Barrabeig et al. BMC Infectious Diseases (2019) 19:954 https://doi.org/10.1186/s12879-019-4496-z RESEARCH ARTICLE Open Access Mumps: MMR vaccination and genetic diversity of mumps virus, 2007–2011 in Catalonia, Spain Irene Barrabeig1,2*† , Andrés Antón3†, Núria Torner1,2,4, Tomàs Pumarola3, Josep Costa3,5, Àngela Domínguez2,4 and the Working Group for the Study for Mumps in Catalonia Abstract Background: Mumps is a vaccine-preventable disease but outbreaks have been reported in persons vaccinated with two doses of MMR vaccine. The objective was to describe the demographic features, vaccination effectiveness and genetic mumps virus diversity among laboratory-confirmed cases between 2007 and 2011 in Catalonia. Methods: Cases and outbreaks of mumps notified to the notifiable diseases system of Catalonia between 2007 and 2011 retrospectively registered were included. Public health care centres provided written immunization records to regional public health staff to determine the vaccination history. Saliva and serum specimens were collected from suspected cases for laboratory-confirmation using real-time reverse- transcriptase PCR (rtRT-PCR) or serological testing. Phylogenetic analysis of the complete SH gene (316 nucleotides) and complete coding HN protein (1749 nucleotides) sequences was made. Categorical variables were compared using the Chi-square or Fisher’s tests and continuous variables using the Student test. Vaccination effectiveness by number of MMR doses was estimated using the screening method. Results: During the study period, 581 confirmed cases of mumps were notified (incidence rate 1.6 cases/100,000 persons-year), of which 60% were male. Three hundred sixty-four laboratory-confirmed cases were reported, of which 44% were confirmed by rtRT-PCR. Of the 289 laboratory-confirmed cases belonging to vaccination cohorts, 33.5% (97) had received one dose of MMR vaccine and 50% (145) two doses. Based on phylogenetic analyses of 316-nucleotide and 174-nucleotide SH sequences, the viruses belonging to viral genotypes were: genotype G (126), genotype D (23), genotype H (2), genotype F (2), genotype J (1), while one remained uncharacterized. Amino acid differences were detected between circulating strains and the Jeryl Lynn vaccine strains, although the majority of amino acid substitutions were genotype-specific. Fifty-one outbreaks were notified that included 324 confirmed mumps cases. Genotype G was the most frequent genotype detected. The family (35%), secondary schools (25%) and community outbreaks (18%) were the most frequent settings. (Continued on next page) * Correspondence: ibarrabeig@gencat.cat 1 Epidemiological Surveillance and Response to Public Health Emergencies Unit in Barcelona South, Agency of Public Health of Catalonia, Generalitat of Catalonia., Hospital Universitari de Bellvitge, Edifici antiga escola d’infermeria, 3a planta, Feixa Llarga, s/n, 08907 L’Hospitalet de Llobregat, Spain 2 CIBER Epidemiología y Salud Pública, Institut of Health Carlos III, Madrid, Spain Full list of author information is available at the end of the article © The Author(s). 2019 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Barrabeig et al. BMC Infectious Diseases (2019) 19:954 Page 2 of 11 (Continued from previous page) Conclusions: Our study shows that genotype G viruses are the most prevalent in Catalonia. Most cases occurred in people who had received two doses of MMR, suggesting inadequate effectiveness of the Jeryl Lynn vaccine strain. The possible factors related are discussed. Keywords: Mumps virus, Genotypes, Molecular surveillance, MMR vaccine, Laboratory diagnosis Background 1998. The incidence of mumps decreased significantly Mumps is a highly-contagious vaccine-preventable disease from 456 to 3.6 cases per 100,000 persons-year between caused by the mumps virus (MuV), an enveloped, 1983 and 2011. Nevertheless, during the 2000s, several negative-strand RNA virus belonging to the Rubulavirus MuV outbreaks were reported in spite of the > 95 and > genus of the Paramyxoviridae family. Infection is usually 90% vaccination coverages for the first and second doses, benign and self-limited, but is sub-clinical and asymptom- respectively, as reported in other countries with high atic in up to 30% of cases. The main clinical manifestation vaccination coverages [5–9]. is parotitis, with one or both parotid glands involved. The objective of this study was to describe the demo- However, mumps infection may also result in clinical graphic features, vaccination effectiveness and genetic complications including aseptic meningitis, encephalitis MuV diversity of laboratory-confirmed cases from 2007 and orchitis, among others. In countries with high vaccin- to 2011. ation coverages, mumps incidence has dropped dramatic- ally as has the percentage of cases with encephalitis and Methods other severe complications have been significantly re- Patient population and study period duced. Mumps disease shows epidemic peaks every 2 to 5 Descriptive study carried out with retrospectively registered years [1]. Laboratory confirmation is based on the detec- cases. From January 2007 to December 2011, suspected tion of MuV-specific immunoglobulin M (IgM) antibodies cases of mumps were reported to the notifiable diseases sys- in serum or saliva specimens, by viral isolation in cell cul- tem of Catalonia. WHO case definitions were used to define ture, or by detection of viral genomic RNA in clinical suspected and confirmed cases. A suspected case was de- samples using molecular methods. Although MuV is con- fined as an acute onset of unilateral or bilateral tender, self- sidered to be serologically monotypic, distinct genetic limiting swelling of the parotid or other salivary glands last- lineages of wild-type MuV have been reported to be co- ing ≥2 days without other apparent cause. A confirmed case circulating. Up to 12 genotypes (A to N, excluding E and was defined as a laboratory-confirmed case or a case meet- M) are currently recognised based on sequence analysis of ing the clinical case definition and epidemiologically-linked the entire 316 nucleotides of the small hydrophobic (SH) to a confirmed case [10]. A mumps outbreak was defined as gene, including the non-coding regions flanking the cod- two or more cases linked by time and place within a max- ing sequence of the SH protein [2]. The hemmagglutinin- imum period of 26 days, one of which must be confirmed neuraminidase (HN) gene encodes the protein that is the by a laboratory [11]. For each case (sporadic cases and cases main target of neutralising antibodies. According to related to outbreaks), field epidemiologists carried out an World Health Organization (WHO) guidelines, parallel epidemiological survey, according to routine procedures for analysis of the HN sequence further supports the assign- mumps surveillance in Catalonia, in which the following ment of genotyping based on SH gene sequencing, par- variables were collected: birth date, gender, symptom onset ticularly when there is an ambiguous result [3, 4]. The (parotitis), vaccination status, vaccine strain, sample collec- WHO recommends MuV genotyping as a tool for the dis- tion date, and confirmatory diagnostic techniques. Public tribution of the genetic lineages that co-circulate world- healthcare centres supplied regional public health staff with wide and for viral epidemiological surveillance to trace the written immunization records to determine the vaccination patterns of virus spread. history. The combined measles, mumps and rubella vaccine The vaccine administered in the study period was the (MMR) was included in the childhood immunization Jeryl Lynn (JL) strain, except for a few years where the schedule at 12 months in 1980 in Catalonia, an autono- Rubini and Urabe AM9 strains were administered. We mous community in the north-eastern Spain with 7.5 were unable to obtain the MMR vaccine composition million inhabitants, and was covered by public financing. used in each study patient, but the birth cohort of cases In 1987, administration of the first MMR dose was and the years when the strains were administered in switched from 12 to 15 months, and reverted to 12 Catalonia were used as an approximation. The Urabe months in 2008. In 1988, a second dose of MMR was in- strain was administered in 1991 and 1992. The first cluded at 11 years, which was switched to 4 years in Rubini vaccine dose was administered between 1994 and Barrabeig et al. BMC Infectious Diseases (2019) 19:954 Page 3 of 11 1995 (birth cohort 1993–1995), and the second Rubini eluted in 25 μl of RNase-free elution buffer using bioMér- vaccine dose in 1994 and 1996 (birth cohort 1983 to ieux NucliSense easyMAG (bioMérieux, Marcy l’Etoile, 1985). We did not consider the administration of one or France) according to the manufacturer’s instructions. two Rubini vaccine doses as valid immunization due to Laboratory-confirmed specimens were kept frozen at − its low immunogenicity. Therefore, only cases vaccinated 80 °C for further analysis. with the JL strain were included. Phylogenetic analysis Laboratory-confirmation The complete SH gene with flanking non-coding regions Serum and saliva specimens were collected from sus- (316 nucleotides) and complete coding HN protein pected cases for laboratory-confirmation using serological (1749 nucleotides) sequences was sequenced in parallel or real-time reverse-transcriptase PCR (rtRT-PCR) test- for subsequent phylogenetic analyses to determine the ing. Commercial enzyme-linked immunoassays (EIA) were MuV genotype of laboratory-confirmed viruses. Amplifi- used, according to the manufacturer’s recommendations, cation of both viral regions was performed using the to detect MuV-specific IgG and IgM antibodies in serum One-step RT-PCR Kit (Qiagen, Hilden, Germany) for specimens. A real-time one-step RT-PCR assay with one-step RT-PCR, the PCR Master Mix (Promega, Madi- primers and probe as previously described [12], was used son, USA) for nested-PCR, and the primers and PCR to detect viral RNA in saliva specimens. A minimum of 1 protocols as shown in Table 1. When there was non- ml was collected after stimulation of the area of the par- amplification of the 316-nucleotide SH region, the otid and salivary glands for 30 s. Samples were collected complete coding SH sequence (174 nucleotides) was preferably during the first 3 days of symptoms. rtRT-PCR amplified using the nested-PCR protocol described by was the test of choice in all patients, especially those Palacios et al. [15]. PCR products were purified using previously-vaccinated, to avoid false-negative IgM anti- Exo-SAP-IT (USB, Affymetrix Inc. Cleveland, Ohio, body results in persons previously infected or immunized, USA) and sequenced using the ABI Prism Big Dye Ter- regardless of the timing of sample [3, 13, 14]. Total nucleic minator cycle sequencing kit v3.1 on the ABI PRISM acids were extracted from 200 μl of fresh specimen and 3130XL sequencer (Applied Biosystems, Foster City, Table 1 Primer sequences and protocols for PCR amplification of complete coding SH gene with flanking non-coding sequence (316 nucleotides) and complete coding HN protein sequences. Nucleotide positions are relative to AF338106 (major component Jeryl-Lynn of live vaccine). The M13 primer binding sites used for sequencing are marked in bold Primer Name Primer Sequence (5′ - 3′) Position (AF338106) Amplification PCR Protocol Outer PCR reactions MuV_0Fa CAAAACAAATCATATCAAYACAATATCAAG 6105–6134 MuV_0Fb GGCTTAYATTGCRACYAAAGA 6066–6086 MuV_0Rab TARGAGTATCTCATTTAGGCC 8464–8444 Thermal profile: 45 °C × 30 min - 95 °C × 15 min - 40 cycles (94 °C × 30 s - 50 °C × 1 min - 68 °C × 3 min) - 68 °C × 10 min Inner PCR reactions MuV_SH_1F TGTAAAACGACGGCCAGTTCRAGTAGTGTCGATGATCTCAT 6130–6152 MuV_SH_1R CAGGAAACAGCTATGACCTTRCTCAAGCCTTGRTCATT 6810–6791 MuV_HN_2F TGTAAAACGACGGCCAGTTYCGRACCTGYTTCCGAATA 6699–6718 MuV_HN_2R CAGGAAACAGCTATGACCACTGTTGCAATYGAGCAG 7359–7342 MuV_HN_3F TGTAAAACGACGGCCAGTCATAATGTRATTAATGCCAACTG 7196–7218 MuV_HN_3R CAGGAAACAGCTATGACCCACCAGCTRGTACTYCTCTG 7893–7874 MuV_HN_4F TGTAAAACGACGGCCAGTTGYATTYCTDGTCTGTGCYTG 7744–7764 MuV_HN_4R CAGGAAACAGCTATGACCGCCATTCTGGCCTGTT 8442–8427 Thermal profile: 95 °C × 5 min - 35 cycles (95 °C × 30 s - 50 °C × 30 s - 72 °C × 1 min) - 72 °C × 10 min Sequencing protocol M13F TGTAAAACGACGGCCAGT M13R CAGGAAACAGCTATGACC Thermal profile: 96 °C × 1 min - 30 cycles (96 °C × 10 s - 50 °C × 5 s - 60 °C × 4 min) Barrabeig et al. BMC Infectious Diseases (2019) 19:954 Page 4 of 11 California, USA) using sequencing primers (Table 1) using the Taylor series. To estimate the VE of one dose, [15]. Nucleotide sequences were edited and assembled people who had received two doses were excluded from using SeqScape v2.5 software (Applied Biosystems, Fos- the calculations of the proportions of cases and the popu- ter City, California, USA) [12]. lation vaccinated. Similarly, people who had received one Phylogenetic analyses of SH and HN sequences were dose were excluded from calculations that estimated the carried out using the reference genotype sequences ac- effectiveness of two doses. cording to WHO genotyping guidelines for mumps [2]. The statistical analysis was made using SPSS/PC, ver- Molecular evolutionary models of nucleotide substitu- sion 18.0 for Windows (SPSS Inc., Chicago, IL, USA) tion were fitted to the multiple sequence alignments and Epidat. using the evolutionary analyses conducted in MEGA v5.2 [16]. The phylogenetic trees were reconstructed Results using a neighbour-joining distance method as imple- Case notifications mented in MEGA v5.2 [16], with the evolutionary model From January 2007 to December 2011, 1175 suspected with the lowest Bayesian information criterion score. cases of mumps disease were reported to the notifiable The topological accuracy of the trees was evaluated by diseases system of Catalonia, of which 581 (49%) were the bootstrap method (1000 replicates). confirmed cases (incidence rate of 1.6 cases/100,000 The amino acid composition of the complete HN pro- persons-year) (Table 2). 60% (347) were male with a tein sequence was characterised relative to the homolo- mean age 16.7 years (SD ± 10.9 years) and 40% (234) gous sequences of vaccine strains with accession numbers were female with a mean age of 18.2 years (SD ± 13.6 AF338106 (major JL component of live vaccine), years) (p = 0.08). AF345290 (minor JL component of live vaccine) and Fifty-nine percent of confirmed cases had a temperature X93180 (Rubini vaccine strain) using MEGA v5.2 [16]. (≥38 °C). 3% presented orchitis and 0.5% encephalitis as Nucleotide sequences were collapsed to haplotypes using complications and 24 patients were hospitalized (median ALignment Transformation EnviRonment (ALTER) to re- 2 days range: 1–5 days) (Additional file 1: Table S1). duce redundant information [17] before being translated Of the 364 laboratory-confirmed cases, 160 (44%) were to amino acid sequences to reveal the different circulating confirmed by rtRT-PCR assay, 174 (48%) by serological genetic MuV variants even though translated amino acid assays and 30 (8%) using both techniques (Table 2). 55% sequences were similar. The acquisition or loss of poten- (201) of laboratory-confirmed cases were male and the tial N-glycosylation sites in the complete amino acid se- mean age was 19.3 years, SD ± 12.6 years (20.2 years in quence of the HN protein was tracked using N-GlycoSite females vs. 18.6 years in males, p = 0.2) and 217 were ep- (www.hiv.lanl.gov). In addition, the genetic variability of idemiologically linked to a laboratory-confirmed case. SH and HN sequences was studied within genotypes, be- tween genotypes and relative to the major JL component Vaccination status and vaccine effectiveness of the live vaccine (AF338106). Of the 364 laboratory-confirmed cases, 297 (81.6%) had criteria for MMR vaccination as they were born after Statistical analysis 1980, when the childhood immunization schedule was Categorical variables were compared using the Chi- introduced in Catalonia. Of these, 49% (145) were vacci- square or Fisher’s tests and continuous variables using nated with two doses, 32.5% (97) with one dose, 14.5% the Student test. Values of p < 0.05 were considered to (43) did not receive MMR, the number of doses was un- be statistically significant. known in 1.3% (4) and information was missing in 2.7% Vaccination effectiveness (VE) was calculated using all (8). Of the 67 remaining cases, 64 were born before confirmed cases born between 1982 and 2010. We ex- 1980 and had had no opportunity for vaccination and cluded (a) children aged < 12 or 15 months according to three cases occurred in children aged < 1 year (Table 2). the current childhood immunization schedule, (b) people The VE was estimated in the 433 eligible cases out of with unknown vaccination status and (c) people who had the 581 confirmed cases reported in Catalonia during received mumps-containing vaccine within 14 days of the 2007–2011. The point estimate of VE for one dose onset of mumps symptoms. VE was estimated using 433 ranged between 86.2% and 87.1% and for two doses be- eligible cases out of 581 confirmed cases. According to the tween 87.6% and 89.3% (Table 3). methodology described by Orenstein et al. [18], VE was estimated using the screening method by the following Distribution of MuV genotype formula: VEi = 1- ((PCVi/1-PCVi) x (1-PPVi)/PPVi)), where According to WHO guidelines [2] MuV genotyping was PCVi is the proportion of cases with i doses, PPVi is the successful in 147 (77%) of the 190 cases confirmed by proportion of the population vaccinated with i doses, and rtRT-PCR by phylogenetic analysis of complete coding i is 1 or 2. 95% confidence intervals (CI) were calculated SH protein sequences with flanking non-coding regions Barrabeig et al. BMC Infectious Diseases (2019) 19:954 Page 5 of 11 Table 2 Characteristics of confirmed mumps cases and outbreaks according to circulating virus genotypes. Catalonia 2007–2011 Confirmed cases Laboratory-confirmed cases Genotype G Genotype D Othersa CASES N % N % N % N % N % Gender 581 364 126 23 5 Male 347 59.7% 201 55.2% 78 61.9% 11 47.8% 4 80.0% Female 234 40.3% 163 44.8% 48 38.1% 12 52.2% 1 20.0% Age group (years) <1 4 0.7% 2 0.5% 0 0.0% 0 0.0% 0 0.0% 1–4 69 11.9% 34 9.3% 3 2.4% 5 21.7% 0 0.0% 5–14 209 36.0% 116 31.9% 32 25.4% 13 56.5% 3 60.0% 15–24 173 29.8% 111 30.5% 56 44.4% 1 4.3% 0 0.0% 25–34 75 12.9% 78 21.4% 28 22.2% 4 17.4% 1 20.0% ≥ 35 51 8.8% 23 6.3% 7 5.6% 0 0.0% 1 20.0% Year 2007 272 46.8% 204 56.0% 90 71.4% 1 4.3% 1 20.0% 2008 85 14.6% 56 15.4% 2 1.6% 10 43.5% 3 60.0% 2009 56 9.6% 22 6.0% 8 6.3% 1 4.3% 1 20.0% 2010 68 11.7% 30 8.2% 5 4.0% 8 34.8% 0 0.0% 2011 100 17.2% 52 14.3% 21 16.7% 3 13.0% 0 0.0% Laboratory tests 364 62.6% rtRT-PCR assays 160 44.0% 108 85.7% 22 95.7% 4 80.0% IgM assays 166 45.6% – – – Both tests 30 8.2% 18 14.3% 1 4.3% 1 20.0% Seroconversion 8 2.2% – – – Epidemiologically-linked cases 217 37.4% 364 Vaccination status Non-vacinated 150 25.8% 110 30.2% 34 27.0% 8 34.8% 2 40.0% One MMR dose 85 14.6% 97 26.6% 39 31.0% 4 17.4% 0 0.0% Two MMR doses 314 54.0% 145 39.8% 52 41.3% 10 43.5% 3 60.0% Unknown number 15 2.6% 4 1.1% 1 0.8% 0 0.0% 0 0.0% Missing information 17 2.9% 8 2.2% 0 0.0% 1 4.3% 0 0.0% Complications Orchitis 20 3.4% 19 5.2% 7 5.6% 0 0.0% 0 0.0% Encephalitis 3 0.5% 3 0.8% 0 0.0% 0 0.0% 0 0.0% Fever 344 59.2% 235 64.6% 83 65.4% 7 30.4% 3 100.0% Time since second dose of MMR vaccine 0–5 years 89 28.3% 45 31.1% 9 17.3% 4 40.0% 1 33.3% ≥ 6 years 225 71.7% 100 68.9% 43 82.7% 6 60.0% 2 66.7% OUTBREAKS Number of outbreaks Outbreak related cases Genotype G Genotype D Othersa N % N % N % N % N % b Total outbreaks 51 _ 324 _ 20 _ 4 _ 3 _ Year 2007 31 60.8% 166 51.2% 16 80.0% 0 0.0% 1 33.3% 2008 11 21.6% 39 12.0% 0 0.0% 2 50.0% 2 66.7% 2009 2 3.9% 9 2.8% 2 10.0% 0 0.0% 0 0.0% Barrabeig et al. BMC Infectious Diseases (2019) 19:954 Page 6 of 11 Table 2 Characteristics of confirmed mumps cases and outbreaks according to circulating virus genotypes. Catalonia 2007–2011 (Continued) 2010 3 5.9% 19 5.9% 1 5.0% 2 50.0% 0 0.0% 2011 4 7.8% 91 28.1% 1 5.0% 0 0.0% 0 0.0% Setting Family 18 35.3% 42 13.0% 7 35.0% 1 25.0% 0 0.0% Secondary 13 25.5% 56 17.3% 3 15.0% 1 25.0% 1 33.3% High school 8 15.7% 168 51.9% 3 15.0% 2 50.0% 1 33.3% Occupational 3 5.9% 7 2.2% 1 5.0% 0 0.0% 1 33.3% Community (discotheque, football team, neighbours) 9 17.6% 51 15.7% 6 30.0% 0 0.0% 0 0.0% a Others: Genotype F, Genotype H and Genotype J b In 21 outbreaks the genotype was not known and 3 outbreaks were not typable” (316 nucleotides) (Fig. 1). In addition, phylogenetic ana- (0.18–3.09%). The mean genetic distances between se- lysis was also performed in another 8 (4%) cases based quences within genotypes relative to the sequences from on complete coding SH sequences (174 nucleotides) the major component of the JL vaccine strain are shown (Additional file 4: Figure S1), showing robust, phylogen- as additional information (Additional file 2: Table S2). etic analysis results (bootstrap values > 70%) even The deduced amino acid sequences of the complete though the length of sequences was shorter than recom- coding HN region that were collapsed into haplotypes mended by the WHO for characterisation. According to were compared with the major component of the JL the phylogenetic analyses of the 316-nucleotide (Fig. 1) and other vaccine strains (Table 4). Up to 6 amino or 174-nucleotide (Additional file 4: Figure S1) SH se- acid differences were found, but there was no gain or quences, genotype frequencies were: 126 (81%) genotype loss of potential N-glycosylation positions within anti- G, 23 (15%) genotype D, 2 (1%) genotype H, 2 (1%) genic regions (amino acid positions 265–288, 329–340 genotype F, 1 (< 1%) genotype J and 1 (< 1%) unclassified and 352–360) previously characterised. In addition, up (Table 2). MuV genotyping based on complete coding to 9 other amino acid changes were found within HN sequences (Additional file 5: Figure S2) was consist- other viral HN regions where some amino acid sub- ent with the results obtained from SH sequences. The stitutions were previously related to immune escape remaining 35 (18%) cases of MuV could not be geno- from neutralisation [19]. No amino acid changes typed due to non-amplification of SH or HN regions, (K335E/R, P/Q354H, E/D356S, R360C, N464K, and likely due to the low viral load or the low quality of gen- S466 N) in other sites previously associated with etic material from laboratory-confirmed clinical samples. neurovirulence were detected [20]. The genetic variability of nucleotide and deduced Nucleotide sequences were submitted to the amino acid SH and HN sequences of laboratory- GenBank database (accession numbers KX609797- confirmed samples was also studied (Additional file 2: KX609951). Table S2). The 155 complete 174-nucleotide SH se- quences were collapsed into 35 (23%) haplotypes, while Temporal distribution of outbreaks the 110 complete coding HN sequences were collapsed In 2007–2011, 51 outbreaks of mumps were notified, into 38 (35%) haplotypes despite being longer (1749 nu- with 324 confirmed cases. Most occurred in 2007 (61%) cleotides). Within genotypes, the complete coding SH and 2008 (22%). The most frequent settings were the sequences showed greater mean genetic divergences family (35%), with a mean size of 2.3 cases, secondary (0.49–6.90%) than the complete coding HN sequences schools (25%) with a mean size of 4.3 cases, and Table 3 Estimates of vaccine effectiveness for one and two doses of the MMR vaccine by birth cohort of all confirmed cases of mumps. Catalonia 2007–2011 Number of cases Vaccine effectiveness (95%CI) Birth cohort No vaccine One dose Two doses One dose Two doses 1982–1991 32 35 73 87.1 (79.2–92,1) 89.3 (83.7–92.9) 1992–2001a 10 52 132 86.8 (74.1–93.3) 87.6 (75,4- 93,7) b 2002–2010 12 51 36 86.2 (74.2–92.7) 88.5 (76.1–94,4) n = 581 (433 cases targeted for vaccination; 116 cases non-targeted for vaccination, 15 unknown number and 17 cases missing information) a To calculate the effectiveness of the second dose, birth cohorts from 1994 to 1996 were excluded as the MMR vaccine administered contained the Rubini strain b Estimates of VE for two doses were birth cohorts from 2002 to 2008 Barrabeig et al. BMC Infectious Diseases (2019) 19:954 Page 7 of 11 community outbreaks in young adults (discotheque, football team, etc.) (18%) with a mean size of 5.7. Eight (16%) outbreaks occurred in high schools, with a mean size of 21 (Table 2). Phylogenetic analysis was carried out in 30 outbreaks: the genotype detected was G in 20 outbreaks, D in 4 outbreaks and F, H and J in one outbreak each, while three outbreaks were non-typable (Table 2 and Fig. 2). Genotype G viruses circulated throughout the study period at variable levels, affecting 99 confirmed cases (Fig. 2). In 2007, genotype G viruses were predominant with 16 (80%) outbreaks that affected 74 confirmed cases, constituting an epidemic wave but during 2008– 2011 their circulation decreased (3 outbreaks with 25 confirmed cases). This was considered an inter-epidemic period. Genotypes D, F, H and J also co-circulated dur- ing the inter-epidemic period (Fig. 2). Discussion This study found five different MuV genotypes. Of the more than 1100 suspected cases, almost half were con- firmed by laboratory methods or epidemiological link- age. In clinical parotitis, causes other than the mumps virus should be considered. In a previous study, we found that approximately 51% of suspected cases of mumps infection were laboratory-confirmed for infec- tion by other viruses such as the Epstein-Bar virus, para- influenza viruses or adenovirus [21]. About 70% of laboratory-confirmed mumps cases were vaccinated, with a mean age of 14.3 years (SD ± 7.3), of whom 40% received two recommended JL vaccine doses. Phylogenetic analyses of SH and HN sequences revealed that the genotypes most frequently detected were G and D. In Spain, the emergence and spread of genotype G vi- ruses since 2006 has been reported [22], and virological surveillance shows continuity until 2011 due to the find- ings of the present study. The circulation of the geno- type G virus has been reported in outbreaks in Europe and USA, and particularly in patients vaccinated with two doses of MMR [6, 7, 19, 23–27]. Our results suggest that genotype G viruses are highly prevalent and have a substantial capacity to spread among the vaccinated population. Mumps cases have continued to occur after our study period, presenting as multiannual waves. Re- cent data suggest that in 2015, a new epidemic wave began in Catalonia, with genotype G being the most prevalent. This behaviour was also observed in the rest of Spain, where 57% of cases with a vaccination history had received ≥1 vaccine dose [28, 29]. A possible explanation might be the antigenic differ- Fig. 1 Phylogenetic reconstruction of complete coding SH gene. The ences between the circulating and vaccine strains (im- strains in the present study are coloured by year: 2007 (orange), 2008 (red), 2009 (pink), 2010 (blue) and 2011 (brown) mune escape) [30, 31], or progressive loss of protective antibodies over time (waning immunity). Other authors Barrabeig et al. BMC Infectious Diseases (2019) 19:954 Page 8 of 11 Table 4 Molecular characterization of deduced amino acid positions in HN protein. The nucleotide sequences were previously collapsed into haplotypes, and the numbers of sequences represented are shown in brackets with the name in the first column. Potential n-glycosylation positions are highlighted in grey. Amino acids other than the deduced reference sequence (AF338106) are shown with a dot Amino acid position previously associated with neurovirulence; Ag Amino acid position within antigenic region, NE Neutralisation-escape position have suggested high-density, close-contact environments dose). Although our results suggest immune escape by the such as schools or universities as likely causes [6, 9, 32]. acquisition of amino acid substitutions within the antigenic With respect to the differences detected between the epitopes of the HN protein, they also indicate a possible loss circulating and JL vaccine strains, the alignment of de- of immunity or secondary vaccine failure. Several factors sup- duced amino acid sequences revealed that most amino port this explanation. First, waning immunity was linked to acid substitutions were genotype-specific. the time since vaccination [26, 33]. In our study, 72% of con- Some reports suggest that neutralising antibodies are spe- firmed cases received the second dose of MMR ≥6 years be- cific to the vaccine strain used, and humoral protection is not fore symptom onset. Secondly, the VE in observational sufficiently efficient to prevent infection by MuVs from differ- studies of the JL strain (75%–82% for a single dose and 79%– ent genotypes and disease progression. Geographical differ- 95% for two doses) [3, 34–39] is lower than the efficacies re- ences between circulating genotypes and the vaccine strain ported in clinical trials (92%–96%) [40, 41]. Similarly, the have been reported worldwide. In the Western Hemisphere, point estimate of VE for all confirmed cases during the study the composition is mainly based on the JL strain (genotype period ranged between 86% and 87% for one dose and 88%– A) and, in a few countries, on the Urabe AM9 (genotype B) 89% for two doses. Thirdly, 58% of laboratory-confirmed pa- and Leningrad-Zagreb (genotype N) strains, whereas the tients were aged > 15 years, and only 10% were aged < 5 years; wild-type viruses currently circulating predominantly belong this is consistent with other studies that found an upsurge of to genotype G strains. Some authors have found that neutra- cases in young adults [24, 25], which is in accordance with a lising epitopes were vaccine strain-specific and, therefore, vac- decrease in neutralising antibody levels over time, as reported cination did not completely prevent mumps disease and in seroepidemiological studies, which probably result in in- complications by viruses belonging to genotypes other than complete protection against heterologous MuV strains [24, the vaccine genotypes [31]. Our results show that viruses be- 42]. This may be explained, at the beginning of the vaccin- longing to five genotypes were co-circulating in the study ation period, by the fact that vaccinated persons had natural period at varying levels despite high community vaccination reinfection due to the circulating virus. When rates of disease coverage with the JL vaccine (mean of 94.2% for the second incidence fell to low levels, the possibility of boosting was Barrabeig et al. BMC Infectious Diseases (2019) 19:954 Page 9 of 11 Fig. 2 Distribution of outbreaks of mumps and outbreak-related cases according to genotype and year of detection. Catalonia 2007–2011. Others: Genotype F, Genotype H and Genotype J reduced. In Finland, a vaccination coverage of > 95% main- sequence at the nucleotide and amino acid levels, as tained over time permitted the elimination of endemic trans- reported by other authors [19]. Despite the lower di- mission of the virus in 1996 [43]. If low titres of neutralising versity of the HN protein compared with the SH pro- antibodies are an important factor in outbreaks, it is essential tein, its molecular characterisation is highly to have a threshold titre to determine the response of anti- recommended to detect viral variants with changes mumps antibodies and whether the subject is fully protected that affect mainly antigenic epitopes [49]. against wild virus infection [44]. The availability of nucleotide sequences might help to Outbreaks have been reported in populations vacci- trace the person-to-person chain of transmission in epi- nated with the JL vaccine strain, but also with the Urabe demiological investigations of outbreaks in the future. A AM9 and Leningrad-Zagreb vaccines [45]. Therefore, global sequence database and mumps strain bank similar the development of a new mumps vaccine would prob- to the Measles Nucleotide Surveillance (MeaNS) data- ably not be the solution to the current problem. Instead, base should be developed to facilitate the distribution of revaccination with a third vaccine dose in adolescents sequence variants of MuV, which is particularly import- could repair the loss of immunity, as other authors have ant to link endemic cases to imported cases from other reported [1]. At present, the CDCs recommend a third countries and monitor the spread of novel genetic viral dose of MMR as a post-exposure measure to control variants with new antigenic features on the HN or the F outbreaks [33, 46–48]. proteins. We found that SH and HN sequencing provided One limitation of the study is that detection of the the same genotyping results in most MuV infections. virus by rtRT-PCR was more frequent in persons who The comparison of mean genetic divergence within had received two doses of MMR than in unvaccinated genotypes, the genetic distances relative to the JL vac- persons. This might be due to the fact that, although cine strain, and the percentage of collapse into haplo- rtRT-PCR is the test of choice, if epidemiologists know types, revealed that the coding SH protein sequence that the suspected case had received the vaccine they is more variable than the coding HN protein prioritize a rtRT-PCR test because, in vaccinated people, Barrabeig et al. BMC Infectious Diseases (2019) 19:954 Page 10 of 11 false-negative serology results (IgM antibody) are fre- Authors’ contributions quent (Additional file 3: Table S3). IB and NT collected clinical information and patient samples; AA, JC and TP performed confirmatory analysis and genotyping; IB, AA and AD designed the research, analysed the data and wrote the paper. All authors read and Conclusions approved the final manuscript. Our study, carried out with retrospective cases, shows that Funding genotype G viruses are the most prevalent in Catalonia and This work was partially funded by CIBER of Epidemiology and Public Health may be transmitted within a highly-vaccinated population. (CIBERESP) Carlos III Health Institute and the Catalan Agency for the Management Most cases occurred in people who had received two doses of Grants for University Research (AGAUR Grant Number 2017/SGR 1342); and Sociedad Española de Enfermedades Infecciosas y Microbiología Clinica (SEIMC) of MMR, suggesting inadequate effectiveness of the JL vac- and Societat Catalana de Malalties Infeccioses i Microbiologia Clínica (SCMIMC) cine strain. The possible factors related to the decrease in (Beca Agustí Pumarola 2010). vaccine effectiveness include secondary vaccine failure (wan- The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. ing immunity), intense exposure to the virus due to social overcrowding, and a possible mismatch between the vaccine Availability of data and materials genotype and that of circulating mumps virus strains. The datasets used and analysed during the current study are available from Molecular and epidemiological studies are needed to the corresponding author on reasonable request. provide information on the factors related to vaccine Ethics approval and consent to participate failure in countries with high vaccine coverages. The study was not submitted for research ethics approval as the activities described were conducted as part of the legislated mandate of the Health Supplementary information Department of Catalonia, the competent authority for the surveillance of Supplementary information accompanies this paper at https://doi.org/10. communicable diseases, which is officially authorized to receive, treat and 1186/s12879-019-4496-z. temporarily store personal data on cases of infectious diseases according to Decret 203/2015 of 15th September which created the epidemiological surveillance network. Therefore, all study activities formed part of public Additional file 1: Table S1. Rates of mumps complications and health surveillance and were thus exempt from institutional board review hospitalization according to MMR status. Catalonia 2007–2011. * and did not require informed consent. Calculated in laboratory-confirmed cases. Additional file 2: Table S2. Genetic divergences of complete coding Consent for publication SH and HN sequences of the present study at nucleotide and amino acid Not applicable. level. (1) The proportion (%) of nucleotide or amino acid differences per site from averaging over all sequence pairs within each group are Competing interests shown.(2) Mean genetic distances (%) between genotypes and reference The authors declare that they have no competing interests. JL5 sequences (AF33106) are shown: n/c denotes cases in which it was not possible to estimate the evolutionary distance. Author details Additional file 3: Table S3. Characteristics of samples studied according 1 Epidemiological Surveillance and Response to Public Health Emergencies to vaccination status. Unit in Barcelona South, Agency of Public Health of Catalonia, Generalitat of Additional file 4: Figure S1. Phylogenetic reconstruction of complete Catalonia., Hospital Universitari de Bellvitge, Edifici antiga escola d’infermeria, coding SH protein (174 nucleotides, from 6268 to 6441positions in 3a planta, Feixa Llarga, s/n, 08907 L’Hospitalet de Llobregat, Spain. 2CIBER AF338106) using the neighbour-joining method rooted to strains belong- Epidemiología y Salud Pública, Institut of Health Carlos III, Madrid, Spain. 3 ing to genotype A. The strains of the present study are coloured by year: Virology Unit, Centre de Diagnòstic Biomèdic, Hospital Clínic, Barcelona, 2007 (orange), 2008 (red), 2009 (pink), 2010 (blue) and 2011 (brown). Spain. 4Department of Medicine, University of Barcelona, Barcelona, Spain. 5 CIBER Enfermedades Hepáticas y Digestivas, Institute of Health Carlos III, Additional file 5: Figure S2. Phylogenetic reconstruction of complete Madrid, Spain. coding HN protein sequences (1749 nucleotides, from 6614 to 8362 positions in AF338106) using the neighbour-joining method rooted to Received: 10 March 2019 Accepted: 23 September 2019 strains belonging to genotype A. The strains of the present study are coloured by year: 2007 (orange), 2008 (red), 2009 (pink), 2010 (blue) and 2011 (brown). References 1. Barskey AE, Glasser JW, LeBaron CW. Mumps resurgences in the United Abbreviations States: a historical perspective on unexpected elements. Vaccine. 2009;27: Ag: Antigenic; CI: Confidence intervals; EIA: Enzyme-linked immunoassays; 6186–95. https://doi.org/10.1016/j.vaccine.2009.06.109. HN: Hemmagglutinin-neuraminidase; IgG: Immunoglobulin G antibodies; 2. World Health Organization. Mumps virus nomenclature update: 2012. Wkly IgM: Immunoglobulin M antibodies; JL: Jeryl Lynn strain; MMR: Measles, Epidemiol Rec. 2012;22:217–24. mumps and rubella vaccine; MuV: Mumps virus; NE: Neutralization escape; 3. Rubin SA. Mumps vaccine. In: Plotkin SA, Orenstein WA, Offit PA, Edwards OR: Odds ratio; PCR: Polymerase chain reaction; rtRT-PCR: real time reverse KM, editors. Vaccines. 7th ed. Philadelphia: Elsevier Inc; 2018. p. 663–88. transcription polymerase chain reaccion; SH: Small hydrophobic; VE: Vaccine 4. Šantak M, Lang-Balija M, Ivancic-Jelecki J, Košutić-Gulija T, Ljubin-Sternak S, effectiveness; WHO: World Health Organization Forcic D. Antigenic differences between vaccine and circulating wild-type mumps viruses decreases neutralization capacity of vaccine-induced Acknowledgements antibodies. Epidemiol Infect. 2013;141:1298–309. https://doi.org/10.1017/ The Working Group for the Study of Mumps in Catalonia is composed of: S0950268812001896. Josep Álvarez, César Arias, Irene Barrabeig, Neus Camps, Mónica Carol, Pere 5. Dayan GH, Quinlisk MP, Parker AA, Barskey AE, Harris ML, Schwartz JMH, Godoy, Ana Martínez, Sofia Minguell, Ignasi Parrón, Ma Rosa Sala, Ariadna et al. Recent resurgence of mumps in the United States. N Engl J Med. Rovira, Núria Torner (Public Health Agency of Catalonia), Cristina Rius (Public 2008;358:1580–9. https://doi.org/10.1056/NEJMoa0706589. Health Agency of Barcelona). 6. Sane J, Gouma S, Koopmans M, de Melker H, Swaan C, van Binnendijk R, et al. The authors thank the physicians and microbiologists of Catalonia who Epidemic of mumps among vaccinated persons, the Netherlands, 2009-2012. reported and confirmed cases. Emerg Infect Dis. 2014;20:643–8. https://doi.org/10.3201/eid2004.131681. Barrabeig et al. BMC Infectious Diseases (2019) 19:954 Page 11 of 11 7. Marin M, Quinlisk P, Shimabukuro T, Sawhney C, Brown C, Lebaron CW. 29. Centro Nacional de Epidemiología. CIBER Epidemiología y Salud Pública Mumps vaccination coverage and vaccine effectiveness in a large outbreak (CIBERESP). Instituto de Salud Carlos III. Resultados de la vigilancia among college students--Iowa, 2006. Vaccine. 2008;26(29–30):3601–7. epidemiológica de las enfermedades transmisibles. Informe anual 2016. https://doi.org/10.1016/j.vaccine.2008.04.075. Madrid; 2018. https://publicaciones.isciii.es/unit.jsp?unitld=cne. 8. Cohen C, White JM, Savage EJ, Glynn JR, Choi Y, Andrews N, et al. Vaccine 30. Crowley B, Afzal MA. Mumps virus reinfection-clinical findings and effectiveness estimates, 2004-2005 mumps outbreak. England Emerg Infect Dis. serological vagaries. Commun Dis Public Health. 2002;5:311–3. 2007;13:12–7. 31. Nöjd J, Tecle T, Samuelsson A, Orvell C. Mumps virus neutralising antibodies 9. Barskey AE, Schulte C, Rosen JB, Handschur EF, Rausch-Phung E, Doll MK, et al. do not protect against reinfection with a heterologous mumps virus Mumps outbreak in orthodox Jewish communities in the United States. N Engl J genotype. Vaccine. 2001;19(13–14):1727–31. Med. 2012;367:1704–13. https://doi.org/10.1056/NEJMoa1202865. 32. Hahné S, Schurink T, Wallinga J, Kerkhof J, van der Sande M, van Binnendijk 10. World Health Organization. Mumps. In: Surveillance standards for vaccine- R, de Melker H. Mumps transmission in social networks: a cohort study. BMC preventable diseases, second edition. World Health Organization: Geneva; 2018. Infect Dis. 2017;17:56. https://doi.org/10.1186/s12879-016-2135-5. https://www.who.int/immunization/monitoring_surveillance/burden/vpd/WHO_ 33. Cardemil CV, Dahl RM, James L, Wannemuehler K, Gary HE, Shah M, et al. SurveillanceVaccinePreventable_13_Mumps_R2.pdf?ua=1. Effectiveness of a third dose of MMR vaccine for mumps outbreak control. 11. Departament de Salut. Guia per a l’eliminació de la parotiditis a Catalunya. N Engl J Med. 2017;377:947–56. https://doi.org/10.1056/NEJMoa1703309. Quaderns de Salut Pública núm 20. Generalitat de Catalunya: Barcelona; 2006. 34. World Health Organization. The immunological basis for immunization http://hdl.handle.net/11351/2571 series. Module 16: Mumps. Geneva: WHO. Immunization, Vaccines and 12. Krause CH, Eastick K, Ogilvie MM. Real-time PCR for mumps diagnosis on clinical Biologicals; 2010. specimens--comparison with results of conventional methods of virus detection 35. Centers for Disease Control and Prevention. Prevention of Measles, Rubella, and nested PCR. J Clin Virol. 2006;37(3):184–9. Congenital Rubella Syndrome, and Mumps, 2013. MMWR Recomm Rep. 13. Gastanaduy PA, Redd SB, Clemmons NS, et al. Measles. In: Centers for 2013;62(RR-04):1–34. Disease Control and Prevention. Manual for the surveillance of vaccine- 36. Harling R, White JM, Ramsay ME, Macsween KF, van den Bosch C. The preventable diseases. Atlanta: Centers for Disease Control and Prevention; effectiveness of the mumps component of the MMR vaccine: a case control 2008. study. Vaccine. 2005;23:4070–4. 14. Litman N, Baum SG. Mumps Virus. In: Mandell G, Bennett J, Dolin R, editors. 37. Schlegel M, Osterwalder J, Galeazzi R, Vernazza P. Comparative efficacy of Principles and practice of infectious diseases. 8th ed. Philadelphia: Elsevier Inc.; three mumps vaccines during disease outbreak in eastern Switzerland: 2015. p. 1942–7. cohort study. BMJ. 1999;319:352. 15. Palacios G, Jabado O, Cisterna D, de Ory F, Renwick N, Echevarria JE, et al. 38. Schaffzin JK, Pollock L, Schulte C, Henry K, Dayan G, Blog D, et al. Molecular identification of mumps virus genotypes from clinical samples: Effectiveness of previous mumps vaccination during a summer camp standardized method of analysis. J Clin Microbiol. 2005;43:1869–78. outbreak. Pediatrics. 2007;120:e862–8. 16. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA5: molecular 39. Snijders BE, van Lier A, van de Kassteele J, Fanoy EB, Ruijs WL, Hulshof F, evolutionary genetics analysis using maximum likelihood, evolutionary distance, et al. Mumps vaccine effectiveness in primary schools and households, the and maximum parsimony methods. Mol Biol Evol. 2011;28:2731–9. https://doi. Netherlands, 2008. Vaccine. 2012;30:2999–3002. https://doi.org/10.1016/j. org/10.1093/molbev/msr121. vaccine.2012.02.035. 17. Glez-Peña D, Gómez-Blanco D, Reboiro-Jato M, Fdez-Riverola F, Posada D. ALTER: 40. Weibel R, Stokes J, Buynak E, Whitman J, Hilleman M. Live attenuated program-oriented conversion of DNA and protein alignments. Nucleic Acids Res. mumps-virus vaccine. 3. Clinical and serologic aspects in a field evaluation. 2010;38:W14–8. https://doi.org/10.1093/nar/gkq321. N Engl J Med. 1967;276:245–51. 18. Orenstein WA, Bernier RH, Dondero TJ, Hinman AR, Marks JS, Bart KJ, et al. Field 41. Sugg W, Finger J, Levine R, Pagano J. Field evaluation of live virus mumps evaluation of vaccine efficacy. Bull World Health Organ. 1985;63(6):1055–68. vaccine. J Pediatr. 1968;72:461–6. 19. Jin L, Örvell C, Myers R, Rota PA, Nakayama T, Forcic D, et al. Genomic diversity of 42. LeBaron CW, Forghani B, Matter L, Reef SE, Beck C, Bi D, et al. Persistence of mumps virus and global distribution of the 12 genotypes. Rev Med Virol. 2015;25: mumps antibodies after 2 doses of measles, mumps and rubella vaccine. J 85–101. https://doi.org/10.1002/rmv.1819. Infect Dis. 2009;199:552–60. https://doi.org/10.1086/605410. 20. Cui A, Brown DWG, Xu W, Jin L. Genetic variation in the HN and SH genes of 43. Peltola H, Davidkin I, Paunio M, Valle M, Leinikki P, Heinonen O. Mumps and mumps viruses: a comparison of strains from mumps cases with and without rubella eliminated from Finland. JAMA. 2000;284:2643–7. neurological symptoms. PLoS One. 2013;8(4):e61791. https://doi.org/10.1371/ 44. Rubin S, Mauldin J, Chumakov K, Vanderzanden J, Iskow R, Carbone K. journal.pone.0061791. Serological and phylogenetic evidence of monotypic immune responses to different mumps virus strains. Vaccine. 2006;24:2662–8. 21. Barrabeig I, Costa J, Rovira A, Marcos M, Isanta R, López-Adalid R, et al. Viral 45. Ong G, Goh KT, Ma S, Chew SK. Comparative efficacy of Rubini, Jeryl- etiology of mumps-like illnesses in suspected mumps cases reported in Catalonia. Lynn and Urabe mumps vaccine in an Asian population. J Inf Secur. Spain Hum Vaccines Immunother. 2015;11:282–7. https://doi.org/10.4161/hv.36165. 2005;51:294–8. 22. Echevarría J, Castellanos A, Sanz J, Pérez C, Palacios G, De Martínez AM, et al. 46. Marin M, Marlow M, Moore KL, Patel M. Recommendation of the advisory Circulation of mumps virus genotypes in Spain from 1996 to 2007. J Clin committee on immunization practices for use of a third dose of mumps Microbiol. 2010;48:1245–54. https://doi.org/10.1128/JCM.02386-09. virus–containing vaccine in persons at increased risk for mumps during an 23. Rota JS, Turner JC, Yost-Daljev MK, Freeman M, Toney DM, Meisel E, et al. outbreak. MMWR Morb Mortal Wkly Rep. 2018;67:33–8. https://doi.org/10. Investigation of a mumps outbreak among university students with two measles- 15585/mmwr.mm6701a7. mumps-rubella (MMR) vaccinations, Virginia, September-December 2006. J Med 47. Nelson GE, Aguon A, Valencia E, Oliva R, Guerrero ML, Reyes R, et al. Virol. 2009;81(10):1819–25. https://doi.org/10.1002/jmv.21557. Epidemiology of a mumps outbreak in a highly vaccinated island 24. Dayan GH, Rubin S. Mumps outbreaks in vaccinated populations: are available population and use of a third dose of measles-mumps-rubella vaccine for mumps vaccines effective enough to prevent outbreaks? Clin Infect Dis. 2008;47: outbreak control-Guam 2009 to 2010. Pediatr Infect Dis J. 2013;32:374–80. 1458–67. https://doi.org/10.1086/591196. https://doi.org/10.1097/INF.0b013e318279f593. 25. Carr M, Moss E, Waters A, Dean J, Jin L, Coughlan S, et al. Molecular 48. Ogbuanu IU, Kutty PK, Hudson JM, Blog D, Abedi GR, GoodelL S, et al. Impact epidemiological evaluation of the recent resurgence in mumps virus infections in of a third dose of measles-mumps-rubella vaccine on a mumps outbreak. Ireland. J Clin Microbiol. 2010;48(9):3288–94. https://doi.org/10.1128/JCM.00434-10. Pediatrics. 2012;130:e1567–74. https://doi.org/10.1542/peds.2012-0177. 26. Vandermeulen C, Roelants M, Vermoere M, Roseeuw K, Goubau P, 49. Gouma S, Cremer J, Parkkali S, Veldhuijzen I, van Binnendijk RS, Koopmans Hoppenbrouwers K. Outbreak of mumps in a vaccinated child population: a MPG. Mumps virus F gene and HN gene sequencing as a molecular tool to question of vaccine failure? Vaccine. 2004;22(21–22):2713–6. study mumps virus transmission. Infect Genet Evol. 2016;45:145–50. https:// 27. Willocks LJ, Guerendiain D, Austin HI, Morrison KE, Cameron RL, Templeton doi.org/10.1016/j.meegid.2016.08.033. KE, et al. An outbreak of mumps with genetic strain variation in a highly vaccinated student population in Scotland. Epidemiol Infect. 2017;145:3219– 25. https://doi.org/10.1017/S0950268817002102. Publisher’s Note 28. Carmona G, Vives N. Resum de les malalties de declaració obligatòria durant Springer Nature remains neutral with regard to jurisdictional claims in l’any 2016. Butlletí Epidemiològic de Catalunya. 2018;2:1–42. published maps and institutional affiliations.