ORIGINAL RESEARCH published: 22 May 2019 doi: 10.3389/fimmu.2019.01055 Fish Red Blood Cells Modulate Immune Genes in Response to Bacterial Inclusion Bodies Made of TNFα and a G-VHSV Fragment Sara Puente-Marin 1,2 , Rosemary Thwaite 3 , Luis Mercado 4 , Julio Coll 5 , Nerea Roher 3† and Maria Del Mar Ortega-Villaizan 1,2*† 1 Departamento de Bioquímica y Biología Molecular, Instituto de Biología Molecular y Celular (IBMC), Universidad Miguel Hernández (UMH), Elche, Spain, 2 Departamento de Bioquímica y Biología Molecular, Instituto de Investigación, Desarrollo e Innovación en Biotecnologîa Sanitaria de Elche (IDiBE), Universidad Miguel Hernández (UMH), Elche, Spain, 3 Department Biologia Cellular, Fisiologia Animal i Immunologia, Institut de Biotecnologia i de Biomedicina (IBB), Universitat Autònoma de Barcelona (UAB), Barcelona, Spain, 4 Grupo de Marcadores Inmunológicos, Laboratorio de Genética e Inmunología Molecular, Instituto de Biología, Pontificia Universidad Católica de Valparaíso (PUCV), Valparaíso, Chile, 5 Departamento de Biotecnología, Instituto Nacional de Investigación y Tecnología Agraria y Alimentaria (INIA), Madrid, Spain Fish Red-Blood Cells (RBCs) are nucleated cells that can modulate the expression of Edited by: different sets of genes in response to stimuli, playing an active role in the homeostasis Jun-ichi Hikima, of the fish immune system. Nowadays, vaccination is one of the main ways to control University of Miyazaki, Japan and prevent viral diseases in aquaculture and the development of novel vaccination Reviewed by: approaches is a focal point in fish vaccinology. One of the strategies that has recently Yong-An Zhang, Huazhong Agricultural emerged is the use of nanostructured recombinant proteins. Nanostructured cytokines University, China have already been shown to immunostimulate and protect fish against bacterial Motoshige Yasuike, Japan Fisheries Research and infections. To explore the role of RBCs in the immune response to two nanostructured Education Agency, Japan recombinant proteins, TNFα and a G-VHSV protein fragment, we performed different in *Correspondence: vitro and in vivo studies. We show for the first time that rainbow trout RBCs are able Maria Del Mar Ortega-Villaizan to endocytose nanostructured TNFα and G-VHSV protein fragment in vitro, despite not mortega-villaizan@umh.es being phagocytic cells, and in response to nanostructured TNFα and G-VHSV fragment, † These authors have contributed the expression of different immune genes could be modulated. equally to this work Keywords: erythrocytes, red blood cells, bacterial inclusion bodies, TNFα, VHSV glycoprotein G, immune response Specialty section: This article was submitted to Comparative Immunology, INTRODUCTION a section of the journal Frontiers in Immunology Fish red blood cells (RBCs) are nucleated cells that contain organelles in their cytoplasm unlike Received: 02 June 2018 those of mammals (1). Apart from their well-known role in gas exchange, recently a set of new Accepted: 24 April 2019 biological roles for nucleated RBCs related to the immune response have been reported. Nucleated Published: 22 May 2019 RBCs are able to phagocytose and act as antigen presenting cells (2, 3). They can respond to different Citation: pathogen associated molecular patterns (PAMPs), modulate leukocyte activity, release cytokine-like Puente-Marin S, Thwaite R, factors (4, 5) and lately they have been implicated in the response to viral infections [reviewed in Mercado L, Coll J, Roher N and Nombela and Ortega-Villaizan (6)].Considering all of these findings, the potential role of RBCs in Ortega-Villaizan MDM (2019) Fish Red the immune system of fish takes on a new, interesting perspective. Blood Cells Modulate Immune Genes in Response to Bacterial Inclusion To date, one of the best strategies for preventing and controlling viral diseases in aquaculture Bodies Made of TNFα and a G-VHSV is DNA vaccination. However, it remains unclear which mechanisms are responsible for this Fragment. Front. Immunol. 10:1055. protection (7). The search for new, safe and effective vaccines has become a priority in this field. doi: 10.3389/fimmu.2019.01055 Among fish viral diseases, viral hemorrhagic septicaemia (VHS) is a lethal infectious fish disease Frontiers in Immunology | www.frontiersin.org 1 May 2019 | Volume 10 | Article 1055 Puente-Marin et al. Erythrocyte Response to Nanostructured Proteins caused by viral hemorrhagic septicaemia virus (VHSV), which Hercules, CA, the USA). For flow cytometry or confocal affects over 50 species of fish, freshwater and marine, in the microscopy, IBfrg16G−VHSV and IBTNFα were conjugated with northern hemisphere (8). fluorescent Atto-488 NHS ester (Sigma-Aldrich) following As an alternative to overcome the safety problems associated manufacturer’s instructions. to live attenuated or DNA vaccines, bacterial inclusion bodies (IBs) nanostructured recombinant proteins have been presented Animals as a new option for vaccination (9). IBs are per se strong Juvenile rainbow trout (Oncorhynchus mykiss) were obtained stimulants of the fish immune system and have a set of from a commercial farm (Piszolla S.L., Cimballa Fish Farm, characteristics which make them an attractive alternative: Zaragoza, Spain), and maintained at the University Miguel they are mechanically stable, production is scalable and cost- Hernandez (UMH) facilities at 14◦ C, fed daily with a commercial effective, they are non-toxic biomaterials and are composed of diet (Skretting, Burgos, Spain). Prior to experiments, fish ware recombinant proteins. The latter means they are an adaptable acclimatized to laboratory conditions for 2 weeks. Separately, prototype, which could be a good platform for vaccination adult rainbow trout were maintained at the Universitat against a wide range of diseases (9, 10). Such nanostructured Autònoma de Barcelona (UAB) at 17 ± 1◦ C, fed daily with recombinant proteins have already been shown to protect fish a commercial diet. The number of individuals used in each against bacterial infection (9). experiment is indicated by an “n” in each figure legend. In this paper, we show for the first time the response of rainbow trout RBCs in vitro and in vivo to two different Cell Cultures nanostructured recombinant proteins, recombinant rainbow Rainbow trout RBCs were obtained from peripheral blood of fish trout tumor necrosis factor alpha protein (IBTNFα ) and sacrificed by overexposure to tricaine (tricaine methanesulfonate, recombinant fragment 16 of the glycoprotein G of VHSV (11) Sigma-Aldrich) (0.3 g/L). Peripheral blood was sampled from (IBfrg16G−VHSV ). In response to recombinant protein IBs, RBCs the caudal vein using insulin syringes (Nipro, Bridgewater, NJ, were able to modulate the expression of interferon related USA) as previously described (14). RBCs were purified by genes, the myxovirus resistance (mx) gene and genes related to two consecutive density gradient centrifugations (7,206 g, Ficoll antigen presentation (cluster of differentiation 83 [cd83], major 1.007; Sigma-Aldrich). Purity of RBCs of 99.9% was estimated histocompatibility class I [mhcI] and major histocompatibility by optical microscopy (Figure S1). Purified RBCs were cultured class II [mhcII]). Genes related to antioxidant response (natural with RPMI-1640 medium (Dutch modification) (Gibco, Thermo killer enhancing factor [nkef ] and glutathione S-transferase pi 1 Fischer Scientific Inc., Carlsbad, CA) supplemented with 10% gene [gstp1] and cytokines (interleukin 1β [il1β], interleukin 12β fetal bovine serum (FBS) gamma irradiated (Cultek, Madrid, [il12β], interleukin 6 [il6], interleukin 2 [il2], and interleukin Spain), 1 mM pyruvate (Gibco), 2 mM L-glutamine (Gibco), 8 [il8]) were also modulated. Interestingly, IBTNFα mostly 50 µg/mL gentamicin (Gibco) and 2 µg/mL fungizone (Gibco), down-regulated in vitro and in vivo immune genes expression 100 U/mL penicillin and 100 µg/mL streptomycin (Sigma- in RBCs meanwhile IBfrg16G−VHSV mainly showed an up- Aldrich) at a density of 106 cells/mL at 14◦ C. regulation trend. Uptake of IBTNFα and IBfrg16G-VHSV by RBCs RBCs cultures were treated with fluorescent IBTNFα or MATERIALS AND METHODS IBfrg16G−VHSV at different concentrations and uptake was analyzed by flow cytometry using a FACSCantoTM cytometer Production of IBs, Purification, (BD Biosciences, Madrid, Spain) (10.000 total events), at Quantification , and Fluorescent Labeling different times post-treatment. For dose-response evaluation, Nanostructured proteins were produced in E. coli following IBs at concentrations of 10, 20 and 50 µg/mL were added to the method described in Torrealba et al. (9) and Thwaite et RBCs cultures for 24 h. For time-course experiments, RBCs al. (12). In short, E. coli transformed with the plasmid of were treated with 80 µg/mL IBTNFα or 160 µg/mL IBfrg16G−VHSV interest was cultured in LB with the appropriate antibiotic for 6, 24 and 48 h. After incubation with IBs, the medium was and recombinant protein expression was induced at OD550nm removed and RBCs were washed with phosphate-buffered saline 0.5–0.8 with 1 mM IPTG (Panreac, Barcelona, Spain). IBs (PBS). RBCs were then resuspended in 200 µL of RPMI 2% FBS were isolated after 3 h additional incubation at 37◦ C via for flow cytometry analysis. enzymatic and mechanical disruption of the cells according In addition, confocal microscopy was performed to evaluate to Torrealba et al. (10), followed by sterility monitoring the uptake of IBs by RBCs. RBCs were incubated with 80 (12). Purified nanoparticles, named here IBfrg16G−VHSV , IBTNFα µg /mL of IBTNFα or 160 µg /mL of IBfrg16G−VHSV for and IBiRFP [an inclusion body made of a non-immunogenic 24 h. Then, medium was removed and RBCs were washed as phytochrome-based near infra-red fluorescent protein (iRFP) indicated above. The RBC nucleus was labeled with 10 µg/mL with the excitation/emission maxima at 690/713 nm (13)], Hoechst (Sigma-Aldrich) and RBC membrane was stained with were stored at −80◦ C until use. Quantification was performed 5 µg/mL of CellMask (Thermo Fischer Scientific). Images were by western blot using an anti-His-tag antibody (Genscript, taken with a Zeiss LSM 700 microscope (Zeiss, Oberkochen, Piscataway, NJ, USA) and calculating the protein concentration Germany) and analyzed with Imaris Software v8.2.1 (Bitplane, from a standard curve using Quantity One software (Biorad, Zurich, Switzerland). Frontiers in Immunology | www.frontiersin.org 2 May 2019 | Volume 10 | Article 1055 Puente-Marin et al. Erythrocyte Response to Nanostructured Proteins RBCs Immune Response After in vitro was sampled as described above and resuspended in RPMI Treatment With IBTNFα or IBfrg16G-VHSV 10% FBS. Then, RBCs were Ficoll-purified as explained RBCs were treated in vitro with 50 µg/mL of each IB for above. Purified RBCs were either resuspended in TRK 24 h. IBiRFP was used as a control. After treatment, RBCs were lysis buffer and stored at −80◦ C until RNA extraction resuspended in TRK lysis buffer (Omega Bio-Tek Inc., Norcross, or fixed for immunofluorescence and flow cytometry, as GA, USA) and stored at −80◦ C until RNA extraction. described below. In order to track the presence of IBs in vivo, IBTNFα was RBCs Immune Response After in vivo monitored in peripheral blood and head kidney from IBTNFα Treatment With IBTNFα or IBfrg16G-vhsv intravenously injected in caudal vein of rainbow trout by means Juvenile rainbow trout (15–20 g) were treated by intravenous of fluorescent microscopy using IN Cell Analyzer 6,000 Cell injection in caudal vein with 50 µL of IBs (5.5 mg/kg) Imaging system (GE Healthcare, Little Chalfont, UK). Blood was or 50 µL of PBS. At 24 and 48 h post-injection fish were extracted 3 h post-injection as described above. Head kidney was sacrificed by overexposure to tricaine. Peripheral blood aseptically removed, placed in 24 well plates with RPMI 10% TABLE 1 | List of primers and probes used. Gene Forward primer Reverse primer Probe Reference or accession number tlr3 ACTCGGTGGTGCTGGTCTTC GAGGAGGCAATTTGGACGAA CAAGTTGTCCCGCTGTCTGCTCCTG (14) tlr9 CCTGCGACACTTCCTGGTTT GCCAGTGGTAAGAAGGAGGATCT CAGACTTCCTGCGTGCCGGCC (15, 16) ifn1 ACCAGATGGGAGGAGATATCACA GTCCTCAAACTCAGCATCATCTATGT AATGCCCCAGTCCTTTTCCCAAATC (14) mx1-3 TGAAGCCCAGGATGAAATGG TGGCAGGTCGATGAGTGTGA ACCTCATCAGCCTAGAGATTGGCTCCCC (16) il15 TACTATCCACACCAGCGTCTGAAC TTTCAGCAGCACCAGCAATG TTCATAATATTGAGCTGCCTGAGTGCCACC (14) nkef CGCTGGACTTCACCTTTGTGT ACCTCACAACCGATCTTCCTAAAC (14) gstp1 CCCCTCCCTGAAGAGTTTTGT GCAGTTTCTTGTAGGCGTCAGA (14) hepcidin TCCCGGAGCATTTCAGGTT GCCCTTGTTGTGACAGCAGTT (14) trx AGACTTCACAGCCTCCTGGT ACGTCCACCTTGAGGAAAAC (14) il6 ACTCCCCTCTGTCACACACC GGCAGACAGGTCCTCCACTA CCACTGTGCTGATAGGGCTGG (17) il12β TGACAGCCAGGAATCTTGCA GAAAGCGAATGTGTCAGTTCAAA ACCCAACGACCAGCCTCCAAGATG (17) tnfα AGCATGGAAGACCGTCAACGAT ACCCTCTAAATGGATGGCTGCTT AAAAGATACCCACCATACATTGAAGCAGATTGCC (18) il8 AGAGACACTGAGATCATTGCCAC CCCTCTTCATTTGTTGTTGGC TCCTGGCCCTCCTGACCATTACTGAG (17, 19) il1β GCCCCCAACCGCCTTA CAGTGTTTGCGGCCATCTTA ACCTTCACCATCCAGCGCCACAA (17) il2 GTTGCAGCATTGGCCTGTT TGTTCTCCTTATCAATCGTCTTTTGT CAACACCACATCAGCATGACTGCCAC NM_001164065.2 cd83 TTGGCTGATGATTCTTTCGATATC TGCTGCCAGGAGACACTTGT TCCTGCCCAATGTAACGGCTGTTGA (20) mhcI GACAGTCCGTCCCTCAGTGT CTGGAAGGTTCCATCATCGT (21) mhcII TGCCATGCTGATGTGCAG GTCCCTCAGCCAGGTCACT CGCCTATGACTTCTACCCCAAACAAAT (22) FIGURE 1 | Uptake of IBTNFα and IBfrg16G−VHSV by RBCs in vitro. (A) Dose-response of RBCs incubated 24 h with 10–50 µg/mL IBfrg16G−VHSV (gray bars) or IBTNFα (black bars). (B) Time course monitoring of RBCs incubated 6, 24, and 48 h with 160 µg/mL IBfrg16G−VHSV (gray bars) or 80 µg/mL IBTNFα (black bars). Data represent mean ± SD (n = 4). Two-way Anova and Dunnett’s multiple comparisons test was performed between all conditions and control (untreated cells) and among concentrations. *, **, ***, ****P-value < 0.05, 0.01, 0.001, and 0.0001, respectively. Frontiers in Immunology | www.frontiersin.org 3 May 2019 | Volume 10 | Article 1055 Puente-Marin et al. Erythrocyte Response to Nanostructured Proteins FBS and disaggregated with a Pasteur pipette and passed through analysis (PCA) and clustering heatmap of immune-gene a Falcon 40 µm nylon cell strainer (BD Biosciencies) using a expression data (2 −1Ct or 2−11Ct ) were performed using plunger of a 5 ml syringe. Clustvis software (24). For PCA, unit variance scaling was applied to rows and singular value decomposition (SVD) RNA Isolation, cDNA Synthesis, RT-qPCR, with imputation was used to calculate principal components. and Gene Expression Analysis For clustering heatmap, columns were collapsed by taking RBCs total RNA was extracted as previously described (14) mean inside each group, rows were centered, and unit using E.Z.N.A. R Total RNA Kit (Omega Bio-Tek Inc.). variance scaling was applied to rows; then, imputation DNAse treatment was performed in order to eliminate was used for missing value estimation; and, both rows residual genomic DNA using TURBOTM DNase (Ambion, and columns were clustered using correlation distance and Thermo Fischer Scientific Inc.). Then cDNA synthesis and average linkage. RT-qPCR was performed as described in Nombela et al (14). Primers and probes used are listed in Table 1. Gene Immunofluorescence Assays expression was analyzed by means of the 2 −1Ct or 2−11Ct Purified RBCs were fixed as previously described (14), (23) using 18S rRNA (Applied Biosystems, Thermo Fischer using 4% paraformaldehyde (PFA; Sigma-Aldrich) and Scientific Inc.) as endogenous gene. Principal component 0.008% glutaraldehyde (GA, Sigma-Aldrich) in RPMI FIGURE 2 | Confocal microscopy images digitalized using z-stack. RBCs incubated with (A) 80 µg/mL IBTNFα or (B) 160 µg/mL IBfrg16G−VHSV for 24 h. IBs are showed in green, cell membrane (CellMaskTM ) in red and nucleus (Hoechst-stained) in blue. (C) IBs monitorization in vivo in cells obtained from head kidney of rainbow trout injected intravenously with 5.5 mg/kg of IBTNFα , 3 h post- injection. Representative bright-field and FITC microscopy images taken with 40× magnification. Frontiers in Immunology | www.frontiersin.org 4 May 2019 | Volume 10 | Article 1055 Puente-Marin et al. Erythrocyte Response to Nanostructured Proteins medium. Anti-MX (25, 26) and anti-IL8 (27) were used TABLE 2 | Immune-gene expression analysis of RBCs stimulated in vitro with as primary antibodies and goat-CFTM 647 anti-mouse IgG 50 µg/mL of IBiRFP , IBTNFα and IBfrg16G−VHSV at 24 h post-treatment. (H+L) and goat-CFTM 647 anti-rabbit IgG (H+L) antibodies IBTNFα IBfrg16G−VHSV (Sigma-Aldrich) were used as secondary antibodies. ′ Mean SD Mean SD Nuclear staining was performed with 1 µg/mL of 4 -6- Diamidino-2-phenylindole (DAPI, Sigma-Aldrich). Images mx 0.902 0.157 1.013 0.199 were captured in an IN Cell Analyzer 6000 Cell Imaging il15 0.943 0.288 1.181 0.414 system. Flow cytometry was carried out in a FACSCantoTM cd83 0.782*** 0.042 0.918 0.101 flow cytometer. mhcI 0.794* 0.138 0.899 0.145 0.965 0.235 1,270 0.428 Software and Statistics mhcII nkef 1.106 0.753 1.067 0.943 Graphpad Prism 6.01 (www.graphpad.com) was used for gstp1 0.785** 0.105 1.254 0.588 statistics and graphic representation. Statistic tests and P- values associated with graphics are indicated in each assay. trx 1.070 0.179 1.289** 0.316 Flow cytometry data was processed and analyzed using tlr3 0.866 0.163 0.887 0.198 Flowing Software 2.5.1 (www.flowingsoftware.com/). Principal tlr9 0.814 0.656 0.907 0.623 component analysis (PCA) and clustering of gene expression RBCs were Ficoll-purified and treated with IBs. 24 h post-treatment gene expression was analysis was performed using ClustVis software (https://biit.cs. analyzed by RT-qPCR, 2−11Ct method, normalized to the endogenous gene eukaryotic ut.ee/clustvis/) (24). 18S, and relative to control cells (treated with IBiRFP ). Data represent mean fold change± SD (n = 4). Mann-Whitney test was performed between each condition and control cells. *, **, ***P-value < 0.05, 0.01, and 0.001 respectively. RESULTS Uptake of IBTNFα and IBfrg16G-VHSV by RBCs In order to evaluate the interaction between RBCs and IBs, we trx gene was significantly up-regulated in IBfrg16G−VHSV treated performed a dose-response and time-course evaluation by means RBCs at 24 h post-treatment (Table 2). of flow cytometry. According to our results, all IB concentrations In order to analyse the gene expression of RBCs in response assayed showed uptake or attachment to RBCs, which increased to each treatment as a whole, multivariate analyses of the gene with IB concentration (Figure 1A). The percentage of IB positive expression data matrix were performed. A principal component cells ranged from 5 to 7% at 50 µg/mL after 24 h incubation. analysis (PCA) plot of the gene expression profile showed Time course evaluation at 6, 24, and 48 h showed no differences a differentiated population of RBCs treated with IBTNFα or in IB load in RBCs (Figure 1B) indicating that the maximum IBfrg16G−VHSV compared to IBiRFP (Figure 3A). This is also IB internalization or attachment occurred by 6 h of incubation. appreciable in the clustering heatmap (Figure 3B), where the However, the time course was carried out with a higher dose and mean values of molecular (gene expression) signatures are up to 17% of fluorescent positive cells were detected. This was clustered. The heatmap data matrix visualizes the values in the maximum percentage uptake achieved under our experimental cells by the use of a color gradient which gives an overview of the conditions. The level of uptake of IBTNFα by RBCs was observed largest and smallest values in the matrix (24). to be higher than IBfrg16G−VHSV when comparing the same concentration of both IBs (Figure 1A). IB uptake was confirmed Immune-Gene and Protein Expression by confocal 3D images, which showed the internalization of IBTNFα (Figure 2A) and IBfrg16G−VHSV (Figure 2B) in the cytosol Modulation in RBCs From Peripheral Blood of RBCs. After in vivo Treatment With IBTNFα The presence of IBTNFα in RBCs was monitored in vivo or IBfrg16G-VHSV in peripheral blood and head kidney cells by fluorescent Rainbow trout were intravenously injected to evaluate the microscopy using intravenously injected IBTNFα . In blood, few immune response triggered by IBs in RBCs of peripheral blood RBCs were found to carry the IBTNFα (data not shown); however, in vivo. RBCs were sampled at 24 and 48 h post-injection. In RBCs carrying IBTNFα were easily found in head kidney cells general, the results showed, as in vitro, a down-regulatory trend extracts (Figure 2C). in the gene expression of IBTNFα treated individuals compared to IBiRFP treated individuals. It should be noted that cd83 was Immune Response of RBCs Induced After significantly down-regulated at 24 h post-injection (Figure 4A), Exposure to IBTNFα or IBfrg16G-VHSV in vitro as occurred in vitro. On the other hand, il6 was significantly To explore the immune response triggered by IBs in RBCs in up-regulated at 24 h post-injection. Further, tlr9, ifn1, il1β, vitro, RBCs were treated with 50 µg/mL of IBTNFα , IBfrg16G−VHSV il2, mhcII and nkef genes were significantly down-regulated or IBiRFP and RNA was extracted at 24 h post-treatment. IBTNFα at 48 h post-injection (Figure 4B). In contrast, IBfrg16G−VHSV tended to down-regulate the genes tested in RBCs at 24 h treated individuals showed an up-regulatory trend at both 24 post-treatment. This down-regulation was statistically significant and 48 h post-injection, compared to IBiRFP , with significant in genes related to antigen presentation (cd83, mhcI) and up-regulation of cytokines il2 and il6, and antioxidant gene antioxidant gene gstp1. On the other hand, only the antioxidant nkef at 24 h post-injection, and of tlr3, interferon inducible Frontiers in Immunology | www.frontiersin.org 5 May 2019 | Volume 10 | Article 1055 Puente-Marin et al. Erythrocyte Response to Nanostructured Proteins FIGURE 3 | Principal component analysis (PCA) of immune-gene expression evaluation of RBCs stimulated in vitro with 50 µg/mL of IBiRFP , IBTNFα, or IBfrg16G−VHSV , at 24 h post-treatment. (A) PCA plot of molecular (gene expression data, 2−11Ct ) signatures of IBiRFP , IBTNFα , or IBfrg16G−VHSV treated samples, at 24 h post-treatment. Ellipses and shapes show clustering of the samples. (B) Heatmap of molecular (gene expression data, 2−11Ct ) signatures of IBiRFP , IBTNFα , or IBfrg16G−VHSV treated samples. Annotations on top of the heatmap show clustering of the samples, mean values. PCA plot and heatmap were performed using Clustvis software. Heatmap data matrix visualizes the values in the cells using a color gradient which gives an overview of the largest and smallest values in the matrix. mx, cd83, and mhcII at 48 h post-injection (Figures 4A,B, macrophages (RT-HKM) and zebrafish liver cells (ZFL). In Table S1). However, mx gene appeared down-regulated at both cell types IBs made with cytokines stimulate the innate 24 h post-injection. Separately, most of the genes were up- immune response (9). Moreover, IBs made with fish viral regulated with all the treatments in comparison with PBS- antigens have evoked an anti-viral innate immune response in injection. ZFL and RT-HKM (12). However, the immune response of The gene expression profile PCA plot depicted differentiated nucleated RBCs to nanostructured cytokine or viral antigen populations for RBCs from individuals treated with IBTNFα IBs has not been tested until now. Nucleated RBCs are the or IBfrg16G−VHSV compared to IBiRFP (Figures 5A, 6A, for main cell in the blood and recently have been endorsed as 24 and 48 h post-injection, respectively), which was also immune cells mediators (6, 28). In this work we show that observed in the clustering heatmap (Figures 5B, 6B, for 24 the uptake or attachment of IBs by rainbow trout RBCs and 48 h post-injection respectively). In addition, at 48 h post- occurred in approximately 7% of cells counted. This contrasts injection, MX and IL8 protein levels, evaluated by means to the near 40% and 80% reported for ZFL and RT-HKM, of flow cytometry, showed an increment, but not statistically respectively, at same concentration (50 µg/mL) of IBTNFα (9). significant, in MX (Figures 7A,C) and IL8 (Figures 7B,D) RBCs endocytosed both the IBs tested here reaching their in RBCs from rainbow trout treated with IBfrg16G−VHSV maximum level at 6 h post-treatment, in contrast to RT-HKM in relation to PBS-injected or the other IBs assayed. This and ZFL cell lines, which reached their maximum uptake result correlates with the mx gene expression at 48 h in at 24 h post-treatment in vitro (10). Besides, monitorization vivo. On the other hand, the protein levels of MX and IL8 of IBTNFα in vivo demonstrated its presence on/in RBCs in RBCs from IBTNFα treated rainbow trout were slightly from head-kidney 3 h post-injection. The mechanism by lower than IBiRFP and PBS-injected individuals (only showing which RBCs endocytose IBs is unknown. It may occur via statistical significance for MX between IBTNFα and IBiRFP the micropinocytosis endocytic pathway, as proposed for treatments), which is consistent with the down-regulatory trend mammalian cells (29). observed in IBTNFα treated RBCs in vivo and in vitro at Significantly, with this work, we add to the growing body of the transcriptional level. Moreover, in whole peripheral blood, data demonstrating nucleated RBCs can exercise a role in the a similar tendency was observed in MX protein expression, immune response. RBCs are able to respond to virus (6, 14, 30), although more pronounced in this case. Note, however, for produce cytokines when exposed to stimuli (17), and endocytose IL8 protein levels, we did not observe any difference among pathogens (2). Here we show for the first time rainbow trout groups (Figures 8A,B). RBCs evoke an immune response to IBs made of cytokine TNFα and viral protein frg16G-VHSV in vitro and in vivo. We demonstrate this response at protein and transcript level. DISCUSSION Rainbow trout Ficoll-purified RBCs treated with IBs in vitro and RBCs Ficoll-purified from blood extracts from IB-intravenously Recently, IBs have been reported as new alternatives in fish injected individuals modulated the expression of genes related to prophylaxis as immunostimulants or adjuvants (10), thus antigen presentation, cytokines and other genes involved in the potentially serving as a new platform for vaccine delivery. immune response. PCA clearly clustered the RBCs’ immune-gene The uptake of IBs has been reported in rainbow trout expression profiles for each treatment. Frontiers in Immunology | www.frontiersin.org 6 May 2019 | Volume 10 | Article 1055 Puente-Marin et al. Erythrocyte Response to Nanostructured Proteins FIGURE 4 | Immune-gene expression analysis of RBCs from rainbow trout injected intravenously with PBS, IBiRFP , IBTNFα , or IBfrg16G−VHSV at 24 and 48 h post-injection. Rainbow trout of 15–20 g were injected with 5.5 mg/kg of IB intravenously. Blood was extracted and RBCs Ficoll-purified 24 h (A) and 48 h (B) post-injection. Gene expression was analyzed by RT-qPCR, 2−1Ct method, with endogenous gene eukaryotic 18S rRNA. Data represent mean AU (arbitrary units) ± SD (n = 4). Mann-Whitney test was performed between each condition and control (treated with PBS or IBiRFP ). #P-value < 0.05, compared to PBS; & P-value < 0.05, compared to IBiRFP . FIGURE 5 | Principal component analysis (PCA) of immune-gene expression evaluation of RBCs from rainbow trout injected intravenously with IBiRFP , IBTNFα , or IBfrg16G−VHSV , at 24 h post-injection. (A) PCA plot of molecular (gene expression data, 2 −1Ct ) signatures footprint of IBiRFP , IBTNFα , or IBfrg16G−VHSV treated samples, at 24 h post-injection. Ellipses and shapes show clustering of the samples. (B) Heatmap of gene expression (2 −1Ct ) signatures of IBiRFP , IBTNFα , or IBfrg16G−VHSV treated samples. Annotations on top of the heatmap show clustering of the samples mean values. PCA plot and heatmap was performed using Clustvis software. Heatmap data matrix visualizes the values in the cells using a color gradient which gives an overview of the largest and smallest values in the matrix. As regards TNFα, RBCs from IBTNFα -treated rainbow trout of immune cells and inflammation. It is mainly produced by individuals showed a down-regulatory trend for genes related monocytes and macrophages along with additional producers to TNFα signaling such as tlr9, tnfα, il1β, il12β, and il2 genes including B and T lymphocytes, NK cells, polymorphonuclear transcripts, in vivo, at 24 and 48 h post-injection, compared leukocytes, and eosinophils in response to bacterial toxins, to fish injected with the non-immunogenic protein IBiRFP . It inflammatory products, and other invasive stimuli (31). Recently, is known that TNFα is a cytokine involved in the regulation nucleated RBCs have been also reported to modulate TNFα Frontiers in Immunology | www.frontiersin.org 7 May 2019 | Volume 10 | Article 1055 Puente-Marin et al. Erythrocyte Response to Nanostructured Proteins FIGURE 6 | Principal component analysis (PCA) of immune-gene expression evaluation of RBCs from rainbow trout injected intravenously with IBiRFP , IBTNFα , or IBfrg16G−VHSV , at 48 h post-injection. (A) PCA plot of molecular (gene expression data, 2 −1Ct ) signatures of IBiRFP , IBTNFα , or IBfrg16G−VHSV treated samples, at 48 h post-injection. Ellipses and shapes show clustering of the samples. (B) Heatmap of molecular (gene expression data, 2 −1Ct ) signatures of IBiRFP , IBTNFα , or IBfrg16G−VHSV treated samples. Annotations on top of the heatmap show clustering of the samples mean values. PCA plot and heatmap was performed using Clustvis software. Heatmap data matrix visualizes the values in the cells using a color gradient which gives an overview of the largest and smallest values in the matrix. FIGURE 7 | Protein expression analysis of RBCs from rainbow trout injected intravenously with 5.5 mg/kg of IBiRFP , IBTNFα , IBfrg16G−VHSV or PBS at 48 h post-injection. (A) Interferon related protein MX and (B) chemokine IL8 Mean Fluorescence Intensity (MFI) measured by flow cytometry. Data represent mean ± SD (n = 4). Mann-Whitney test was performed between each condition and control cells (treated with PBS or IBiRFP ). &P-value < 0.05, compared to IBiRFP . Representative immunofluorescence images of RBCs stained with (C) anti-MX and (D) anti-IL8, taken with 60× magnification. Protein stain in red, DAPI (blue) for nuclei stain. protein in response to IPNV virus exposure (30). Here we is a pleiotropic cytokine with a diverse range of biological observed that RBCs exposed to IBTNFα down-regulated the actions. TNF family members are known to represent a “double- inflammatory response at 24 and 48 h post-treatment. TNFα edged sword,” having both beneficial and detrimental activities Frontiers in Immunology | www.frontiersin.org 8 May 2019 | Volume 10 | Article 1055 Puente-Marin et al. Erythrocyte Response to Nanostructured Proteins FIGURE 8 | Protein expression analysis of total blood samples from rainbow trout injected intravenously with 5.5 mg/kg of IBiRFP , IBTNFα , IBfrg16G−VHSV , and PBS at 48 h post-injection. (A) Interferon related protein MX and (B) chemokine IL8 Mean Fluorescence Intensity (MFI) measured by flow cytometry. Data represent mean ± SD (n = 4). Mann-Whitney test was performed between each condition and control cells (treated with PBS or IBiRFP ). #P-value < 0.05, compared to PBS. (32). Systemic exposure to recombinant TNFα would cause a up-regulation of mhcII and cd83 gene expression in rainbow shock similar to septic shock syndrome (31). Further, TNFα trout RBCs, thus endowing them the characteristics of antigen inhibition of IFNγ-induced IL12 production exerts mechanisms presenting cells (APCs). CD83 and MHCII are principally by which TNFα and IL12 cytokines can elicit anti-inflammatory produced by professional APCs to process antigens and induce T and repair functions, tightly modulated by positive and negative cell priming. However, recently, the concept of non-professional feedback signals for optimal immunity without manifested APCs is emerging (40). These atypical APCs up-regulate the inflammation (33). Another important observation is that fish expression of MHC and related molecules under certain stimuli. recombinant TNFα has been reported to regulate the expression However, there is not enough evidence about their functionality of endothelial cells TLRs, including TLR9, but had negligible priming T cells (40). effects on macrophages (34). Therefore, taking into account that Bacterial lipopolysaccharide has been reported to stimulate nucleated RBCs are the most abundant cell type in peripheral the innate immune response of RBCs in vitro (28). Bacterial IBs, blood, it would make sense that RBCs were equipped to modulate which contain remnants of endotoxin, are therefore considered inflammation in response to a systemic exposure to TNFα. immunostimulants per se (41), which is shown by the global Moreover, in the IBTNFα injected group, genes related to antigen increment in the immune response of RBCs from rainbow trout presentation, cd83 and mhcII, were also down-regulated at 24 injected with IBiRFP compared to PBS-injection. This, added and 48 h, respectively. As well, RBCs treated in vitro with IBTNFα to the utilization of IBs as delivery platforms to administrate down-regulated the expression of cd83 and mhcI 24 h post- cytokines, coadjuvants, or antigens, makes them a good candidate treatment. TNFα has been reported to modulate IFNγ-induced for future vaccines. In this context, RBCs have shown their ability MHC class II expression in a cell type-specific mode (35). to mount or modulate and immune-response to IBs made of Therefore, TNFα treatment augments or blocks MHC class II cytokine TNFα and the viral protein frg16G-VHSV. induction depending on the cell type and cellular differentiation All these considerations provide a new perspective on the role state (35). mhcII and cd83 gene expression has been previously and potential use of RBCs. Given the large amount of RBCs in the reported for rainbow trout RBCs (3, 36) and chicken RBCs (37). organism and their rapid distribution throughout the body they However, this is the first report that shows the regulation of cd83 could be a promising target cell for the presentation or delivery and mhcII gene transcripts in response to an immunostimulant. of IBs or other types of vaccine carriers. On the other hand, RBCs from rainbow trout injected with IBfrg16G−VHSV showed an up-regulatory trend for most of the genes, specifically interleukins il2 and il6, and antioxidant ETHICS STATEMENT enzyme nkef were significantly up-regulated, compared to IBiRFP , at 24 h post-injection. This is probably due to the effort of RBCs Experimental protocols and methods of the experimental animals to compensate the inflammatory response triggered after the first at the UMH were reviewed and approved by the Animal Welfare treatment stimulus. Then, 48 h post-injection, the Type 1 IFN Body and the Research Ethics Committee at the University and antigen presentation responses were increased, since tlr3, mx, Miguel Hernandez (approval number 2014.205.E.OEP; cd83, and mhcII genes transcripts were significantly up-regulated, 2016.221.E.OEP) and by the competent authority of the compared to IBiRFP . MX protein production was consistent with Regional Ministry of Presidency and Agriculture, Fisheries, Food gene expression levels. and Water supply (approval number 2014/VSC/PEA/00205). G-VHSV is known to induce the expression of ifn1 and All methods were carried out in accordance with the Spanish mx (25, 38, 39). Peptides derived from G-VHSV have also Royal Decree RD 53/2013 and EU Directive 2010/63/EU for demonstrated their efficacy to induce type 1 IFN response (25, the protection of animals used for research experimentation 26, 39). It is also noteworthy that IBfrg16G−VHSV triggered the and other scientific purposes. All experimental procedures of Frontiers in Immunology | www.frontiersin.org 9 May 2019 | Volume 10 | Article 1055 Puente-Marin et al. Erythrocyte Response to Nanostructured Proteins the experimental animals at the UAB were approved by the and by grants from the Spanish Ministry of Science, Human and Animal Experimentation Ethics Committee of the European commission and AGAUR funds to NR Universitat Autònoma de Barcelona (Reference 1533) and were (AGL2015-65129-R MINECO/FEDER and 2014SGR- done in strict accordance with the recommendations of the 345 AGAUR). RT holds a pre-doctoral scholarship from European Directive (2010/63/EU) on the protection of animals AGAUR (Spain). used for scientific purposes. ACKNOWLEDGMENTS AUTHOR CONTRIBUTIONS The authors would like to thank Remedios Torres and Efren SP-M performed experiments, analyzed data, and wrote the Lucas for their technical assistance and Nuria Barba from the manuscript. RT performed experiments and contributed to Servei de Microscopia and Manuela Costa from the Servei manuscript preparation. JC contributed to IBfrg16G−VHSV de Citometria of the Universitat Autònoma de Barcelona construction. LM provided valuable antibodies for the for helpful technical assistance. We are also thankful to the experiments. NR conceived ideas, oversaw the research and two reviewers for their valuable and constructive comments contributed to manuscript preparation. MO-V conceived ideas, and corrections. oversaw the research and co-wrote the manuscript. SUPPLEMENTARY MATERIAL FUNDING The Supplementary Material for this article can be found This work was supported by the European Research online at: https://www.frontiersin.org/articles/10.3389/fimmu. Council fund to MO-V (ERC Starting Grant GA639249) 2019.01055/full#supplementary-material REFERENCES fragments of their viral G protein. J Virol Methods. (2011) 176:14– 23. doi: 10.1016/j.jviromet.2011.05.018 1. Glomski CA, Tamburlin J, Chainani M. The phylogenetic odyssey of the 12. Thwaite R, Ji J, Torrealba D, Coll J, Sabès M, Villaverde A, et al. erythrocyte. III. Fish, the lower vertebrate experience. Histol Histopathol. Protein nanoparticles made of recombinant viral antigens: a promising (1992) 7:501–28. biomaterial for oral delivery of fish prophylactics. Front Immunol. (2018) 2. Passantino L, Massaro MA, Jirillo F, Di Modugno D, Ribaud MR, 9:1652. doi: 10.3389/fimmu.2018.01652 Modugno GD, et al. Antigenically activated avian erythrocytes 13. Filonov GS, Piatkevich KD, Ting LM, Zhang J, Kim K, Verkhusha VV. release cytokine-like factors: a conserved phylogenetic function Bright and stable near-infrared fluorescent protein for in vivo imaging. Nat discovered in fish. Immunopharmacol Immunotoxicol. (2007) Biotechnol. (2011) 29:757–61. doi: 10.1038/nbt.1918 29:141–52. doi: 10.1080/08923970701284664 14. Nombela I, Puente-Marin S, Chico V, Villena AJ, Carracedo B, Ciordia S, et 3. Puente-Marin S, Nombela I, Ciordia S, Mena MC, Chico V, Coll J, et al. Identification of diverse defense mechanisms in rainbow trout red blood al. In silico functional networks identified in fish nucleated red blood cells in response to halted replication of VHS virus. F1000Research. (2017) cells by means of transcriptomic and proteomic profiling. Genes. (2018) 6:1958. doi: 10.12688/f1000research.12985.1 9:E202. doi: 10.3390/genes9040202 15. Ortega-Villaizan M, Chico V, Falco A, Perez L, Coll JM, Estepa A. 4. Morera D, Roher N, Ribas L, Balasch JC, Donate C, Callol A, et al. RNA-Seq The rainbow trout TLR9 gene and its role in the immune responses reveals an integrated immune response in nucleated erythrocytes. PLoS ONE. elicited by a plasmid encoding the glycoprotein G of the viral (2011) 6:e26998. doi: 10.1371/journal.pone.0026998 hemorrhagic septicaemia rhabdovirus (VHSV). Mol Immunol. (2009) 5. Workenhe ST, Kibenge MJ, Wright GM, Wadowska DW, Groman DB, 46:1710–7. doi: 10.1016/j.molimm.2009.02.006 Kibenge FS. Infectious salmon anaemia virus replication and induction 16. Ortega-Villaizan M, Chico V, Martinez-Lopez A, Falco A, Perez L, Coll of alpha interferon in Atlantic salmon erythrocytes. Virol J. (2008) JM, et al. In vitro analysis of the factors contributing to the antiviral 5:36. doi: 10.1186/1743-422X-5-36 state induced by a plasmid encoding the viral hemorrhagic septicaemia 6. Nombela I, Ortega-Villaizan M. Nucleated red blood cells: immune virus glycoprotein G in transfected trout cells. Vaccine. (2011) 29:737– cell mediators of the antiviral response. PLoS Pathog. (2018) 14 43. doi: 10.1016/j.vaccine.2010.11.021 :e1006910. doi: 10.1371/journal.ppat.1006910 17. Chico V, Puente-Marin S, Nombela I, Ciordia S, Mena MC, Carracedo B, et 7. Holvold LB, Myhr AI, Dalmo RA. Strategies and hurdles using DNA vaccines al. Shape-shifted red blood cells: a novel red blood cell stage? Cells. (2018) to fish. Vet Res. (2014) 45:21. doi: 10.1186/1297-9716-45-21 7:E31. doi: 10.3390/cells7040031 8. OIE. Chapter 2.3.10: Viral Haemorrhagic Septicaemia. In: Manual of 18. Purcell MK, Nichols KM, Winton JR, Kurath G, Thorgaard GH, Wheeler P, Diagnostic Tests for Aquatic Animals. OIE, editor (2017). Available online at: et al. Comprehensive gene expression profiling following DNA vaccination of http://www.oie.int/en/standard-setting/aquatic-manual/access-online/. rainbow trout against infectious hematopoietic necrosis virus. Mol Immunol. 9. Torrealba D, Parra D, Seras-Franzoso J, Vallejos-Vidal E, Yero D, (2006) 43:2089–106. doi: 10.1016/j.molimm.2005.12.005 Gibert I, et al. Nanostructured recombinant cytokines: a highly stable 19. Wang T, Bird S, Koussounadis A, Holland JW, Carrington A, Zou alternative to short-lived prophylactics. Biomaterials. (2016) 107:102– J, et al. Identification of a novel IL-1 cytokine family member in 14. doi: 10.1016/j.biomaterials.2016.08.043 teleost fish. J Immunol. (2009) 183:962–74. doi: 10.4049/jimmunol.0 10. Torrealba D, Seras-Franzoso J, Mamat U, Wilke K, Villaverde A, Roher N, et 802953 al. Complex particulate biomaterials as immunostimulant-delivery platforms. 20. Ortega-Villaizan M, Martinez-Lopez A, Garcia-Valtanen P, Chico V, Perez L, PLoS ONE. (2016) 11:e0164073. doi: 10.1371/journal.pone.0164073 Coll JM, et al. Ex vivo transfection of trout pronephros leukocytes, a model 11. Encinas P, Gomez-Casado E, Estepa A, Coll JM. An ELISA for detection of for cell culture screening of fish DNA vaccine candidates. Vaccine. (2012) trout antibodies to viral hemorrhagic septicemia virus using recombinant 30:5983–90. doi: 10.1016/j.vaccine.2012.07.013 Frontiers in Immunology | www.frontiersin.org 10 May 2019 | Volume 10 | Article 1055 Puente-Marin et al. Erythrocyte Response to Nanostructured Proteins 21. Chaves-Pozo E, Montero J, Cuesta A, Tafalla C. Viral hemorrhagic septicemia production: a potential mechanism for the anti-inflammatory activities and infectious pancreatic necrosis viruses replicate differently in rainbow of tumor necrosis factor. Proc Natl Acad Sci USA. (1998) 95:13806– trout gonad and induce different chemokine transcription profiles. Dev Comp 11. doi: 10.1073/pnas.95.23.13806 Immunol. (2010) 34:648–58. doi: 10.1016/j.dci.2010.01.009 34. Roca FJ, Mulero I, Lopez-Munoz A, Sepulcre MP, Renshaw SA, Meseguer J, 22. Jorgensen TR, Raida MK, Kania PW, Buchmann K. Response of rainbow trout et al. Evolution of the inflammatory response in vertebrates: fish TNF-alpha (Oncorhynchus mykiss) in skin and fin tissue during infection with a variant is a powerful activator of endothelial cells but hardly activates phagocytes. J of Gyrodactylus salaris (Monogenea: Gyrodactylidae). Folia Parasitol. (2009) Immunol. (2008) 181:5071–81. doi: 10.4049/jimmunol.181.7.5071 56:251–8. doi: 10.14411/fp.2009.029 35. Han Y, Zhou ZH, Ransohoff RM. TNF-alpha suppresses IFN-gamma-induced 23. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real- MHC class II expression in HT1080 cells by destabilizing class II trans- time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. (2001) activator mRNA. J Immunol. (1999) 163:1435–40. 25:402–8. doi: 10.1006/meth.2001.1262 36. Puente-Marin S, Nombela I, Chico V, Ciordia S, Mena MC, Coll J, et 24. Metsalu T, Vilo J. ClustVis: a web tool for visualizing clustering of multivariate al. Rainbow Trout Erythrocytes ex vivo transfection with a DNA vaccine data using Principal Component Analysis and heatmap. Nucleic Acids Res. encoding VHSV Glycoprotein G induces an antiviral immune response. Front (2015) 43:W566–70. doi: 10.1093/nar/gkv468 Immunol. (2018) 9:2477. doi: 10.3389/fimmu.2018.02477 25. Chico V, Martinez-Lopez A, Ortega-Villaizan M, Falco A, Perez L, 37. St Paul M, Paolucci S, Barjesteh N, Wood RD, Sharif S. Chicken erythrocytes Coll JM, et al. Pepscan mapping of viral hemorrhagic septicemia virus respond to Toll-like receptor ligands by up-regulating cytokine transcripts. glycoprotein G major lineal determinants implicated in triggering host cell Res Vet Sci. (2013) 95:87–91. doi: 10.1016/j.rvsc.2013.01.024 antiviral responses mediated by type I interferon. J Virol. (2010) 84:7140– 38. Acosta F, Collet B, Lorenzen N, Ellis AE. Expression of the glycoprotein of 50. doi: 10.1128/JVI.00023-10 viral hemorrhagic septicaemia virus (VHSV) on the surface of the fish cell 26. Martinez-Lopez A, Garcia-Valtanen P, Ortega-Villaizan M, Chico V, Gomez- line RTG-P1 induces type 1 interferon expression in neighbouring cells. Fish Casado E, Coll JM, et al. VHSV G glycoprotein major determinants implicated Shellfish Immunol. (2006) 21:272–8. doi: 10.1016/j.fsi.2005.12.006 in triggering the host type I IFN antiviral response as DNA vaccine molecular 39. Ortega-Villaizan M, Chico V, Martinez-Lopez A, Garcia-Valtanen adjuvants. Vaccine. (2014) 32:6012–9. doi: 10.1016/j.vaccine.2014.07.111 P, Coll JM, Estepa A. Development of new therapeutical/adjuvant 27. Mercado L, Santana P, Palacios C, Narváez E, Guzmán F, Gallardo JA. molecules by pepscan mapping of autophagy and IFN inducing Antipeptide antibodies: a tool for detecting IL-8 in salmonids. Elect J determinants of rhabdoviral G proteins. Mol Immunol. (2016) Biotechnol. (2012) 15:20. doi: 10.2225/vol15-issue5-fulltext-15 70:118–24. doi: 10.1016/j.molimm.2015.10.008 28. Morera D, MacKenzie SA. Is there a direct role for erythrocytes in the immune 40. Kambayashi T, Laufer TM. Atypical MHC class II-expressing antigen- response? Vet Res. (2011) 42:89. doi: 10.1186/1297-9716-42-89 presenting cells: can anything replace a dendritic cell? Nat Rev Immunol. 29. Seras-Franzoso J, Sanchez-Chardi A, Garcia-Fruitos E, Vazquez (2014) 14:719–30. doi: 10.1038/nri3754 E, Villaverde A. Cellular uptake and intracellular fate of protein 41. Garcia-Fruitos E. Inclusion bodies: a new concept. Microbial Cell Factor. releasing bacterial amyloids in mammalian cells. Soft Matter. (2016) (2010) 9:80. doi: 10.1186/1475-2859-9-80 12:3451–60. doi: 10.1039/C5SM02930A 30. Nombela I, Carrion A, Puente-Marin S, Chico V, Mercado L, Perez L, et Conflict of Interest Statement: The authors declare that the research was al. Infectious pancreatic necrosis virus triggers antiviral immune response conducted in the absence of any commercial or financial relationships that could in rainbow trout red blood cells, despite not being infective. F1000Research. be construed as a potential conflict of interest. (2017) 6:1968. doi: 10.12688/f1000research.12994.2 31. Ma X. TNF-alpha and IL-12: a balancing act in macrophage functioning. Copyright © 2019 Puente-Marin, Thwaite, Mercado, Coll, Roher and Ortega- Microbes Infect. (2001) 3:121–9. doi: 10.1016/S1286-4579(00)01359-9 Villaizan. This is an open-access article distributed under the terms of the Creative 32. Aggarwal BB. Signalling pathways of the TNF superfamily: a double- Commons Attribution License (CC BY). The use, distribution or reproduction in edged sword. Nat Rev Immunol. (2003) 3:745–56. doi: 10.1038/ other forums is permitted, provided the original author(s) and the copyright owner(s) nri1184 are credited and that the original publication in this journal is cited, in accordance 33. Hodge-Dufour J, Marino MW, Horton MR, Jungbluth A, Burdick MD, with accepted academic practice. No use, distribution or reproduction is permitted Strieter RM, et al. Inhibition of interferon gamma induced interleukin12 which does not comply with these terms. Frontiers in Immunology | www.frontiersin.org 11 May 2019 | Volume 10 | Article 1055