JOURNAL OF NEUROTRAUMA 36:1060–1079 (April 1, 2019) Mary Ann Liebert, Inc. DOI: 10.1089/neu.2018.5986 Sulfonylurea Receptor 1, Transient Receptor Potential Cation Channel Subfamily M Member 4, and KIR6.2: Role in Hemorrhagic Progression of Contusion Volodymyr Gerzanich,1 Jesse A. Stokum,1 Svetlana Ivanova,1 Seung Kyoon Woo,1 Orest Tsymbalyuk,1 Amit Sharma,1 Fatih Akkentli,1 Ziyan Imran,1 Bizhan Aarabi,1 Juan Sahuquillo,2,3 and J. Marc Simard1,4,5 Abstract In severe traumatic brain injury (TBI), contusions often are worsened by contusion expansion or hemorrhagic progression of contusion (HPC), which may double the original contusion volume and worsen outcome. In humans and rodents with contusion- TBI, sulfonylurea receptor 1 (SUR1) is upregulated in microvessels and astrocytes, and in rodent models, blockade of SUR1 with glibenclamide reduces HPC. SUR1 does not function by itself, but must co-assemble with either KIR6.2 or transient receptor potential cation channel subfamily M member 4 (TRPM4) to form KATP (SUR1-KIR6.2) or SUR1-TRPM4 channels, with the two having opposite effects on membrane potential. Both KIR6.2 and TRPM4 are reportedly upregulated in TBI, especially in astrocytes, but the identity and function of SUR1-regulated channels post-TBI is unknown. Here, we analyzed human and rat brain tissues after contusion-TBI to characterize SUR1, TRPM4, and KIR6.2 expression, and in the rat model, to examine the effects on HPC of inhibiting expression of the three subunits using intravenous antisense oligodeoxynucleotides (AS-ODN). Glial fibrillary acidic protein (GFAP) immunoreactivity was used to operationally define core versus penumbral tissues. In humans and rats, GFAP-negative core tissues contained microvessels that expressed SUR1 and TRPM4, whereas GFAP-positive penumbral tissues contained astrocytes that expressed all three subunits. Förster resonance energy transfer imaging demonstrated SUR1-TRPM4 heteromers in endothelium, and SUR1-TRPM4 and SUR1-KIR6.2 heteromers in as- trocytes. In rats, glibenclamide as well as AS-ODN targeting SUR1 and TRPM4, but not KIR6.2, reduced HPC at 24 h post-TBI. Our findings demonstrate upregulation of SUR1-TRPM4 and KATP after contusion-TBI, identify SUR1-TRPM4 as the primary molecular mechanism that accounts for HPC, and indicate that SUR1-TRPM4 is a crucial target of glibenclamide. Keywords: brain contusion; brain swelling; glibenclamide; hemorrhagic progression of contusion; KATP; SUR1-TRPM4; traumatic brain injury Introduction sion of contusion’’ (HPC). HPC is not simply an intracerebral he- matoma that expands from a point source, compressing normal T he most common mass lesions associated with traumatic brain injury (TBI) are hemorrhagic brain contusions (BCs), also called traumatic intracerebral hematomas, which occur in 13– brain, but instead is characterized by a progressive increase in the volume of brain undergoing hemorrhagic transformation.4,5 HPC occurs during the first few hours after trauma, and the 35% of patients following moderate-to-severe TBI.1–3 BCs remain pericontusional zone or ‘‘penumbra’’ is a key driver of this pro- a serious clinical problem because of their associated morbidity. gression. An expanding hemorrhage post-TBI may be linked to Mechanical loading (i.e., applied mechanical forces) physically coagulopathy or platelet dysfunction,6 but absent these causes, destroy brain tissues and trigger mechanosensitive processes that HPC is attributed to the catastrophic structural failure of micro- initiate secondary injury cascades in the surrounding penumbra, vessels.4,5 Dysfunction or death of microvascular endothelial most importantly, contusion expansion, or ‘‘hemorrhagic progres- cells in the penumbra results in the fragmentation of microvessels, 1 Department of Neurosurgery, 4Department of Pathology, 5Department of Physiology, University of Maryland School of Medicine, Baltimore, Maryland. 2 Neurotraumatology and Neurosurgery Research Unit, 3Department of Neurosurgery, Vall d’Hebron University Hospital, Universitat Autònoma de Barcelona, Barcelona, Spain.  Volodymyr Gerzanich et al., 2018; Published by Mary Ann Liebert, Inc. This Open Access article is distributed under the terms of the Creative Commons License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. 1060 SUR1 CHANNELS IN CONTUSION BRAIN INJURY 1061 leading to the formation of petechial hemorrhages.7 Experimental Here, we studied the expression and assembly of SUR1, TRPM4 work has shown that, as microvascular fragmentation progresses and KIR6.2 in brain tissues from humans with TBI and from a rat outward from the initial site of contusion, petechial hemorrhages model of TBI, with a particular focus on astrocyte expression of coalesce, eventually doubling the original contusion volume over these channels. To address the function of the three subunits in the course of 12 h after trauma.4 In humans with BCs, HPC occurs HPC, we studied the effects of antisense-mediated gene knock- in 50–75% of cases, hemorrhagic lesion volumes expand 50% or down of the three subunits in a rat model of contusion-TBI. Here, more with an average expansion rate of 0.7 mL per hour, and we report that, indeed, both TRPM4 and KIR6.2 are upregulated increased expansion rates are significantly associated with poor post-TBI in astrocytes of both species, where they co-assemble outcome or death.3,8,9 with SUR1 to form heteromers of SUR1-TRPM4 and SUR1- HPC is of vital clinical importance. HPC not only destroys brain KIR6.2. Also, we report that inhibiting the expression of SUR1 and tissue, but it also causes brain swelling, the strongest prognostic TRPM4, but not KIR6.2, reduces HPC post-TBI. indicator of poor outcome in TBI.10,11 In TBI, brain swelling arises from the combined space-occupying effects of extracellular edema Methods fluid, cellular swelling, extravasated blood, and other processes. Edema, which is recognized as a major contributor to brain swelling, Human tissues can be treated using osmotherapeutic agents such as mannitol and All cases were patients at the R. Adams Cowley Shock Trauma hypertonic saline. By contrast, extravasated blood, which arises from Center, Baltimore; the cases reported here are distinct from the both the initial contusion and from HPC, and which also is a major cohort from Barcelona reported earlier.13,28 The tissue collection contributor to brain swelling, currently has no clinical treatment. protocol was approved by the Institutional Review Board (IRB) of Reducing HPC could significantly impact brain swelling in BC. the University of Maryland School of Medicine. Under this IRB The ion channel regulatory subunit, sulfonylurea receptor 1 protocol, brain tissue biopsy specimens were obtained from 16 (SUR1), is strongly linked to TBI, especially BC. SUR1 protein and patients with non-ballistic, closed head injury, contusion-TBI who Abcc8 messenger RNA (mRNA), which encodes SUR1, are tran- underwent decompressive craniectomy (by BA or JMS) for ele- scriptionally upregulated at the site of injury in animal models of vated intracranial pressure29 between January 12, 2013, and August 3, 2014. All had CT scans exhibiting hemorrhagic contusions with TBI and in humans with TBI.4,12,13 SUR1 upregulation is found in mass effect. Patients were (mean – standard deviation) 48 – 20 microvascular endothelium, astrocytes, and neurons. SUR1 is held years of age, and 81% were male. The mechanism of injury was to be responsible for microvascular failure leading to edema and motor vehicle accident, pedestrian struck, or assault. Time to sur- HPC, since edema, capillary fragmentation and HPC are reduced gery was 58 – 85 h (range, 2–280) after TBI. by blocking SUR1 with glibenclamide.4,14–17 In a recent study in In each case, one or two biopsy specimens, 0.5–1 cm3, were humans, Jha and colleagues showed that the level of SUR1 in the obtained from what appeared grossly to be non-necrotic brain at the ventricular cerebrospinal fluid was a good biomarker of brain interface between contused brain and normal-appearing brain. swelling identified on the computed tomography (CT) scan.18 Also, Following biopsy, specimens were placed immediately in 4% the same group showed that ABCC8 genetic variability in patients formaldehyde for immersion fixation. Tissues were cryoprotected with TBI and regionally clustered single nucleotide polymorphisms with 30% sucrose, embedded in optimum cutting temperature (OCT) compound, frozen on dry ice, and cryosectioned (10 lm). are associated with post-traumatic brain swelling.19,20 Recently, For control tissues, five postmortem specimens were obtained pharmacological inhibition of SUR1 was shown in human clinical from three men and two women who died rapidly from non- trials to reduce brain swelling after ischemic stroke21 and to reduce neurological diseases, including pneumonia, status asthmaticus, HPC after TBI.22 and rupture of aortic aneurysm.30 The postmortem interval ranged The unique molecular biology of SUR1 has hindered a full un- from 18–74 h. The average age of control subjects was 51.3 – 7.0 derstanding of its pathological role in TBI. SUR1 is a member of years. the adenosine triphosphate (ATP) binding cassette (ABC) trans- porter superfamily. SUR1 does not function by itself but instead Antibody validation modulates the properties of distinct pore-forming ion channels by participating in heterologous co-associations. In different The custom anti-SUR1 and anti-TRPM4 antibodies used for cell types, SUR1 co-assembles either with the inwardly rectifying immunolabeling and immunoFRET in this study were validated K+ (KIR) 6.2 channel to form KATP channels,23–25 or with transient previously using lysates from appropriate SUR1 and TRPM4 ex- pression systems, tissues from wild-type, Trpm4–/– and Abcc8–/– receptor potential melastatin 4 (TRPM4) to form SUR1-TRPM4 mice, and using mass spectrometry of immunoisolated pro- channels.26 Notably, these two channels have opposite physiolog- teins,26 in accordance with recommendations for antibody val- ical effects—upon activation, KATP channels mediate K+ efflux and idation by Uhlen and colleagues.31 Here, we further validated cell hyperpolarization, whereas SUR1-TRPM4 channels mediate the specificity of the custom anti-SUR1 antibody for immuno- Na+ influx and cell depolarization. In TBI, little is known about histochemistry of human tissues by comparing immunolabeling SUR1’s potential pore-forming subunit partners. Two recent re- of adjacent sections using our custom polyclonal antibody, a ports have shed important light on this question, but these reports monoclonal antibody (S289-16; Novus Biologicals, Littleton, yielded unexpected findings: Gorse and colleagues27 reported that CO) and a commercial polyclonal antibody (sc-5789; Santa Cruz TRPM4 was upregulated in a rodent model of TBI, especially in Biotechnology, Dallas, TX). astrocytes, whereas Castro and colleagues28 reported that KIR6.2 We evaluated the suitability of three commercial anti-KIR6.2 antibodies using myc-tagged KIR6.x (myc-KIR6.2 or myc-KIR6.1) was upregulated in humans with TBI, again especially in astro- plasmids expressed in COS-7 cells. Myc-KIR6.2 and myc-KIR6.1 cytes. Given the opposite functional effects of the two channels, we plasmids were constructed as follows. Complementary DNA clones thought it important to revisit this question of astrocyte expression encoding mouse Kcnj11 (KIR6.2) and Kcnj8 (KIR6.1) were ob- of SUR1-regulated channels post-TBI. Also, given the critical role tained from Dr. Shyng (Oregon Health and Science University, of SUR1 in HPC post-TBI, we thought it important to determine Portland, OR) and DNASU Plasmid Repository (Tempe, AZ), re- which of the SUR1-regulated channels was linked to HPC. spectively, and used as templates for polymerase chain reaction 1062 GERZANICH ET AL. (PCR). The amplified PCR products were cloned into pCMV- To further validate GTX80493 specifically for immunohisto- Tag3C vector (Agilent Technologies, Santa Clara, CA) for ex- chemistry, we used it to co-localized expression of KIR6.2 protein pression of myc-KIR6.x. The myc-KIR6.x plasmids were verified and Kcnj11 mRNA in brain tissue sections from contusion-TBI by DNA sequencing prior to transfection. patients. In situ hybridization was performed for Kcnj11 mRNA, Whole–cell lysates and myc-KIR6.2 immunoprecipitates were and the same tissue section was double-immunolabeled for glial immunoblotted using anti-myc antibody (sc-40; Santa Cruz Bio- fibrillary acidic protein (GFAP) and for KIR6.2 using GTX80493 technology) or one of three anti-KIR6.2 antibodies: 1) GTX80493, (see Methods). Immunolabeling showed GFAP-expressing stellate an anti-human (N-terminus of KIR6.2), rabbit polyclonal antibody cells with prominent expression of KIR6.2, with the same cells also from GeneTex (Irvine, CA); 2) sc-11226, an anti-human (N- exhibiting Kcnj11 mRNA (Fig. 1D; asterisks). In the same field, terminus of KIR6.2) goat polyclonal antibody from Santa Cruz other cells were present, as identified by nuclear staining with 4¢,6- Biotechnology; or 3) sc-11228, an anti-human (internal region of diamidino-2-phenylindole (DAPI); these cells showed no immu- KIR6.2) goat polyclonal antibody from Santa Cruz Biotechnology. noreactivity with GTX80493, and no Kcnj11 mRNA (Fig. 1D; Anti-myc immunoblot of whole–cell lysates and of myc-KIR6.2 circles). Using a different anti-KIR6.2 antibody (APC-020; Alomone immunoprecipitate from cells transfected with empty vector yiel- Labs) that was validated previously28 confirmed astrocyte-specific ded no bands (Fig. 1A; lanes 1, 3). Anti-myc immunoblots of expression of KIR6.2 in the same tissue specimen (Fig. 1E). whole–cell lysates and myc-KIR6.2 immunoprecipitate from cells GTX80493 exhibited no immunoreactivity when used to label transfected with myc-KIR6.2 showed bands at *75 kDa, *110 kDa, control (uninjured) GFAP+ tissues (Fig. 1F). and *150 kDa (Fig. 1A; lanes 2, 4). An additional band at *38 kDa All immunohistochemistry for KIR6.2 reported in this manu- was observed in the anti-myc immunoblot of myc-KIR6.2 im- script was conducted using GTX80493. munoprecipiate (Fig. 1A; lane 4). These four bands correspond to the monomer and multimers of KIR6.2.32 Histology, immunolabeling, and immunoFRET The antibody from GeneTex yielded an immunoblot that was of human tissues nearly identical to that obtained with anti-myc antibody (Fig. 1A; lanes 5–8). GTX80493 detected all multimers of KIR6.2 (Fig. 1A; Human sections were stained with hematoxylin and eosin using lane 8). GTX80493 showed one faint nonspecific band *120 kDa routine techniques, and were examined with light microscopy. For in the absence of KIR6.2 expression (Fig. 1A; lane 5). terminal deoxynucleotidyl transferase dUTP nick end labeling The antibodies from Santa Cruz Biotechnology were evaluated (TUNEL) assay, cryosections were processed according to kit in- using only whole–cell lysates (Fig. 1B; lanes 1, 2). When used to structions (C10617; Thermo Fisher Scientific Inc.). immunoblot lysates that did not contain KIR6.2, the sc-11228 For fluorescence immunohistochemistry, cryosections were immunoblot showed many nonspecific bands (Fig. 1B; lane 3), and blocked 1 h in 2% donkey serum (D9663; Sigma-Aldrich, St. Louis, detected KIR6.2 only very poorly (Fig. 1B; lane 4). Similarly, sc- MO) and 0.2% Triton X-100. After rinsing, sections were incubated 11226 showed many nonspecific bands (Fig. 1B; lane 5), although overnight at 4C with a primary antibody: goat ant-SUR1 (1:500; it did detect all KIR6.2 multimers (Fig. 1B; lane 6). custom antibody,26 mouse monoclonal anti-SUR1 (1:100; S289- We also evaluated the ability of GTX80493 to distinguish be- 16; Novus Biologicals), goat anti-SUR1 (C-16; 1:200; sc-5789; tween KIR6.2 and KIR6.1 (both of which can be expressed by Santa Cruz Biotechnology, Santa Cruz, CA), chicken anti-TRPM4 astrocytes; see Discussion). COS7 cells were used to express myc- (1:500; custom antibody), goat anti-TRPM4 (G-20; 1:200; sc- KIR6.2 or myc-KIR6.1, as above. Immunoblot using anti-myc 27540; Santa Cruz Biotechnology), or KIR6.2 (1:100; GTX80493; antibody confirmed the expression of both (Fig. 1C). Immunoblot GeneTex, Irvine, CA). After labeling for one of the channel using GTX80493 again confirmed detection of KIR6.2 multimers, subunits, double immunolabeling was performed using either: but KIR6.1 was not detected. As noted above, GTX80493 showed CY3-conjugated, monoclonal anti-GFAP (1:500; C9205; Sigma- one faint nonspecific band *120 kDa in both the absence and Aldrich), or rabbit anti-collagen IV (1:200; ab6586; Abcam, presence of KIR6.x expression (Fig. 1C). Cambridge, MA), or mouse anti-CD68 (ED1; 1:100; MAB1435; ‰ FIG. 1. KIR6.2 antibody validation. (A) Whole–cell lysate (WL) or anti-myc immunoprecipitate (IP) were prepared from COS-7 cells transfected with myc-KIR6.2 or empty vector; immunoblot with anti-myc antibody showed no bands with expression of empty vector (lanes 1, 3), and showed KIR6.2 monomers and multimers with KIR6.2 expression (lanes 2, 4); immunoblot with GTX80493 anti- KIR6.2 antibody showed a single faint nonspecific band in WL immunoblot of empty vector (lane 5), and showed KIR6.2 monomers and multimers with KIR6.2 expression (lanes 6, 8); representative of three experiments. (B) Whole lysate was prepared from COS-7 cells transfected with myc-KIR6.2 or empty vector; immunoblot with anti-myc antibody showed no bands with expression of empty vector (lane 1), and showed KIR6.2 monomers and multimers with KIR6.2 expression (lane 2); immunoblot with sc-11228 anti-KIR6.2 antibody showed multiple nonspecific bands with expression of empty vector (lane 3), and no KIR6.2 with expression of KIR6.2 (lane 4); immunoblot with sc-11226 anti-KIR6.2 antibody showed multiple nonspecific bands with expression of empty vector (lane 5), and showed KIR6.2 multimers with expression of KIR6.2 (lane 6); representative of three experiments. (C) Whole lysate was prepared from COS-7 cells transfected with empty vector, or myc-KIR6.1 or myc-KIR6.2; immunoblot with anti-myc antibody showed no bands with expression of empty vector, and showed KIR6.1 or KIR6.2 multimers with KIR6.1 or KIR6.2 expression, as indicated; immunoblot with GTX80493 anti-KIR6.2 antibody showed a single faint nonspecific band with empty vector and with KIR6.1 expression, and showed multimers with KIR6.2 expression, as indicated; representative of three experiments. (D) Combined in situ hybridization and double immunolabeling of the same tissue section from human brain after TBI. Upper panel: superimposed double immunolabeling for KIR6.2 (GTX80493, GeneTex; green) and glial fibrillary acidic protein (GFAP; red) showed astrocytes that express KIR6.2 (asterisks); in the same field, other cells identified by 4¢,6-diamidino-2-phenylindole staining of nuclei showed no immunoreactivity for GFAP or KIR6.2 (red circles). Lower panel: in situ hybridization for Kcnj11 in the same tissue section showed positive signal within the same astrocytes that express KIR6.2 protein (asterisks), and no signal in cells that express no KIR6.2 protein (circles); representative of five experiments. (E) Double immunolabeling for KIR6.2 using APC-020 (Alomone Labs; green) and GFAP (red) in tissues from the same case as in (D) confirmed the specificity of the anti-KIR6.2 antibody, GTX80493. (F) Double immunolabeling for KIR6.2 (GTX80493, GeneTex; green; green) and GFAP (red) in control (uninjured) cortical tissue showed that GTX80493 exhibited no immunoreactivity when used to label control GFAP+ tissues. SUR1 CHANNELS IN CONTUSION BRAIN INJURY 1063 Millipore Sigma, Burlington, MA), to analyze cell-specific ex- intensity twice that of background. Controls included incubation pression. For visualization, we used fluorescent-labeled species- with pre-immune serum, when available, omission of primary appropriate secondary antibodies (1:500, Alexa Fluor 488 [green] antibodies, and testing cell-specific antibodies (anti-GFAP, anti- and Alexa Fluor 555 [red]; Invitrogen/Molecular Probes, Eugene, CD68) to assure no cross-reactivity with SUR1, TRPM4, or OR) at room temperature. Sections were cover-slipped using Pro- KIR6.2. Long Gold antifade reagent containing the nuclear stain, DAPI To demonstrate formation of SUR1-TRPM4 and SUR1-KIR6.2 (Invitrogen). Immunolabeled sections were visualized using epi- heteromers, we performed antibody-based Förster Resonance En- fluorescence microscopy (Nikon Eclipse 90i; Nikon Instruments ergy Transfer (immunoFRET),33 using methods we described.26,34,35 Inc., Melville, NY). Specific labeling was defined as fluorescence To study SUR1-TRPM4 heteromers, we used rabbit anti-SUR1 1064 GERZANICH ET AL. (1:200; custom antibody) and goat anti-TRPM4 (G-20; 1:200; sc- Finally, slides were rinsed in distilled H2O and then were im- 27540; Santa Cruz Biotechnology) primary antibodies, along with munolabeled for the corresponding protein using a fluorescent donkey anti-rabbit CY5 (1:100) and mouse anti-goat CY3 (1:100) secondary antibody, as above. (the Jackson Laboratory) secondary antibodies. To study SUR1- KIR6.2 heteromers, we used goat anti-SUR1 (1:400; custom Rat experiments antibody) and rabbit anti-KIR6.2 (1:50: GTX80493; Genetex) primary antibodies, along with donkey anti-rabbit CY5 (1:100) Ethics statement. We certify that all applicable institutional and mouse anti-goat CY3 (1:100; the Jackson Laboratory) sec- and governmental regulations concerning the ethical use of animals ondary antibodies. Sections were first immunolabeled using a were followed during the course of this research. Animal exper- mixture of the two primary antibodies, with incubation performed iments were performed under a protocol approved by the Institu- overnight at 4C. After washing with phosphate-buffered saline tional Animal Care and Use Committee of the University of (PBS), the sections were incubated with a mixture of the two Maryland School of Medicine, and in accordance with the relevant secondary antibodies for 1 h, rinsed and cover-slipped. FRET guidelines and regulations as stipulated in the United States Na- fluorescence imaging was analyzed on a commercial laser scan- tional Institutes of Health Guide for the Care and Use of Laboratory ning microscope combination system, LSM510 Meta (Zeiss, Jena, Animals. All efforts were made to minimize the number of animals Germany) with an Axiovert inverted microscope and a 63 · oil used and their suffering. immersion lens. The following settings were used throughout the experiments: for Cy3, excitation, 543 nm; detection, 565–615 nm; Subjects and surgical procedure for contusion-TBI. Male for Cy5, excitation, 633 nm; detection, 650–704 nm. The images Wistar rats, ages 12–16 weeks (325–400 g; Harlan, Indianapolis, were captured and processed with the LSM Image Examiner IN), were anesthetized (60 mg/kg ketamine plus 7.5 mg/kg xyla- software (Zeiss), with an integration time of 5 msec/pixel. ROIs zine, intraperitoneally) and allowed to breathe room air spontane- were three rectangles, 225 · 180 lm, positioned within GFAP+ ously. Core temperature was maintained at 37C with an isothermal tissues. Controls studied here included omission of primary an- pad (Deltaphase; Braintree Scientific, Braintree, MA). Oxygen tibodies and study of uninjured control brain tissues; additional saturation and heart rate were monitored using a pulse oximeter controls for immunoFRET validation used a COS-7 cell expres- (Mouse Ox; STARR Life Sciences Corp., Oakmont, PA). Sur- sion system, as described.26 gical incision sites were prepared using iodine and alcohol, and a sterile environment was maintained throughout the procedure. Rats Immunohistochemistry analysis were mounted in a stereotactic apparatus (Stoelting Co., Wood Dale, IL). Lidocaine solution (2%) was injected prior to making an Channel subunit expression was assessed in all cases, but was incision. A midline scalp incision was made to expose the skull. A quantified only in cases with GFAP-positive specimens. Unbiased circular bone incision positioned 2 mm anterior to lambda and measurements of signal intensity within regions of interest (ROIs) 1 mm lateral to midline was made using a high-speed drill with a were obtained using NIS-Elements AR software (Nikon Instru- 1 mm diamond burr (Dremel, model 732), to create a 6-mm di- ments, Melville, NY). Images were collected from sections dou- ameter craniotomy in the left parietal region. After removing the ble immunolabeled for GFAP and SUR1 or TRPM4 or KIR6.2. bone flap, contusion-TBI was induced using a controlled cortical The GFAP channel was used to define ROIs (pixel intensity impact device (Impact One impactor system; 39463920; Leica >2 · background). The GFAP-defined ROIs were used to quantify Biosystems, Buffalo Grove, IL) with the following parameter set- astrocyte-specific expression of SUR1, TRPM4, or KIR6.2, with tings: 5 mm diameter impactor, angled 20 from vertical, 4.5 mm the % ROI calculated by dividing the number of positive pixels (> tissue displacement from the dural surface, 1 m/sec velocity, 200 msec 2 · background) for individual channel subunits by the total number dwell time. The bone flap was then repositioned and cemented in of GFAP+ pixels in the ROI. For each case, three representative place using a cyanoacrylate adhesive (Loctite 454 Prism Instant areas (410 · 325 lm ROI) were analyzed and averaged. Adhesive Gel plus Insta-Set accelerator). For analgesia, we used buprenorphine (0.05 mg/kg) 15 min before surgery then every In situ hybridization 12 h for 24 h. For in situ hybridization, cryosections were processed with digoxigenin-labeled probes against Abcc8 (antisense: 5¢-TGCA Series. Four series of rats with contusion-TBI were studied. In GGGGTCAGGGTCAGGGCGCTGTCGGTCCACTTGGCCAG series 1, five contusion-TBI rats were euthanized at each of four CCAGTA-3¢), TRPM4 (antisense: 5¢-CCGAGAGTGGAATTCCC time-points: 6, 12, 24 and 72 h, with five uninjured rats serving as GGATGAGGCGGTAACGCTGC-3¢), or KIR6.2 (antisense: 5¢-CCA controls; these rats were used for immunohistochemistry. In series TGCGCCCCCCAAAGCCAATAGTCACTTGGACCTCAAT-3¢), 2, five contusion-TBI rats received no treatment and were eutha- supplied by IDT (Skokie, IL). In situ hybridization was performed nized at 15 min to measure the hemorrhagic lesion area (primary on 10-lm sections and controls using an IsHyb In Situ Hybridiza- hemorrhage before HPC) and hemispheric swelling. In series 3, 18 tion (ISH) Kit (Biochain Institute, Inc., Newark, CA) according to contusion-TBI rats were administered either glibenclamide (nine the manufacturer’s protocol. Sections were incubated in diethyl rats) or vehicle (nine rats). In series 4, 53 contusion-TBI rats were pyrocarbonate (DEPC)–treated PBS and fixed in 4% paraformal- administered either antisense-oligodeoxynucleotide (AS-ODN) dehyde in PBS for 20 min. After being rinsed twice with DEPC- targeting a channel subunit, or scrambled ODN (Scr-ODN) or sense PBS, the slides were treated with 10 lg/mL proteinase K at 37C for ODN (SE-ODN) as control, including AS-ODN targeting SUR1 10 min. Slides were then washed in DEPC-PBS, rinsed with DEPC- (12 rats, with 10 Scr-ODN controls), TRPM4 (seven rats, with eight H2O, and prehybridized with ready-to-use prehybridization solution SE-ODN controls) or KIR6.2 (eight rats, with eight SE-ODN (BioChain Institute, Newark, CA) for 3 h at 50C. The DIG-labeled controls). Rats in series 3 and series 4, were euthanized at 24 h to probe was diluted in hybridization buffer (BioChain Institute, measure the hemorrhagic lesion area (primary hemorrhage plus Newark, CA) and applied at 4 ng/lL. Sections then were incubated secondary hemorrhage after HPC) and hemispheric swelling. at 45C for 16 h. Post-hybridization washing and immunological detection, using anti-DIG-alkaline phosphatase (AP) with NBT/ Treatments. The drug formulation for glibenclamide (#G2539; BCIP as substrates were performed as recommended by the man- Sigma) in dimethyl sulfoxide was as described.36 Treatment consisted ufacturer. AP-conjugated anti-DIG antibodies (1:100 PBS diluted, of administering a single loading dose of glibenclamide (10 lg/kg) or BioChain Institute, Newark, CA), were incubated with slides for 2 h. an equivalent volume of vehicle intraperitoneally within 10 min of SUR1 CHANNELS IN CONTUSION BRAIN INJURY 1065 trauma, as well as continuous infusion via mini-osmotic pump (Alzet antibody),26 chicken anti-TRPM4 (1:500; custom antibody), goat 2001, 1.0 lL/h; Alzet Corp, Cupertino, CA) beginning at the end of anti-TRPM4 (G-20; 1:200; sc-27540; Santa Cruz Biotechnology), surgery, resulting in delivery of 400 ng/h or an equivalent volume of or KIR6.2 (1:100; GTX80493; GeneTex, Irvine, CA). After la- vehicle subcutaneously until euthanasia. The dose of glibenclamide beling for one of the channel subunits, double immunolabeling was used here has been shown to not result in hypoglycemia. performed using either: CY3-conjugated, monoclonal anti-GFAP Anti-SUR1 (5¢-GGCCGAGTGGTTCTCGGT-3¢) and anti- (1:500; C9205; Sigma-Aldrich), or monoclonal anti-RECA TRPM4 (5’-TTGTGGTAACACTCTCCAAA-3¢) AS-ODNs were (MA1-81510; 1:100; HIS52; Invitrogen, ThermoFisher Scientific, described and validated previously in rats in vivo.37–39 These AS- Waltham, MA), or mouse anti-CD68 (ED1; 1:100; MAB1435; ODNs were shown to result in >60% suppression of protein ex- Millipore Sigma), to analyze cell specific expression. Secondary pression as well as highly significant reductions in progressive antibodies and subsequent image processing, as well as TUNEL hemorrhagic necrosis in a contusion spinal cord injury model. Anti- labeling were performed as above. KIR6.2 (5¢-CCTTTCGGGACAGCATGGCT-3¢) AS-ODN was described and validated previously in rats in vivo.40 This AS-ODN was shown to result in 80% suppression of Kcnj11 mRNA expression Statistical analysis in the basal ganglia. ODNs, which were phosphorothioated at 4 distal Data are presented as mean – SEM, unless otherwise noted. The bonds at both the 5¢ and 3¢ ends to protect against endogenous nu- treatment effect (percent reduction in hemorrhagic lesion area or cleases,41 were obtained commercially (Sigma-Aldrich). Prior to percent reduction in hemispheric swelling) was calculated as: (AV– surgery, mini-osmotic pumps (Alzet 2001D, 8 lL/h; Durect Corp.) AD)/(AV-AB)*100, where AB is area at baseline, AV is area at 24 h fitted with jugular vein catheters were loaded with ODN and primed. with vehicle/control treatment, and AD is area at 24 h with drug ODN solutions were prepared in sterile normal saline (NS; 4 mg/mL). treatment. Statistical analyses were performed using Origin Pro Immediately after trauma, the jugular vein was catheterized, a (V8; OriginLab Corp, Northampton, MA). Student’s t-test and one- loading dose of ODN (400 lg in 100 lL) was administered intra- way analysis of variance with Tukey’s honestly significant differ- venously, and the pump catheter was inserted into the vein with ence post hoc comparisons were used as appropriate. the pump implanted subcutaneously in the dorsal thorax, to obtain intravenous delivery of ODN at a rate of 32 lg /h until euthanasia, yielding a total dose delivered of *1.2 mg/24 h. Results Brain tissue specimens from 16 patients with non-ballistic Exclusions. In all series, there was no unplanned mortality, contusion-TBI who required decompressive craniectomy were first and no animal was excluded for any reason. immunolabeled for GFAP. Since GFAP expression is reduced or absent in the core of ischemic and contusion injuries,43–45 whereas Hemorrhagic lesion area and hemispheric swelling it is upregulated in surrounding penumbral regions, we used GFAP At the designated time after trauma, rats were euthanized by an immunoreactivity to operationally classify our specimens as being intraperitoneal injection of pentobarbital (> 100 mg/kg), then un- GFAP-negative, likely from core regions, or GFAP-positive, likely derwent transcardial perfusion with NS (60 mL) followed by 10% from penumbral regions. In eight cases, GFAP labeling was absent neutral buffered formalin (50 mL; Sigma-Aldrich). Immediately or near-absent in all specimens, and in most of these, there was after perfusion-fixation, brains were harvested and bisected cor- widespread TUNEL labeling indicative of severe cellular damage, onally at the contusion epicenter using a pre-chilled (-20C) rat consistent with these specimens originating from potentially non- brain coronal matrix (Ted Pella Inc., Redding, CA). The exposed viable core regions. In the other eight cases, GFAP immunolabeling coronal faces were imaged on a flatbed scanner to obtain high was prominent in most of the specimens, with modest or no TUNEL resolution digital images (red-green-blue [RGB]; 600 dpi). To obtain unbiased measurements of hemorrhagic lesion area, labeling, consistent with these specimens originating from or con- we used an algorithm-based segmentation protocol similar to what taining viable penumbral tissues. In one of the GFAP-positive cases, we used previously for TTC-stained sections after ischemia,42 two specimens were obtained, with one specimen showing robust taking into account that the colors red and white have opposite GFAP immunoreactivity and the other specimen from the same biological meaning in the two scenarios. NIS-Elements AR soft- patient being GFAP-negative (Fig. 2), illustrating the dichotomous ware (Nikon Instruments, Melville, NY) was used to process the nature of GFAP immunoreactivity in contusion specimens. RGB images. The quadrant that included cortex, corpus callosum and hippocampus with normal-appearing brain surrounding the contusion was outlined manually. The hemorrhagic lesion area GFAP-negative human specimens within this quadrant was determined, based on pixel intensities GFAP-negative specimens were immunolabeled for SUR1. Half identified by a histogram of the green channel (dark pixels depict of the GFAP-negative specimens also were negative for SUR1. The blood; brighter pixels depict normal brain). The percent hemor- rhagic lesion was calculated based on the hemorrhagic lesion area other GFAP-negative specimens showed prominent SUR1 ex- and the area of the manually traced ipsilateral hemisphere. The pression, which was markedly greater compared with control tis- percent hemispheric swelling was calculated based on the areas of sues (Fig. 3A). Structures that were immunopositive for SUR1 the manually traced ipsilateral and contralateral hemispheres. This consisted of elongated structures, likely microvessels, as well as unbiased method of segmentation for determining the hemorrhagic small round cells (Fig. 3A). lesion area was validated in a subset of images by two investigators Double immunolabeling for collagen IV, which identifies the (ZI, JAS), blinded to treatment group, who independently traced the basal lamina of microvessels, and for SUR1 or TRPM4 or KIR6.2, hemorrhagic area manually on full color RGB images. HPC is showed expression of SUR1 and TRPM4 in microvessels (Fig. 3B, defined as the increase in hemorrhagic lesion area at 24 h compared 3C). Immunolabeling for CD68 showed that most of the small with 15 min after trauma. round cells were microglia/macrophages. Double immunolabeling for CD68 and SUR1 or TRPM4 or KIR6.2 showed expression of the Immunolabeling and TUNEL staining of rat tissues three channel subunits in microglia/macrophages (Fig. 3D-F).28 For rat tissues, cryosections were immunolabeled as above using Double immunolabeling showed that SUR1 and TRPM4 were co- the following primary antibodies: goat ant-SUR1 (1:500; custom localized in both microvessels and small round cells (Fig. 3G), and 1066 GERZANICH ET AL. or absent in microvessels or microglia/macrophages (Fig. 4B). SUR1 expression in occasional non-GFAP-positive cells, some of which may have been neurons or microglia/macrophages,13 was not studied in these specimens. GFAP-positive cells that expressed SUR1 protein also expressed ABCC8 mRNA (Fig. 4B). Immunolabeling with two other anti- SUR1 antibodies, a monoclonal (S289-16; Novus Biologicals) and a commercial polyclonal (sc-5789; Santa Cruz Biotechnology), yielded images similar to those obtained with the custom anti- SUR1 antibody (Fig. 4C). Quantification using GFAP as the region of interest confirmed that SUR1 was significantly upregulated in penumbral astrocytes post-TBI (Fig. 4D). Like SUR1, TRPM4 was minimally expressed in control cortical tissues, but was upregulated in GFAP-positive penumbral speci- mens (Fig. 5A), similar to that reported in diffuse TBI.27 Double immunolabeling with GFAP showed that TRPM4 expression was prominent in astrocytes, and could also be observed in small round cells (Fig. 5B). GFAP-positive cells that expressed TRPM4 protein also expressed TRPM4 mRNA, as did some small round cells (Fig. 5B). Co-immunolabeling showed that astrocytes that labeled positive for TRPM4 also labeled positive for SUR1 (Fig. 5C), and FRET experiments showed that TRPM4 and SUR1 formed het- eromers of SUR1-TRPM4 (Fig. 5D). Quantification using GFAP as the region of interest confirmed that TRPM4 was significantly upregulated in cortical astrocytes post-TBI (Fig. 4D). Like SUR1 and TRPM4, KIR6.2 was minimally expressed in control cortical tissues, except in occasional neurons, but was up- regulated in GFAP-positive penumbral specimens (Fig. 6A), as reported.28 Double immunolabeling with GFAP showed that KIR6.2 expression was prominent in astrocytes (Fig. 6B). KIR6.2 expression in non-GFAP-positive cells, presumably neurons, was sparse and did not differ appreciably from controls.28 GFAP- positive cells that expressed KIR6.2 protein also expressed KCNJ11 mRNA (Fig. 6B). Co-immunolabeling showed that cells that labeled positive for KIR6.2 also labeled positive for SUR1 (Fig. 6C), and FRET experiments showed that KIR6.2 and SUR1 formed heteromers of SUR1-KIR6.2 (Fig. 6D). Quantification us- ing GFAP as the region of interest confirmed that KIR6.2 was significantly upregulated in cortical astrocytes post-TBI (Fig. 4D). Double immunolabeling showed that TRPM4 and KIR6.2 were expressed in the same cells whose stellate morphology was consistent with astrocytes (Fig. 6E). Overall, qualitative assessment of the eight FIG. 2. Glial fibrillary acidic protein (GFAP) immunoreactivity GFAP-positive specimens revealed that the three subunits, SUR1, dichotomizes human contusion–traumatic brain injury (TBI) specimens. (A-C) Two sections from the same patient, stained TRPM4, and KIR6.2, tended to be upregulated in parallel in astrocytes, with hematoxylin and eosin (A) or immunolabeled for GFAP (B, that expression during the first 24 h after injury tended to be variable, C), with the latter shown at low (B) and high (C) magnification: and that later, essentially all astrocytes upregulated all three subunits. Note absence of specific immunoreactivity for GFAP in the specimen on the left vs. specific labeling of stellate-shaped cells in Channel subunit expression in rat contusion-TBI the companion specimen on the right. (case #2, 11 days post-TBI). In the rat contusion model, the lesion core identified by the hemorrhagic area in unstained sections showed markedly reduced FRET imaging showed that SUR1 and TRPM4 co-assembled to GFAP immunoreactivity45 along with markedly elevated TUNEL form SUR1-TRPM4 heteromers in microvessels (Fig. 3H). labeling (Fig. 7A, 7B), consistent with previous findings,43–45 and consistent with our rational for dichotomizing the human specimens. GFAP-positive human specimens We studied SUR1 expression in the core and penumbra as a GFAP-positive specimens were immunolabeled for SUR1. All function of time. In the core, SUR1 expression was significantly of the GFAP-positive specimens also were positive for SUR1, which increased over controls, it peaked at 6 h, remained elevated at 12 h, was markedly greater compared with control tissues (Fig. 4A), as declined at 24 h, then rose again at 72 h (Fig. 7C).4,12 During the reported.13 The most prominent structures that were immunopositive first 24 h, the primary structures within the core that labeled for for SUR1 were stellate-shaped cells (Fig. 4A). Double immunolabeling SUR1 were elongated structures, consistent with microvessels for SUR1 and GFAP or CD68 or collagen IV showed that SUR1 (Fig. 7D). However, at 72 h, labeling of microvessels was no longer expression was by far more prominent in astrocytes and minimal evident and instead, labeling was most prominent in small round FIG. 3. (A) Immunolabeling for sulfonylurea receptor 1 (SUR1) showed sparse immunoreactivity in the control specimen (CTR) vs. widespread expression in elongated structures and small round cells in a glial fibrillary acidic protein (GFAP)–negative specimen from contusion–traumatic brain injury (TBI). (B, C) Double immunolabeling for collagen IV (COLIV) (red) and SUR1 (B) or transient receptor potential cation channel subfamily M member 4 (TRPM4) (C) showed expression of SUR1 and TRPM4 in microvessels; merged images are also shown. (D-F) Double immunolabeling for CD68 (red) and SUR1 (D) or TRPM4 (E) or KIR6.2 (F) showed expression of SUR1, TRPM4 and KIR6.2 in microglia/macrophages; merged images are also shown. (G) Double immunolabeling for SUR1 (green) and TRPM4 (red) showed co-localization in a microvessel. (H) ImmunoFRET for SUR1 (red) and TRPM4 (magenta) shows co-assembly of SUR1-TRPM4 heteromers (yellow pseudocolor) in a microvessel. The findings illustrated are from the GFAP- negative specimen shown in Figure 2, left, and are representative of all GFAP-negative, SUR1-positive specimens from four cases of human contusion-TBI; (four cases with GFAP-negative specimens showed no immunoreactivity for SUR1). Case #2, 11 days post-TBI; case #3, 7 days post-TBI. 1067 FIG. 4. Glial fibrillary acidic protein (GFAP)–positive specimens from human contusion– traumatic brain injury (TBI) exhibit sulfonylurea receptor 1 (SUR1) expression in astrocytes. (A) Immunolabeling for SUR1 showed sparse immunoreactivity in the control specimen (CTR) vs. widespread expression in a GFAP-positive specimen from contusion-TBI. (B) Double immunolabeling for SUR1 (red) and GFAP (green) showed astrocyte expression of SUR1; merged images confirm co-localization (yellow); in situ hybridization of the same tissue section for Abcc8 messenger RNA showed positive signal co-localized with GFAP-positive, SUR1-expressing astro- cytes; arrowheads point to cells with all three signals. (C) Three adjacent tissue sections from a GFAP-positive specimen im- munolabeled using three different anti-SUR1 antibodies: our custom polyclonal antibody26 (ab1), a monoclonal antibody (S289-16; Novus Biologicals; ab2), and a commercial polyclonal antibody (sc-5789; Santa Cruz Biotechnology; ab3): Note comparable labeling by all three antibodies of stellate-shaped cells with good signal-to-noise ratio and minimal background labeling (case #2, 11 days post- TBI; case #5, 1 day post-TBI). (D) Quantification of SUR1, transient receptor potential cation channel subfamily M member 4 (TRPM4), and KIR6.2 expression in GFAP-positive astrocytes in TBI specimens (red) vs. controls (black); quantification performed based on GFAP-defined region of interest; scatterplots as well as box plots are shown; each symbol is from a different case; box plot symbols: small box, mean; ––, median; large box, 25th and 75th percentile; · , 1st and 99th percentile; -, max and min: Note that in controls, GFAP-positive astrocytes expressed minimal channel subunits, whereas all three channel subunits were overexpressed in GFAP-positive astrocytes in contusion-TBI specimens; **p < 0.01. The findings illustrated are representative of all GFAP-positive specimens from eight cases of human contusion-TBI. 1068 SUR1 CHANNELS IN CONTUSION BRAIN INJURY 1069 FIG. 5. Glial fibrillary acidic protein (GFAP)–positive specimens from human contusion– traumatic brain injury (TBI) exhibit transient receptor potential cation channel subfamily M member 4 (TRPM4) expression in astrocytes. (A) Immunolabeling for TRPM4 showed sparse immunoreactivity in the control specimen (CTR) vs. widespread expression in a GFAP-positive specimen from contusion-TBI (TBI). (B) Double immunolabeling for GFAP (red) and TRPM4 (green) showed astrocyte expression of TRPM4; merged images confirms co-localization (yellow); in situ hybridization of the same tissue section for Trpm4 messenger RNA showed positive signal co-localized with GFAP-positive, TRPM4-expressing astrocytes; arrowheads point to stellate-shaped cells with all three signals; asterisk denotes GFAP-negative small round cell with TRPM4 protein and mRNA. (C) Double immunolabeling showing sulfonylurea receptor 1 (SUR1; red) and TRPM4 (green) co-localization in perivascular astrocytes; merged images also shown (yellow). (D) ImmunoFRET for SUR1 (red) and TRPM4 (magenta) shows co-assembly of SUR1-TRPM4 heteromers (yellow pseudocolor) in astrocytes. The findings illustrated are representative of all GFAP-positive specimens from eight cases of human contusion-TBI. (case #2, 11 days post-TBI; case #5, 1 day post-TBI) cells (Fig. 7D). SUR1 immunolabeling of the GFAP-negative core In core tissues, double immunolabeling with RECA and SUR1 did not show any stellate-shaped cells. By contrast, SUR1 im- or TRPM4 or KIR6.2 showed microvascular expression of SUR1 munolabeling of the GFAP-positive penumbra showed numerous and TRPM4, but no convincing evidence of KIR6.2 (Fig. 8A-C). stellate-shaped cells, with these cells being the predominant cell- Double immunolabeling of core tissues showed that SUR1 and type (Fig. 7D). TRPM4 were co-localized in microvessels (Fig. 8D). 1070 GERZANICH ET AL. FIG. 6. Glial fibrillary acidic protein (GFAP)–positive specimens from human contusion- traumatic brain injury (TBI) exhibit KIR6.2 expression in astrocytes. (A) Immunolabeling for KIR6.2 showed sparse immunoreactivity in the control specimen (CTR) vs. wide- spread expression in a GFAP-positive specimen from contusion-TBI. (B) Double immunolabeling for GFAP (red) and KIR6.2 (green) showed astrocyte expression of KIR6.2; merged images confirm co-localization (yellow); in situ hybridization of the same tissue section for Kcnj11 messenger RNA showed positive signal co-localized with GFAP-positive, KIR6.2-expressing astrocytes; arrowheads point to cells with all three signals. (C) Double immunolabeling showed that KIR6.2 (red) and sulfonylurea receptor 1 (SUR1; green) were co- localized (yellow) in astrocytes. (D) ImmunoFRET for SUR1 (magenta) and KIR6.2 (red) showed co-assembly of SUR1-KIR6.2 heteromers (yellow pseudocolor) in astrocytes. (E) Double immunolabeling showed that KIR6.2 (green) and transient receptor potential cation channel subfamily M member 4 (TRPM4) (red) were co-localized in astrocytes. The findings illustrated are representative of all GFAP-positive specimens from eight cases of human contusion-TBI. (case #2, 11 days post-TBI; case #5, 1 day post-TBI) In core tissues, double immunolabeling with CD68 and SUR1 or KIR6.2, as well as TRPM4 and KIR6.2 all co-localized in astrocytes TRPM4 or KIR6.2 showed that microglia/macrophages accounted (Fig. 9D-F). for most of the small round cells, and that these cells expressed all three channel subunits (Fig. 8E-G). Glibenclamide and HPC In the penumbra, double immunolabeling with GFAP and SUR1 or TRPM4 or KIR6.2 showed that astrocytes expressed all three In the rat model, quantification of the hemorrhagic lesion area at channel subunits (Fig. 9A-C). Quantification using GFAP as the baseline (15 min) versus 24 h was used to gauge HPC. At baseline, region of interest confirmed that SUR1, TRPM4 and KIR6.2 were the hemorrhagic lesion area, reflecting the primary hemorrhage, significantly upregulated in penumbral astrocytes post-TBI (Fig. 9G). was small, whereas by 24 h, the hemorrhagic lesion area had grown Double immunolabeling showed that SUR1 and TRPM4, SUR1 and significantly (Fig. 10), reflecting the fact that the primary SUR1 CHANNELS IN CONTUSION BRAIN INJURY 1071 FIG. 7. Sulfonylurea receptor 1 (SUR1) expression in rat contusion- traumatic brain injury (TBI). (A, B) Coronal image of contusion (A) and coronal section immunolabeled for glial fibrillary acidic protein (GFAP; red) and stained for TUNEL (green; B), showing that the hemorrhagic core is largely devoid of GFAP immunoreactivity, but shows widespread TUNEL labeling; the white line in (A) depicts the output of the algorithm-based segmentation protocol used to identify the hemorrhagic lesion area (see Methods). (C, D) Quanti- fication of total SUR1 expression in core (red) vs. penumbra (blue) as a function of time post-contusion-TBI; five rats per time-point; the labels ‘‘microvessels,’’ ‘‘astrocytes,’’ and ‘‘macrophages’’ in (C) are based on high magnification views (D), showing that: 1) early in the core, SUR1 is most prominent in elongated structures consistent with microvessels; 2) later in the core, SUR1 is most prominent in small round cells; and 3) at all times in the penumbra, SUR1 is most prominent in stellate cells consistent with astrocytes. hemorrhage had undergone HPC.4 Images of the hemorrhages at AS-ODN and HPC 24 h confirmed that the increase in blood was not due to an increase in bleeding from a point source, but was dispersed throughout We used AS-ODNs to assess the functional role of the three the tissues, consistent with hemorrhagic transformation of brain channel subunits in HPC. Circulating intravascular oligonucleotides (Fig. 10B). Measurements of hemispheric volume showed that normally are excluded from the brain parenchyma by the intact hemispheric swelling was commensurate with hemorrhagic lesion blood–brain barrier (BBB),46 but TBI causes BBB disruption47 that area (Fig. 10D). Glibenclamide treatment initiated within 15 min enables delivery of circulating oligonucleotides to brain cells. after trauma yielded a hemorrhagic lesion area at 24 h that was Moreover, following central nervous system (CNS) trauma, AS- significantly less than in vehicle-treated animals, reflecting a re- ODNs may be selectively taken up by activated endothelium.39,48 duction in mean HPC by *58%. Similarly, glibenclamide treat- Within 15 min of trauma, rats were administered intravenous ment was associated with hemispheric swelling at 24 h that was AS-ODNs directed against Abcc8, Trpm4, or Kir6.2 mRNA. The significantly less than in vehicle-treated animals, with a reduction hemorrhagic lesion areas in controls for the three treatments were in mean swelling of *66%. not significantly different. Compared with controls, anti-Abcc8 and 1072 GERZANICH ET AL. FIG. 8. Glial fibrillary acidic protein (GFAP)–negative specimens from rat contusion–traumatic brain injury (TBI) exhibit sulfonylurea receptor 1 (SUR1) expression in microvessels and microglia/macrophages. (A-C) Double immunolabeling for rat endothelial cell antigen (RECA) (green) and SUR1 (A) or transient receptor potential cation channel subfamily M member 4 (TRPM4) (B) or KIR6.2 (C) at 24 h post-TBI showed expression of SUR1 and TRPM4 in microvessels; merged images are shown in the right panels (yellow). (D) Double immunolabeling for SUR1 (green) and TRPM4 (red) at 24 h post-TBI shows co-localization in microvessels. (E-G) Double immunolabeling for CD68 (green) and SUR1 (E) or TRPM4 (F) or KIR6.2 (G) at 72 h post-TBI showed expression of SUR1, TRPM4, and KIR6.2 in microglia/macrophages; merged images are also shown. The findings illustrated are representative of five specimens from rat contusion-TBI with GFAP-negative core. anti-Trpm4 AS-ODNs significantly reduced hemorrhagic lesion swelling at 24 h that was significantly less than in controls (Fig. 11), areas at 24 h, while values for the two treatments were not signif- with reductions in mean swelling of *58% and *70% by anti- icantly different from each other (Fig. 11). Assuming baseline Abcc8 and anti-Trpm4 AS-ODNs, respectively. By contrast, values comparable to those above, mean HPC was reduced *70% following administration of anti-Kir6.2 AS-ODN, hemorrhagic and *92% by anti-Abcc8 and anti-Trpm4 AS-ODNs, respectively. lesion area and hemispheric swelling at 24 h were not significantly Similarly, AS-ODN treatment was associated with hemispheric different compared with controls (Fig. 11). SUR1 CHANNELS IN CONTUSION BRAIN INJURY 1073 FIG. 9. Glial fibrillary acidic protein (GFAP)–positive specimens from rat contusion– traumatic brain injury (TBI) exhibit sulfo- nylurea receptor 1 (SUR1) expression in astrocytes. (A-C) Double immunolabeling for GFAP (green) and SUR1 (A) or transient receptor potential cation channel subfamily M member 4 (TRPM4) (B) or KIR6.2 (C) showed expression of all three channel subunits in astrocytes; merged images are shown in the right panels (yellow). (D-F) Double immunolabeling for SUR1 and TRPM4 (D), SUR1 and KIR6.2 (E), and TRPM4 and KIR6.2 (F), shows co-localization in astrocytes; merged images are shown in the right panels (yellow). (G) Expression of SUR1, TRPM4 and KIR6.2 in GFAP-positive astrocytes in TBI specimens (red) vs. controls (black); quantification performed based on GFAP-defined region of interest; scatterplots as well as box plots are shown; box plot symbols are the same as in Figure 4: Note that in controls, GFAP-positive astrocytes expressed minimal channel subunits, whereas all three channel subunits were expressed in GFAP-positive astrocytes in contusion-TBI specimens; **p < 0.01. Discussion Channel subunit expression in human contusions There are two major findings in the present report. First, indi- Dichotomizing tissues as being GFAP-positive versus GFAP- vidual subunits and heteromers of SUR1-TRPM4 and KATP negative facilitated our investigation of channel subunit expression (SUR1-KIR6.2) channels were upregulated after human TBI, in various cell types. This classification is justified by observations confirming and expanding on recent reports on SUR1 and KIR6.2 both here and previously that GFAP expression is reduced or absent expression in human TBI,13,28 and recapitulating observations on in the core of ischemic and contusion injuries,43–45 whereas it is SUR1 and TRPM4 in animal models of contusion-TBI.4,12,27 upregulated in surrounding penumbral regions. Equating GFAP Second, our data with AS-ODNs in the rat contusion model showed immunoreactivity with core versus penumbra may be a broad that SUR1-TRPM4, not KATP (SUR1-KIR6.2), accounts best for generalization, but it was useful for predicting the cell types and post-contusion HPC. Overall, our data support the hypotheses that patterns of SUR1 expression. SUR1-TRPM4 plays a crucial role in contusion-TBI, and that a In GFAP-negative core tissues, SUR1 was upregulated most primary target of glibenclamide in TBI is SUR1-TRPM4. prominently in two cell types, microvascular endothelium and 1074 GERZANICH ET AL. FIG. 10. Glibenclamide reduces hemorrhagic progression of contusion (HPC). (A-C) Images of coronal sections of brains through the epicenter, obtained in vehicle-treated animals 15 min after trauma (A) and 24 h after trauma (B), or in a glibenclamide-treated animal 24 h after trauma (C); the increase in area of brain exhibiting hemorrhagic transformation between 15 min and 24 h represents HPC. (D) Quantification of hemorrhagic lesion area (above) or hemispheric swelling (below) in vehicle-treated animals 15 min after trauma (black) and 24 h after trauma (red), or in glibenclamide-treated animals 24 h after trauma (green); 5 or 9 rats per group; box plot symbols same as in Figure 4; **p < 0.01 with respect to 15 min; ##p < 0.01 with respect to 24 h controls. CD68-positive microglia/macrophages. By contrast, in GFAP- These studies showed that KATP channels mediate neuronal hy- positive penumbral tissues, SUR1 was upregulated predominantly perpolarization, which counteracts anoxic/ischemic depolarization, in astrocytes. In specimens characterized using FRET, we found and thereby reduces neuronal death. In accord with this, KIR6.2-null evidence of SUR1-TRPM4 heteromers in microvascular endothe- mice are vulnerable to brain hypoxia, and exhibit a reduced lium, whereas both SUR1-TRPM4 and SUR1-KIR6.2 heteromers threshold for hypoxia-induced generalized seizures,52,53 while were identified in astrocytes. Cortical neurons also express SUR1 KIR6.2-overexpressing mice are protected.54 as part of KATP channels, and SUR1 in neurons previously was Whereas constitutive KIR6.2 expression by neurons is estab- reported to be increased in human TBI specimens,13 but here, we lished, KIR6.2 expression in glial cells in the normal brain is did not quantify channel subunit expression in neurons. controversial, or may depend on location. Dunn-Meynell and col- Overall, our findings in human TBI accord with observations on leagues55 reported that while various neurons in rat brain express SUR1 in human TBI by Martinez-Valverde and colleagues,13 and KIR6.2 mRNA, neither astrocytes nor oligodendrocytes express they accord with findings on SUR1 in TBI rat models reported here KIR6.2 mRNA. Conversely, Zhou and colleagues56 showed that and previously.4,12 Also, our findings on KIR6.2 accord with pre- glia in the rodent corpus callosum and cerebellar white matter (but vious observations in human TBI by Castro and colleagues,28 who not cerebral cortex) weakly express KIR6.2. In the present study, as first reported upregulation of KIR6.2, predominantly in astrocytes. well as in the report by Castro and colleagues,28 KIR6.2 was not The present study is the first to report on TRPM4 in the human brain identified in astrocytes in control human cortex. after TBI, and our findings are in accord with those reported in a Conversely, several reports indicate that astrocytes normally ex- diffuse-TBI rat model.27 press the closely related subunit KIR6.1.57,58 Moreover, recent data indicate that in disease states, there may be a dramatic increase in KIR6.2 expression in reactive protoplasmic and fibrous astrocytes, KATP whereas no such increase is observed for KIR6.1, a phenomenon that KATP channels are activated by processes associated with energy was termed ‘‘aberrant expression of KIR6.2.’’59 In both the report by deprivation (e.g., a fall in the ATP/ADP ratio). Work investigating the Castro and colleagues28 as well as here, so-called aberrant expression function of neuronal KATP channels under pathological conditions has of KIR6.2 in reactive astrocytes was identified post-TBI. Although focused primarily on their role in hypoxia or excitotoxicity.49–51 questions may remain about constitutive expression of KIR6.2 in SUR1 CHANNELS IN CONTUSION BRAIN INJURY 1075 FIG. 11. AS-ODN targeting Abcc8 and Trpm4, but not Kcnj11, reduces hemorrhagic progression of contusion (HPC). (A) Images of coronal sections of brains through the epicenter, obtained 24 h after trauma in animals administered control-ODN (CTR), Abcc8-ODN, Trpm4-ODN or Kcnj11-ODN, as indicated; arrowheads point to distinct petechial hemorrhages. (B) Quantification of hemorrhagic lesion area (above) or hemispheric swelling (below), in control-ODN-treated animals 24 h after trauma (red), and in Abcc8- or Trpm4- or Kcnj11-ODN-treated animals 24 h after trauma (blue); control-ODN was either scrambled (Scr) or sense (SE) ODN, as indicated; 7–12 rats per group; box plot symbols same as in Figure 4; **p < 0.01 with respect to control; analysis of variance revealed no statistically significant difference between the three controls, or between Kcnj11-ODN-treated animals and controls. quiescent astrocytes, upregulation of KIR6.2 in cortical reactive as- although smooth muscle cells of cerebral arteries express the var- trocytes under pathological conditions seems certain. ious subunits.60,61 Vascular smooth muscle KATP channels mediate In contrast to neurons and astrocytes, KATP channel subunits are vasodilation in response to hypoxia.62,63 essentially undetectable in endothelium of normal brain micro- The role of KATP in TBI, especially in penumbral astrocytes vessels or endothelium of the basilar and middle cerebral arteries, where KIR6.2 is strongly upregulated, remains unknown. Our 1076 GERZANICH ET AL. experiments with AS-ODN targeting KIR6.2 did not identify a role Co-expression of KATP and SUR1-TRPM4 for KIR6.2, and by inference for KATP, in brain swelling or HPC. Some cells, including astrocytes and microglia/macrophages, Given the prominent expression of KATP in penumbral astrocytes were found to express both KATP and SUR1-TRPM4 channels. As post-TBI, we infer that astrocytes do not play a substantive role in plasmalemmal channels, these two channels have opposite effects HPC. Although we cannot rule out a problem with AS-ODN entry on membrane polarization—upon activation, KATP channels me- into astrocytes in vivo in our experiments, we note that the same diate K+ efflux and cell hyperpolarization, whereas SUR1-TRPM4 AS-ODN was shown to be effective in downregulating KIR6.2 in channels mediate Na+ influx and cell depolarization. These oppo- basal ganglia neurons in vivo.40 Importantly, our negative data with site functions may not conflict, however, since the two channels are anti-KIR6.2 AS-ODN do not imply that KIR6.2 upregulation in regulated differently by intracellular ATP and calcium, which in- reactive astrocytes is without function, only that our experiments teract with the pore-forming subunit, not SUR1. KATP (SUR1- did not identify that function in TBI. Future work will examine this KIR6.2) is inhibited by ATP with an EC50 *18 lM, and the in- important question more carefully. hibitory action of ATP is counteracted by ADP,69,70 whereas SUR1-TRPM4 is inhibited by ATP with an EC50 0.8 lM, with no SUR1-TRPM4 effect of ADP.71 Moreover, of the two subunits, only TRPM4 is sensitive to intracellular calcium/calmodulin.26,71 Thus, although In animal models of contusion-TBI, blockade of SUR1 with both have the same SUR1 regulatory subunit, independent regu- glibenclamide reduces capillary fragmentation in the penumbra, lation of the two channels via the different pore-forming subunits is which is the immediate cause of HPC.4 In our previous study, we likely. Other cells also are known to express SUR1, KIR6.2, and quantified HPC based on spectrophotometric analysis of tissue TRPM4 simultaneously, including pancreatic b cells72 and neurons hemoglobin, and found that the hemoglobin content increased *2- of the arcuate nucleus.73 Notably, in pancreatic b cells, KATP and fold between baseline and 24 h, and that this increase was blunted TRPM4 function together to regulate insulin secretion,72,74 illus- by *90% by glibenclamide.4 In the present study, we quantified trating co-operative, not mutually opposed, functions. Further HPC based on the area of hemorrhagic brain visible on single study is needed to determine the subcellular localization and to coronal images for each rat, and found that the hemorrhagic area identify the complex functional interactions served by co- increased *2-fold between baseline and 24 h, and that this increase expression of KATP and SUR1-TRPM4 in reactive astrocytes and was blunted by *50% by glibenclamide. Independent studies in rat microglia/macrophages post-TBI. and mouse models of contusion-TBI that used either MRI14 or tissue hemoglobin15 reported that glibenclamide reduced hemorrhagic Brain swelling lesion volumes by *50%. A study in humans with contusion-TBI that used volumetric analysis of CT scans found that glibenclamide re- In TBI, brain swelling is directly responsible for major morbidity duced hemorrhagic lesion volumes by *80%.22 This broad concor- and death.10,11 In TBI, more so than in ischemia, it is important to dance on the robust effect of glibenclamide across independent distinguish between ‘‘brain swelling’’ and ‘‘brain edema,’’ two terms laboratories and across different species underscores the important that are occasionally conflated but are not equivalent. Whereas role of SUR1 in HPC. edema contributes to brain swelling, edema is only one of several Glibenclamide is a sulfonylurea drug that targets sulfonylurea distinct space-occupying components responsible for swelling. Brain receptors, of which three are known: SUR1, SUR2A, and SUR2B. swelling arises from the combined space-occupying effects of ex- Of these, glibenclamide exhibits the highest potency at SUR1.64 travasated blood, extracellular edema fluid, cellular swelling, vas- Here, we found that the effects of glibenclamide on HPC and brain cular engorgement, and, possibly, hydrocephalus. Extravasated swelling were closely mimicked by anti-SUR1 AS-ODN, which blood from both the initial contusion and from HPC contributes in largely eliminates involvement of SUR2A and SUR2B in HPC a major way to brain swelling. Extracellular edema fluid, which after contusion-TBI, and is consistent with glibenclamide acting via develops later via two distinct mechanisms (see below), is another SUR1, not via some off-target effect. important contributor. Cellular swelling, especially of astrocytes, We showed that the effects of blocking SUR1 are replicated may be a larger contributor to brain swelling than is usually ac- using AS-ODN directed against Trpm4. These findings establish, knowledged.27,75 Post-traumatic vascular engorgement or hyper- for the first time, that SUR1-TRPM4 is a dominant molecular emia, which is attributed to vasoparalysis or venous outflow mechanism responsible for HPC. Notably, previous work in non- obstruction, also may contribute significantly to brain swelling.76,77 TBI models also showed that suppression of SUR1 and TRPM4 Some of these processes develop rapidly, while others worsen pro- results in an essentially identical post-injury phenotype. In a contu- gressively over days. All have different underlying mechanisms, and sion spinal cord injury model, genetic suppression of either subunit is while some may be inhibitable, at least in principal, others are not. similarly effective at preventing ‘‘progressive hemorrhagic necro- In the present study, extravasated blood was found to be a major sis,’’39,48,65 a process of hemorrhagic lesion expansion in SCI that is contributor to brain swelling. The finding that glibenclamide, anti- similar to HPC in TBI. In experimental allergic encephalomyelitis, SUR1 AS-ODN and anti-TRPM4 AS-ODN reduced brain swelling genetic suppression of either subunit is similarly effective at reducing at 24 h by approximately half (Fig. 10 and Fig. 11) is best attributed inflammation and disease progression.66 In activated microglia to a treatment-related reduction in secondary hemorrhage from in vitro, pharmacological inhibition of either subunit is similarly HPC, which was of a similar magnitude. At 24 h, extravasated effective at reducing transcription of nitric oxide synthase 2.67 In blood seems to be the dominant factor responsible for brain activated astrocytes in vitro, pharmacological inhibition of either swelling in this TBI model. This finding accords with the obser- subunit is similarly effective at reducing cell swelling.68 Thus, in vation in humans that midline shift, a measure of hemispheric diverse CNS injury scenarios, the SUR1-TRPM4 channel plays a swelling, and hematoma volume are nearly co-linear.10 Notably, critical role in pathogenesis, with blockade or inhibition of either pharmacological inhibition of SUR1 was shown recently in a hu- subunit yielding a similar favorable post-injury phenotype. man clinical trial to reduce HPC after TBI.22 SUR1 CHANNELS IN CONTUSION BRAIN INJURY 1077 In TBI, edema forms via two distinct mechanisms, with the swelling.’’ J.M.S. is a member of the Board of Directors and holds distinction based on the origin of the osmotically active solute, shares in Remedy Pharmaceuticals, and is a paid consultant for either intracontusional or intravascular. The intracontusional Biogen. No support, direct or indirect, was provided to J.M.S., or component was characterized by Katayama and colleagues,78 who for this project, by Remedy Pharmaceuticals or by Biogen. For all showed that hemorrhagic/necrotic lesions in BCs have very high other authors, no competing financial interests exist. osmolarity. The increase in osmotic pressure is due to metabolic production of osmoles or the release of idiogenic osmoles from References necrotic tissues.79 The high osmolarity of the hyperosmolar core acts as a powerful force that attracts water from the perilesional 1. Graham, D.I., Adams, J.H., Nicoll, J.A., Maxwell, W.L., and Gen- brain through a compromised BBB. In this case, the causative os- narelli, T.A. (1995). The nature, distribution and causes of traumatic brain injury. Brain Pathol. 5, 397–406. molytes originate from within the contusion. This component of 2. Saatman, K.E., Duhaime, A.C., Bullock, R., Maas, A.I., Valadka, A., edema can be reduced by intravascular osmotherapies, which and Manley, G.T.; Workshop Scientific Team and Advisory Panel counteract the transport of water from the vascular compartment Members. (2008). Classification of traumatic brain injury for targeted into the tissues, but because water flux from the vascular com- therapies. J. Neurotrauma 25, 719–738. 3. Cepeda, S., Gomez, P.A., Castano-Leon, A.M., Martinez-Perez, partment cannot be specifically blocked, this component is not R., Munarriz, P.M., and Lagares, A. (2015). Traumatic intracerebral amenable to targeted pharmacological inhibition. hemorrhage: risk factors associated with progression. J. Neurotrauma The second component of edema is driven by osmotically active 32, 1246–1253. solutes, in this case ions and proteins, that are transported from 4. Simard, J.M., Kilbourne, M., Tsymbalyuk, O., Tosun, C., Caridi, J., Ivanova, S., Keledjian, K., Bochicchio, G., and Gerzanich, V. (2009). the vascular compartment into the injured brain, to form ionic Key role of sulfonylurea receptor 1 in progressive secondary hemor- and vasogenic edema. Involvement of endothelial transporters/ rhage after brain contusion. J. Neurotrauma 26, 2257–2267. co-transporters such as SUR1-TRPM4 in this process suggests that 5. Kurland, D., Hong, C., Aarabi, B., Gerzanich, V., and Simard, J.M. this component may be subject to pharmacological inhibition. In a (2012). Hemorrhagic progression of a contusion after traumatic brain rat contusion-TBI model, with an increase in brain water from 78.5 injury: a review. J. Neurotrauma 29, 19–31. 6. Maegele, M., Schochl, H., Menovsky, T., Marechal, H., Marklund, N., to 80.8%, Zweckberger and colleagues14 reported that glib- Buki, A., and Stanworth, S. (2017). Coagulopathy and haemorrhagic enclamide decreased excess water down to 80.5%, or by 15%. In a progression in traumatic brain injury: advances in mechanisms, di- mouse contusion-TBI model complicated by hypotension, with an agnosis, and management. Lancet Neurol. 16, 630–647. increase in brain water from 78.3 to 80.4%, Jha and colleagues17 7. Dietrich, W.D., Alonso, O., and Halley, M. (1994). Early microvas- reported that glibenclamide did not reduce ipsilateral excess water, cular and neuronal consequences of traumatic brain injury: a light and electron microscopic study in rats. J. Neurotrauma 11, 289–301. but that contralateral excess water, which was increased from 78.3 8. Alahmadi, H., Vachhrajani, S., and Cusimano, M.D. (2010). The to 78.6%, was eliminated by the drug. In a mouse contusion-TBI natural history of brain contusion: an analysis of radiological and model, Xu and colleagues15 reported that glibenclamide reduced clinical progression. J. Neurosurg. 112, 1139–1145. Evans blue extravasation by 35%. Glibenclamide was shown re- 9. Carnevale, J.A., Segar, D.J., Powers, A.Y., Shah, M., Doberstein, C., Drapcho, B., Morrison, J.F., Williams, J.R., Collins, S., Monteiro, K., cently in a human clinical trial to reduce brain swelling from edema and Asaad, W.F. (2018). Blossoming contusions: identifying factors after ischemic stroke,21 but a comparable effect on edema in human contributing to the expansion of traumatic intracerebral hemorrhage. J. TBI remains to be examined. In the present study, our experiments Neurosurg. 1–12. with AS-ODNs were designed explicitly to address HPC and its 10. Nelson, D.W., Nystrom, H., MacCallum, R.M., Thornquist, B., Lilja, role in hemispheric swelling, not the subsequent development of A., Bellander, B.M., Rudehill, A., Wanecek, M., and Weitzberg, E. (2010). Extended analysis of early computed tomography scans of edema. Future studies will examine the effects of AS-ODNs on traumatic brain injured patients and relations to outcome. J. Neuro- edema formation in a rat contusion-TBI model. trauma 27, 51–64. 11. Jacobs, B., Beems, T., van der Vliet, T.M., Diaz-Arrastia, R.R., Borm, Conclusion G.F., and Vos, P.E. (2011). Computed tomography and outcome in moderate and severe traumatic brain injury: hematoma volume and In humans and rats, contusion-TBI is accompanied by upregu- midline shift revisited. J. Neurotrauma 28, 203–215. lation of SUR1-TRPM4 in endothelium, astrocytes and microglia/ 12. Patel, A.D., Gerzanich, V., Geng, Z., and Simard, J.M. (2010). Glib- macrophages, and of KATP (SUR1-KIR6.2) in astrocytes and mi- enclamide reduces hippocampal injury and preserves rapid spatial learning in a model of traumatic brain injury. J. Neuropathol. croglia/macrophages, with cell-type specific expression being dif- Exp. Neurol. 69, 1177–1190. ferent in the lesion core versus the penumbra. In vivo experiments 13. Martinez-Valverde, T., Vidal-Jorge, M., Martinez-Saez, E., Castro, L., with AS-ODNs show that SUR1-TRPM4 plays a critical role in Arikan, F., Cordero, E., Radoi, A., Poca, M.A., Simard, J.M., and HPC and in early brain swelling, whereas a role for KATP in TBI has Sahuquillo, J. (2015). Sulfonylurea Receptor 1 in humans with post- traumatic brain contusions. J. Neurotrauma 32, 1478–1487. yet to be identified. 14. Zweckberger, K., Hackenberg, K., Jung, C.S., Hertle, D.N., Kiening, K.L., Unterberg, A.W., and Sakowitz, O.W. (2014). Glibenclamide Acknowledgments reduces secondary brain damage after experimental traumatic brain injury. Neuroscience 272, 199–206. J.M.S is supported by grants from the Department of Veterans 15. Xu, Z.M., Yuan, F., Liu, Y.L., Ding, J., and Tian, H.L. (2017). Affairs (I01BX002889), the Department of Defense (SCI170199), Glibenclamide attenuates blood-brain barrier disruption in adult mice the National Heart, Lung and Blood Institute (R01HL082517) and after traumatic brain injury. J. Neurotrauma 34, 925–933. the National Institute of Neurological Disorders and Stroke 16. Kochanek, P.M., Bramlett, H.M., Dixon, C.E., Dietrich, W.D., Mondello, S., Wang, K.K.W., Hayes, R.L., Lafrenaye, A., Pov- (NINDS) (R01NS060801; R01NS102589; R01NS105633); V.G. lishock, J.T., Tortella, F.C., Poloyac, S.M., Empey, P., and Shear, is supported by a grant from NINDS (NS061934). D.A. (2018). Operation brain trauma therapy: 2016 update. Mil. Med. 183, 303–312. Author Disclosure Statement 17. Jha, R., Molyneaux, B.J., Jackson, T.C., Wallisch, J., Park, S.Y., Poloyac, S.M., Vagni, V.A., Janesko-Feldman, K.L., Hoshitsuki, K., J.M.S. holds a U.S. patent (7,285,574), ‘‘A novel non-selective Minnigh, M.B., and Kochanek, P.M. (2018). Glibenclamide produces cation channel in neural cells and methods for treating brain region-dependent effects on cerebral edema in a combined injury 1078 GERZANICH ET AL. model of traumatic brain injury and hemorrhagic shock in mice. J. Sur1-Trpm4 Cation Channel Expression in Human Cerebral Infarcts. Neurotrauma 35, 2125–2135. J. Neuropathol. Exp. Neurol. 74, 835–849. 18. Jha, R.M., Puccio, A.M., Chou, S.H., Chang, C.H., Wallisch, J.S., 36. Simard, J.M., Woo, S.K., Tsymbalyuk, N., Voloshyn, O., Yurovsky, Molyneaux, B.J., Zusman, B.E., Shutter, L.A., Poloyac, S.M., V., Ivanova, S., Lee, R., and Gerzanich, V. (2012). Glibenclamide-10- Janesko-Feldman, K.L., Okonkwo, D.O., and Kochanek, P.M. (2017). h treatment window in a clinically relevant model of stroke. Transl. Sulfonylurea receptor-1: a novel biomarker for cerebral edema in Stroke Res. 3, 286–295. severe traumatic brain injury. Crit. Care Med. 45, e255–e264. 37. Simard, J.M., Chen, M., Tarasov, K.V., Bhatta, S., Ivanova, S., Mel- 19. Jha, R.M., Puccio, A.M., Okonkwo, D.O., Zusman, B.E., Park, S.Y., nitchenko, L., Tsymbalyuk, N., West, G.A., and Gerzanich, V. (2006). Wallisch, J., Empey, P.E., Shutter, L.A., Clark, R.S., Kochanek, P.M., and Newly expressed SUR1-regulated NC(Ca-ATP) channel mediates Conley, Y.P. (2017). ABCC8 single nucleotide polymorphisms are as- cerebral edema after ischemic stroke. Nat. Med. 12, 433–440. sociated with cerebral edema in severe TBI. Neurocrit. Care 26, 213–224. 38. Simard, J.M., Tsymbalyuk, O., Ivanov, A., Ivanova, S., Bhatta, S., 20. Jha, R.M., Koleck, T.A., Puccio, A.M., Okonkwo, D.O., Park, S.Y., Geng, Z., Woo, S.K., and Gerzanich, V. (2007). Endothelial sulfo- Zusman, B.E., Clark, R.S.B., Shutter, L.A., Wallisch, J.S., Empey, nylurea receptor 1-regulated NC Ca-ATP channels mediate progres- P.E., Kochanek, P.M., and Conley, Y.P. (2018). Regionally clustered sive hemorrhagic necrosis following spinal cord injury. J. Clin. Invest. ABCC8 polymorphisms in a prospective cohort predict cerebral oe- 117, 2105–2113. dema and outcome in severe traumatic brain injury. J. Neurol. Neu- 39. Gerzanich, V., Woo, S.K., Vennekens, R., Tsymbalyuk, O., Iva- rosurg. Psychiatry pii, jnnp-2017-317741. nova, S., Ivanov, A., Geng, Z., Chen, Z., Nilius, B., Flockerzi, V., 21. Sheth, K.N., Elm, J.J., Molyneaux, B.J., Hinson, H., Beslow, L.A., Freichel, M., and Simard, J.M. (2009). De novo expression of Sze, G.K., Ostwaldt, A.C., Del Zoppo, G.J., Simard, J.M., Jacobson, Trpm4 initiates secondary hemorrhage in spinal cord injury. Nat. S., and Kimberly, W.T. (2016). Safety and efficacy of intravenous Med. 15, 185–191. glyburide on brain swelling after large hemispheric infarction 40. Lamensdorf, I., Meiri, N., Harvey-White, J., Jacobowitz, D.M., and (GAMES-RP): a randomised, double-blind, placebo-controlled phase Kopin, I.J. (1999). Kir6.2 oligoantisense administered into the globus 2 trial. Lancet Neurol. 15, 1160–1169. pallidus reduces apomorphine-induced turning in 6-OHDA hemi- 22. Khalili, H., Derakhshan, N., Niakan, A., Ghaffarpasand, F., Salehi, M., parkinsonian rats. Brain Res. 818, 275–284. Eshraghian, H., Shakibafard, A., and Zahabi, B. (2017). Effects of oral 41. Galderisi, U., Cascino, A., and Giordano, A. (1999). Antisense oli- glibenclamide on brain contusion volume and functional outcome of gonucleotides as therapeutic agents. J. Cell. Physiol. 181, 251–257. patients with moderate and severe traumatic brain injuries: a ran- 42. Simard, J.M., Yurovsky, V., Tsymbalyuk, N., Melnichenko, L., Iva- domized double-blind placebo-controlled clinical trial. World Neu- nova, S. and Gerzanich, V. (2009). Protective effect of delayed rosurg. 101, 130–136. treatment with low-dose glibenclamide in three models of ischemic 23. Noma, A. (1983). ATP-regulated K+ channels in cardiac muscle. stroke. Stroke 40, 604–609. Nature 305, 147–148. 43. Liu, D., Smith, C.L., Barone, F.C., Ellison, J.A., Lysko, P.G., Li, K., and 24. Bryan, J., Munoz, A., Zhang, X., Dufer, M., Drews, G., Krippeit- Simpson, I.A. (1999). Astrocytic demise precedes delayed neuronal death Drews, P., and Aguilar-Bryan, L. (2007). ABCC8 and ABCC9: ABC in focal ischemic rat brain. Brain research. Mol. Brain Res. 68, 29–41. transporters that regulate K+ channels. Pflugers Arch. 453, 703–718. 44. Zhao, X., Ahram, A., Berman, R.F., Muizelaar, J.P., and Lyeth, B.G. 25. Aittoniemi, J., Fotinou, C., Craig, T.J., de Wet, H., Proks, P., and (2003). Early loss of astrocytes after experimental traumatic brain Ashcroft, F.M. (2009). Review. SUR1: a unique ATP-binding cassette injury. Glia 44, 140–152. protein that functions as an ion channel regulator. Philos. Trans. R. 45. Abu Hamdeh, S., Shevchenko, G., Mi, J., Musunuri, S., Bergquist, J., Soc. Lond. B Biol. Sci. 364, 257–267. and Marklund, N. (2018). Proteomic differences between focal and 26. Woo, S.K., Kwon, M.S., Ivanov, A., Gerzanich, V., and Simard, J.M. diffuse traumatic brain injury in human brain tissue. Sci. Rep. 8, 6807. (2013). The sulfonylurea receptor 1 (Sur1)-transient receptor potential 46. Vinogradov, S.V., Batrakova, E.V., and Kabanov, A.V. (2004). Na- melastatin 4 (Trpm4) channel. J. Biol. Chem. 288, 3655–3667. nogels for oligonucleotide delivery to the brain. Bioconjug. Chem. 15, 27. Gorse, K., Lantzy, M.K., Lee, E.D., and Lafrenaye, A.D. (2018). 50–60. Trpm4 induces astrocyte swelling but not death after diffuse traumatic 47. Baskaya, M.K., Rao, A.M., Dogan, A., Donaldson, D., and Dempsey, brain injury. J. Neurotrauma 15 Jul 2018; Epub ahead of print. R.J. (1997). The biphasic opening of the blood-brain barrier in the 28. Castro, L., Noelia, M., Vidal-Jorge, M., Sanchez-Ortiz, D., Gandara, cortex and hippocampus after traumatic brain injury in rats. Neurosci. D., Martinez-Saez, E., Cicuendez, M., Poca, M.A.D., Simard, J.M., Lett. 226, 33–36. and Sahuquillo, J. (2018). Kir6.2, the pore-forming subunit of ATP- 48. Simard, J.M., Woo, S.K., Norenberg, M.D., Tosun, C., Chen, Z., sensitive K+ channels, is overexpressed in human post-traumatic brain Ivanova, S., Tsymbalyuk, O., Bryan, J., Landsman, D., and Gerzanich, contusions. J. Neurotrauma 2018 Jul 24; Epub ahead of print. V. (2010). Brief suppression of Abcc8 prevents autodestruction of 29. Aarabi, B., Hesdorffer, D.C., Simard, J.M., Ahn, E.S., Aresco, C., spinal cord after trauma. Sci. Transl. Med. 2, 28ra29. Eisenberg, H.M., McCunn, M., and Scalea, T. (2009). Comparative 49. Soundarapandian, M.M., Zhong, X., Peng, L., Wu, D., and Lu, Y. study of decompressive craniectomy after mass lesion evacuation in (2007). Role of K(ATP) channels in protection against neuronal ex- severe head injury. Neurosurgery 64, 927–39. citatory insults. J. Neurochem. 103, 1721–1729. 30. Mehta, R.I., Ivanova, S., Tosun, C., Castellani, R.J., Gerzanich, V., 50. Sun, H.S. and Feng, Z.P. (2013). Neuroprotective role of ATP- and Simard, J.M. (2013). Sulfonylurea receptor 1 expression in human sensitive potassium channels in cerebral ischemia. Acta Pharmacol. cerebral infarcts. J. Neuropathol. Exp. Neurol. 72, 871–883. Sin. 34, 24–32. 31. Uhlen, M., Bandrowski, A., Carr, S., Edwards, A., Ellenberg, J., 51. Szeto, V., Chen, N.H., Sun, H.S., and Feng, Z.P. (2018). The role of Lundberg, E., Rimm, D.L., Rodriguez, H., Hiltke, T., Snyder, M., and KATP channels in cerebral ischemic stroke and diabetes. Acta Phar- Yamamoto, T. (2016). A proposal for validation of antibodies. Nat. macol. Sin. 39, 683–694. Methods 13, 823–827. 52. Yamada, K., Ji, J.J., Yuan, H., Miki, T., Sato, S., Horimoto, N., Shi- 32. Yan, F.F., Lin, C.W., Cartier, E.A., and Shyng, S.L. (2005). Role of mizu, T., Seino, S., and Inagaki, N. (2001). Protective role of ATP- ubiquitin-proteasome degradation pathway in biogenesis efficiency of sensitive potassium channels in hypoxia-induced generalized seizure. {beta}-cell ATP-sensitive potassium channels. Am. J. Physiol. Cell Science 292, 1543–1546. Physiol. 289, C1351–C1359. 53. Sun, H.S., Feng, Z.P., Miki, T., Seino, S. and French, R.J. (2006). En- 33. Konig, P., Krasteva, G., Tag, C., Konig, I.R., Arens, C., and Kummer, hanced neuronal damage after ischemic insults in mice lacking Kir6.2- W. (2006). FRET-CLSM and double-labeling indirect immunofluo- containing ATP-sensitive K+ channels. J. Neurophysiol 95, 2590–2601. rescence to detect close association of proteins in tissue sections. Lab. 54. Heron-Milhavet, L., Xue-Jun, Y., Vannucci, S.J., Wood, T.L., Willing, Invest. 86, 853–864. L.B., Stannard, B., Hernandez-Sanchez, C., Mobbs, C., Virsolvy, A., 34. Tosun, C., Kurland, D.B., Mehta, R., Castellani, R.J., deJong, J.L., Kwon, and LeRoith, D. (2004). Protection against hypoxic-ischemic injury in M.S., Woo, S.K., Gerzanich, V., and Simard, J.M. (2013). Inhibition of transgenic mice overexpressing Kir6.2 channel pore in forebrain. Mol. the Sur1-Trpm4 channel reduces neuroinflammation and cognitive im- Cell. Neurosci. 25, 585–593. pairment in subarachnoid hemorrhage. Stroke 44, 3522–3528. 55. Dunn-Meynell, A.A., Rawson, N.E., and Levin, B.E. (1998). Dis- 35. Mehta, R.I., Tosun, C., Ivanova, S., Tsymbalyuk, N., Famakin, B.M., tribution and phenotype of neurons containing the ATP-sensitive K+ Kwon, M.S., Castellani, R.J., Gerzanich, V., and Simard, J.M. (2015). channel in rat brain. Brain Res. 814, 41–54. SUR1 CHANNELS IN CONTUSION BRAIN INJURY 1079 56. Zhou, M., Tanaka, O., Suzuki, M., Sekiguchi, M., Takata, K., Ka- form a heteromultimeric complex that amplifies ion/water osmotic wahara, K., and Abe, H. (2002). Localization of pore-forming subunit coupling and drives astrocyte swelling. Glia 66, 108–125. of the ATP-sensitive K(+)-channel, Kir6.2, in rat brain neurons and 69. Ammala, C., Bokvist, K., Galt, S., and Rorsman, P. (1991). Inhibition of glial cells. Brain research. Mol. Brain Res. 101, 23–32. ATP-regulated K(+)-channels by a photoactivatable ATP-analogue in 57. Zhou, M., Tanaka, O., Sekiguchi, M., Sakabe, K., Anzai, M., Izumida, mouse pancreatic beta-cells. Biochim. Biophys. Acta 1092, 347–349. I., Inoue, T., Kawahara, K., and Abe, H. (1999). Localization of the 70. Bokvist, K., Ammala, C., Ashcroft, F.M., Berggren, P.O., Larsson, O., and ATP-sensitive potassium channel subunit (Kir6. 1/uK(ATP)-1) in rat Rorsman, P. (1991). Separate processes mediate nucleotide-induced in- brain. Brain Res, Mol, Brain Res. 74, 15–25. hibition and stimulation of the ATP-regulated K(+)-channels in mouse 58. Thomzig, A., Wenzel, M., Karschin, C., Eaton, M.J., Skatchkov, S.N., pancreatic beta-cells. Proc. Biol. Sci. 243, 139–144. Karschin, A., and Veh, R.W. (2001). Kir6.1 is the principal pore- 71. Chen, M. and Simard, J.M. (2001). Cell swelling and a nonselective forming subunit of astrocyte but not neuronal plasma membrane K- cation channel regulated by internal Ca2+ and ATP in native reactive ATP channels. Mol. Cell. Neurosci. 18, 671–690. astrocytes from adult rat brain. J. Neurosci. 21, 6512–6521. 59. Griffith, C.M., Xie, M.X., Qiu, W.Y., Sharp, A.A., Ma, C., Pan, A., 72. Cheng, H., Beck, A., Launay, P., Gross, S.A., Stokes, A.J., Kinet, J.P., Yan, X.X., and Patrylo, P.R. (2016). Aberrant expression of the pore- Fleig, A., and Penner, R. (2007). TRPM4 controls insulin secretion in forming KATP channel subunit Kir6.2 in hippocampal reactive as- pancreatic beta-cells. Cell Calcium 41, 51–61. trocytes in the 3xTg-AD mouse model and human Alzheimer’s dis- 73. Hashiguchi, H., Sheng, Z., Routh, V., Gerzanich, V., Simard, J.M., ease. Neuroscience 336, 81–101. and Bryan, J. (2017). Direct versus indirect actions of ghrelin on 60. Ningaraj, N.S., Rao, M.K., and Black, K.L. (2003). Adenosine 5’- hypothalamic NPY neurons. PloS one 12, e0184261. triphosphate-sensitive potassium channel-mediated blood-brain tumor 74. Marigo, V., Courville, K., Hsu, W.H., Feng, J.M., and Cheng, H. (2009). barrier permeability increase in a rat brain tumor model. Cancer Res. TRPM4 impacts on Ca2+ signals during agonist-induced insulin se- 63, 8899–8911. cretion in pancreatic beta-cells. Mol. Cell. Endocrinol. 299, 194–203. 61. Ploug, K.B., Edvinsson, L., Olesen, J., and Jansen-Olesen, I. (2006). 75. Jayakumar, A.R., Tong, X.Y., Ruiz-Cordero, R., Bregy, A., Bethea, Pharmacological and molecular comparison of K(ATP) channels in rat J.R., Bramlett, H.M., and Norenberg, M.D. (2014). Activation of NF- basilar and middle cerebral arteries. Eur. J. Pharmacol. 553, 254–262. kappaB mediates astrocyte swelling and brain edema in traumatic 62. Santa, N., Kitazono, T., Ago, T., Ooboshi, H., Kamouchi, M., Wa- brain injury. J. Neurotrauma 31, 1249–1257. kisaka, M., Ibayashi, S., and Iida, M. (2003). ATP-sensitive potassium 76. Marmarou, A., Maset, A.L., Ward, J.D., Choi, S., Brooks, D., Lutz, channels mediate dilatation of basilar artery in response to intracel- H.A., Moulton, R.J., Muizelaar, J.P., DeSalles, A., and Young, H.F. lular acidification in vivo. Stroke 34, 1276–1280. (1987). Contribution of CSF and vascular factors to elevation of ICP 63. Jansen-Olesen, I., Mortensen, C.H., El-Bariaki, N., and Ploug, K.B. in severely head-injured patients. J. Neurosurg. 66, 883–890. (2005). Characterization of K(ATP)-channels in rat basilar and middle 77. Kelly, D.F., Kordestani, R.K., Martin, N.A., Nguyen, T., Hovda, D.A., cerebral arteries: studies of vasomotor responses and mRNA expres- Bergsneider, M., McArthur, D.L., and Becker, D.P. (1996). Hyper- sion. Eur. J. Pharmacol. 523, 109–118. emia following traumatic brain injury: relationship to intracranial 64. Fujita, A. and Kurachi, Y. (2000). Molecular aspects of ATP-sensitive hypertension and outcome. J. Neurosurg. 85, 762–771. K+ channels in the cardiovascular system and K+ channel openers. 78. Katayama, Y. and Kawamata, T. (2003). Edema fluid accumulation Pharmacol. therapeutics 85, 39–53. within necrotic brain tissue as a cause of the mass effect of cerebral 65. Simard, J.M., Woo, S.K., Aarabi, B., and Gerzanich, V. (2013). The contusion in head trauma patients. Acta Neurochir. Suppl. 86, 323–327. Sur1-Trpm4 channel in spinal cord injury. J. Spine Suppl 4. 79. Kawamata, T., Mori, T., Sato, S., and Katayama, Y. (2007). Tissue 66. Makar, T.K., Gerzanich, V., Nimmagadda, V.K., Jain, R., Lam, K., hyperosmolality and brain edema in cerebral contusion. Neurosurg. Mubariz, F., Trisler, D., Ivanova, S., Woo, S.K., Kwon, M.S., Bryan, Focus 22, E5. J., Bever, C.T., and Simard, J.M. (2015). Silencing of Abcc8 or in- hibition of newly upregulated Sur1-Trpm4 reduce inflammation and Address correspondence to: disease progression in experimental autoimmune encephalomyelitis. J. J. Marc Simard, MD, PhD Neuroinflammation 12, 210. University of Maryland 67. Kurland, D.B., Gerzanich, V., Karimy, J.K., Woo, S.K., Vennekens, School of Medicine R., Freichel, M., Nilius, B., Bryan, J., and Simard, J.M. (2016). The 22 S. Greene Street, Suite S12D Sur1-Trpm4 channel regulates NOS2 transcription in TLR4-activated microglia. J. Neuroinflammation 13, 130. Baltimore, MD 21201-1595 68. Stokum, J.A., Kwon, M.S., Woo, S.K., Tsymbalyuk, O., Vennekens, R., Gerzanich, V., and Simard, J.M. (2018). SUR1-TRPM4 and AQP4 E-mail: msimard@som.umaryland.edu