements. Most established mast cell domain containing a single Src homology 3 (SH3) domain (11). chemoattractants are antigens recognized by immunoglobulins The Myo1f transcript has been described as selectively expressed bound to FcεRI and stem cell factor (SCF), the ligand for in the spleen, mesenteric lymph nodes, thymus, lung, NK cells, the KIT receptor, a type III tyrosine kinase receptor (1). KIT macrophages, and dendritic cells (13). signal transduction is crucial for mast cell growth, survival and Interestingly, Myo1f knockout mice have also been reported differentiation, as well as for the migration and homing of to show increased susceptibility to infection by Listeria mast cells into target tissues. KIT through PI3 kinase signaling monocytogenes as a consequence of abnormally increased influences mast cell growth and survival (2). SCF is a major adhesion and reduced motility of neutrophils. This increased chemotactic attractant for mast cells and their precursors. adhesion results from augmented exocytosis of β2 integrin- Once bound to KIT, SCF causes KIT tyrosine phosphorylation containing granules (14). and formation of docking sites for SH2 domain-containing This study examines the capacity of 3BP2 to regulate Rho molecules, such as Lyn and Fyn. Activation of Fyn leads to GTPase activity and mast cell migration and identifies Myo1f as phosphorylation of Gab2 and subsequent activation of the small a binding partner for 3BP2. Further, it characterizes Myo1f GTPase Rac that is responsible for the cytoskeletal reorganization expression and distribution in mast cells and evaluates Myo1f and mast cell migration (3). function in adhesion, integrin expression, and SCF dependent The SH3-binding protein 2 (3BP2) is a cytoplasmic adapter migration in mast cells. protein originally identified to bind to the tyrosine kinase Abl SH3 domain (4). Human 3BP2 is a 561-aa protein containing an N-terminal pleckstrin homology (PH) domain, an SH3- MATERIALS AND METHODS binding proline-rich region, and a C-terminal SH2 domain. 3BP2 positively regulates mast cell responses through FcεRI Cell Lines and Reagents and KIT receptors (5, 6). The knockdown expression of 3BP2 The LAD2 huMC line kindly provided by Drs. A. Kirshenbaum reduces degranulation, cytokine secretion and mast cell survival and D.D. Metcalfe (National Institutes of Health, Bethesda, MD) (5, 6). It has been reported that 3BP2 is required for optimal was grown in StemPro-34 media (Life Technologies, Carlsbad, activation of Src family kinases and small GTPase Rac2 that CA), supplemented with StemPro-34 nutrient and L-glutamine regulates chemoattractant-mediated neutrophil activation, and (2 mM), penicillin (100 U/mL) and streptomycin (100 µg/mL), motility. Consequently, the loss of 3BP2 increases susceptibility and 100 ng/mL SCF (Amgen, Thousand Oaks, CA) (15). The to infections such as Listeria monocytogenes. These functional human mast cell line HMC-1 was obtained from J.H. Butterfield defects are partially explained by the failure to fully activate Vav1 (Mayo Clinic, Rochester, MN, USA) and was grown in Iscove’s (7). Vav1 is a guanosine-nucleotide-exchange factor (GEF) for medium supplemented with 10% heat-inactivated FBS, penicillin members of the Rho GTPase family (8). RhoA, Rac1,2,3, and (100 U/ml), and streptomycin (100 µg/ml) (16). COS-7 cell line Cdc42 belong to the family of Rho GTPases that regulates a range was cultured in Dulbecco’s Modified Eagle Medium (DMEM), of biological response pathways, including cell motility and actin 10% FCS, 1% penicillin-streptomicin (mixture 5k/5k), 1% L- dynamics (9). glutamine A 200 mM. This work aims to investigate the role of 3BP2 in cytoskeleton reorganization and mast cell migration. In order to shed light on Antibodies and Other Reagents the molecules involved in 3BP2 signalosome, the three-hybrid Mouse antibodies, α-3BP2 C5, α-3BP2 C11, α-Myo1f C5, α-KIT screening system was performed on a bone marrow expression (clone Ab81), and rabbit α-Kit (H300) were purchased from library using human 3BP2 as bait. Vav1 and Myo1f were found to Santa Cruz (Santa Cruz Biotechnology, Inc. Santa Cruz, CA). be ligand partners for 3BP2. Vav1 has previously been reported Mouse anti-CD29-APC (α-integrin β1) clone MAR4 from BD to bind to Y183 3BP2 (10), but Myo1f represents a novel binding Pharmigen (BD Biosciences, San José, CA), mouse α-integrin ligand for 3BP2 and its expression and function in mast cells β7-PE from Biolegend (San Diego, CA), goat α-mouse alexa- remain elusive. 647, and goat α-rabbit alexa-488 were from Life Technologies Myo1f is a long-tailed unconventional class I myosin whose (Carlsbad, CA), mouse α-human-FcεRI-PE from eBioscience gene is located on the chromosome 19 (19p13.3-p13.2) (11). (San Diego, CA). Mouse α-Rac1, α-RhoA, and α-Cdc42 Myosins are actin-dependent molecular motors that use the antibodies were from Cytoskeleton (Cytoskeleton Inc., Denver, energy from ATP hydrolysis to move along actin filaments CO), mouse α-Rac2 antibody was from antibodies-online. (12). Class I myosins are evolutionarily ancient, represent the Antiphosphotyrosine (pTyr) monoclonal was obtained from largest group of unconventional myosins and exist in a wide Zymed Laboratories (Invitrogen Life Technologies, Carlsbad, range of species. Mice and humans have a total of eight class I CA). Biotinylated human IgE (IgEB) was obtained from myosin heavy-chain genes, six of which encode short-tailed forms Abbiotec (San Diego, CA, USA). Anti-mouse peroxidase Ab (Myo1a, b, c, d, g and h) and two of which encode long-tailed was obtained from DAKO (Carpinteria, CA, USA). Streptavidin, Frontiers in Immunology | www.frontiersin.org 2 May 2019 | Volume 10 | Article 1058 Navinés-Ferrer et al. 3BP2 and Myo1f in Mast Cell Migration the tyrosine kinase inhibitor sunitinib malate, puromycin, poly- lysis buffer, snap-frozen in liquid nitrogen and processed within 2 lysine-D, fibronectin, doxycycline hyclate, mouse α-tubulin weeks after preparation. Lysate aliquots, corresponding to Rac1- (DM1A), and mouse α-flag (m2Ab) were purchased from Rac2, Cdc42, and RhoA assays, were applied, respectively, to Sigma (Sigma-Aldrich, St. Louis, MO, USA). α-pKIT Tyr703 wells coated with Rac1, Cdc42, or Rho-GTP-binding protein. was from Cell Signaling (Cell Signaling Technology, Danvers, Active, GTP-bound GTPases bound to the wells were detected MA) and α-GPF from Roche (Roche Molecular Biochemical, with the corresponding specific Ab. Constitutively active proteins Pleasanton, CA). Goat α-rabbit-HRP was from Life Technologies were used as a standard. (Life Technologies). Immunoprecipitation, Immunoblotting, and Cell Activation or Inhibition COS Transfection Cells were starved overnight in culture media without SCF. Cells were treated with Sunitinib as described above. Whole The following day, cells were stimulated with 100 ng/ml of cell lysate preparations were obtained as described elsewhere SCF in Tyrode’s buffer for the indicated times. For IgE- (20). Immunoprecipitation experiments were conducted using a dependent activation we sensitized cells with biotinylated IgE procedure described elsewhere (5). COS-7 cells were transiently (0.1 µg/ml) overnight, and stimulated them for 30 min at 37◦ C transfected using Nucleofector (Cell Line Nucleofector Kit V with streptavidin (0.4 µg/ml) to induce IgE crosslinking. For from Lonza Cologne AG, Lonza) following the manufacturer’s inhibition, cells were incubated with Sunitinib for 30 min at 37◦ C instructions. Cells were transfected with a flag-tagged Myo1f in Tyrode’s Buffer, DMSO was used as a control. construct from (OriGene Technologies, Rockville, MD), cloned into a pCMV6-Entry plasmid. 3BP2 cloned in pCDNA 3.1 and Immunofluorescence Assays Fyn cloned in psrα used in COS transfections were described Cells were activated or inhibited as described above. Afterwards, in Saborit et al. (21) and Alvarez-Errico et al. (22), respectively. cells were fixed in PFA 4%—phosphate buffered saline (PBS) at SH2-3BP2-GFP construct was obtained cloning the SH2 domain 4◦ C. Then, cells were seeded on a poly-lysine-D coated plate with of 3BP2 into a pN3-EGFP construct (Clontech Laboratories, a Cytospin device (50.000 cells/sample). Cells were permeabilized Inc, Mountain View, CA, USA); pN3-EGFP plasmid was used with Saponin buffer (PBS-0.05% Saponin) for 15 min at 4◦ C. as control. Afterwards, we used blocking buffer [0.2% skimmed milk, 2% FCS, 1% bovine serum albumin (BSA), 0.01% triton X-100, 0.01% NaN3 , 20% Rabbit Serum (or 20% FCS), dissolved in PBS] for Lentiviral Transduction 1 h at 4◦ C. We used primary antibodies (0.1–0.2 µg/100.000 cell) Lentiviral particles to silence the 3BP2 gene expression were for 2 h of incubation at 4◦ C. At last, we used goat anti-mouse or generated using Mission shRNA technology, according to the goat anti-rabbit secondary antibodies labeled with Alexa-488 or manufacturer’s instructions (Sigma-Aldrich, St. Louis, MO) as Alexa-647 for 45 min (dilution 1:300 – 1:500) at 4◦ C. For nuclei described elsewhere (5, 6). The lentivirus with shRNA sequences staining we used Hoechst stain (dilution 1:10.000 in PBS-0.1% A, B, C, or D for Myo1f were from Origen Technologies. The BSA), and for actin staining we used phalloidin-TRITC (dilution TRCN0000158118 sequence that overlaps with sequence D in 1:500 – 1:1000). Preparations were visualized with a Leica SP5 the Origen plasmids (CGTCTTCAAGACCGAGTTTGT) was confocal microscope. All images were processed with Fiji/ImageJ furthered cloned into a Tet-pLKO-puro plasmid [Addgene free software (17). plasmid 21915; (23)] which expression is inducible by doxycycline (0.5 µg/mL) and used for subsequent experiments. Yeast Three-Hybrid Assay The Lenti ORF clone of human SH3-domain binding protein The yeast three-hybrid system was performed as described 2 (SH3BP2), transcript variant 1, mGFP tagged and Lenti vector elsewhere (18). The 3BP2 adaptor cloned in the bicistronic with C-terminal monomeric GFP tag as a control (OriGene pBridge vector (which carries the src-Fyn clone) and transformed Technologies) were used for 3BP2 overexpression experiments. in the yeast strain CG1945 was used as a bait to screen a human bone marrow matchmaker cDNA library cloned in Migration Assays pACT2 (Clontech Laboratories Inc, Mountain View, CA, USA). Migration assays were performed using transwell polycarbonate Cotransformed clones that grew under restrictive conditions membranes from Costar (8 µm pores, Corning Incorporated, were then tested using the β-galactosidase assay. The β- Kennebunk, ME) suitable for mast cells as reported in Kataoka galactosidase liquid culture assay using o-nitrophenyl β-D- et al. (24). Briefly, LAD2 cells were starved O/N in complete galactopyranoside as a substrate was carried out as described media without SCF and, when necessary, with biotinylated IgE. in the Clontech yeast protocols handbook. Positive clones were The next day, 1 × 105 cells per point were washed with fresh processed to purify their plasmids and they were sequenced. StemPro-34 media and dropped into the upper transwells. After 10 min for stabilization we added the stimulus on the bottom Active GTPase Assays well (100 ng/mL of SCF, 0.4 µg/ml streptavidin or StemPro GTPase activation assays were performed using Rac1, Cdc42, Supplement 1x), and the cells were left to migrate for 4 h at 37◦ C and RhoA G-LISA kits following manufacturer’s instructions and 5% CO2 . After 4 h the cells were rinsed with an EDTA-NaCl- (Cytoskeleton) as well as described elsewhere (19). Briefly, Cell PBS buffer to detach them from the bottom of the upper chamber, lysates (5 × 105 to 2 × 106 cells) were prepared using G-LISA they were stained with crystal violet and counted under optic Frontiers in Immunology | www.frontiersin.org 3 May 2019 | Volume 10 | Article 1058 Navinés-Ferrer et al. 3BP2 and Myo1f in Mast Cell Migration microscopy. In all cases, the cells in the upper chamber were line in which KIT has the gain-of-function mutation D816V. counted after 4 h with Trypan blue to evaluate viability. As shown in Figure 2, 3BP2 silencing impairs cell migration toward SCF in HMC-1 cells. In this case migration basal levels Adhesion Assays are higher than those observed in LAD2 mast cells since KIT P96 plates were coated O/N with fibronectin (20 µg/mL), poly- signaling is constitutively active. Although the mutation confers lysine-D (0.1% w/v) or PBS. Next day, wells were washed with receptor activation in absence of SCF, SCF addition still increases PBS, blocked with 5% BSA and washed again with PBS. 1–5 cell activation as reported by us and others (6, 25). Altogether × 104 cells starved O/N were dropped in triplicate wells and our data indicates that 3BP2 provides signals needed for SCF- activated with 100 ng/mL SCF in complement-free StemPro-34 dependent mast cell migration. media for 30 min. After that, wells were rinsed 3 times with PBS and the number of remaining cells was assessed with CellTiter- 3BP2 Is Essential for FcεRI-Mediated Mast Glo R Luminescent Cell Viability Assay from Promega (Promega Cell Migration Corporation, Madison, WI). It has been reported that Lyn and Syk are essential for FcεRI- mediated migration (26). Since the adaptor molecule 3BP2 FACS Staining coprecipitates with Lyn and Syk in mast cells and 3BP2 silencing β7 and β1 integrins, KIT and FcεRI expression were detected leads to a decrease in Syk phosphorylation (5) we next assessed by direct staining with the indicated Abs for 30 min at 4◦ C. the ability of 3BP2 to promote FcεRI-mediated migration. For Cells were then analyzed using a FACSCalibur flow cytometer that purpose non target or 3BP2 silenced LAD2 cells were (FACScan; BD Biosciences). In all cases dead cells were excluded sensitized with biotinylated IgE overnight. Migration assays were based on their Forward (FSC) and side scattering (SSC) profile. performed using streptavidin as stimuli (mimicking the allergen). As shown in Figure 3, 3BP2 silencing leads to an impairment Data Analysis in migration toward the streptavidin. Levels of FcεRI in both All results are expressed as mean ± standard error of the mean types of cells were similar. As reported previously, 3BP2 silencing (SEM). Unpaired student’s t-test or one-way ANOVA were used does not affect FcεRI expression levels (5). To check whether to determine significant differences (p-value) between two or 3BP2 role in chemotaxis goes beyond FcεRI or KIT receptors we several experimental groups, respectively, after determination of carried out migration assays using the StemPro 34 supplement as normal distribution of the sample and variance analysis. stimuli. This supplement contains a wide array of growth factors needed for growth and proliferation of LAD2 cells. Interestingly, RESULTS cells where 3BP2 was silenced show less migration toward the stimuli suggesting an overall role of 3BP2 in LAD2 migration 3BP2 Is Critical for SCF-Dependent Mast (Figure S1). Cell Migration Given that 3BP2 is required for proper KIT signaling (6), and The 3BP2 Adaptor Protein Is Required for SCF, the ligand for KIT, is a major chemotactic factor in mast Rac2 and Cdc42 Activation in Mast Cells cells (1), this study explores the capacity of 3BP2 to modulate The adaptor molecule 3BP2 has been proposed as a key SCF-dependent chemokinesis. Migration assays were carried out molecule for Rho family GTPase activation and migration in using Transwell chambers, with SCF as the stimuli. 3BP2 shRNAs neutrophils (7). The Rho family of GTPases undergoes activation sequences were validated in previous works (5, 6). Our data by GTP/GDP exchange and controls cytoskeletal rearrangements show that 3BP2-silenced LAD2 cells (Figure 1A) do not migrate (9). First we characterized the activation pattern of the Rho toward an SCF gradient (Figure 1B). As described previously, GTPase family in the human mast cell line LAD2 (Figure S2). 3BP2 knockdown cells downregulate KIT expression, thereby Activation of Rac1, Rac2, and Cdc42 increases after IgE and SCF leading to cell apoptosis (6). The migration experiments were stimulation. Thus, we then performed an assay to determine performed under the same conditions in which cell survival RhoA/Rac1/Rac2/Cdc42 activity in 3BP2-silenced LAD2. Our and KIT expression were not significantly affected (first week results show that Cdc42 and Rac2 activation was significantly of transduction). The viability was tested in all these conditions impaired in 3BP2-silenced cells after activation. Interestingly, to rule out a lack of migration due to cell apoptosis (data not Rac-1 was not modified, thus indicating that 3BP2 is selectively shown). To ensure the specificity of this event, silenced cells relevant for activation of some members of Rho family GTPases were reconstituted for 3BP2 using a plasmid-encoding 3BP2-GFP (Figure 4). The data suggest the involvement of 3BP2 in protein or a control GFP protein (Figure 1C). The GFP and KIT pathways associated with cell motility and actin dynamics. expression levels were monitored to ensure good transfection efficiency before the migration tests were carried out (Figure 1D). Myo1f as a Novel Ligand for 3BP2 As expected, 3BP2 reconstitution reestablished the capacity for In parallel to these studies, we screened a human bone marrow cell migration (Figure 1E). library using the yeast three-hybrid system used previously (18, Next, we analyzed whether 3BP2 was also needed for mutant 21), this time with 3BP2 as the bait in order to search for KIT D816V-mediated migration. KIT D816V is a hallmark of new ligands for 3BP2. Our screening process rendered known mastocytosis, a rare disease caused by the accumulation of partners for 3BP2, including Vav1 (data not shown) and Myo1f, functionally defective mast cells. For that we used HMC-1 cell a novel ligand. Myo1f is a long-tailed class I myosin that consists Frontiers in Immunology | www.frontiersin.org 4 May 2019 | Volume 10 | Article 1058 Navinés-Ferrer et al. 3BP2 and Myo1f in Mast Cell Migration FIGURE 1 | 3BP2 knockdown impairs SCF-dependent mast cell migration. (A) Western blot showing the 3BP2 shRNA knockdown in LAD2 cells. (B) Percentage of migrated non-target control (NT-shRNA) o 3BP2-knockdown (3BP2-shRNA) LAD2 mast cells toward SCF gradient (100 ng/mL). (C) Western blot determination of the reconstitution of both groups with 3BP2-GFP or GFP alone. (D) GFP and KIT receptor expression determined by flow cytometry. NT-shRNA is represented by an empty black curve and 3BP2-shRNA is represented by a filled gray curve. Mean intensity of fluorescence (MIF) of each group is represented in parentheses. (E) Percentage of cell migration after 4 h chemotaxis with SCF (100 ng/mL) of silenced and reconstituted cells, as indicated in the figure. Viability was tested in the upper wells after the assay. The one-way ANOVA test was used for the statistical analysis (*p < 0.05, ***p < 0.001). Migration data are the mean of three independent experiments. FIGURE 2 | 3BP2 knockdown decreases migration of mast cells harboring the KITD816V mutation. (A) Western blot showing the 3BP2 shRNAs knockdown in HMC-1 cells. (B) Percentage of migrated HMC-1 mast cells silenced for 3BP2 (3BP2-shRNA) or non-target control (NT-shRNA) toward an SCF gradient (100 ng/mL). The student’s t-test was used for the statistical analysis (*p < 0.05, ****p < 0.0001). In all migration assays, viability was tested in the upper wells after the assay. Data are the mean of three independent experiments. of an N-terminal motor domain, light-chain-binding IQ motifs, the c-terminal region of the protein containing the complete a basic tail homology 1, a proline-rich TH2 domain and a TH3 SH3 domain (Figure 5A). Moreover, 3BP2 coprecipitated with domain containing a single Src homology 3 (SH3) domain. Myo1f in transfected COS cells in the absence or presence of A positive clone observed in the screening process encoded Fyn kinase (Figure 5B), thereby indicating an interaction that is Frontiers in Immunology | www.frontiersin.org 5 May 2019 | Volume 10 | Article 1058 Navinés-Ferrer et al. 3BP2 and Myo1f in Mast Cell Migration FIGURE 3 | 3BP2 also reduces significantly IgE-dependent cell migration. (A) FcεRI expression in NT and 3BP2-silenced LAD2 cells. (B) Percentage of cell migration after 4 h chemotaxis with IgE+ Streptavidin in NT and 3BP2-silenced cells. Viability was tested in the upper wells after the assay. The one-way ANOVA test was used for the statistical analysis (***p < 0.001). Migration data are the mean of three independent experiments. FIGURE 4 | 3BP2 knockdown impairs Cdc42 and Rac2 activation in mast cells. G-Lisa quantification of GTP-bound (active) small GTPases Rho (A) Cdc42; (B) Rac2, (C) Rac1, and (D) RhoA were performed before and after activation by IgE-stv plus SCF for 30 min in LAD2 cells. (E) Western blot showing GTPases levels in NT and 3BP2-silenced cells. The one-way ANOVA test was used for the statistical analysis (**p < 0.01, ****p < 0.0001). Data are the mean of three independent experiments. Frontiers in Immunology | www.frontiersin.org 6 May 2019 | Volume 10 | Article 1058 Navinés-Ferrer et al. 3BP2 and Myo1f in Mast Cell Migration independent of phosphorylation. Interestingly, Myo1f and 3BP2 were well expressed in mast cells, and no significant differences are susceptible to phosphorylation by Fyn kinase, thus suggesting were observed between untreated and SCF-stimulated cells in regulation of these proteins upon phosphorylation. In order to terms of membrane expression measured by flow cytometry check whether Myo1f can also be recruited by the SH2 domain (data not shown). Interestingly, Myo1f-silenced cells were found of 3BP2, we performed an immunoprecipitation experiment in to express significantly less β1 integrin, in comparison with COS cells transfected with only the SH2 domain of 3BP2 in non-target cells (Figure 8A). Our results also show mild but the presence of Fyn. Our findings revealed that no binding was significant differences in β7 expression between control cells and observed in these conditions (Figure 5C). Myo1f-silenced cells (Figure 8B). SCF-dependent mast cell migration is preceded by an increase Myo1f Is Expressed in Mast Cells and in cell adhesion, a process that is dependent on integrins (28). Colocalizes With 3BP2 Next we assessed whether the differential expression of integrins Next, we determined the expression of Myo1f in human mast on Myo1f silencing affects SCF-dependent cell adhesion. As cells. Mast cell lines LAD2 and HMC-1 and CD34+ -derived shown in Figure 8C, Myo1f silencing induced by doxycycline human mast cells express Myo1f, as confirmed by western blot in affected SCF-induced adhesion to fibronectin. our study (Figure 6A). Myo1f colocalizes with the cortical actin Finally, we measured the capacity of these cells to migrate network in resting conditions and after SCF stimulation in LAD2 toward an SCF chemotactic gradient through a fibronectin- cells (Figure 6B). Myo1f and 3BP2 showed some localization coated surface. Our data show that Myo1f-silenced cells had a under resting and SCF-activated conditions. Interestingly, Myo1f significantly lower migration capacity under these conditions, and 3BP2 colocalization was found mostly on the cell membrane thus indicating that this impaired adhesion affected mast cell at 5 min (Figure 6C). Our data suggest that KIT activation may migration (Figure 8D). modulate the 3BP2-Myo1f interaction. In that context, in HMC- We conducted similar experiments in 3BP2 silencing cells 1 cell line, where KIT is constitutively active, 3BP2 and Myo1f assessing integrins expression profile. We found that β1 integrin colocalized at the plasma membrane. Remarkably, the KIT kinase expression was significantly reduced but β7 integrin expression inhibition with sunitinib altered the colocalization (Figure 6D) was unaffected in 3BP2-silenced cells (Figures 9A,B). We found and 3BP2-Myo1f coprecipitation is abrogated in those conditions as well significant differences in cell adhesion to fibronectin (Figure 6E). These data indicate that KIT signaling can regulate in 3BP2-silenced cells (Figure 9C). These differences may also the Myo1f-3BP2 interaction. contribute to the capability of cells to migrate. As we show above when 3BP2 expression is low or almost absent cell migration is more grossly affected that the one observed in Myo1f Knockdown Does Not Impair Myo1f-silenced cells. SCF-Dependent Mast Cell Migration We next assessed whether Myo1f knockdown can modulate KIT functions by analyzing cell migration. Various Myo1f shRNA sequences were tested in LAD2 cells (Figure 7A). Only one DISCUSSION shRNA sequence showed significant Myo1f silencing and was Migration of mast cells is required for their recruitment to further cloned under doxycycline-inducible plasmid to control target tissues and for their infiltration to inflammation sites Myo1f silencing and reconstitution at will. Western blot was associated with chronic atopic diseases, or during bacterial or performed to corroborate the knockdown data (Figure 7B), and parasitic infection. Thus, mast cells recognize chemotactic stimuli KIT expression levels were evaluated by flow cytometry in non- and trigger a signaling cascade of events that lead to integrin target cells vs. Myo1f-silenced cells (Figure 7C). Our results show activation, adhesion and migration. SCF, the KIT ligand, is a that Myo1f knockdown does not affect the capacity of mast key chemotactic factor and is crucial for mast cell proliferation, cells to migrate toward SCF under these conditions (Figure 7D). survival, homing and migration. Proper KIT signaling is required Viability was also monitored after migration and showed no to ensure that these events progress properly. Some years ago, changes (data not shown). our group showed that the 3BP2 adaptor protein previously described as critical for mast cell degranulation through FcεRI β1 (CD29) and β7 Integrin Expression Are (5) also regulates survival through KIT receptor expression and Affected in Myo1f and 3BP2 Silencing signaling (6). As we reported, 3BP2 regulates KIT transcription It has been reported that neutrophils from Myo1f-deficient mice through microphthalmia-associated transcription factor (MITF), exhibit abnormally increased adhesion and reduced motility described to control KIT expression. Thus, reduced 3BP2 as a result of augmented exocytosis of β2-integrin–containing expression is associated with decreased KIT expression and granules and a reduction in cortical actin (14). β1 and β7 integrins increased cellular apoptosis (6). are responsible for migration and homing in SCF-dependent In this study we show that 3BP2 also plays a role in SCF- mast cell migration (27). Thus, we analyzed the integrin profile dependent cell migration. Since the silencing of 3BP2 ends up of β1 (CD29), β2 (CD18), and β7 chains in Myo1f vs. control reducing KIT expression and compromising cell viability, all cells. β2 expression was very low in mast cells under various experiments we performed were monitored for KIT expression treatments, and no differences were observed in silenced or and cell viability. The mechanisms underlying 3BP2-modulated control cells (data not shown). Conversely, β1 and β7 integrins cell migration may be related to its role as a scaffold protein, Frontiers in Immunology | www.frontiersin.org 7 May 2019 | Volume 10 | Article 1058 Navinés-Ferrer et al. 3BP2 and Myo1f in Mast Cell Migration FIGURE 5 | Myo1f, a new ligand for 3BP2. (A) Representation of Myo1f. The clone identified through the three-hybrid assay was the SH3 region of this protein (aa901-1098). (B) Immunoprecipitation of the 3BP2 protein in COS-7 cells transfected with 3BP2 and Myo1f-flag, with or without the presence of Fyn kinase. Membrane was blotted with α-pTyr, α-flag, and α-3BP2 antibodies. (C) Immunoprecipitation of 3BP2 in COS-7 cells transfected with the SH2 domain of 3BP2 (SH2-GFP) and Myo1f-flag, with or without the presence of Fyn kinase. Membrane was blotted with α-flag and α-GFP antibodies. since with its binding partners it builds a molecular network that degranulation (5) and with the present data, which showed that contributes to the KIT signalosome. Indeed, the silencing of 3BP2 Rac2 and Cdc42 activation was impaired in 3BP2 knockdown reduces PI3K and MAP kinase signaling after SCF engagement mast cells in which chemotaxis was diminished. Interestingly, (6). This work used the yeast three-hybrid system to screen a Rac2 knockout exhibits a reduction in mast cell survival (34) human bone marrow library, using human 3BP2 as bait, and as occurs in 3BP2 silenced cells (6), thus suggesting that both identified Vav1 (clone encoding the SH2 domain; amino acids molecules are involved in a common signal pathway. 665-754) and Myo1f (clone encoding SH3 domain; amino acids The mechanism used for 3BP2 to connect KIT triggering with 901-1185) as ligands for 3BP2. Vav1 has been reported to bind to small GTPase activity has not been elucidated. 3BP2 is known to 3BP2 in a phosphorylation-dependent manner, thus increasing coprecipitate with KIT in mast cells but no direct binding to the NK cell killing (10, 21, 29) and B cell activation (30). 3BP2 has receptor has been reported (6). Src kinases Lyn, Fyn and PI3K are been reported as crucial for full activation of Vav1 in neutrophils, ligands for KIT binding to Y568, Y570, and Y721, respectively, in thereby supporting a role for the adaptor in neutrophil activation the cytoplasmic tail of the human receptor. On the other hand, and migration through activation of Rho family of GTPases (7). 3BP2 can be phosphorylated by Fyn and Lyn (30, 36) and has Rho GTPases, specifically Rac1,2,3, RhoA and Cdc42, have been been reported to be associated with Src kinases (5, 36) and PI3K shown to regulate various exocytosis-related events, including (29). It is therefore conceivable that KIT and 3BP2 are linked actin remodeling, exocytic complex formation and calcium through these common partners. Interestingly, Fyn-dependent influx, across a number of cell models (31). Although their exact axis on KIT activation leads to the phosphorylation of Gab2 and mechanism of regulation may vary between cells, it appears that cytoskeleton reorganization and mast cell migration through Rac Rho GTPases are predominantly responsible for regulating actin GTPase activation (37–40). Studies with different murine KIT remodeling. Rac1 and Cdc42 have been reported to stimulate mutants showed the importance of Y567 and Y719 for KIT– mast cell exocytosis, while RhoA has no effect (32). Although mediated chemotaxis. Phosphorylated Y567 recruits Src kinases Rac1 and Rac2 are 92% identical, they have been shown to have Lyn or Fyn, and this results in activation of the p38 pathway, distinct cellular functions (33). Therefore, a lack of Rac2 results which is also important for chemotaxis (39, 41). Interestingly, in diminished chemotaxis and degranulation in mast cells, thus 3BP2 silencing impairs the p38 pathway in mast cells after FcεRI defining distinct functions for Rac2 that cannot be compensated triggering (5). Altogether, 3BP2 could act synergistically with for by Rac1 (34, 35). This is consistent with previous data where Scr kinases, thus increasing the Rho family of small GTPases we reported that 3BP2 silencing expression inhibits mast cell and chemotaxis. In contrast, phosphorylated Y179 recruits PI3K Frontiers in Immunology | www.frontiersin.org 8 May 2019 | Volume 10 | Article 1058 Navinés-Ferrer et al. 3BP2 and Myo1f in Mast Cell Migration FIGURE 6 | 3BP2 and Myo1f colocalization is modulated by KIT signaling in mast cells. (A) Expression of Myo1f in the mast cell lines HMC-1 and LAD2 and in CD34+-derived human mast cells (huMCs). (B) Immunofluorescence of LAD2 mast cells showing Myo1f (green), actin staining (phalloidin; red) and the nucleus (Hoechst; blue) after 5 min of stimulation with SCF (100 ng/mL) or resting (0 min). (C) Immunofluorescence of LAD2 mast cells showing Myo1f (green), 3BP2 (red) and the nucleus (Hoechst; blue) after stimulation for different times with SCF (100 ng/mL) or resting (0 min). (D) Immunofluorescence of HMC-1 cells treated with sunitinib (10 µM) or untreated showing Myo1f (green), 3BP2 (red) and the nucleus (Hoechst; blue). (E) Immunoprecipitation of 3BP2 in HMC-1 cells treated with sunitinib (10 µM) or control (DMSO). Membrane was blotted with α-Myo1f, α-3BP2, and α-KIT/α-pKIT antibodies to check KIT inhibition by sunitinib. and the mediated and enhanced calcium signaling that has been interaction is independent of phosphorylation and possibly found to be critical for chemotaxis (41). 3BP2 silencing has involves the SH3 domain of Myo1f and the proline-rich been reported to impair calcium signaling in mast cells (5). In domain of 3BP2. However, it may be modulated after KIT summary, 3BP2, through common ligands, may modulate SCF- activation. After 5 min of SCF stimulation, 3BP2 translocates dependent MAP kinase activity and calcium influx that leads to to the membrane, thereby increasing its colocalization with activity of the Rho family of small GTPases, which is important Myo1f in that area. Myo1f membrane location is also for mast cell chemotaxis. more apparent after KIT engagement. This is consistent In this work, we identified Myo1f as a novel binding partner with an increase in PI3K activity upon KIT activation and for 3BP2. Myo1f is an unconventional long-tailed myosin production of phosphatidylinositol-3, 4, 5-triphosphate (PIP3), a not involved in muscle contraction and whose expression is binding site for PH-domain containing proteins like 3BP2 and restricted to the immune system. However, its expression and Myo1f. In the HMC-1 mast cell line (harboring KITD816V), role in mast cell function remains unclear. We showed that where KIT is constitutively active, colocalization of both Myo1f is expressed in CD34-derived mast cells and mast cell proteins can be observed in the membrane area and by lines, and colocalizes with the cortical actin ring. 3BP2-Myo1f coprecipitation. Interestingly, coprecipitation is abolished in Frontiers in Immunology | www.frontiersin.org 9 May 2019 | Volume 10 | Article 1058 Navinés-Ferrer et al. 3BP2 and Myo1f in Mast Cell Migration FIGURE 7 | Myo1f knockdown does not affect SCF-dependent migration. (A) Western blot showing the Myo1f shRNAs tested. (B) Western blot showing Myo1f knockdown and (C) membrane surface expression of KIT receptor in LAD2 mast cells silenced for Myo1f (Myo1f-shRNA) or non-target control (NT-shRNA) after doxycycline induction (0.5 µg/mL). (D) Percentage of migrated LAD2 mast cells silenced for Myo1f (Myo1f-shRNA) or non-target control (NT-shRNA) toward an SCF gradient (100 ng/mL) with doxycycline induction (0.5 µg/mL). The student’s t-test was used for the statistical analysis. In all migration assays, viability was tested in the upper wells after the assay. Data are the mean of three independent experiments. FIGURE 8 | β1 and β7 integrin expression are reduced as well as adhesion and migration to fibronectin in Myo1f knockdown mast cells. (A) Flow cytometry analysis of β1 (CD29) expression on NT and Myo1f shRNA LAD2 cells, (B) β7 integrin expression in NT shRNA and Myo1f shRNA. NT shRNA is represented by an empty black curve and Myo1f shRNA is represented by a filled gray curve. The mean of each group is represented in parentheses. (C) NT shRNA cells and Myo1f shRNA LAD2 cells were assayed for adhesion in fibronectin-coated wells, stimulated with SCF (100 ng/mL) for 30 min, and the percentage of adhesion was determined. (D) NT shRNA and Myo1f shRNA LAD2 mast cells were assessed for migration for 4 h in fibronectin-coated Transwell chambers and then counted under optic microscopy. Viability was tested in the upper wells after the assay. The student’s t-test (A,B) or ordinary one-way ANOVA test (C,D) was used for the statistical analysis (*p < 0.05, **p < 0.01). The bar chart data correspond to the mean of at least three independent experiments. the presence of the kinase inhibitor sunitinib, that causes Myo1f has been reported as key for neutrophil migration. both molecules to distribute mostly in the cytoplasm. Overall, Indeed, Myo1f knockout mice showed increased susceptibility we concluded that Myo1f links 3BP2 to actin cytoskeleton to infection by Listeria monocytogenes due to an improper after KIT stimulation. neutrophil migration to the infection sites (14). The authors Frontiers in Immunology | www.frontiersin.org 10 May 2019 | Volume 10 | Article 1058 Navinés-Ferrer et al. 3BP2 and Myo1f in Mast Cell Migration In our study, we explore the expression of several integrins after Myo1f knockdown. Our data showed that Myo1f knockdown decrease the cell surface expression of two integrin β chains, β1 (CD29) and β7, which are critical for mast cell adhesion and migration, usually coupled with the α4 chain. It has also been determined that Fyn kinase plays a role in mediating KIT/β1 integrin crosstalk in mast cells through Rac activation to promote spreading, cytoskeletal remodeling and migration (39, 40). Integrin α-4/β-1 (VLA-4) and α-4/β-7 are receptors for fibronectin (46). Consequently, we found that Myo1f-silenced cells have significantly reduced mast cell adhesion to fibronectin upon SCF activation. Moreover, migration of Myo1f-silenced mast cells was impaired, specifically on the integrin ligand (fibronectin)-coated surface, which resembles the physiological environment. Our results suggest that Myo1f may regulate integrin trafficking in mast cells and thus possibly affects integrin-vesicle exocytosis. Interestingly, we found that 3BP2 can also regulate β1 expression, thus indicating that both molecules are involved in that pathway, but cannot regulate β7 integrins, thereby showing a selective cascade for both molecules. β2 integrin levels in LAD2 were almost undetectable (data not shown), in line with the very low levels of β2 previously reported in human mast cells (47). We cannot discard that Myo1f may be acting in the integrin functionality as well. Integrins and actin are coupled through a physical linkage, which provides traction for migration (48). In that context, Myo1f would provide a link with the actin cytoskeleton and the adaptor protein 3BP2 delivering signals for adhesion to fibronectin and further cell migration. More experiments are needed to define the mechanism. With respect to the role of Myo1f in the immune system, the Myo1f gene has been found to be fused to the mixed lineage leukemia (MLL) gene in acute monocytic leukemia (49). The presence of the Vav1-Myo1f fusion protein (where the FIGURE 9 | 3BP2 silencing decreases β1 expression and significantly impairs C-terminal SH3 domain of Vav1 is replaced by the SH3 of adhesion to fibronectin. (A) Flow cytometry analysis of β1 (CD29) expression Myo1f) was recently reported in peripheral T-cell lymphomas on NT and 3BP2 shRNA LAD2 cells, (B) β7 integrin expression in NT shRNA (PTLC), a heterogeneous group of non-Hodgkin lymphomas and 3BP2 shRNA. NT shRNA is represented by an empty black curve and 3BP2 shRNA is represented by a filled gray curve. The mean of each group is frequently associated with poor prognosis. This supports a represented in parentheses. (C) NT shRNA cells and 3BP2 shRNA LAD2 cells possible role for the Myo1f SH3 domain in promoting the were assayed for adhesion in fibronectin-coated wells, stimulated with SCF activity of the Vav1-Myo1f oncoprotein (50, 51). Furthermore, (100 ng/mL) for 30 min, and the percentage of adhesion was determined. The Myo1f has been proposed as a candidate gene for nonsyndromic student’s t-test (A,B) or ordinary one-way ANOVA test (C) was used for the deafness (52). statistical analysis (**p < 0.01). The bar chart data correspond to the mean of at least three independent experiments. In summary, we have defined a key role for 3BP2 in SCF- dependent mast cell migration and identified a new partner, Myo1f, which links the adaptor to the actin cytoskeleton reported that Myo1f prevents excessive exocytosis of β2 following KIT activation. This myosin regulates integrin- integrin-containing vesicles by regulating cortical F-actin or by dependent adhesion and migration. controlling the final step of exocytosis (14). This type of integrin Further investigation is needed to clarify the mechanisms of is dominant in integrin-mediated adhesion to the vascular Myo1f in the regulation of migration. The targeting of Myo1f endothelium, a process that is crucial for neutrophil migration could serve as a tool to help shed light on cytoskeleton changes to infected tissues (42, 43). Lately, Salvermoser and collaborators to modulate mast cell function. demonstrated that Myo1f is crucial for the dynamics of the deformation of the neutrophil nucleus and consequent capacity of these cells to extravasate in vivo rather than for AUTHOR CONTRIBUTIONS integrin regulation (44). More recently, it has been shown that Myo1f regulates integrin-αVβ3 inducing M1-polarization in MM conceived the experiments, provided secure funding, wrote, macrophages through PI3K/Akt/STAT signaling (45). and reviewed the manuscript. AN-F performed, conceived Frontiers in Immunology | www.frontiersin.org 11 May 2019 | Volume 10 | Article 1058 Navinés-Ferrer et al. 3BP2 and Myo1f in Mast Cell Migration experiments, and reviewed the manuscript. EA-E performed supported by a grant from Fundación Gangoiti Barrera. We experiments and reviewed the manuscript. ES-C provided are indebted to the service of advanced optical microscopy technical support and reviewed the manuscript. JS conceived of the CCIT (University of Barcelona) and to the Cytomics experiments and reviewed the manuscript. core facility of the Institut d’Investigacions Biomèdiques August Pi i Sunyer (IDIBAPS) for technical support. We ACKNOWLEDGMENTS thank Cristina Luque and Anna Gieryng for assistance with experiments. This study has been funded by Instituto de Salud Carlos III (Spain) through the project SAF2015-68124-R (Ministry for SUPPLEMENTARY MATERIAL Economy and Competitiveness, Spain) co-funded by European Regional Development Fund/European Social Fund Investing The Supplementary Material for this article can be found in your future and Thematic Networks and Co-operative online at: https://www.frontiersin.org/articles/10.3389/fimmu. Research Centers: ARADyAL RD16/0006/0007. AN-F was 2019.01058/full#supplementary-material REFERENCES activation following aggregation of FcepsilonRI or FcgammaRI. Leuk Res. (2003) 27:677–82. doi: 10.1016/S0145-2126(02)00343-0 1. Halova I, Draberova L, Draber P. Mast cell chemotaxis - 16. Nilsson G, Blom T, Kusche-Gullberg M, Kjellen L, Butterfield JH, Sundstrom chemoattractants and signaling pathways. Front Immunol. (2012) C, et al. Phenotypic characterization of the human mast-cell line HMC-1. 3:119. doi: 10.3389/fimmu.2012.00119 Scand J Immunol. (1994) 39:489–98. doi: 10.1111/j.1365-3083.1994.tb03404.x 2. Kim MS, Radinger M, Gilfillan AM. The multiple roles of 17. Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, phosphoinositide 3-kinase in mast cell biology. Trends Immunol. (2008) et al. Fiji: an open-source platform for biological-image analysis. Nat Methods. 29:493–501. doi: 10.1016/j.it.2008.07.004 (2012) 9:676–82. doi: 10.1038/nmeth.2019 3. Draber P, Halova I, Polakovicova I, Kawakami T. Signal 18. Sayos J, Martin M, Chen A, Simarro M, Howie D, Morra M, et al. Cell surface transduction and chemotaxis in mast cells. Eur J Pharmacol. (2016) receptors Ly-9 and CD84 recruit the X-linked lymphoproliferative disease 778:11–23. doi: 10.1016/j.ejphar.2015.02.057 gene product SAP. Blood. (2001) 97:3867–74. doi: 10.1182/blood.V97.12.3867 4. Ren R, Mayer BJ, Cicchetti P, Baltimore D. Identification of a ten- 19. Tumova M, Koffer A, Simicek M, Draberova L, Draber P. The transmembrane amino acid proline-rich SH3 binding site. Science. (1993) 259:1157– adaptor protein NTAL signals to mast cell cytoskeleton via the small 61. doi: 10.1126/science.8438166 GTPase Rho. Eur J Immunol. (2010) 40:3235–45. doi: 10.1002/eji.2010 5. Ainsua-Enrich E, Alvarez-Errico D, Gilfillan AM, Picado C, Sayos J, Rivera 40403 J, et al. The adaptor 3BP2 is required for early and late events in 20. Tkaczyk C, Metcalfe DD, Gilfillan AM. Determination of protein FcepsilonRI signaling in human mast cells. J Immunol. (2012) 189:2727– phosphorylation in Fc epsilon RI-activated human mast cells by immunoblot 34. doi: 10.4049/jimmunol.1200380 analysis requires protein extraction under denaturing conditions. J Immunol 6. Ainsua-Enrich E, Serrano-Candelas E, Alvarez-Errico D, Picado C, Sayos Methods. (2002) 268:239–43. doi: 10.1016/S0022-1759(02)00210-7 J, Rivera J, et al. The adaptor 3BP2 is required for KIT receptor 21. Saborit-Villarroya I, Del Valle JM, Romero X, Esplugues E, Lauzurica P, Engel expression and human mast cell survival. J Immunol. (2015) 194:4309– P, et al. The adaptor protein 3BP2 binds human CD244 and links this receptor 18. doi: 10.4049/jimmunol.1402887 to Vav signaling, ERK activation, and NK cell killing. J Immunol. (2005) 7. Chen G, Dimitriou I, Milne L, Lang KS, Lang PA, Fine N, et al. The 175:4226–35. doi: 10.4049/jimmunol.175.7.4226 3BP2 adapter protein is required for chemoattractant-mediated neutrophil 22. Alvarez-Errico D, Oliver-Vila I, Ainsua-Enrich E, Gilfillan AM, activation. J Immunol. (2012) 189:2138–50. doi: 10.4049/jimmunol.1103184 Picado C, Sayos J, et al. CD84 negatively regulates IgE high- 8. Bustelo XR. Vav family exchange factors: an integrated affinity receptor signaling in human mast cells. J Immunol. (2011) regulatory and functional view. Small GTPases. (2014) 187:5577–86. doi: 10.4049/jimmunol.1101626 5:9. doi: 10.4161/21541248.2014.973757 23. Wiederschain D, Wee S, Chen L, Loo A, Yang G, Huang A, et al. Single-vector 9. Ridley AJ. Rho GTPase signalling in cell migration. Curr Opin Cell Biol. (2015) inducible lentiviral RNAi system for oncology target validation. Cell Cycle. 36:103–12. doi: 10.1016/j.ceb.2015.08.005 (2009). 8:498–504. doi: 10.4161/cc.8.3.7701 10. Jevremovic D, Billadeau DD, Schoon RA, Dick CJ, Leibson PJ. Regulation of 24. Kataoka TR, Kumanogoh A, Bandara G, Metcalfe DD, Gilfillan AM. CD72 NK cell-mediated cytotoxicity by the adaptor protein 3BP2. J Immunol. (2001) negatively regulates KIT-mediated responses in human mast cells. J Immunol. 166:7219–28. doi: 10.4049/jimmunol.166.12.7219 (2010) 184:2468–75. doi: 10.4049/jimmunol.0902450 11. Krendel M, Mooseker MS. Myosins: tails (and heads) of functional diversity. 25. Sun J, Pedersen M, Ronnstrand L. The D816V mutation of c-Kit circumvents Physiology. (2005) 20:239–51. doi: 10.1152/physiol.00014.2005 a requirement for Src family kinases in c-Kit signal transduction. J Biol Chem. 12. Smrz D, Bandara G, Beaven MA, Metcalfe DD, Gilfillan AM. Prevention (2009) 284:11039–47. doi: 10.1074/jbc.M808058200 of F-actin assembly switches the response to SCF from chemotaxis to 26. Kitaura J, Kinoshita T, Matsumoto M, Chung S, Kawakami Y, Leitges M, et al. degranulation in human mast cells. Eur J Immunol. (2013) 43:1873– IgE- and IgE+Ag-mediated mast cell migration in an autocrine/paracrine 82. doi: 10.1002/eji.201243214 fashion. Blood. (2005) 105:3222–9. doi: 10.1182/blood-2004-11-4205 13. Bement WM, Hasson T, Wirth JA, Cheney RE, Mooseker MS. 27. Hallgren J, Gurish MF. Mast cell progenitor trafficking and maturation. Adv Identification and overlapping expression of multiple unconventional Exp Med Biol. (2011) 716:14–28. doi: 10.1007/978-1-4419-9533-9_2 myosin genes in vertebrate cell types. Proc Natl Acad Sci USA. (1994) 28. Dastych J, Metcalfe DD. Stem cell factor induces mast cell adhesion to 91:11767. doi: 10.1073/pnas.91.24.11767c fibronectin. J Immunol. (1994) 152:213–9. 14. Kim SV, Mehal WZ, Dong X, Heinrich V, Pypaert M, Mellman I, et al. 29. Saborit-Villarroya I, Martinez-Barriocanal A, Oliver-Vila I, Engel P, Sayos Modulation of cell adhesion and motility in the immune system by Myo1f. J, Martin M. The adaptor 3BP2 activates CD244-mediated cytotoxicity in Science. (2006) 314:136–9. doi: 10.1126/science.1131920 PKC- and SAP-dependent mechanisms. Mol Immunol. (2008) 45:3446– 15. Kirshenbaum AS, Akin C, Wu Y, Rottem M, Goff JP, Beaven MA, et al. 53. doi: 10.1016/j.molimm.2008.03.021 Characterization of novel stem cell factor responsive human mast cell lines 30. Foucault I, Le Bras S, Charvet C, Moon C, Altman A, Deckert M. The LAD 1 and 2 established from a patient with mast cell sarcoma/leukemia; adaptor protein 3BP2 associates with VAV guanine nucleotide exchange Frontiers in Immunology | www.frontiersin.org 12 May 2019 | Volume 10 | Article 1058 Navinés-Ferrer et al. 3BP2 and Myo1f in Mast Cell Migration factors to regulate NFAT activation by the B-cell antigen receptor. Blood. 43. Walzog B, Scharffetter-Kochanek K, Gaehtgens P. Impairment of (2005) 105:1106–13. doi: 10.1182/blood-2003-08-2965 neutrophil emigration in CD18-null mice. Am J Physiol. (1999) 31. Ory S, Gasman S. Rho GTPases and exocytosis: what are the molecular 276:G1125–1130. doi: 10.1152/ajpgi.1999.276.5.G1125 links? Semin Cell Dev Biol. (2011) 22:27–32. doi: 10.1016/j.semcdb.2010. 44. Salvermoser M, Pick R, Weckbach LT, Zehrer A, Lohr P, Drechsler 12.002 M, et al. Myosin 1f is specifically required for neutrophil migration in 32. Hong-Geller E, Holowka D, Siraganian RP, Baird B, Cerione RA. Activated 3D environments during acute inflammation. Blood. (2018) 131:1887– Cdc42/Rac reconstitutes Fcepsilon RI-mediated Ca2+ mobilization and 98. doi: 10.1182/blood-2017-10-811851 degranulation in mutant RBL mast cells. Proc Natl Acad Sci USA. (2001) 45. Piedra-Quintero ZL, Serrano C, Villegas-Sepulveda N, Maravillas-Montero JL, 98:1154–9. doi: 10.1073/pnas.98.3.1154 Romero-Ramirez S, Shibayama M, et al. Myosin 1F regulates M1-polarization 33. Gu Y, Filippi MD, Cancelas JA, Siefring JE, Williams EP, Jasti AC, by stimulating intercellular adhesion in macrophages. Front Immunol. (2018) et al. Hematopoietic cell regulation by Rac1 and Rac2 guanosine 9:3118. doi: 10.3389/fimmu.2018.03118 triphosphatases. Science. (2003) 302:445–9. doi: 10.1126/science. 46. Ruegg C, Postigo AA, Sikorski EE, Butcher EC, Pytela R, Erle DJ. Role of 1088485 integrin alpha 4 beta 7/alpha 4 beta P in lymphocyte adherence to fibronectin 34. Yang FC, Kapur R, King AJ, Tao W, Kim C, Borneo J, et al. Rac2 and VCAM-1 and in homotypic cell clustering. J Cell Biol. (1992) 117:179– stimulates Akt activation affecting BAD/Bcl-XL expression while mediating 89. doi: 10.1083/jcb.117.1.179 survival and actin function in primary mast cells. Immunity. (2000) 12:557– 47. Sperr WR, Agis H, Czerwenka K, Klepetko W, Kubista E, Boltz-Nitulescu G, 68. doi: 10.1016/S1074-7613(00)80207-1 et al. Differential expression of cell surface integrins on human mast cells and 35. Baier A, Ndoh VN, Lacy P, Eitzen G. Rac1 and Rac2 control distinct events human basophils. Ann Hematol. (1992) 65:10–6. doi: 10.1007/BF01715119 during antigen-stimulated mast cell exocytosis. J Leukoc Biol. (2014) 95:763– 48. Vicente-Manzanares M, Choi CK, Horwitz AR. Integrins in cell migration–the 74. doi: 10.1189/jlb.0513281 actin connection. J Cell Sci. (2009) 122:199–206. doi: 10.1242/jcs.052894 36. Maeno K, Sada K, Kyo S, Miah SM, Kawauchi-Kamata K, Qu X, et al. 49. Taki T, Akiyama M, Saito S, Ono R, Taniwaki M, Kato Y, et al. The Adaptor protein 3BP2 is a potential ligand of Src homology 2 and 3 MYO1F, unconventional myosin type 1F, gene is fused to MLL in infant acute domains of Lyn protein-tyrosine kinase. J Biol Chem. (2003) 278:24912– monocytic leukemia with a complex translocation involving chromosomes 7, 20. doi: 10.1074/jbc.M301201200 11, 19 and 22. Oncogene. (2005) 24:5191–7. doi: 10.1038/sj.onc.1208711 37. Linnekin D, Deberry CS, Mou S. Lyn associates with the juxtamembrane 50. Boddicker RL, Razidlo GL, Dasari S, Zeng Y, Hu G, Knudson RA, region of c-Kit and is activated by stem cell factor in hematopoietic et al. Integrated mate-pair and RNA sequencing identifies novel, targetable cell lines and normal progenitor cells. J Biol Chem. (1997) 272:27450– gene fusions in peripheral T-cell lymphoma. Blood. (2016) 128:1234– 5. doi: 10.1074/jbc.272.43.27450 45. doi: 10.1182/blood-2016-03-707141 38. Timokhina I, Kissel H, Stella G, Besmer P. Kit signaling through PI 3-kinase 51. Abate F, Da Silva-Almeida AC, Zairis S, Robles-Valero J, Couronne L, and Src kinase pathways: an essential role for Rac1 and JNK activation in Khiabanian H, et al. Activating mutations and translocations in the guanine mast cell proliferation. EMBO J. (1998) 17:6250–62. doi: 10.1093/emboj/17. exchange factor VAV1 in peripheral T-cell lymphomas. Proc Natl Acad Sci 21.6250 USA. (2017) 114:764–9. doi: 10.1073/pnas.1608839114 39. Samayawardhena LA, Hu J, Stein PL, Craig AW. Fyn kinase acts upstream 52. Chen AH, Stephan DA, Hasson T, Fukushima K, Nelissen CM, of Shp2 and p38 mitogen-activated protein kinase to promote chemotaxis Chen AF, et al. MYO1F as a candidate gene for nonsyndromic of mast cells towards stem cell factor. Cell Signal. (2006) 18:1447– deafness, DFNB15. Arch Otolaryngol Head Neck Surg. (2001) 54. doi: 10.1016/j.cellsig.2005.11.005 127:921–5. doi: 10.1001/archotol.127.8.921 40. Samayawardhena LA, Kapur R, Craig AW. Involvement of Fyn kinase in Kit and integrin-mediated Rac activation, cytoskeletal Conflict of Interest Statement: The authors declare that the research was reorganization, and chemotaxis of mast cells. Blood. (2007) conducted in the absence of any commercial or financial relationships that could 109:3679–86. doi: 10.1182/blood-2006-11-057315 be construed as a potential conflict of interest. 41. Ueda S, Mizuki M, Ikeda H, Tsujimura T, Matsumura I, Nakano K, et al. Critical roles of c-Kit tyrosine residues 567 and 719 in stem cell Copyright © 2019 Navinés-Ferrer, Ainsua-Enrich, Serrano-Candelas, Sayós and factor-induced chemotaxis: contribution of src family kinase and PI3- Martin. This is an open-access article distributed under the terms of the Creative kinase on calcium mobilization and cell migration. Blood. (2002) 99:3342– Commons Attribution License (CC BY). The use, distribution or reproduction in 9. doi: 10.1182/blood.V99.9.3342 other forums is permitted, provided the original author(s) and the copyright owner(s) 42. Anderson DC, Springer TA. Leukocyte adhesion deficiency: an inherited are credited and that the original publication in this journal is cited, in accordance defect in the Mac-1, LFA-1, and p150,95 glycoproteins. Annu Rev Med. (1987) with accepted academic practice. No use, distribution or reproduction is permitted 38:175–94. doi: 10.1146/annurev.me.38.020187.001135 which does not comply with these terms. Frontiers in Immunology | www.frontiersin.org 13 May 2019 | Volume 10 | Article 1058