Stem Cell Research 40 (2019) 101578 Contents lists available at ScienceDirect Stem Cell Research journal homepage: www.elsevier.com/locate/scr Lab resource: Stem Cell Line Generation of an integration-free iPSC line, ICCSICi005-A, derived from a T Parkinson's disease patient carrying the L444P mutation in the GBA1 gene Eva Rodríguez-Travera,b, César Rodríguezc, Eva Díaz-Guerraa,b, Fabián Arenasb,d, Marcos Araúzo-Bravoe, María Orerac, Jaime Kulisevskyb,d, Rosario Moratallaa,b, Carlos Vicarioa,b, ⁎ a Instituto Cajal-Consejo Superior de Investigaciones Científicas (CSIC), Madrid, Spain b Centro de Investigación Biomédica en Red sobre Enfermedades Neurodegenerativas (CIBERNED), Madrid, Spain c Servicio de Bioquímica Clínica, Hospital General Universitario Gregorio Marañón, Madrid, Spain d Movement Disorders Unit, Neurology Dept., Hospital Sant Pau, Barcelona, Spain e Biodonostia Health Research Institute, San Sebastián, Spain ABSTRACT The L444P mutation in the GBA1 gene which encodes β-glucocerebrosidase-1, is a major risk factor for developing Parkinson's disease (PD) and dementia with Lewy bodies (DLB). We report the generation and characterization of an induced pluripotent stem cell (iPSC) line derived from a female PD patient carrying the L444P/wt mutation. The iPSC line presented a normal morphology, expressed endogenous pluripotency markers, could be differentiated into endodermal, mesodermal and ectodermal cells, was free from Sendai vectors and reprogramming factors, had a normal karyotype and maintained the original GBA1 genotype. Thus, this iPSC line can serve to establish cellular models of PD. Resource utility Sendai viral vectors expressing the transcription factors OCT4, KLF4, SOX2, and c-MYC. Three weeks after transduction, primary colonies Generating patient-specific cells bearing a specific gene mutation is were picked and expanded as clonal lines on mouse embryonic fibro- a valuable strategy for exploring mechanisms of neurodegeneration and blasts (MEFs), and the iPS cell clone ICCSICi005-A was selected for in- finding potential therapeutic treatments. The cell line reported here, depth characterization (Fig. 1; Table 1). This clonal line showed a along with our previously reported collection of iPSCs, make a unique normal iPSC morphology (flat and compact, with defined borders) by set of iPSCs for studying the role of GBA1 mutations in PD. light microscopy observation (Fig. 1A), and expressed the human pluripotency markers NANOG, TRA-1-60, TRA-1-81, SSEA-3 and SSEA- Resource details 4 as demonstrated by immunofluorescence (Fig. 1B–F) and OCT4, SOX2 and NANOG as shown by RT-qPCR (Fig. 1G) This line exhibited a Among the high number of mutations occurring in the GBA1 gene, normal karyotype (46, XX; analyzed at passage 7) (Fig. 1H). Next, the the L444P destabilizes β-glucocerebrosidase-1 structure leading to re- iPSC line was differentiated following three distinct protocols that duced enzyme activity and protein level. This mutation represents a promote the induction of endodermal, mesodermal or ectodermal strong genetic risk factor for developing PD and DLB (García-Sanz et al., lineages (see below). The positive immunostaining with specific anti- 2017; Seto-Salvia et al., 2012; García-Sanz et al., 2018; Migdalska- bodiesTable 2 against alpha-feto protein (AFP; endoderm), DESMIN Richards and Schapira, 2016). In this study, we report the generation (mesoderm) as well as PAX6 and TUJ1 (ectoderm) (Fig. 1I-L, Table 1) and characterization of an iPSC line from a female PD patient carrying confirmed the pluripotency of our iPSC line. Furthermore, the SeV the L444P/wt mutation in GBA1. genome and reprogramming transgenes were not detected by RT-PCR This human iPSC line was generated by reprogramming dermal fi- (performed in RNA from cells at passage 12), supporting that this line broblasts isolated from a skin biopsy taken from the ventral side of the was integration-free (Fig. 1M). Short tandem repeat (STR) analysis of donor's forearm. Fibroblasts were transduced with non-integrative 10 different genomic loci demonstrated that the parental fibroblasts ⁎ Corresponding author at: Instituto Cajal-Consejo Superior de Investigaciones Científicas (CSIC), Madrid, Spain. E-mail address: cvicario@cajal.csic.es (C. Vicario). https://doi.org/10.1016/j.scr.2019.101578 Received 3 June 2019; Received in revised form 28 August 2019; Accepted 11 September 2019 Available online 12 September 2019 1873-5061/ © 2019 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/). E. Rodríguez-Traver, et al. Stem Cell Research 40 (2019) 101578 Fig. 1.. Characterization of an iPSC line carrying the GBA1-L444P mutation. 2 E. Rodríguez-Traver, et al. Stem Cell Research 40 (2019) 101578 Table 1 Characterization and validation. Classification Test Result Data Morphology Photography Visual record of the line: normal iPSC morphology Fig. 1A Phenotype Qualitative analysis Positive expression of pluripotency markers: NANOG, TRA- Fig. 1B-F Immunocytochemistry 1-60, TRA-1-81, SSEA-3 and SSEA-4 Quantitative analysis The iPSC line expresses OCT4, SOX2 and NANOG Fig. 1G RT-qPCR transcription factors Genotype Karyotype (G-banding) and resolution 46, XX Fig. 1H Resolution 450–500 Identity Microsatellite PCR (mPCR) OR N/A N/A STR analysis of fibroblasts and iPSC line 10 sites tested, identity verified (100% match) Submitted in archive with journal Mutation analysis (IF Sequencing Heterozygous L444P mutation in GBA1 (T > C, Supplementary Fig. 1A APPLICABLE) p.Leu483pro) Southern Blot OR WGS N/A N/A Microbiology and virology Mycoplasma Mycoplasma testing by PCR: Negative Supplementary Fig. 1C Differentiation potential Embryoid body formation followed by Proof of three germ-layers formation by positive Fig. 1I-L directed differentiation immunostaining for AFP, DESMIN, PAX6 and ß-III- TUBULIN Donor screening (OPTIONAL) HIV 1 + 2 Hepatitis B, Hepatitis C N/A N/A Genotype additional info Blood group genotyping N/A N/A (OPTIONAL) HLA tissue typing N/A N/A and the ICCSICi005-A iPSC line shared all the tested alleles with a 100% cAMP (Sigma-Aldrich), 20 ng/mL BDNF (Peprotech), 20 ng/mL GDNF match (archived at SCR journal). (Peprotech) and 1 ng/mL TGFβ-3 (Peprotech). For mesodermal differ- The presence of the L444P mutation in GBA1 was analyzed using entiation, 0.01 mM ascorbic acid was added to the hiPSC medium. For Sequenom MassArray technology. Mass spectrum from this iPSC con- endodermal differentiation, no exogenous factors were added to the taining the L444P/wt mutation (Supplementary Fig. 1A; Table 1) dis- hiPSC medium. All cultures were fixed on days 16–17. played peaks for C and T at the expected mass (5155 and 5232). These results confirm that the L444P mutation carried by the PD patient was Immunocytochemistry maintained in the corresponding iPSCs. In contrast, the mass spectra for an iPSC line derived from a healthy control carrying no GBA1 mutations Immunofluorescence staining was performed following standard shows absence of a peak for the base C (Supplementary Fig. 1B). Ad- procedures (Nieto-Estévez et al., 2013) using specific primary and ditionally, the cells were free from mycoplasma (Supplementary secondary antibodies (Table 2). Cells were imaged on a Leica SP-5 Fig. 1C; Table 1). confocal microscope. Materials and methods RT-qPCR Reprogramming of dermal fibroblasts Total RNA was extracted from the hiPSCs and subjected to RT-qPCR following standard procedures (Nieto-Estévez et al., 2013) using spe- Fibroblasts were isolated from a skin biopsy, plated at 10,000 cells/ cific primers (Table 2). Gene expression levels were determined in tri- cm2 and incubated (37 °C, 5% CO2). On day 2, they were transduced plicate in samples from three experiments and normalized versus using the using the CytoTune™ -iPS 2.0 Sendai Reprogramming Kit GAPDH levels. (Thermo-Fisher). After seven days, transduced fibroblasts were seeded on MEFs and two-three weeks later, colonies were expanded in hiPSC Sendai virus and transgene detection medium (KnockOut™ DMEM/F12, 100 μM NEAA, 2 mM glutaMAX, 55 μM ß-mercaptoethanol, 100 U/mL Penicillin/100 μl/mL, Total RNA (500 ng) was used for RT-PCR analysis using the fol- Streptomycin B, 20% KnockOut serum replacement; Thermo-Fisher). lowing PCR conditions: 1 min 45 s at 95 °C, 45 s at 95 °C, 45 s at 55–60 °C, 1 min at 72 °C (35 cycles), 5 min at 72 °C (primers listed in Embryoid body (EB) formation and three-lineage differentiation Table 2). The iPSC colonies were mechanically divided to generate EBs, Karyotyping which on day 5 were plated for initiating differentiation. For ecto- dermal differentiation, cultures were treated with 250 ng/mL Noggin The iPSCs were treated with 10 μg/mL Colcemid (Irvine Scientific; (Peprotech) and 5 μM A83 (Miltenyi-Biotec). On day 11, the hiPSC 2 h at 37 °C) and incubated with Trypsin-EDTA (Euroclone) 10 min at medium was changed to Neurobasal (Thermo Fisher) with 2% B27, 37 °C. Hypotonic treatment was carried out with 0.075 M KCl (30 min at 2 mM Glutamax, 0.02 mM ascorbic acid (Sigma-Aldrich), 0.05 mM 37 °C) and cells were fixed with methanol / acetic acid (3: 1). Cells were 3 E. Rodríguez-Traver, et al. Stem Cell Research 40 (2019) 101578 Table 2 Reagents details. Antibodies used for immunocytochemistry/flow-citometry Antibody Dilution Company Cat # and RRID Pluripotency Markers Rabbit anti-NANOG 1:250 Stemgent Cat#09–0020 RRID:AB_2298294 Rat anti-SSEA-3 1:100 Stemgent Cat#09–0014 RRID:AB_1512168 Mouse anti-SSEA-4 1:100 Hybridoma Bank Cat#MC-813-70 RRID:AB_528477 Mouse anti-TRA-1-60 1:200 Stemgent Cat#09–0010 RRID:AB_1512170 Mouse anti-TRA-1-81 1:200 Stemgent Cat#09–0011 RRID:AB_1512171 Differentiation Markers Mouse anti-AFP 1:100 R&D Systems Cat#MAB1368 RRID:AB_357658 Rabbit anti-DESMIN 1:250 Lab Vision Cat#RB-9014-P0 RRID:AB_149768 Rabbit anti-PAX6 1:300 Covance Cat#PRB-278P RRID:AB_291612 Mouse anti-β-III TUBULIN (TUJ1) 1:1000 Covance Cat#MMS-435P RRID:AB_2313773 Secondary antibodies Alexa Fluor 488 Goat Anti-Rabbit IgG 1:750 Thermo Fisher Scientific Cat# A-11008, RRID:AB_143165 Alexa Fluor 488 Donkey Anti-Mouse IgG 1:750 Thermo Fisher Scientific Cat# A-21202, RRID:AB_141607 Alexa Fluor488 Goat Anti-Rat IgM 1:500 Thermo Fisher Scientific Cat# A-21212, RRID:AB_2535798 Alexa Fluor 594 Donkey 1:750 Thermo Fisher Scientific Cat# A-21203, RRID:AB_2535789 Anti-Mouse IgG 1:400 Jackson ImmunoResearch Labs Cat# 115–076-075, RRID:AB_2338588 Texas Red Goat Anti-Mouse IgM Primers Target Forward/Reverse primer (5′-3′) Sendai Viral Vectors (PCR) SeV GGATCACTAGGTGATATCGAGC/ ACCAGACAAGAGTTTAAGAGATATGTATC KOS ATGCACCGCTACGACGTGAGCGC/ ACCTTGACAATCCTGATGTGG TTCCTGCATGCCAGAGGAGCCC/ AATGTATCGAAGGTGCTCAA KLF4 TAACTGACTAGCAGGCTTGTCG/ TCCACATACAGTCCTGGATGATGATG c-MYC Pluripotency Markers (qPCR) NANOG TCTGCTGAGATGCCTCACACGG/ CACACAGCTGGGTGGAAGAGAAC OCT4 CCCCTGTCTCTGTCACCACT/ TGAATGAAGAACTTAATCCCAAA SOX2 ACACTGCCCCTCTCACACAT/ TCCCATTTCCCTCGTTTTT House-Keeping Genes (qPCR) GADPH AACCATGAGAAGTATGACAACAGCC/ TGAGTCCTTCCACGATACCAAAGT dropped on a microscope slide and metaphases were G-banded with processing. Moreover, multiple samples can be processed at the same Wright stain. At least 10 to 20 metaphases were counted and structu- time. rally evaluated (450 to 500 bands per haploid number). Mycoplasma detection Genotyping Mycoplasma testing in the culture medium was performed using GBA1 genotype was determined in DNA extracted from human fi- Mycoplasma Detection Kit (SoutherBiotech). broblasts and hiPSCs using Sequenom MassArray IPLEX technology performed at the CEGEN-ISCIII (Santiago de Compostela, Spain). This Short tandem repeat (STR) analysis technology couples single-base extension after a PCR using ddNTPs with a MALDI-TOF mass spectrometry analysis. For a specific allele, DNAs from parental fibroblasts and the iPSC line were analyzed at differences in mass will depend on a single base (the studied one). the Genomics Unit of CNIO-ISCIII (Madrid, Spain). Nine STR loci plus Accordingly, it is a powerful tool for genotyping single nucleotide the Amelogenin (AMEL) locus for gender determination were PCR polymorphisms (SNPs) with great accuracy. Since it uses multiplex and amplified (GenePrint 10 kit; Promega). Each DNA was subsequently mass array formats it allows the analysis of several mutations in a single analyzed using an ABI Prism 3730xl Genetic Analyzer and the Osiris reaction well; thus, minimizing DNA amount, cost and time for v2.6 software (NIH). 4 E. Rodríguez-Traver, et al. Stem Cell Research 40 (2019) 101578 Key resource table Supplementary data to this article can be found online at https:// doi.org/10.1016/j.scr.2019.101578. Unique stem cell line identifier ICCSICi005-A Acknowledgments Alternative name(s) of stem cell IC-PD5-F-iPS-4F-1 line Institution Instituto Cajal- CSIC and CIBERNED, We thank Drs. Marta Martínez and Miquel Vila for sharing with us Madrid, Spain PD5 fibroblasts. We also thank Mª José Román for technical assistance. Contact information of distributor Carlos Vicario, cvicario@cajal.csic.es This work was funded by grants from the Spanish Ministerio de Type of cell line iPSC Origin Human Economía y Competitividad (MINECO: SAF2013-47596-R and Additional origin info Age: 76 CIBERNED CB06/05/0065) to C.V., from CIBERNED CB06/05/0055 to Sex: Female R.M, from CIBERNED CB06/05/0041 to J.K., and from Fundación Ethnicity: Caucasian Ramón Areces (CIVP18A3941) to C.V. and R.M. E.R.-T. was supported Cell Source Dermal fibroblasts by a FPI Fellowship from the MINECO. Clonality Clonal Method of reprogramming Non-integrative (Sendai viral vectors) ex- pressing hOCT4, hKLF4, hSOX2 and hc- Declaration of Competing Interest MYC Genetic Modification Yes The authors declare no conflict of interest. Type of Modification Hereditary Associated disease Parkinson's disease Gene/locus GBA1 / 1q22. L444P/wt mutation (exon 10) References Method of modification N/A Name of transgene or resistance N/A García-Sanz, P., Orgaz, L., Bueno-Gil, G., Espadas, I., Rodríguez-Traver, E., Kulisevsky, J., Inducible/constitutive system N/A ... Moratalla, R., 2017. N370S-GBA1 mutation causes lysosomal cholesterol accu- Date archived/stock date 11/04/2019 mulation in Parkinson's disease. Mov. Disord. 32 (10), 1409–1422. https://doi.org/ Cell line repository/bank IC-PD5-F-iPS-4F-1 10.1002/mds.27119. Banco Nacional de Líneas Celulares (BNLC, García-Sanz, P., Orgaz, L., Fuentes, J.M., Vicario, C., Moratalla, R., 2018. Cholesterol and Spanish Stem Cell Bank): http://www.isciii. multilamellar bodies: Lysosomal dysfunction in GBA-Parkinson disease. Autophagy es/ISCIII/es/contenidos/fd-el-instituto/fd- 14 (4), 717–718. https://doi.org/10.1080/15548627.2018.1427396. organizacion/fd-estructura-directiva/fd- Migdalska-Richards, A., Schapira, A.H., 2016. The relationship between glucocer- subdireccion-general-investigacion-terapia- ebrosidase mutations and Parkinson disease. J. Neurochem. 139 Suppl 1, 77–90. https://doi.org/10.1111/jnc.13385. celular-medicina-regenerativa/fd-centros- Seto-Salvia, N., Pagonabarraga, J., Houlden, H., Pascual-Sedano, B., Dols-Icardo, O., unidades/fd-banco-nacional-lineas- Tucci, A., ... Clarimon, J., 2012. Glucocerebrosidase mutations confer a greater risk of celulares/fd-lineas-celulares-disponibles/ dementia during Parkinson's disease course. Mov. Disord. 27 (3), 393–399. https:// lineas-de-celulas-iPS.shtml doi.org/10.1002/mds.24045. Ethical approval The study was approved by the Commission Nieto-Estévez, V., Pignatelli, J., Araúzo-Bravo, M.J., Hurtado-Chong, A., Vicario-Abejón, of Guarantees for the Donation and C., 2013. A global transcriptome analysis reveals molecular hallmarks of neural stem Utilization of Human Cells and Tissues, cell death, survival, and differentiation in response to partial FGF-2 and EGF depri- Instituto de Salud Carlos III (ISCIII) (ap- vation. PLos One 8 (1), e53594. proval numbers 3212701 and 4103331). Informed consent was obtained from the patient. 5