Case Report published: 08 November 2019 doi: 10.3389/fgene.2019.01087 A Novel Nonsense Mutation (c.414G>A; p.Trp138*) in CLDN14 Causes Hearing Loss in Yemeni Families: A Case Report Walaa Kamal Eldin Mohamed 1,2, Mona Mahfood 1, Abdullah Al Mutery 1,3, Sallam Hasan Abdallah 3 and Abdelaziz Tlili 1,3* 1Department of Applied Biology, College of Sciences, University of Sharjah, Sharjah, United Arab Emirates, 2 Departament de Genètica i de Microbiologia, Facultat de Biociències, Universitat Autònoma de Barcelona, Barcelona, Spain, 3 Human Genetics & Stem Cells Research Group, Research Institute of Sciences & Engineering, University of Sharjah, Sharjah, United Arab Emirates Non-syndromic hearing loss (NSHL) is a hereditary disorder that affects many populations. Many genes are involved in NSHL and the mutational load of these genes often differs among ethnic groups. Claudin-14 (CLDN14), a tight junction protein, is known to be associated with NSHL in many populations. In this study, we aimed to identify the responsible variants in 3 different Yemeni families affected with NSHL. Firstly, clinical exome Edited by: Musharraf Jelani, sequencing (CES) performed for 3 affected patients from these different families identified Islamia College University, a new nonsense variant (c.414G > A) in CLDN14. This variant was then confirmed by Pakistan Sanger sequencing and PCR-RFLP. Subsequently, four microsatellite markers were used Reviewed by: Muhammad Umair, to genotype these families, which revealed a founder effect for this variant. Overall, this Quaid-i-Azam University, study illustrates the implication of the CLDN14 gene in the Yemeni population with NSHL Pakistan and identifies a new founder variant. Agnese De Mario, University of Padova, Keywords: CLDN14 gene, clinical exome sequencing, nonsense variant, non-syndromic hearing loss, Italy founder effect *Correspondence: Abdelaziz Tlili atlili@sharjah.ac.ae BACKGROUND Specialty section: Hearing loss (HL) is a relatively common congenital disorder; its prevalence in newborns is 1 in This article was submitted to 1,000 live births (MORTON, 1991). Hereditary HL can be associated with other symptoms but in Genetic Disorders, the majority of cases (70%) it is non-syndromic (Najmabadi and Kahrizi, 2014). Non-syndromic a section of the journal hearing loss (NSHL) can be classified by its mode of inheritance as; autosomal dominant (~15– Frontiers in Genetics 20%), autosomal recessive (~80%), X-linked, Y-linked or mitochondrial (together ~2%) (ACMG; Received: 26 July 2019 Hone and Smith, 2002). Accepted: 09 October 2019 Published: 08 November 2019 Autosomal recessive non-syndromic hearing loss (ARNSHL) is extremely genetically heterogeneous with 72 genes and 108 loci associated with this type of HL (https://hereditaryhearingloss. Citation: org). Next Generation Sequencing (NGS) is an important approach for screening diseases with Mohamed WKE, Mahfood M, Al Mutery A, Abdallah SH and Tlili A high heterogeneity, such as hearing loss, as it can quickly characterize hundreds of genes and a (2019) A Novel Nonsense Mutation large number of common variants (http://hearing.harvard.edu/db/genelist.htm) in timely and cost (c.414G>A; p.Trp138*) in CLDN14 effective manner as opposed to Sanger sequencing (Gürtler et al., 2008; Gao et al., 2015). Causes Hearing Loss in Yemeni Families: A Case Report. Abbreviations: NSHL, Non-syndromic Hearing Loss; ARNSHL, Autosomal Recessive Non-Syndromic Hearing Loss; HL, Front. Genet. 10:1087. Hearing Loss; PCR, Polymerase Chain Reaction; RFLP, Restriction Fragment Length Polymorphism; CLDN14, Claudin 14; doi: 10.3389/fgene.2019.01087 CES, Clinical exome sequencing. Frontiers in Genetics | www.frontiersin.org 1 November 2019 | Volume 10 | Article 1087 Mohamed et al. New HL-CLDN14 Founder Mutation Variants in gap and tight junctions are known to be associated identification of CLDN14 variants in families with ARNSHL with ARNSHL (Martínez et al., 2009; Kim et al., 2014). Connexins (Wilcox et al., 2001), several genetic and functional studies have are important for the formation of gap junctions between adjacent been performed. These studies confirmed the implication of the cells, where direct intercellular communication via diffusion of CLDN14 gene in hearing loss (Lu et al., 2018). ions and metabolites can occur (Goodenough and Paul, 2003); In this study, we performed Clinical Exome Sequencing (CES) members of the connexin family have an important role in and identified a new nonsense variant in three different Yemeni ARNSHL. In fact, many reports claim that approximately 50% of families. Haplotype analysis of the CLDN14 gene region, using autosomal recessive HL cases are caused by either homozygous four microsatellite markers, showed that this pathogenic DNA or compound heterozygous variants in the gap junction beta 2 variant has a founder effect. (GJB2) gene (Zheng et al., 2015), making the GJB2 gene the most frequent gene implicated in ARNSHL. Therefore, it is common to pre-screen NSHL individuals for GJB2 variants, to determine CASE PRESENTATION whether NGS techniques are required. In the inner ear, tight junctions are involved to maintain the difference in concentration In this study, we investigated three consanguineous Yemeni between the endolymph and the perilymph. The CLDN14 gene, families diagnosed with ARNSHL (Figure 1A). The proband encoding a tight junction protein, serves as potassium-restrictive YMN2 of the family YMN-I is a 25 year old affected female. Her barrier in the Corti organ (Ben-Yosef et al., 2003). Since the audiogram showed an average pure tone air conduction (PTA) FIGURE 1 | Pedigrees of the affected families, Audiograms and PCR-RFLP. (A) Pedigrees of three affected families with non-syndromic hearing loss. Arrows denote the probands. (B) Audiograms of the affected probands from the 3 Yemeni families: (o) indicates air conduction for right ear, (x) indicates air conduction for left ear. (C) Results of the PCR-RFLP analysis in YMNII and YMNIII affected families. The 987 PCR product digested with the AvaII restriction enzyme. The wildtype allele is cleaved into three fragments 558, 348, and 81 bp, whereas the c.414G>A mutant allele is cleaved into two fragments 906 and 81 bp in length. ND, undigested PCR product. Frontiers in Genetics | www.frontiersin.org 2 November 2019 | Volume 10 | Article 1087 Mohamed et al. New HL-CLDN14 Founder Mutation varying from 60–80 for her left and right ears (Figure 1) and in-house Variation and Mutation Annotation Toolkit 2.3.4 the otoscopy of both ears was normal. The proband’s younger (VariMAT). The remaining variants were then further filtered by sister (YMN3) is 23 years old and showed an average PTA of frequency (i.e. < 0.01%) in dbSNP (https://www.ncbi.nlm.nih. 70–80; her otoscopy was also normal (Supplementary Figure 1). gov/projects/SNP/) or ExAC Browser (http://exac.broadinstitute. The proband’s younger brother and parents are phenotypically org/). Finally, to predict the functional impact of the candidate normal. The YMN-II family consists of three affected female variants the following bioinformatics tools were used: Variant siblings, YMN4 is 29 year old, YMN5 is 14 year old and YMN6 is Effect Predictor (VEP) (http://grch37.ensembl.org/Homo_ 21 year old with PTA of 90–100, 70–80 and 80 for left and right sapiens/Tools/VEP) and VarSome (https://varsome.com/). ears respectively, their otoscopy was also normal. Moreover, the proband’s third sister, brother and parents are phenotypically normal (Figure 1 and Supplementary Figure 1). The last family Sanger Sequencing YMN-III consisted of two affected female siblings YMN8 and Sanger sequencing was performed for all members of the YMN9 (25 and 29 years old respectively) with PTA of 100, 90–100 investigated families to confirm the co-segregation of the for left and right ears (Figure 1 and Supplementary Figure 1), c.414G>A variant with the disease phenotype. In order to amplify the otoscopy result for both affected females was normal. The the exonic region corresponding to this variant, we designed the proband in this family has an elder affected sister (sample could following primers: CLDN14-F: ACCACCATCCTGCCGCACTG not be collected), deceased affected brother, two phenotypically and CLDN14-R: TGTTTGCAGTGGTCGTGGTG. Polymerase normal brothers and parents. In summary, the analysis of the Chain Reaction (PCR) was then carried out at an annealing audiograms of the three families (Supplementary Table 1), temperature of 55°C generating amplicons of 550 bp in length. The showed a sloppy audiogram shape in all the affected individuals. amplified products were then purified using ExoSapIT clean up reagent (Affymetrix, Fisher Scientific, Göteborg—Sweden). Cycle sequencing was performed using Big dye terminator V3.1 cycle MATERIALS AND METHODS sequencing kit (Applied Biosystems, USA). The products were later purified using Dye EX 2.0 spin kit (Qiagen, Germany) and injected Sample Collection in the 3500 Genetic Analyzer (Applied Biosystems, Thermo Fisher Collection of samples was done in collaboration with Al-Amal Scientific, USA). The sequences were aligned with the published association of deaf and mutism in Hadramout coast (Mukallah, sequence of the CLDN14 gene (NG_011777.1; NP_001139549.1). Yemen). Consent forms were filled and signed by all participants. Saliva samples were collected from the participants using Oragene-DNA (OG-500) Kit (DNA Genotek, CANADA), and Variant Screening Using PCR-RFLP only letters and numbers were used to label DNA samples to The AvaII restriction enzyme was used to screen the c.414G>A protect the participant’s privacy. Genomic DNA was extracted nucleotide transition in the affected families and healthy controls. using Prep IT L2P (DNA Genotek, CANADA) following the The primers’ sequences were: CATTTCCTTTCTCTCCCTGCT manufacturer’s protocol. The experimental procedures were and GACATTTCCTCGCATTCACA. The PCR product size was of approved by the Ethics Committee from the University of 987 bp. The digestion of PCR products was performed according Sharjah (Sharjah, UAE) and by the General Directorate of the to the manufacturer’s instructions (New England Biolabs, USA) Office of the Ministry of Health and population-Hadramout followed by separation on 2% agarose gel at 80 V for 1 h and half. Coast (Mukallah, Yemen). Genotyping Clinical Exome Sequencing and Four microsatellite markers (D21S1252, D21S168, D21S267, Bioinformatics Analysis and D21S1894), flanking the CLDN14 gene chromosomal Clinical exome sequencing and standard data analysis was region were chosen (Figure 3A). The sequences of these performed for the affected individuals YMN3, YMN5, and microsatellite markers are described in Supplementary Table 2. YMN8. The genomic DNA was sheared and used to perform For each marker, the forward primer was labeled with a specific exome capture using oligonucleotide probes (SureSelect fluorescence and the PCR products were analyzed using the V5+UTRs) following the manufacturer’s provided protocols. The Genetic Analyzer 3500 (Applied Biosystems, Thermo Fisher exonic region was later enriched by hybridizing capture probes. Scientific, USA). Gene mapper software v5.0 was used for alleles The captured fragments were then adapted to produce libraries call and haplotypes were constructed manually. that were sequenced on the Illumina HiSeq 2500/4000 system (Illumina, San Diego, CA, USA) to generate paired end 2X 100bp sequence reads to produce 100x mean coverage. Only reads that RESULTS were generated from high quality sequences were analyzed after quality control for variant calling and annotation, and later were Clinical Exome Sequencing (CES) Analysis aligned to the human reference genome build GRCh37/hg19 Three affected families with ARNSHL were studied (Figure 1A). using BWA-0.7.12. PCR duplicates were then removed using The proband of each affected family was screened for variants in Picard-1.140 and variants were called using Genome Analysis the GJB2 gene using PCR and Sanger Sequencing and no variant Toolkit (GATK) v2.3-9. Known variants were annotated with has been detected. Thus, we performed a CES analysis including Frontiers in Genetics | www.frontiersin.org 3 November 2019 | Volume 10 | Article 1087 Mohamed et al. New HL-CLDN14 Founder Mutation 126 genes implicated in HL. The total numbers of variants were (Figure 3A). Apart from marker D21S1894, a homozygous 327640 for YMN3, 314150 for YMN5, and 267190 for YMN8. haplotype for the alleles 246,104 and 188, of the markers As all families were consanguineous, we considered only D21S1252, D21S168, and D21S267, has been detected in all homozygous variants located in the HL-related genes and with affected individuals, while parents and healthy individuals were a frequency less than 0.01 (Table 1). Subsequently, VEP (Variant heterozygous for this particular haplotype (Figure 3B). Effect Predictor) tool, LoFTool score, LRT pred, Mutation Taster pred and VarSome were used to predict the functional impact of these remaining variants. The LoFTool score identified only one DISCUSSION variant in the CLDN14 gene (c.414G>A) as damaging, LRT pred In this study, we analyzed 3 Yemeni families with ARNSHL. As showed that the same variant is D (deleterious) and the Mutation variants in the GJB2 gene are among the most common variants Taster pred showed that it is a disease causing (D, D, D, D, D). in Middle East (Shahin et al., 2002; Tlili et al., 2017), known to VarSome also confirmed that this variant in the CLDN14 gene is be related to HL and is commonly used for clinical screening predicted to be pathogenic. (Zheng et al., 2015), we first pre-screened the affected individuals To confirm these findings, we sequenced the 7th exon of for variants in this gene. Due to the absence of pathogenic the CLDN14 using Sanger sequencing (Figure 2). The analysis variants within the GJB2 gene, we further analyzed the affected revealed a co-segregation of the c.414G>A variant in the three samples by CES. The CES results allowed us to identify a novel families. This co-segregation was also confirmed by PCR- nonsense variant p.Trp138Ter (c.414G>A) in the CLDN14 gene. RFLP using the AvaII restriction enzyme (Figure 1C). In fact, The co-segregation of this variant with the disease was confirmed all affected individuals were homozygous for this nucleotide by Sanger sequencing and PCR-RFLP. While most of the variants transition, parents were heterozygous, and unaffected siblings in CLDN14 that lead to hearing loss in different populations were were either heterozygous or homozygous normal. missense variants (Supplementary Table 3), nonsense variants were only found in this study and in one family from Pakistan Genotyping and Haplotype Analysis (Lee et al., 2012). Variants of CLDN14 have been previously Based on the previous results shown in Table 1, we assumed associated with hearing loss in Canada, Pakistan, India and that the nonsense variant p.Trp138Ter (c.414G>A) is a Morocco (Wilcox et al., 2001; Bashir et al., 2010; Lee et al., 2012; common founder variant. To confirm our hypothesis, four Bashir et al., 2013; Charif et al., 2013; Pandey et al., 2017; Pater short tandem repeats (STR) markers (D21S1252, D21S168, et al., 2017) (Supplementary Table 3). In addition, some studies D21S267, D21S1894) were analyzed in the three affected families showed the absence of variants in the CLDN14 gene for other TABLE 1 | Predicted impact of the remaining variants after filtration of the CES results. Gene Patient ID Variant type cDNA variant Amino acid change Classification BDP1 YMN3 Exonic-NC* n.2439A>T *NA Likely benign CLDN14 YMN3 Nonsense c.414G>A p.Trp138Ter Pathogenic YMN5 YMN8 SLC26A2 YMN5 Missense c.1721T>C p.Ile574Thr Benign NARS2 YMN5 5UTR c.-854C>T *NA Uncertain significance CDH23 YMN8 5UTR c.-35_-31dup *NA Likely benign *NC, Exonic Non coding; *NA, Not available. FIGURE 2 | Electropherograms. Representative electropherogram of a normal homozygous individual (A), a heterozygous individual (B) and an affected homozygous individual (C). Frontiers in Genetics | www.frontiersin.org 4 November 2019 | Volume 10 | Article 1087 Mohamed et al. New HL-CLDN14 Founder Mutation FIGURE 3 | Founder effect of the c.414G>A variant. (A) Chromosomal location of the CLDN14 gene and the 4 STR markers on chromosome 21 used to study the c.414G > A founder effect (B) Haplotype analysis in the 3 affected families showing the segregation of a common haplotype with the c.414G>A variant and confirming its founder effect. populations such as Tunisia, Turkey and China (Uyguner et al., al., 2010; Bashir et al., 2013). For the Yemeni families studied 2003; Belguith et al., 2009; Lu et al., 2018). here, and as the variant is common, the phenotypic variability is The new c.414G>A variant within the CLDN14 gene showed probably due to modifier genes and/or environmental factors. a phenotypic variability among the 3 Yemeni families. In fact, the Tight junctions in the inner ear are important as they are essential audiograms revealed that the affected members have moderate to to sustain the paracellular permeability between endolymph and profound congenital hearing loss (Figure 1B). The HL phenotypic the adjacent tissue and maintain the apical-basal polarity within variability observed in our study has been also reported in the cell. Thus, tight junctions are considered a dynamic barrier different families with CLDN14 variants (Wilcox et al., 2001). A between the external and internal environments (Gupta and Ryan, previous study that compared the audiograms of affected Pakistani 2010). Variants occurring in tight junction genes such as claudin-14 individuals with CLDN14 variants, showed that the studied (CLDN14) have been shown to be involved in HL (Nunes et al., patients presented moderate to severe, moderately severe to 2012). Claudin 14 is highly expressed in the kidney, liver and inner profound, and severe to profound HL. This phenotypic variability ear (Wilcox et al., 2001; Ben-Yosef et al., 2003). In the inner ear, could be explained by both the nature of the pathogenic variant CLDN14 plays a key role during the auditory process by recycling and the possibility of interaction with modifier genes (Bashir et potassium ions from the hair cells back to the endolymph (Duman Frontiers in Genetics | www.frontiersin.org 5 November 2019 | Volume 10 | Article 1087 Mohamed et al. New HL-CLDN14 Founder Mutation and Tekin, 2012). In vitro studies, mouse knockout models and (No. REC-15-11-P004). The patients/participants provided their human phenotype studies demonstrated that this gene is very written informed consent to participate in this study. crucial for a normal function of the auditory system (Wilcox et al., 2001; Ben-Yosef et al., 2003; Angelow et al., 2008). In fact, it has been shown that Cldn14-null mice exhibit HL due to the rapid AUTHOR CONTRIBUTIONS deterioration and the loss of function of their cochlear outer hair cells (OHCs) shortly after birth (Ben-Yosef et al., 2003). AT designed the study. AT and AM supervised the study. WM Since the c.414G>A variant was observed in three unrelated performed the experiments and wrote the manuscript. AT, WM, families, we genotyped four microsatellite markers to test its and MM revised and edited the manuscript. AT, WM, MM, and founder effect. It was preferable to use microsatellite markers SA analyzed the data. All authors have read and approved the rather than SNPs because they are more polymorphic and they manuscript. provide efficient and informative genotyping as they are highly mutable often with 15 or more alleles in any populations (Baird et al., 2008). Our analysis confirmed the founder effect of the FUNDING c.414G>A variant. This is the second documented evidence for a founder variant in the CLDN14 gene. The first founder effect has The work presented here was funded by the University of Sharjah been reported for the c.488C>T variant that was predominant in and Sheikh Hamdan Bin Rashid Al-Maktoum Award for Medical the island population of Newfoundland (Pater et al., 2017). Sciences. In sum, we report here the first variant responsible for hearing loss in Yemeni population. This variant is a nonsense variant located within the CLDN14 gene and has a founder effect. ACKNOWLEDGMENTS We would like to express our sincere gratitude to the Al-Amal association of deaf and mutism in Hadramout and the families DATA AVAILABILITY STATEMENT included in this study for their full cooperation. Also, we would The datasets analyzed in this manuscript are not publicly like to thank Dr. Mohamed Kamal Basalama for his assistance in available. Requests to access the datasets should be directed to collecting the samples. atlili@sharjah.ac.ae. SUPPLEMENTARY MATERIAL ETHICS STATEMENT The Supplementary Material for this article can be found online at: The studies involving human participants were reviewed and https://www.frontiersin.org/articles/10.3389/fgene.2019.01087/ approved by University of Sharjah Research Ethics Committee full#supplementary-material REFERENCES Charif, M., Bakhchane, A., Abidi, O., Boulouiz, R., Eloualid, A., Roky, R., et al. (2013). Analysis of CLDN14 gene in deaf Moroccan patients with non- ACMG. (2002). Genetics evaluation guidelines for the etiologic diagnosis of congenital syndromic hearing loss. Gene 523, 103–105. doi: 10.1016/j.gene.2013.03.123 hearing loss. Genetic evaluation of congenital hearing loss expert panel. ACMG Duman, D., and Tekin, M. (2012). Autosomal recessive nonsyndromic statement. Genet. Med. 4, 162–171. doi: 10.109700125817-200205000-00011 deafness genes: a review. Front. Biosci. (Landmark Ed.) 17, 2213–2236. doi: Angelow, S., Ahlstrom, R., and Yu, A. S. L. (2008). Biology of claudins. Am. J. 10.2741/4046 Physiol. Renal Physiol. 295, F867–F876. doi: 10.1152/ajprenal.90264.2008 Gao, X., Huang, S.-S., Yuan, Y.-Y., Wang, G.-J., Xu, J.-C., Ji, Y.-B., et al. (2015). Baird, N. A., Etter, P. D., Atwood, T. S., Currey, M. C., Shiver, A. L., Lewis, Z. A., Targeted gene capture and massively parallel sequencing identify TMC1 et al. (2008). Rapid SNP discovery and genetic mapping using sequenced RAD as the causative gene in a six-generation Chinese family with autosomal markers. PloS One 3, e3376. doi: 10.1371/journal.pone.0003376 dominant hearing loss. Am. J. Med. Genet. A 167A, 2357–2365. doi: 10.1002/ Bashir, R., Fatima, A., and Naz, S. (2010). Mutations in CLDN14 are associated ajmg.a.37206 with different hearing thresholds. J. Hum. Genet. 55, 767–770. doi: 10.1038/ Goodenough, D. A., and Paul, D. L. (2003). Beyond the gap: functions of unpaired jhg.2010.104 connexon channels. Nat. Rev. Mol. Cell Biol. 4, 285–294. doi: 10.1038/nrm1072 Bashir, Z.-H., Latief, N., Belyantseva, I. A., Iqbal, F., Amer Riazuddin, S., Gupta, I. R., and Ryan, A. K. (2010). Claudins: unlocking the code to tight junction Khan, S. N., et al. (2013). Phenotypic variability of CLDN14 mutations function during embryogenesis and in disease. Clin. Genet. 77, 314–325. doi: causing DFNB29 hearing loss in the Pakistani population. J. Hum. Genet. 10.1111/j.1399-0004.2010.01397.x 58, 102–108. doi: 10.1038/jhg.2012.143 Gürtler, N., Egenter, C., Bösch, N., and Plasilova, M. (2008). Mutation analysis of Belguith, H., Tlili, A., Dhouib, H., Ben Rebeh, I., Lahmar, I., Charfeddine, I., et al. the Cx26, Cx30, and Cx31 genes in autosomal recessive nonsyndromic hearing (2009). Mutation in gap and tight junctions in patients with non-syndromic hearing impairment. Acta Otolaryngol. 128, 1056–1062. doi: 10.1080/00016480701854727 loss. Biochem. Biophys. Res. Commun. 385, 1–5. doi: 10.1016/j.bbrc.2009.02.125 Hone, S. W., and Smith, R. J. H. (2002). Medical evaluation of pediatric hearing Ben-Yosef, T., Belyantseva, I. A., Saunders, T. L., Hughes, E. D., Kawamoto, K., Van loss. Laboratory, radiographic, and genetic testing. Otolaryngol. Clin. North Itallie, C. M., et al. (2003). Claudin 14 knockout mice, a model for autosomal Am. 35, 751–764. doi: 10.1016/S0030-6665(02)00048-8 recessive deafness DFNB29, are deaf due to cochlear hair cell degeneration. Kim, M.-A., Kim, Y.-R., Sagong, B., Cho, H.-J., Bae, J. W., Kim, J., et al. (2014). Hum. Mol. Genet. 12, 2049–2061. doi: 10.1093/hmg/ddg210 Genetic analysis of genes related to tight junction function in the korean Frontiers in Genetics | www.frontiersin.org 6 November 2019 | Volume 10 | Article 1087 Mohamed et al. New HL-CLDN14 Founder Mutation population with non-syndromic hearing loss. PloS One 9, e95646. doi: 10.1371/ Tlili, A., Al Mutery, A., Kamal Eddine Ahmad Mohamed, W., Mahfood, M., journal.pone.0095646 and Hadj Kacem, H. (2017). Prevalence of GJB2 mutations in affected Lee, K., Ansar, M., Andrade, P. B., Khan, B., Santos-Cortez, R. L. P., Ahmad, W., individuals from united arab emirates with autosomal recessive et al. (2012). Novel CLDN14 mutations in Pakistani families with autosomal nonsyndromic hearing loss. Genet. Test. Mol. Biomarkers 21, 686–691. doi: recessive non-syndromic hearing loss. Am. J. Med. Genet. A 158A, 315–321. 10.1089/gtmb.2017.0130 doi: 10.1002/ajmg.a.34407 Uyguner, O., Emiroglu, M., Uzumcu, A., Hafiz, G., Ghanbari, A., Baserer, N., et al. Lu, Y., Yao, J., Wei, Q., Xu, J., Xing, G., and Cao, X. (2018). Genetic analysis of (2003). Frequencies of gap- and tight-junction mutations in Turkish families CLDN14 in the Chinese population affected with non-syndromic hearing loss. with autosomal-recessive non-syndromic hearing loss. Clin. Genet. 64, 65–69. Int. J. Pediatr. Otorhinolaryngol. 105, 6–11. doi: 10.1016/j.ijporl.2017.11.016 doi: 10.1034/j.1399-0004.2003.00101.x Martínez, A. D., Acuña, R., Figueroa, V., Maripillan, J., and Nicholson, B. (2009). Wattenhofer, M., Reymond, A., Falciola, V., Charollais, A., Caille, D., Borel, C., Gap-junction channels dysfunction in deafness and hearing loss. Antioxid. et al. (2005). Different mechanisms preclude mutant CLDN14 proteins from Redox Signal. 11, 309–322. doi: 10.1089/ars.2008.2138 forming tight junctions in vitro. Hum. Mutat. 25, 543–549. doi: 10.1002/ MORTON, N. E. (1991). Genetic epidemiology of hearing impairment. Ann. N. Y. humu.20172 Acad. Sci. 630, 16–31. doi: 10.1111/j.1749-6632.1991.tb19572.x Wilcox, E. R., Burton, Q. L., Naz, S., Riazuddin, S., Smith, T. N., Ploplis, B., Najmabadi, H., and Kahrizi, K. (2014). Genetics of non-syndromic hearing loss in et al. (2001). Mutations in the gene encoding tight junction claudin-14 cause the Middle East. Int. J. Pediatr. Otorhinolaryngol. 78, 2026–2036. doi: 10.1016/j. autosomal recessive deafness DFNB29. Cell 104, 165–172. doi: 10.1016/ ijporl.2014.08.036 S0092-8674(01)00200-8 Nunes, A. P., Oliveira, I. O., Santos, B. R., Millech, C., Silva, L. P., González, D. A., Zheng, J., Ying, Z., Cai, Z., Sun, D., He, Z., Gao, Y., et al. (2015). GJB2 mutation et al. (2012). Quality of DNA extracted from saliva samples collected with spectrum and genotype-phenotype correlation in 1067 han chinese subjects the OrageneTM DNA self-collection kit. BMC Med. Res. Methodol. 12, 65. doi: with non-syndromic hearing loss. PloS One 10, e0128691. doi: 10.1371/journal. 10.1186/1471-2288-12-65 pone.0128691 Pandey, N., Rashid, T., Jalvi, R., Sharma, M., Rangasayee, R., Andrabi, K. I., et al. (2017). Mutations in OTOF, CLDN14 & SLC26A4 genes as major causes of Conflict of Interest: The authors declare that the research was conducted in the hearing impairment in Dhadkai village, Jammu & Kashmir, India. Indian J. absence of any commercial or financial relationships that could be construed as a Med. Res. 146, 489–497. doi: 10.4103/ijmr.IJMR_635_15 potential conflict of interest. Pater, J. A., Benteau, T., Griffin, A., Penney, C., Stanton, S. G., Predham, S., et al. (2017). A common variant in CLDN14 causes precipitous, prelingual Copyright © 2019 Mohamed, Mahfood, Al Mutery, Abdallah and Tlili. This is an sensorineural hearing loss in multiple families due to founder effect. Hum. open-access article distributed under the terms of the Creative Commons Attribution Genet. 136, 107–118. doi: 10.1007/s00439-016-1746-7 License (CC BY). The use, distribution or reproduction in other forums is permitted, Shahin, H., Walsh, T., Sobe, T., Lynch, E., King, M.-C., Avraham, K. B., et al. provided the original author(s) and the copyright owner(s) are credited and that the (2002). Genetics of congenital deafness in the Palestinian population: multiple original publication in this journal is cited, in accordance with accepted academic connexin 26 alleles with shared origins in the Middle East. Hum. Genet. 110, practice. No use, distribution or reproduction is permitted which does not comply 284–289. doi: 10.1007/s00439-001-0674-2 with these terms. Frontiers in Genetics | www.frontiersin.org 7 November 2019 | Volume 10 | Article 1087