Stem Cell Research 38 (2019) 101482 Contents lists available at ScienceDirect Stem Cell Research journal homepage: www.elsevier.com/locate/scr Lab resource: Multiple cell lines A collection of integration-free iPSCs derived from Parkinson's disease T patients carrying mutations in the GBA1 gene Eva Rodríguez-Travera,b, Eva Díaz-Guerraa,b, César Rodríguezc, Pablo Fernándeza,b, Fabián Arenasb,d, Marcos Araúzo-Bravoe, María Orerac, Jaime Kulisevskyb,d, Rosario Moratallaa,b, Carlos Vicarioa,b, ⁎ a Instituto Cajal-Consejo Superior de Investigaciones Científicas (CSIC), Madrid, Spain b Centro de Investigación Biomédica en Red sobre Enfermedades Neurodegenerativas (CIBERNED), Madrid, Spain c Servicio de Bioquímica Clínica, Hospital General Universitario Gregorio Marañón, Madrid, Spain d Movement Disorders Unit, Neurology Dept., Hospital Sant Pau, Barcelona, Spain e Biodonostia Health Research Institute, San Sebastián, Spain ABSTRACT Mutations in the GBA1 gene, which encodes the lysosomal enzyme Glucocerebrosidase1 are major risk factors for Parkinson's disease (PD) and dementia with Lewy bodies (DLB). We have generated induced pluripotent stem cells (iPSCs) from fibroblasts of four PD patients carrying the N370S/wt or the L444P/wt heterozygous mutations in GBA1. The iPSCs presented a normal morphology, expressed endogenous pluripotency markers and could be differentiated into endodermal, meso- dermal and ectodermal cells. These iPSCs were free from Sendai viral vectors and reprogramming factors, had a normal karyotype and maintained the original GBA1 genotype. Resource table Inducible/constitutive N/A system Date archived/stock da- 20/03/2018 te Unique stem cell lines ICCSICi001-A Cell line repository/ba- Banco Nacional de Líneas Celulares (BNLC, Spanish Stem identifier ICCSICi002-A nk Cell Bank): http://www.isciii.es/ISCIII/es/contenidos/fd- ICCSICi003-A el-instituto/fd-organizacion/fd-estructura-directiva/fd- ICCSICi004-A subdireccion-general-investigacion-terapia-celular- Alternative names of st- IC-PD1-F-iPS-4F-1 medicina-regenerativa/fd-centros-unidades/fd-banco- em cell lines IC-PD2-F-iPS-4F-1 nacional-lineas-celulares/fd-lineas-celulares-disponibles/ IC-PD3-F-iPS-4F-1 lineas-de-celulas-iPS.shtml IC-PD4-F-iPS-4F-1 Ethical approval The study was approved by the Commission of Guarantees Institution Instituto Cajal-CSIC, Madrid for the Donation and Utilization of Human Cells and Contact information of Carlos Vicario cvicario@cajal.csic.es Tissues-Instituto de Salud Carlos III (ISCIII), Spain (ap- distributor proval numbers: 3212701 and 4,103,331). Informed con- Type of cell lines Induced pluripotent stem cells (iPSCs) sents were obtained from the patients. Origin Human Cell Source Dermal fibroblasts Clonality Clonal Method of reprogram- Non-integrative: CytoTune™ Sendai reprogramming vec- Resource utility ming tors expressing hOCT4, hSOX2, hKLF4 and hc-MYC. Multiline rationale Same disease non-isogenic cell lines Generating patient-specific cellular models is a valuable strategy for Gene modification Yes exploring mechanisms of neurodegeneration and finding potential Type of modification Hereditary therapeutic treatments. Nevertheless, access to and expandability of Associated disease Parkinson's disease Gene/locus N370S/wt and L444P/wt mutations in the GBA1 gene primary cells such as human brain cells are extremely difficult. Thus, Method of modification N/A our collection of integration-free-hiPSCs can be used as a cellular model Name of transgene or r- N/A for studying GBA1-associated PD. esistance ⁎ Corresponding author at: Instituto Cajal-Consejo Superior de Investigaciones Científicas (CSIC), Madrid, Spain. E-mail address: cvicario@cajal.csic.es (C. Vicario). https://doi.org/10.1016/j.scr.2019.101482 Received 10 May 2019; Received in revised form 27 May 2019; Accepted 4 June 2019 Available online 06 June 2019 1873-5061/ © 2019 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/). E. Rodríguez-Traver, et al. Stem Cell Research 38 (2019) 101482 Table 1 Summary of lines. iPSC line names Abbreviation in figures Gender Age Ethnicity Genotype of locus Disease ICCSICi001-A (IC-PD1-F-iPS-4F-1) N370S-PD1 Female 67 Caucasian GBA1 (N370S/wt, c.1226 A > G) PD ICCSICi002-A (IC-PD2-F-iPS-4F-1) N370S-PD2 Female 75 Caucasian GBA1 (N370S/wt, c.1226 A > G) PD Moderate dementia ICCSICi003-A (IC-PD3-F-iPS-4F-1) L444P-PD3 Female 74 Caucasian GBA1 (L444P/wt, c.1448 T > C) PD Dementia ICCSICi004-A (IC-PD4-F-iPS-4F-1) L444P-PD4 Male 52 Caucasian GBA1 (L444P/wt, c.1448 T > C) PD Resource details tested alleles with a 100% homology (archived at SCR journal). Heterozygous mutations in the GBA1 gene are strong genetic risk Materials and methods factors for developing PD and DLB. Among the high number of muta- tions described, the N370S and L444P are the most common in PD Reprogramming of dermal fibroblasts (García-Sanz et al., 2017; Seto-Salvia et al., 2012; García-Sanz et al., 2018; Migdalska-Richards and Schapira, 2016). In this study, we report Fibroblasts were isolated from skin biopsies of PD patients, plated at the generation and characterization of four hiPSC lines from different 10,000 cells/cm2 and incubated (37 °C, 5% CO2). On day 2, they were PD patients, two carrying the N370S/wt mutation and two with the transduced using the CytoTuneTM-iPS Reprogramming Kit (Thermo- L444P/wt mutation in GBA1 (Table 1, Fig. 1g. Fisher). After seven days, transduced fibroblasts were seeded on mouse Human iPSCs were generated by reprogramming dermal fibroblasts embryonic fibroblasts and two-three weeks later colonies, were picked isolated from skin biopsies obtained from the donor's forearm, using and expanded in hiPSC medium (KnockOutTM DMEM/F12, 100 μM non-integrative Sendai viral vectors encoding the transcription factors NEAA, 2 mM glutaMAX, 55 μM ß-mercaptoethanol, 100 U/mL OCT4, SOX2, KLF4 and c-MYC. Primary colonies were picked and ex- Penicillin/100 μL/mL Streptomycin B, 20% KnockOut serum replace- panded as clonal lines three weeks after transduction. ICCSICi001-A, ment; Thermo-Fisher). ICCSICi002-A, ICCSICi003-A and ICCSICi004-A hiPSC clones were se- lected for in-depth characterization. The lines obtained presented a Embryoid body (EB) formation and three-lineage differentiation genuine hiPSC colony morphology (flat and compact, with sharp edges, Fig. 1 A1-A4). They were further analyzed to assess their pluripotency, The iPSC colonies were mechanically divided into cell clumps to genomic stability and the clearance of Sendai viral vectors and repro- generate EBs, which on day 5 were plated on coverslips to initiate gramming factors after several passages (Fig. 1; Supplementary Fig. 1; differentiation. For ectodermal differentiation, cultures were treated Table 2). The expression of pluripotency markers NANOG, TRA-1-60, with 250 ng/mL Noggin (Peprotech) and 5 μM A83 (Miltenyi Biotec). TRA-1-81, SSEA-3 and SSEA-4 was detected by immunocytochemistry On day 11, the hiPSC medium was changed to Neurobasal medium (Fig. 1 B1-F4) and the expression of OCT4, SOX2 and NANOG tran- (Thermo Fisher) with 2% B27, 2 mM Glutamax, 0.02 mM ascorbic acid scription factors was confirmed by RT-qPCR (Fig. 1G. These lines pre- (Sigma-Aldrich), 0.05 mM cAMP (Sigma-Aldrich), 20 ng/mL BDNF sented a normal karyotype (analyzed at passages 9–16): 46, XX for (Peprotech), 20 ng/mL GDNF (Peprotech) and 1 ng/mL TGFβ-3 hiPSCs from female donors (Fig. 1H-J) and 46, XY for hiPSCs derived (Peprotech). For mesodermal differentiation, 0.01 mM ascorbic acid from a male donor (Fig. 1K. To demonstrate the pluripotency of the was added to the medium. For endodermal differentiation, no growth hiPSC lines, we produced embryoid bodies, which were differentiated factors or small molecules were added. All cultures were fixed on days using three protocols to promote the generation of cells typical of the 16–17. three germ layer lineages: endoderm, mesoderm and ectoderm. Positive immunostaining with specific antibodies to alpha-feto protein (AFP; an Immunocytochemistry endodermal marker), DESMIN (a mesodermal marker) and PAX6 and β- III-TUBULIN/TUJ1 (two ectodermal markers) (Fig. 1 L1-O4) supported Immunofluorescence staining was performed following our stan- that all our hiPSC lines were truly pluripotent. Notably, the presence of dard procedures (Vergaño-Vera et al., 2015) using specific primary and the SeV genomeFig. 1P) and of the four reprogramming factors (Sup- secondary antibodies (Table 3). Cells were imaged on a Leica SP-5 plementary Fig. 1 A) was not detected after 5–10 passages by RT-PCR, confocal microscope. indicating that these hiPSC lines were integration-free. The presence of GBA1 mutations in the iPSCs was confirmed using RT-qPCR Sequenom MassArray technology. Mass spectrum from samples con- taining the N370S/wt mutation (Supplementary Fig. 1 B, C; Table 2) Total RNA was extracted from the hiPSCs and subjected to RT-qPCR displayed peaks for G and A at the expected mass (5202 and 5282, following our standard procedures (Vergaño-Vera et al., 2015) using respectively). Mass spectrum from samples having the L444P/wt mu- specific primers (Table 3. Gene expression levels were determined in tation (Supplementary Fig. 1 D, E; Table 2) showed peaks for C and T at triplicate in samples from three experiments and normalized versus the expected mass (5155 and 5232). These results confirm that the GAPDH levels. GBA1 mutations carried by the PD patients were maintained in the corresponding hiPSCs. Additionally, all the cells were free from myco- Sendai virus and transgene detection plasma (Supplementary Fig. 1. F; Table 2). Finally, short tandem repeat (STR) analysis of 10 different genomic loci demonstrated that the Total RNA (500 ng) was used for RT-PCR analysis using the fol- parental fibroblasts and the corresponding hiPSC lines shared all the lowing PCR conditions: 1 min 45 s at 95 °C, 45 s at 95 °C, 45 s at 2 E. Rodríguez-Traver, et al. Stem Cell Research 38 (2019) 101482 Fig. 1. Characterization of iPSCs derived from Parkinson´s disease patients. 3 E. Rodríguez-Traver, et al. Stem Cell Research 38 (2019) 101482 Table 2 Characterization and validation. Classification Test Result Data Morphology Photography Visual record of the lines: normal iPSC morphology Fig. 1 A1-A4 Phenotype Qualitative analysis: Immunocytochemistry Positive expression of pluripotency markers: NANOG, TRA- Fig. 1 B1-F4 1-60, TRA-1-81, SSEA-3 and SSEA-4 Quantitative analysis: RT-qPCR Positive expression of OCT4, SOX2 and NANOG Fig. 1 G transcription factors Genotype Karyotype (G-banding) and resolution N370S-PD1: 46, XX Fig. 1H-K N370S-PD2: 46, XX L444P-PD3: 46, XX L444P-PD4: 46, XY Resolution 450–500 Identity Microsatellite PCR (mPCR) OR STR analysis of DNA Profiling performed N/A fibroblasts and iPSCs 10 sites tested, identity verified (100% match). Submitted in archive with journal Mutation analysis Sequencing Heterozygous mutations in GBA1. Supplementary Fig. 1 B-E N370S-PD1: A > G (p.Asn409Ser) N370S-PD2: A > G (p.Asn409Ser) L444P-PD3: T > C (p.Leu483Pro) L444P-PD4: T > C (p.Leu483Pro) Southern Blot OR WGS N/A N/A Microbiology and virology Mycoplasma Mycoplasma testing by PCR: Negative Supplementary Fig. 1 F Differentiation potential Embryoid body formation followed by directed Proof of three germ layers formation by positive Fig. 1 L1-O4 differentiation immunostaining for AFP, DESMIN, PAX6 and ß-III- TUBULIN Donor screening (OPTIONAL) HIV 1 + 2 Hepatitis B, Hepatitis C N/A N/A Genotype additional info Blood group genotyping N/A N/A (OPTIONAL) HLA tissue typing N/A N/A 55–60 °C, 1 min at 72 °C (35 cycles), 5 min at 72 °C (primers listed in Mycoplasma detection Table 3). Mycoplasma testing in the culture medium was performed using Karyotyping Mycoplasma Detection Kit (SoutherBiotech). The iPSCs were treated with 10 μg/mL Colcemid (Irvine Scientific) (2 h at 37 °C) and incubated with Trypsin-EDTA (Euroclone) 10 min at Short tandem repeat (STR) analysis 37 °C. Hypotonic treatment was carried out with 0.075 M KCl (30 min at 37 °C) and cells were fixed with methanol/acetic acid (3: 1). Cells were DNAs of parental fibroblasts and iPSC lines were analyzed at the dropped on a microscope slide and metaphases were G-banded with Genomics Unit of CNIO-ISCIII (Madrid, Spain). Nine STR loci plus the Wright stain. At least 10 to 20 metaphases were counted and structu- Amelogenin (AMEL) locus for gender determination were PCR ampli- rally evaluated (sensitivity, 450 to 500 bands per haploid number). fied (GenePrint 10 kit; Promega). Each DNA was subsequently analyzed using an ABI Prism 3730xl Genetic Analyzer and the Osiris v2.6 soft- Genotyping ware (NIH). Supplementary data to this article can be found online at https:// GBA1 genotype was determined in DNA extracted from human fi- doi.org/10.1016/j.scr.2019.101482. broblasts and hiPSCs using Sequenom MassArray technology performed at the CEGEN-ISCIII (Santiago de Compostela, Spain). 4 E. Rodríguez-Traver, et al. Stem Cell Research 38 (2019) 101482 Table 3 Reagents details. Antibodies used for immunocytochemistry Antibody Dilution Company Cat # and RRID Pluripotency Markers Rabbit anti-NANOG 1:250 Stemgent Cat#09-0020 RRID:AB_2298294 Rat anti-SSEA-3 1:100 Stemgent Cat#09-0014 RRID:AB_1512168 Mouse anti-SSEA-4 1:100 Hybridoma Bank Cat#MC-813-70 RRID:AB_528477 Mouse anti-Tra-1-60 1:200 Stemgent Cat#09-0010 RRID:AB_1512170 Mouse anti-Tra-1-81 1:200 Stemgent Cat#09-0011 RRID:AB_1512171 Differentiation Markers Mouse anti-AFP 1:100 R&D Systems Cat#MAB1368 RRID:AB_357658 Rabbit anti-DESMIN 1:250 Lab Vision Cat#RB-9014-P0 RRID:AB_149768 Rabbit anti-PAX6 1:300 Covance Cat#PRB-278P RRID:AB_291612 Mouse anti-β-III Tubulin (TUJ1) 1:1000 Covance Cat#MMS-435P RRID:AB_2313773 Secondary antibodies Alexa Fluor 488 Goat Anti-Rabbit IgG 1:750 Thermo Fisher Scientific Cat# A-11008, RRID:AB_143165 Alexa Fluor 488 Donkey Anti-Mouse IgG 1:750 Thermo Fisher Scientific Cat# A-21202, RRID:AB_141607 Alexa Fluor488 Goat Anti-Rat IgM 1:500 Thermo Fisher Scientific Cat# A-21212, RRID:AB_2535798 Alexa Fluor 594 Donkey 1:750 Thermo Fisher Scientific Cat# A-21203, RRID:AB_2535789 Anti-Mouse IgG 1:400 Jackson ImmunoResearch Labs Texas Red Goat Anti-Mouse IgM Cat# 115-076-075, RRID:AB_2338588 Primers Target Forward/Reverse primer (5′-3′) Sendai Viral Vectors (PCR) SeV GGATCACTAGGTGATATCGAGC/ACCAGACAAGAGTTTAAGAGATATGTATC cMYC TAACTGACTAGCAGGCTTGTCG/TCCACATACAGTCCTGGATGATGATG OCT4 CCCGAAAGAGAAAGCGAACCAG/AATGTATCGAAGGTGCTCAA SOX2 ATGCACCGCTACGACGTGAGCGC/AATGTATCGAAGGTGCTCAA KLF4 TTCCTGCATGCCAGAGGAGCCC/AATGTATCGAAGGTGCTCAA Pluripotency Markers (qPCR) NANOG TCTGCTGAGATGCCTCACACGG/CACACAGCTGGGTGGAAGAGAAC OCT4 CCCCTGTCTCTGTCACCACT/TGAATGAAGAACTTAATCCCAAA SOX2 ACACTGCCCCTCTCACACAT/TCCCATTTCCCTCGTTTTT House-Keeping Genes (qPCR) GADPH AACCATGAGAAGTATGACAACAGCC/TGAGTCCTTCCACGATACCAAAGT Declaration of Competing Interest ... Moratalla, R., 2017. N370S-GBA1 mutation causes lysosomal cholesterol accu- mulation in Parkinson's disease. Mov. Disord. 32 (10), 1409–1422. https://doi.org/ 10.1002/mds.27119. The authors declare no conflict of interest. García-Sanz, P., Orgaz, L., Fuentes, J.M., Vicario, C., Moratalla, R., 2018. Cholesterol and multilamellar bodies: Lysosomal dysfunction in GBA-Parkinson disease. Autophagy Acknowledgments 14 (4), 717–718. https://doi.org/10.1080/15548627.2018.1427396. Migdalska-Richards, A., Schapira, A.H., 2016. The relationship between glucocer- ebrosidase mutations and Parkinson disease. J. Neurochem. 139 (Suppl. 1), 77–90. We thank Drs. Marta Martínez and Miquel Vila for sharing with us https://doi.org/10.1111/jnc.13385. PD4 fibroblasts. We also thank Mª José Román for technical assistance. Seto-Salvia, N., Pagonabarraga, J., Houlden, H., Pascual-Sedano, B., Dols-Icardo, O., Tucci, A., ... Clarimon, J., 2012. Glucocerebrosidase mutations confer a greater risk of This work was funded by grants from the Spanish Ministerio de dementia during Parkinson's disease course. Mov. Disord. 27 (3), 393–399. https:// Economía y Competitividad (MINECO: SAF2013-47596-R and doi.org/10.1002/mds.24045. CIBERNED CB06/05/0065) to C.V., from CIBERNED CB06/05/0055 to Vergaño-Vera, E., Díaz-Guerra, E., Rodríguez-Traver, E., Méndez-Gómez, H.R., Solís, O., Pignatelli, J., ... Vicario-Abejón, C., 2015. Nurr1 blocks the mitogenic effect of FGF-2 R.M, from CIBERNED CB06/05/0041 to J.K., and from Fundación and EGF, inducing olfactory bulb neural stem cells to adopt dopaminergic and do- Ramón Areces (CIVP18A3941) to C.V. and R.M. E.R.-T. was supported paminergic-GABAergic neuronal phenotypes. Dev. Neurobiol. 75 (8), 823–841. by a FPI Fellowship from the MINECO. https://doi.org/10.1002/dneu.22251. References García-Sanz, P., Orgaz, L., Bueno-Gil, G., Espadas, I., Rodríguez-Traver, E., Kulisevsky, J., 5