Received: 1 February 2019 | Revised: 27 March 2019 | Accepted: 18 April 2019 DOI: 10.1111/xen.12524 ORIGINAL ARTICLE Generation of cattle knockout for galactose‐α1,3‐galactose and N‐glycolylneuraminic acid antigens Andrea Perota1 | Irina Lagutina1 | Roberto Duchi1 | Elisa Zanfrini1 | Giovanna Lazzari1,2 | Jean Paul Judor3,4 | Sophie Conchon3,4 | Jean Marie Bach5 | Tomaso Bottio6 | Gino Gerosa6 | Cristina Costa7 | Manuel Galiñanes8 | Jean Christian Roussel9 | Vered Padler‐Karavani10 | Emanuele Cozzi11 | Jean Paul Soulillou3,4 | Cesare Galli1,2 1 Avantea, Laboratory of Reproductive Technologies, Cremona, Italy 2 Fondazione Avantea, Cremona, Italy 3 Centre de Recherche en Transplantation et Immunologie, UMR 1064, INSERM, Université de Nantes, Nantes, France 4 Institut de Transplantation Urologie Néphrologie (ITUN), CHU Nantes, Nantes, France 5 IECM, Immuno‐endocrinology, EA4644 Oniris, University of Nantes, USC1383 INRA, Oniris, Nantes, France 6 Cardiac Surgery Unit ‐ Department of Cardiac, Thoracic and Vascular Sciences and Public Health ‐ Padova University School of Medicine and CORIS, Padova, Italy 7 Infectious Diseases and Transplantation Division, Institut d’Investigació Biomèdica de Bellvitge (IDIBELL), Hospitalet de Llobregat, Barcelona, Spain 8 Reparative Therapy of the Heart, Vall d’Hebron Research Institute (VHIR) and Department of Cardiac Surgery, University Hospital Vall d’Hebron, Autonomous University of Barcelona (AUB), Barcelona, Spain 9 Department of Thoracic and CardioVascular Surgery, Nantes Hospital University, Nantes, France 10 The George S. Wise Faculty of Life Sciences, Department of Cell Research and Immunology, Tel Aviv University, Tel Aviv, Israel 11 Transplant Immunology Unit, Padua General Hospital, Padua, Italy Correspondence Cesare Galli, Avantea, Laboratory of Abstract Reproductive Technologies, Cremona, Italy. Two well‐characterized carbohydrate epitopes are absent in humans but present in Email: cesaregalli@avantea.it other mammals. These are galactose‐α1,3‐galactose (αGal) and N‐glycolylneuraminic Funding information acid (Neu5Gc) which are introduced by the activities of two enzymes including α(1,3) This work was supported by the European Union Seventh Framework Program galactosyltransferase (encoded by the GGTA1 gene) and CMP‐Neu5Gc hydroxylase (FP7/2007/2013) under the Grant (encoded by the CMAH gene) that are inactive in humans but present in cattle. Hence, agreement 603049 for Translink consortium (http://www.trans​linkp​roject.com/) bovine‐derived products are antigenic in humans who receive bioprosthetic heart valves (BHVs) or those that suffer from red meat syndrome. Using programmable nucleases, we disrupted (knockout, KO) GGTA1 and CMAH genes encoding for the enzymes that catalyse the synthesis of αGal and Neu5Gc, respectively, in both male and female bovine fibroblasts. The KO in clonally selected fibroblasts was detected by polymerase chain reaction (PCR) and confirmed by Sanger sequencing. Selected fibroblasts colonies were used for somatic cell nuclear transfer (SCNT) to produce cloned embryos that were implanted in surrogate recipient heifers. Fifty‐three This is an open access article under the terms of the Creat​ive Commo​ns Attri​bution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited. © 2019 The Authors. Xenotransplantation Published by John Wiley & Sons Ltd. Xenotransplantation. 2019;26:e12524.  wileyonlinelibrary.com/journal/xen | 1 of 13 https://doi.org/10.1111/xen.12524 2 of 13 | PEROTA et al. embryos were implanted in 33 recipients heifers; 3 pregnancies were carried to term and delivered 3 live calves. Primary cell cultures were established from the 3 calves and following molecular analyses confirmed the genetic deletions. FACS analysis showed the double‐KO phenotype for both antigens confirming the mutated geno‐ types. Availability of such cattle double‐KO model lacking both αGal and Neu5Gc offers a unique opportunity to study the functionality of BHV manufactured with tis‐ sues of potentially lower immunogenicity, as well as a possible new clinical approaches to help patients with red meat allergy syndrome due to the presence of these xeno‐ antigens in the diet. KEYWORDS bioprosthetic Heart Valve (BHV), cattle, CMAH, GGTA1, knockout, Neu5Gc, xenotransplantation, αGal 1 | I NTRO D U C TI O N in the clinic are in fact manufactured with bovine pericardia, that carries non‐negligible amounts of αGal8 and of Neu5Gc9 even after Two well‐characterized antigens are absent in humans but present currently used manufacturing treatments. in mammals and include galactose‐α1,3‐galactose (αGal) and N‐gly‐ Pig‐ and cattle‐derived products are also a major source of pro‐ colylneuraminic acid (Neu5Gc) whose synthesis are catalysed by teins for human consumption, and particularly, cattle are the major α(1,3) galactosyltransferase (encoded by the GGTA1 gene)1,2 and source of dairy products. Such products can become allergenic for CMP‐Neu5Gc hydroxylase (encoded by the CMAH gene) 3-5 respec‐ some patients or infants consuming baby milk replacers. This allergy, tively. These have been identified as major antigens in xenotrans‐ known as the red meat allergy syndrome,18,19 generally follows a tick 3 plantation studies or retrospective clinical findings . Pigs that carry bite inducing an isotype shift for IgE against αGal antigen. Neu5Gc mutations in both genes, and therefore lack these xenoantigens, is not synthesized by humans, but it can be incorporated through have been generated.6 Moreover, porcine kidneys lacking αGal are the diet and found in minute amounts in endothelial or epithelial 7 not hyperacutely rejected. It is also expected that such tissues will cells of various tissues, likely contributing to inflammation‐related be less immunogenic for patients being implanted with animal‐de‐ diseases. 20,21 Furthermore, cattle can be used as a “bioreactor” to rived tissues engineered to lack both antigens. produce bioactive molecules for nutraceuticals or biomedical use, One of the major clinical applications of xenogenic tissues is for including r‐human lactoferrin22 in bovine milk. However, the result‐ the manufacturing of bioprosthetic heart valves (BHVs), and it has ing product differs from the human one because of the different been shown that such tissues carry the same xenoantigens despite glycosylation pattern. 23 Similarly, partially “humanized” antibodies24 the glutaraldehyde treatments used in the manufacturing process8,9. produced in cattle for various purposes still display Neu5Gc epi‐ Almost 300 000 patients are now undergoing BHV replacement topes25,26 that might be the target of an immune response by the each year 10 with a growing demand. The sources of BHV are those host with clinically relevant side effects. manufactured from pig or bovine pericardia as compared to mechan‐ The scope of the present work was to generate cattle KO for ical heart valve (MHV) that require lifelong anticoagulation therapy. both αGal and Neu5Gc antigens using a genome editing approach. 27 Bovine BHVs suffer however premature structural valve degen‐ A stillborn calf KO for αGal has been reported, 28 but to the best of eration (SVD). The functionality of BHV is maintained for 10‐15 years our knowledge, this work has not progressed further. Availability in older patients. However, in younger (<35 years old) patients, BHVs of DKO cattle line offers the opportunity to explore the potential undergo SVD much earlier. 11 It is hypothesized that among various of such animals to provide low immunogenic cattle‐derived prod‐ metabolic causes, SVD is also immune‐mediated since both αGal 8,12 ucts for clinical purposes as well as for the food industry and human and Neu5Gc9,13 are still present on the BHV used in the clinic. consumption. After BHV replacement, there is an increase of anti‐αGal anti‐ bodies14,15 and it has been reported in an experimental context that 2 | M ATE R I A L S A N D M E TH O DS implantation of BHV from αGal‐knockout pigs into primates is as‐ sociated with a reduced anti‐αGal immune response.16 Moreover, 2.1 | Animal experiments and source of animals valves from αGal/Neu5Gc‐deficient pigs further reduce human IgM/ IgG binding when compared to BHV from wild‐type pigs17. A similar All procedures involving the use of animals in this study were ap‐ situation is likely to occur whether bovine double knockout (DKO) proved by the Animal Welfare Committee of Avantea and carried out tissue would be used. Seventy per cent of the BHV currently used in accordance with the Italian Law (D.Lgs 26/2014) and EU directive PEROTA et al. | 3 of 13 TA B L E 1 Primers used for genotyping Oligo Sequence (5′‐3′) Gene Target exon Amplicon (bp) of bovine wild‐type cell lines, edited colonies and cloned animals FW1 GGATGCCTTTGATAGAGTTGG GGTA1 9 440 RV1 GCTTTCATCATGCCATTGG FW2 AGCATCTTTCACAACTCAGG GGTA1 4 739 RV2 TGAGACATTAGGAACATGGC FW3 TCAGGAGGAGACATCACCAACGG CMAH 2 225 RV3 TGCCCATCCTACTTGTCGAGGG 2010/63/EU regulating animal experimentation after authorization and btGGTA1cr2). Years later, when we targeted the female line, by relevant authorities (Ministry of Health project n 991/2017‐PR). we were able to find an efficient guide for exon 4 (Table 3, btGG‐ Bovine adult fibroblasts (BAFs) were derived from a skin biopsy of a TA1cr3) used for the pig by Sato et al. 29 Editing of the CMAH gene Holstein bull and a cow with previous successful record of somatic was achieved efficiently in the exon 2 carrying the ATG codon. For cell nuclear transfer (SCNT). Recipient heifers used as surrogate the editing of the male, we used one guide (Table 2, btCMAHcr1) mothers were also of Holstein breed. and subsequently for the female we found a more efficient guide (Table 3, btCMAHcr2). Target exons and primers used for PCR analyses and Sanger se‐ 2.2 | Chemicals quencing of each gene are summarized in Table 1. All the synthe‐ All chemicals were purchased from Sigma‐Aldrich (Milano, Italy) un‐ tized oligonucleotides and the Sanger sequencing services were less otherwise stated. purchased from Eurofins Genomics, unless otherwise stated. 2.3 | PCR set‐up for identification and validation of 2.4 | Genomic DNA extraction and PCR conditions target genes Primary fibroblasts and tissues biopsies were lysed at 55°C for Ensemble database was analysed to obtain the Reference genome 3 hours using a lysis buffer (100 mmol/L Tris HCl pH 8.3, 5 mmol/L sequences for the GGTA1 (ENSBTAG00000012090) and of the EDTA pH 8.1, 0.2% SDS, 200 mmol/L NaCl) supplemented with CMAH (ENSBTAG00000003892) genes. These sequences were Proteinase K (300 µg/mL; Macherey‐Nagel). Genomic DNA was studied in silico to identify possible target sequences, and the se‐ extracted (Sambrook et al, 1989) and resuspended with TE buffer. lected regions were amplified by PCR and analysed with Sanger se‐ All the amplifications were performed using Takara La Taq DNA quencing to exclude polymorphisms in male and female fibroblast Polymerase (Takara, Japan). cell lines selected for the genome editing. Polymerase chain reaction conditions for GGTA1 in the male line Editing of GGTA1 gene started initially in the male line targeting (exon 9) were as follows (FW1 + RV1 = 440 bp): 94°C, 2 minutes; the exon 9 and because of the paucity of tools available at the time 94°C, 30 seconds, 72°C (−1°C/cycle), 30 seconds; 72°C, 15 seconds we never found efficient RNA guide. Therefore, we decided to use for 8 cycles; 94°C, 30 seconds, 58°C, 30 seconds; 72°C, 15 seconds two guides that targeted the same sequence (Table 2, btGGTA1cr1 for 35 cycles; and a final extension step of 72°C for 7 minutes. PCR TA B L E 2 Oligonucleotides synthetized for the assembly of desired CRISPR/Cas9 expression vectors used for the male line and sequence of the ssCMAH‐STOP oligo Target gene Expression Oligo Sequence (5′‐3′) Guide sequence—PAM (5′‐3′) (exon) vector btGGTA1cr1 FW CACCGGAGACCCTGGGCGAGTCGG GGAGACCCTGGGCGAGTCGG‐TGG GGTA1 (9) pX330‐btG‐ btGGTA1cr1 RV AAACCCGACTCGCCCAGGGTCTCC GTA1cr1 btGGTA1cr2 FW CACCGCTGGGCCACCGACTCGCCC GCTGGGCCACCGACTCGCCC‐AGG GGTA1 (9) pX330‐btG‐ btGGTA1cr2 RV AAACGGGCGAGTCGGTGGCCCAGC GTA1cr2 btCMAHcr1FW CACCGACTATGGGCAGGCAAGTGA GACTATGGGCAGGCAAGTGA‐GGG CMAH (2) pX330‐btC‐ btCMAHcr1 RV AAACTCACTTGCCTGCCCATAGTC MAHcr1 ssCMAH‐STOP oligo GTGACAGCTGCCATTCTTCTGAAA // // // TACCCAGGGAGAGGCAACGACAGA CTTAAGGCAGGCAAGTGAGGGAGG CATTACTTTGCTGGGAAGGTGGGG TCAA 4 of 13 | PEROTA et al. conditions for GGTA1 in the exon 4 of the female line were as follows (FW2 + RV2 = 739 bp): 94°C, 2 minutes; 94°C, 30 seconds, 60°C, Target gene 30 seconds, 72°C, 30 seconds for 35 cycles; and a final extension GGTA1 (4) CMAH (2) (exon) step of 72°C for 7 minutes. For CMAH, PCR conditions were as follows (FW3 + RV3 = 225 bp): // 94°C, 2 minutes; 94°C, 30 seconds; 58°C, 30 seconds; 72°C, 30 sec‐ GAGAGGCAACGACAGACTAT‐GGG GAGAAAATAATGAATGTCAA‐AGG onds for 40 cycles; and a final extension step of 72°C for 7 minutes. Determination of the absence of any genomic polymorphisms Guide sequence—PAM (5′‐3′) was achieved cloning each resulting PCR products in E coli using the TOPO TA cloning kit (Thermo Fisher Scientific). Resulting purified plasmids (Plasmid Mini kit, Qiagen) were subjected to Sanger se‐ quencing analyses (Eurofins Genomics). 2.5 | CRISPR/Cas9 plasmid constructs, single guide RNA synthesis and design of ssCMAH‐STOP // oligonucleotide AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC Editing of the GGTA1 and CMAH genes of the bovine male line was achieved by cloning and expressing the desired single guide RNAs (sgRNAs), into the pX330‐U6‐Chimeric_BB‐CBh‐hSpCas9 expres‐ sion vector, that was a gift from Feng Zhang (Addgene plasmid # 42230). DNA oligonucleotides for sgRNAs (Table 2) were purchased GAAATTAATACGACTCACTATAGAGAGGCAACGACAGACTATGTTTTAGAGCTAGAAATAGCAAG GAAATTAATACGACTCACTATAGAGAAAATAATGAATGTCAAGTTTTAGAGCTAGAAATAGCAAG from Eurofins Genomics. Annealing and molecular cloning of gene‐ specific complementary oligos were done following the protocol de‐ scribed by Cong and colleagues.30 The resulting purified expression vectors (Plasmid mini kit, PC‐20, Qiagen) were verified by Sanger Oligonucleotides used for in vitro T7 transcription of sgRNAs used for the female line sequencing before transfection. Edited female colonies were obtained transfecting the Cas9 protein/gRNA ribonucleoprotein complexes (Cas9‐RNPs). 31,32 Desired sgRNAs (btGGTA1cr3 and btCMAHcr2) were in vitro syn‐ thetized following the CRISPOR guidelines (http://crisp​or.org/). Briefly, oligonucleotides (Table 3) were annealed, amplified and purified before to use the resulting amplification product as tem‐ plate (1μg) for the following transcription step. Single guide RNAs were finally synthetized using the TranscriptAid T7 High Yield Transcription kit (Thermo Fisher Scientific) and purified on sil‐ ica membranes columns (MEGAclear Transcription clean‐up kit, Thermo Fisher Scientific) according to the manufacturer's instruc‐ tions and stored at −80°C. We targeted the CMAH gene using as template a synthetized sin‐ gle strand oligonucleotide (ssCMAH‐STOP oligo) specific for the exon 2 and symmetric according to the position of the CMAH‐START codon. Its sequence is characterized by the substitution of the START codon Sequence (5′‐3′) (ATG) with a STOP codon (TAA, in bold Figure 1A), generating a new AflII restriction site (CTTAAG, underlined in Figure 1A), useful for the identification of the knock‐in colonies (152bp + 73 bp) with the AflII‐ RFLP analyses (AflII from Thermo Fisher Scientific; 1 hour at 37°C). btGGTA1cr3sgRNA btCMAHcr2sgRNA sgRNAT7common 2.6 | Culture, transfection and selection of adult fibroblasts TA B L E 3 Oligo Bovine adult fibroblasts (male and female) were cultured in DMEM + M199 (1:1) +10%FCS in 5%CO2, 5%O2 at 38°C. PEROTA et al. | 5 of 13 (A) (B) (C) F I G U R E 1 Editing of GGTA1 and CMAH genes in male and female fibroblasts. A, Target sequences for selected sgRNAs and ssCMAH‐ STOP oligo sequence. For each bovine gene (GGTA1 and CMAH), target sequences are indicated on the respective exons recognized by the selected sgRNAs. PAM sequences are highlighted in blue. In the ssCMAH‐STOP oligo sequence, the TAA (STOP) codon is highlighted in bold character; the AflII restriction site is underlined. B, PCR analyses of female colonies. The results of the PCR analyses performed for the genomic characterization of the female colonies (A1, A2, A3, A4, A5 and A6) selected after Dynabeads sorting are reported as an example. Each colony was analysed for the GGTA1 gene (739 bp) and for the CMAH gene (225 bp). Resulting electrophoretic patterns determined directly that some colonies were characterized by visible Indels, creating bands different from the WT controls. This situation is clear for colonies A1 (double band), A2 (deletion) and A6 (deletion) in PCR analyses for the GGTA1 gene (°) and for colonies A1 (double band) and A5 (deletion) in PCR analyses for the CMAH gene (#). Resulting CMAH‐PCR products were also digested with the AflII restriction enzyme, detecting the alleles interested by the targeting event. Due to the introduction of a STOP codon (TAA) in the START position (ATG) of the CMAH gene, only the HDR‐CMAH alleles will be cut by the restriction enzyme producing two lower bands (152 + 73 bp). A simple agarose electrophoresis enabled us to identify possible additional edited colonies detecting the STOP codon insertion (**) for colonies A2 and A6 and the single insertion (*) for colonies A3 and A4. In these last ones, the not targeted allele resulted uncut (225 bp) as the WT sample. For this reason, the final determination of the exact Indels, occurred in all the edited colonies, was determined by Sanger sequencing of the resulting TOPO TA E coli clones. 100 = 100 bp ladder (Thermo Fisher Scientific); A1, A2, A3, A4, A5 and A6 = transfected females colonies; WT = wild‐type female line; H20 = Nucleases‐free water. C, Sequences alignments of colonies used for the SCNT. Sanger sequencing outlining the mutations affecting the GGTA1 and the CMAH genes of colonies selected for the SCNT step. For the GGTA1 gene, the exon 9 was used as reference for the male colonies and a PCR product including the exon 4 was used for the female ones. In both cases, deletions of different lengths were obtained (Table S1). For the CMAH gene, all edited alleles of the edited colonies were aligned using as reference a PCR product including the exon 2 sequence. In this case, in both lines, we were able to determine the TAA substitution, as result of the targeting event mediated by the site‐specific cut, produced by the CRISPR/Cas9 system driven by the sgRNA btCMAHcr1 Male fibroblasts (2 × 106 cells) were transfected using complex format of the S pyogenes. Cas9‐RNP was obtained mixing Nucleofector (V‐024 program, Lonza), two µg of each the 3 CRISPR/ the recombinant Cas9 protein (14.4 μg; Edit‐R Cas9, Dharmacon), Cas9 expressing vectors (pX330‐btGGTA1cr1 and pX330‐btG‐ with the btGGTA1cr3‐sgRNA (3.6 μg), the btCMAHcr2‐sgRNA GTA1cr2—exon9 of GGTA1 gene; pX330‐btCMAHcr1—exon 2 of (3.6 μg) and 0.4 nmol of the ssCMAH‐STOP oligo. CMAH gene) and 0.4 nmol of the ssCMAH‐STOP oligo (IDT). Transfected cells were plated in a 60‐mm dish and cultured for 6 Female fibroblasts (1 × 10 cells) were transfected using Neon 3 days when they were passaged 1‐3. Day 7 male (6.5 × 106 cells) and system (P‐9 program; Thermo Fisher Scientific) and the Cas9‐RNP D5 female (2.3 × 106 cells) αGal‐negative cells were selected using 6 of 13 | PEROTA et al. biotin‐conjugated IB4 lectin attached to streptavidin‐coated mag‐ 6‐DMAP and 5 μg/mL cycloheximide. At the end of the activation, 33-35 6 netic beads. Cells were harvested (6.5 × 10 cells) and suspended reconstructed embryos were cultured in mSOF supplemented in 0.2 mL PBS containing 1 µg biotin‐conjugated IB4 lectin (Sigma) with essential and non‐essential amino acids and 4 mg/mL BSA up and 0.1 mg Dynabeads M‐280 streptavidin (Life Technologies). The to 7‐8 days to the blastocyst stage. αGal‐positive cells were removed using a magnetic rack. The proce‐ dure was repeated three times. The αGal‐negative cells were plated 2.8 | Recipients synchronization, embryo transfer on 150‐mm plates and cultured for 9‐10 days when the largest colo‐ (ET) and calving nies with good morphology were picked up and expanded. For each colony, one aliquot was cryopreserved in liquid ni‐ Heifers of 14‐16 months of age were used as recipients. Oestrus was trogen (DMEM/TCM199 1:1, 20% FBS and 10% DMSO) for sub‐ synchronized using the Ovsynch protocol with two injections of a sequent SCNT and another was lysed for DNA extraction and GnRH analogue (Dalmarelin, Fatro, Italy) 8 days apart. Forty‐eight molecular analyses (PCR, AflII‐RFLP, TOPO TA cloning and Sanger hours after the second injection, animals were observed for oestrus sequencing). signs and 6 days later those that showed oestrus were ultrasound Only colonies that, during the CMAH molecular screenings, pre‐ scanned to detect the presence of a corpus luteum (CL). Those that sented detectable Indels in their PCR products and/or that resulted had a well‐developed CL received 1 or 2 embryos (either fresh or positive for the AflII‐RFLP assay (152 bp + 73 bp) were subjected to frozen thawed) by non‐surgical ET ipsilateral to the CL. Four weeks the Sanger sequencing analyses for both genes (GGTA1 and CMAH), after ET, pregnancy diagnosis was performed by ultrasound scan‐ detecting the occurred Indels and the successful ssCMAH‐STOP oli‐ ning and then the pregnant animals were checked at monthly inter‐ gonucleotide knock‐in events. val till the end of the pregnancy. The delivery of the calves was by Eight (four male and four female) confirmed DKO colonies, edited elective caesarean section at 280 days of gestation. for GGTA1 and CMAH genes, were selected for further screening in SCNT to assess developmental potential. Before SCNT embryos were 2.9 | Genotyping and phenotyping analyses for transferred into recipients, at least 10 cloned embryos of each selected αGal and Neu5Gc antigens in DKO cattle‐derived colony were analysed for the absence of wild‐type genotypes. Genomic primary cells DNA extraction procedure, PCR amplification and sequencing reactions were done using the same materials and methods described above. Newborn calves were subjected to ear biopsy to establish a primary cell line, to extract the genomic DNA for genotyping by PCR and DNA sequencing as described above. Resulting primary fibroblasts 2.7 | Somatic cell nuclear transfer (SCNT) for each calf were expanded and cryopreserved in DMEM:TCM199 36 The protocol used is described in Galli et al with minor modifica‐ 1:1 with 10% DMSO and 20% FCS in CBS straws (IMV, Italy). For tions. Briefly, the bovine ovaries were collected at a local abattoir. FACS analysis, bovine fibroblasts were thawed and cultured in Follicles larger than 3 mm were aspirated, and cumulus‐oocyte DMEM medium (Gibco), with 10% FBS, 1% Peni‐Strepto and bFGF complexes were selected and in vitro matured in TCM 199 supple‐ (Sigma, 1 ng/mL). Once confluent, cells were trypsinized and split mented with 10% (v/v) foetal calf serum, 1 mg/mL 17 b‐oestradiol, into two culture dishes, one with the complete medium as above and ITS, 100 mg/mL sodium pyruvate, 90 mg/mL L‐cysteine, 720 mg/ the other with DMEM medium, 5% human serum (Sigma), 1% Peni/ mL glycine, 7 nL/mL b‐mercaptoethanol, gonadotropins (0.05 IU/ strepto and bFGF (1 ng/mL). For αGal analysis, cells were trypsi‐ mL FSH and 0.05 IU/mL LH; Meropur 75, Ferring) and growth fac‐ nized, resuspended and washed in PBS + BSA 0.1%. The cells were tors (50 ng/mL long‐EGF and 10 ng/mL bFGF) at 38.5°C in 5% CO2 pelleted (750g x 1 minute, 4°C) and resuspended in PBS + BSA 0.1% in humidified air for 22 hours. The day before SCNT, nuclear donor containing the FITC coupled lectin (BS‐I Isolectin B4) diluted 1:50 cells were induced into quiescence by serum starvation (0.5% and incubated at 4°C for 30 minutes. After 3 washes in PBS BSA FCS). The day of SCNT, cells were trypsinized and resuspended 0.1%, cells were ready for FACS analysis. 37 in H‐SOF buffered with 25 mmol/L Hepes (H‐SOF) used for all For Neu5Gc analysis, cells were cultured for at least 2 weeks in manipulations. Oocytes with an extruded polar body were stained DMEM + human serum. Foetal calf serum is rich in Neu5Gc that is with Hoechst 33342 (5 μg/mL) and enucleated in the presence of incorporated by cells in culture. Therefore, to avoid false positives, cytochalasin B (5 μg/mL) by the aspiration of polar body and as‐ the cells used for the FACS analysis have to be cultured for at least sociated metaphase II plate in minimal volume of ooplasm under 2 weeks in culture media without Neu5GC, by replacing FCS with UV. Donor cells were transferred in the perivitelline space of enu‐ human serum. Cells were seeded in 96‐well plates (106 cells/well), cleated oocytes. Donor cell‐cytoplast couplets were washed in washed once with PBS with 0.5% fish gelatin (PBS‐FG) and then 0.3 M mannitol solution and fused by double DC‐pulse (1.5 Kv/ incubated in 200 µL PBS‐FG with anti‐Neu5Gc antibody or con‐ cm) 30 µsec long and returned into maturation medium. After one trol isotype (BioLegend, chicken polyclonal IgY, dilution 1 :1000) hour, at about 27‐29 hours of maturation, NT embryos were acti‐ for 1 hour at 4°C, washed four times in PBS‐FG, incubated in vated with 5 µmol/L ionomycin for 4 minutes followed by 3 hours 100 µL PBS‐FG with Alexa 647‐coupled anti‐IgY antibody (Jackson of incubation in mSOF medium supplemented with 1 mmol/L ImmunoResearch, F(ab′)2 fragment donkey anti‐chicken 1:500) for PEROTA et al. | 7 of 13 1 hour at 4°C, washed four times in PBS‐FG and transferred into used a different system using neon transfection with the Cas9 pro‐ FACS tubes. FACS analysis was conducted using a BD Pharmingen tein for the first time. From the one million female fibroblasts trans‐ LSR‐II flow cytometer and FlowJo software (TreeStar). Despite this fected with Neon and the Cas9‐RNP at D5, 2.3 × 10 6 cells were used culture period, where the cells are also not growing under optimal for Dynabeads sorting. The efficiency of transfection was very low conditions, sometimes it is not sufficient to clear all the carry‐over compare to the editing of male fibroblasts that was obtained using of Neu5Gc due to culture conditions and often some background a plasmid for transfection but all αGal‐negative cells were plated in staining remains like the one observed in Figure 4. one 150‐mm dish and after 9 days 6 colonies were picked up. Of the 41 male colonies selected by pick up and analysed, CMAH‐PCR and AflII‐RFLP analyses revealed that 15 appeared to be edited 3 | R E S U LT S for the CMAH gene and for this reason they were sent for Sanger sequencing analyses of their GGTA1 and CMAH genes (Figure 1C 3.1 | Disruption of GGTA1 and CMAH genes in and Table S1). GGTA1‐KO was confirmed in all 15 colonies and 13 primary bovine fibroblast lines (31.7%) resulted also KO for Neu5Gc (Table 4). Two millions male fibroblasts were nucleofected and expanded The female colonies were subjected to the same analysis. The for 7 days to 6.5 × 106. After Dynabeads sorting, 4200 αGal‐nega‐ PCR analysis (Figure 1B) followed by Sanger sequencing analyses tive cells (0.065%) were recovered and plated in 20 Petri dishes (Figure 1C and Table S1) on both genes of the six female colonies (∅ = 150 mm) for clonal selection. Ten days after plating, 41 (1%) revealed that two colonies were heterozygotes and four colonies best growing colonies were picked up for PCR analysis and SCNT. were KO (66.6%) for the CMAH gene and that all six colonies were Editing of the female fibroblasts took place a year later, and we (A) (B) (C) (D) F I G U R E 2 DKO calves and sequencing results. A, Pictures of cloned DKO calves. Two healthy cloned bull calves (9161 and 9162) were generated from two different DKO colonies (A4 and E3). Cloned heifer calf was generated using the colony A6. B, Sequencing results for 9161. For the GGTA1 gene, it was confirmed that this gene is affected by two different deletions (21 and 171 bp), as previously described for the edited colony A4 (Table S1). These data were finally demonstrated by the deletion (17 bp) generated in the CMAH gene. C, Sequencing results for 9162. The GGTA1 gene sequence presented a 8 bp deletion, and the CMAH gene is characterized by the same 2 different mutations (TAA substitution; del 13 bp) detected in colony E3 (Table S1). D, Sequencing results for 9163. The same Indels, characterizing the GGTA1 (del 54 bp) and the CMAH (TAA substitution) genes of A6 colony (Table S1), were confirmed 8 of 13 | PEROTA et al. (A) (B) F I G U R E 3 FACS analyses for 9161, 9162 male calves. Fibroblasts from wild‐type animal (WT) and from the edited male calves were analysed by FACS. As negative controls, pig DKO fibroblasts were used as no bovine material was available. The results demonstrated that the αGal (A) and (B) Neu5Gc antigens were absent from the cell surface of cloned calves, confirming the genotype analyses for the knocked‐out genes (GGTA1 and CMAH). Fibroblasts WT (positive control): wild‐type primary fibroblasts from the bovine line prior to genetic modification expressing the αGal and the Neu5Gc antigens. Pig fibroblasts Gal‐KO and Neu5Gc‐KO (negative control): porcine primary fibroblasts NOT expressing the αGal and the Neu5Gc antigens. Fibroblasts 9161/9162 Gal‐KO and Neu5Gc‐KO: primary fibroblasts derived from cloned DKO calves PEROTA et al. | 9 of 13 GGTA1‐KO (Table 4), confirming the high efficiency of Dynabeads controls, pig cells KO for both antigens were used. The female phe‐ selection for the GGTA1 KO. notyping was performed in the same way as for the males but in Male A4 and E3 and female A6 colonies were used for SCNT based this case the negative control was the male 9162. In this experi‐ on their morphology and growing characteristics and embryo produc‐ ment performed a year later with different experimental context, tion after SCNT. Ten SCNT embryos of each colony were sequenced to the αGal was completely negative. In the case of Neu5Gc, both the confirm the purity of the selected colonies for the required mutations control (9162) and the female (9163) had some background stain‐ (Figure 1C) to avoid potential contaminations of WT cells. ing. Since the 9162 pictured in Figure 3 is the same as in Figure 4, we can conclude that the tail of Neu5Gc staining is background staining coming from the different experimental setting and cul‐ 3.2 | Generation of DKO calves by SCNT ture conditions. Two male DKO colonies (A4 and E3) were used as nuclear do‐ nors for SCNT (Table 5). Seven blastocysts (BLs), derived from colony A4, were transferred in 5 synchronized recipients, 4 (80%) 4 | D I S CU S S I O N became pregnant and 1 pregnancy (25%) went to term deliver‐ ing 1 calf (9161, Figure 2A). Fifteen BLs derived from colony E3 In this work, we targeted two well‐known xenoantigens identified were transferred in 12 synchronized recipients; 5 (41.6%) became as such from pig xenotransplantation studies that are also expressed pregnant, 1 pregnancy (20%) went to term delivering 1 calf (9162, in cattle. Here, we show that editing bovine fibroblasts are possible Figure 2A). using both CRISPR/Cas9 in plasmid and Cas9‐RNP formats and live Female DKO colony A6 was used for SCNT, and 31 BLs were animals can be generated through SCNT. The advent of program‐ transferred in 16 recipients; 6 (37.5%) became pregnant and 1 preg‐ mable nucleases for genome editing in large animals, especially the nancy went to term delivering 1 calf (9163, Figure 2A). pig, has greatly increased its efficiency by reducing the number of animals required and the costs involved. The number of genetically modified pigs and the consequent generation of animal models 3.3 | Genotyping of cloned calves through precise genetic engineering have grown exponentially in the Sanger sequencing of TOPO TA‐cloned PCR products of DKO last 10 years. However, genetically modified cattle are still very few calves confirmed the Indels characterizing the colonies used for due to some constrains for applying this technology to this species cloning. In details, in clone 9161, GGTA1 gene is affected by two dif‐ such as the long generation interval. Nevertheless, cattle would be ferent mutations in exon 9 (del AGACCCTGGGCGAGTCGGTGG/ more relevant for food production since it is a major source of beef del 171bp) and the exon 2 of the CMAH gene carries a deletion and dairy products. Furthermore, one of the major potential applica‐ (del GGCAGGCAAGTGAGGGA) as it was described for colony tions for DKO cattle for both GGTA1 and CMAH would be as a source A4 (Table S1; Figure 2B). In clone 9162 (Figure 2A), a deletion in of less immunogenic biological materials (pericadia) to manufacture GGTA1 gene (del AGTCGGTG) is accompanied by 2 different mu‐ BHV. In addition, genetically engineered cattle would also allow to tations in the exon 2 of CMAH gene. The first allele was inacti‐ produce food to avoid, for example, anaphylactic reaction following vated by the substitution of the ATG codon (START) with the TAA the consumption of red meat in some allergic individuals. codon (STOP), due to the homology‐directed repair (HDR) event Despite the low transfection efficiency in bovine fibroblasts that driven by the ssCMAH‐STOP oligo, as described for colony E3 affected the total number of edited colonies, because of the thor‐ (Table S1, Figure 2C), and the second allele has 13 bp deletion (del ough screening of the few colonies selected and the combination AGGCAAGTGAGGG). with SCNT, we were able to generate DKO male and female calves. Sanger sequencing results of female clone 9163 (Figure 2A) All the bovine genome editing work was undertaken to disrupt si‐ demonstrated that a deletion in the exon 4 of the GGTA1 gene (del multaneously the GGTA1 and the CMAH genes without the need 54bp) and the substitution of the START to a STOP codon (ATG  TAA) of a selectable marker, choosing primary cell lines whose genomic in the exon 2 of the CMAH gene are identical to the Indels described sequences were not affected by polymorphisms. We started the bo‐ for the donor female colony A6 (Table S1, Figure 2D). PCR analy‐ vine genome editing work in the male line transfecting the plasmid ses on the male calves (data not shown) demonstrated also that the format of the S pyogenes CRISPR/Cas9 system, while later its Cas9‐ CRISPR/Cas9 expression vectors were not integrated in the genome RNP format was tested in the female line. of the cloned calves. We selected to target exon 9 of GGTA1 gene in the male line using together two different sgRNAs (btGGTA1cr1 and btGG‐ TA1cr2—Figure 1A). In contrast to the female line, we targeted 3.4 | Phenotyping of cloned calves the exon 4, using the protein (Cas9‐RNP), designing a sgRNA FACS analysis confirmed the genotyping results of the three calves. specific for the START codon (btGGTA1cr3 Figure 1A). The use of All primary cell lines derived from biopsies of the cloned male calves Dynabeads and IB4 lectins greatly compensated for the low trans‐ do not express αGal (Figure 3A) and Neu5Gc (Figure 3B) as op‐ fection efficiency very effectively since all the analysed colonies posed to WT control cells before genetic engineering. As negative derived from cells that did not bind IB4 were all KO for the GGTA1 10 of 13 | PEROTA et al. (A) (B) F I G U R E 4 FACS analyses for DKO female 9163 calf. Fibroblasts from wild‐type animal (WT) and from the edited female calf were analysed by FACS. As negative controls, FACS‐validated DKO fibroblasts from 9162 male calf were used. The results demonstrated that the αGal (A) and (B) Neu5Gc antigens were absent from the cell surface of cloned female calf, confirming the genotype analyses for the knocked‐out genes (GGTA1 and CMAH). Fibroblasts WT (positive control): wild‐type primary fibroblasts from the bovine line prior to genetic modification expressing the αGal and the Neu5Gc antigens. Fibroblasts 9162 Gal‐KO and Neu5Gc‐KO (negative control): bovine primary fibroblasts NOT expressing the αGal and the Neu5Gc antigens. Fibroblasts 9163 Gal‐KO and Neu5Gc‐KO: primary fibroblasts derived from cloned DKO female calf PEROTA et al. | 11 of 13 TA B L E 4 Fibroblasts colonies—screening results CMAH‐KO Bovine line Picked colonies GGTA1‐KO (beads) (PCR + RFLP) GGTA1‐KO (sequencing) CMAH‐KO (sequencing) Male 41 41 15 15 13 Female 6 6 6 6 4 TA B L E 5 Development of cloned embryos after transfer into recipient heifers No. of born Bovine line No. of colonies No. of embryos No. of recipients No. of pregnant (%) alive at term Male A4 7 5 4 (80) 1 Male E3 15 12 5 (41.6) 1 Female A6 31 16 6 (37.5) 1 (Table 4). As a consequence, also the KO rate for the CMAH gene conditions; on the other end, also the male cells used as nega‐ was very high indicating that when these nucleases enter the cells, tive control that was completely clear in a previous experiment they are very effective on all the targets. This event was also de‐ (Figure 3B) had the same right shift for Neu5Gc (Figure 4B). We 38 scribed for the pig by Li et al. The use of ssODN‐mediated KI can conclude that the generation of DKO cattle is possible using with CRISPR/Cas9 system for KO purposes was also possible in the latest genome editing technologies combined with SCNT. cattle and facilitated the PCR screening because of the insertion This will offer the opportunity to use novel biological materials of an AflII restriction site. The use of the plasmid to introduce and of bovine origin for medical and industrial application as well as express all the machinery required was in our experiments more for human consumption in the form of beef or dairy products for efficient than the use of the protein but because we required only allergic individuals. a few cell clones for SCNT, it did not affect the success at the end since we had far more cell clone that we could need for SCNT. The AC K N OW L E D G E M E N T S reason for preferring the Cas9 protein to the plasmid is to avoid the risk of integration of the plasmid. Luckily in this case, we did not The authors acknowledge the technical support of Gabriella detect any integration of the CRISPR/Cas9 expressing plasmids in Crotti, Paola Turini, Silvia Colleoni, Gaia Fiorini from Avantea. the genome of the male calves. CRISPR/Cas9‐mediated genome Luigi Scordamaglia CEO of INALCA Spa for the access to bovine editing procedures are compatible with SCNT, and the efficiency ovaries. Yasuhiro Takeuchi, Michael Breimer, Jan Holgersson, is comparable when WT cells are used. Three live calves were de‐ Rafael Manez Mendiluce and Xi Chen of the Translink consor‐ livered by caesarean section and the first born (9161) is about to tium for discussion during the course of the work and reading the reach puberty while the female is only a few days old. The geno‐ manuscript. type of the three claves born alive exactly matched the genotype of the three cell clones selected for SCNT (Table S1). To further C O N FL I C T O F I N T E R E S T S validate the genotyping findings with the phenotype, FACS analy‐ sis was performed on fibroblasts derived from the three newborn The authors declare no conflict of interests. animals. The absence of αGal and Neu5Gc was clearly confirmed on the two bull calves. To perform the FACS analysis, primary cells AU T H O R C O N T R I B U T I O N were grown from biopsy taken in the first days of life of the calves that were gestated by WT surrogate mother and fed after birth AP, EC, JPS and CG conceived the project and designed the experi‐ with milk from WT cows; moreover, the culture of primary cells ments. AP, IL, RD, EZ, GL, JPJ and SC performed the experiments, col‐ was performed with FCS supplementation to culture media from lected and analysed the data. JMB, EC, JPS, VPK, CC, GG, MG and TB WT source. All these conditions favour incorporation of Neu5Gc provided advice for experimental design discussion of results and re‐ into the cells that before the analysis requires 2‐3 week in culture view of the manuscript. EC, JPS and CG secured the funding. CG, AP with serum lacking Neu5Gc. We used human serum in this period and IL wrote the manuscript. All authors reviewed and approved the to allow the cells to shed the incorporated Neu5Gc but this time manuscript. is variable depending on culture conditions, not ideal with human serum for bovine fibroblasts and the reagents used. The pheno‐ ORCID typical characterization of the female calf by FACS was not yet ex‐ Vered Padler‐Karavani https://orcid.org/0000-0002-4761-3571 tensively completed (only one experiment was performed). There is some background noise due to Neu5Gc remnants of the culture Cesare Galli https://orcid.org/0000-0002-9529-6136 12 of 13 | PEROTA et al. REFERENCES 19. Apostolovic D, Tran TA, Starkhammar M, Sanchez‐Vidaurre S, Hamsten C, Van Hage M. The red meat allergy syndrome in Sweden. 1. Kobayashi T, Cooper DK. Anti‐Gal, alpha‐Gal epitopes, and xeno‐ Allergo J Int. 2016;25(2):49–54. transplantation. Subcell Biochem. 1999;32:229‐257. 20. Alisson‐Silva F, Kawanishi K, Varki A. Human risk of diseases asso‐ 2. Bouhours D, Pourcel C, Bouhours JE. Simultaneous expression ciated with red meat intake: Analysis of current theories and pro‐ by porcine aorta endothelial cells of glycosphingolipids bearing posed role for metabolic incorporation of a non‐human sialic acid. the major epitope for human xenoreactive antibodies (Gal alpha Mol Aspects Med. 2016;51:16–30. 1–3Gal), blood group H determinant and N‐glycolylneuraminic acid. 21. Samraj AN, Pearce OM, Laubli H, et al. A red meat‐derived glycan Glycoconj J. 1996;13(6):947‐953. promotes inflammation and cancer progression. Proc Natl Acad Sci 3. Scobie L, Padler‐Karavani V, Le Bas‐Bernardet S, et al. Long‐term USA. 2015;112(2):542–547. IgG response to porcine Neu5Gc antigens without transmission 22. Wang M, Sun Z, Yu T, et al. Large‐scale production of recombinant of PERV in burn patients treated with porcine skin xenografts. J human lactoferrin from high‐expression, marker‐free transgenic Immunol (Baltimore, Md: 1950). 2013;191(6):2907‐2915. cloned cows. Sci Rep. 2017;7(1):10733. 4. Zhu A, Hurst R. Anti‐N‐glycolylneuraminic acid antibodies identified 23. Parc AL, Karav S, Rouquie C, Maga EA, Bunyatratchata A, in healthy human serum. Xenotransplantation. 2002;9(6):376‐381. Barile D. Characterization of recombinant human lactoferrin 5. Salama A, Evanno G, Harb J, Soulillou JP. Potential deleteri‐ N‐glycans expressed in the milk of transgenic cows. PLoS ONE. ous role of anti‐Neu5Gc antibodies in xenotransplantation. 2017;12(2):e0171477. Xenotransplantation. 2015;22(2):85‐94. 24. Sano A, Matsushita H, Wu H, et al. Physiological level production 6. Lutz AJ, Li P, Estrada JL, et al. Double knockout pigs deficient in of antigen‐specific human immunoglobulin in cloned transchromo‐ N‐glycolylneuraminic acid and Galactose α‐1,3‐Galactose reduce somic cattle. PLoS ONE. 2013;8(10):e78119–e78119. the humoral barrier to xenotransplantation. Xenotransplantation. 25. Buist M, Komatsu E, Lopez P, et al. Features of N‐Glycosylation of 2013;20(1):27‐35. Immunoglobulins from Knockout Pig Models. J Anal Bioanal Tech. 7. Chen G, Qian H, Starzl T, et al. Acute rejection is associated with 2016;7:5. antibodies to non‐Gal antigens in baboons using Gal‐knockout pig 26. Ghaderi D, Zhang M, Hurtado‐Ziola N, Varki A. Production plat‐ kidneys. Nat Med. 2005;11(12):1295‐1298. forms for biotherapeutic glycoproteins. Occurrence, impact, and 8. Naso F, Gandaglia A, Bottio T, et al. First quantification of alpha‐Gal challenges of non‐human sialylation. Biotechnol Genet Eng Rev. epitope in current glutaraldehyde‐fixed heart valve bioprostheses. 2012;28:147–175. Xenotransplantation. 2013;20(4):252‐261. 27. Tan W, Carlson DF, Lancto CA, et al. Efficient nonmeiotic allele in‐ 9. Reuven EM, Leviatan Ben‐Arye S, Marshanski T, et al. trogression in livestock using custom endonucleases. Proc Natl Acad Characterization of immunogenic Neu5Gc in bioprosthetic heart Sci. 2013;110(41):16526. valves. Xenotransplantation. 2016;23(5):381‐392. 28. Sendai Y, Sawada T, Urakawa M, et al. α1,3‐Galactosyltransferase‐Gene 10. Naso F, Gandaglia A. Different approaches to heart valve de‐ knockout in cattle using a single targeting vector with loxP sequences cellularization: A comprehensive overview of the past 30 years. and cre‐expressing adenovirus. Transplantation. 2006;81(5):760‐6. Xenotransplantation. 2018;25(1).https​://doi.org/10.1111/xen.12354​ 29. Sato M, Miyoshi K, Nagao Y, et al. The combinational use of CRISPR/ 11. Schoen FJ, Levy RJ. Founder's Award, 25th Annual Meeting Cas9‐based gene editing and targeted toxin technology enables of the Society for Biomaterials, perspectives. Providence, efficient biallelic knockout of the alpha‐1,3‐galactosyltransfer‐ RI, April 28‐May 2, 1999. Tissue heart valves: current chal‐ ase gene in porcine embryonic fibroblasts. Xenotransplantation. lenges and future research perspectives. J Biomed Mater Res. 2014;21(3):291–300. 1999;47(4):439‐465. 30. Cong L, Ran FA, Cox D, et al. Multiplex genome engineer‐ 12. Park CS, Park SS, Choi SY, Yoon SH, Kim WH, Kim YJ. Anti alpha‐gal ing using CRISPR/Cas systems. Science (New York, NY). immune response following porcine bioprosthesis implantation in 2013;339(6121):819–823. children. J Heart Valve Dis. 2010;19(1):124‐130. 31. Kim S, Kim D, Cho SW, Kim J, Kim JS. Highly efficient RNA‐guided 13. Barone A, Benktander J, Whiddon C, et al. Glycosphingolipids genome editing in human cells via delivery of purified Cas9 ribonu‐ of porcine, bovine, and equine pericardia as potential immune cleoproteins. Genome Res. 2014;24(6):1012–1019. targets in bioprosthetic heart valve grafts. Xenotransplantation. 32. Liang X, Potter J, Kumar S, et al. Rapid and highly efficient mam‐ 2018;25(5):e12406. malian cell engineering via Cas9 protein transfection. J Biotechnol. 14. Bloch O, Golde P, Dohmen PM, Posner S, Konertz W, Erdbrügger 2015;208:44–53. W. Immune response in patients receiving a bioprosthetic heart 33. Fujimura T, Takahagi Y, Shigehisa T, et al. Production of alpha 1,3‐ valve: lack of response with decellularized valves. Tissue Eng Part A. galactosyltransferase gene‐deficient pigs by somatic cell nuclear 2011;17(19–20):2399‐2405. transfer: a novel selection method for gal alpha 1,3‐Gal antigen‐de‐ 15. McGregor CG, Carpentier A, Lila N, Logan JS, Byrne GW. ficient cells. Mol Reprod Develop. 2008;75(9):1372–1378. Cardiac xenotransplantation technology provides materials for 34. Hauschild J, Petersen B, Santiago Y, et al. Efficient generation of a improved bioprosthetic heart valves. J Thorac Cardiovasc Surg. biallelic knockout in pigs using zinc‐finger nucleases. Proc Natl Acad 2011;141(1):269‐275. Sci USA. 2011;108(29):12013–12017. 16. McGregor CG, Kogelberg H, Vlasin M, Byrne GW. Gal‐knockout bi‐ 35. Tucker BA, Rahimtula M, Mearow KM. A procedure for select‐ oprostheses exhibit less immune stimulation compared to standard ing and culturing subpopulations of neurons from rat dorsal biological heart valves. J Heart Valve Dis. 2013;22(3):383‐390. root ganglia using magnetic beads. Brain Res Brain Res Protoc. 17. Zhang R, Wang Y, Chen L, et al. Reducing immunoreactivity of por‐ 2005;16(1–3):50–57. cine bioprosthetic heart valves by genetically‐deleting three major 36. Galli C, Lagutina I, Vassiliev I, Duchi R, Lazzari G. Comparison of glycan antigens, GGTA1/beta4GalNT2/CMAH. Acta Biomater. microinjection (piezo‐electric) and cell fusion for nuclear trans‐ 2018;72:196‐205. fer success with different cell types in cattle. Cloning Stem Cells. 18. Steinke JW, Platts‐Mills TA, Commins SP. The alpha‐gal story: 2002;4(3):189–196. lessons learned from connecting the dots. J Allergy Clin Immunol. 37. Tervit HR, Whittingham DG, Rowson LE. Successful culture in vitro 2015;135(3):589–596; quiz 597. of sheep and cattle ova. J Reprod Fertil. 1972;30(3):493–497. PEROTA et al. | 13 of 13 38. Li P, Estrada JL, Burlak C, et al. Efficient generation of geneti‐ cally distinct pigs in a single pregnancy using multiplexed sin‐ How to cite this article: Perota A, Lagutina I, Duchi R, et al. gle‐guide RNA and carbohydrate selection. Xenotransplantation. Generation of cattle knockout for galactose‐α1,3‐galactose 2015;22(1):20–31. and N‐glycolylneuraminic acid antigens. Xenotransplantation. 2019;26:e12524. https​://doi.org/10.1111/xen.12524​ S U P P O R T I N G I N FO R M AT I O N Additional supporting information may be found online in the Supporting Information section at the end of the article.