ORIGINAL RESEARCH published: 14 January 2019 doi: 10.3389/fphys.2018.01894 Supplementing Maturation Medium With Insulin Growth Factor I and Vitrification-Warming Solutions With Reduced Glutathione Enhances Survival Rates and Development Ability of in vitro Matured Vitrified-Warmed Pig Oocytes Edited by: Barbara Azevedo Pereira 1,2 , Marcio Gilberto Zangeronimo 2 , Miriam Castillo-Martín 1 , Katja Teerds, Beatrice Gadani 1,3 , Bruna Resende Chaves 1,2 , Joan Enric Rodríguez-Gil 4 , Sergi Bonet 1 Wageningen University, Netherlands and Marc Yeste 1* Reviewed by: 1 Unit of Cell Biology, Biotechnology of Animal and Human Reproduction (TechnoSperm), Department of Biology, Faculty of Fulvio Gandolfi, Sciences, Institute of Food and Agricultural Technology, University of Girona, Girona, Spain, 2 Laboratory of Animal University of Milan, Italy Physiology and Pharmacology, Department of Veterinary Medicine, Federal University of Lavras, Lavras, Brazil, 3 Department Jing Xu, of Veterinary Medical Sciences, University of Bologna, Bologna, Italy, 4 Unit of Animal Reproduction, Department of Animal Oregon Health & Science University, Medicine and Surgery, Faculty of Veterinary Medicine, Autonomous University of Barcelona, Cerdanyola del Vallès, Spain United States *Correspondence: Marc Yeste The present study sought to determine whether in vitro maturation (IVM) of pig oocytes in marc.yeste@udg.edu a medium supplemented with insulin growth factor-I (IGF-I) and subsequent vitrification with or without reduced glutathione (GSH) affect their quality and developmental Specialty section: This article was submitted to competence, and the expression of genes involved in antioxidant, apoptotic and stress Reproduction, responses. In Experiment 1, cumulus-oocyte complexes were matured in the absence a section of the journal Frontiers in Physiology or presence of IGF-I (100 ng·mL−1 ) and then vitrified-warmed with or without 2 mM Received: 22 July 2018 of GSH. Maturation rate was evaluated before vitrification, and oocyte viability, DNA Accepted: 14 December 2018 fragmentation and relative transcript abundances of BCL-2-associated X protein (BAX), Published: 14 January 2019 BCL2-like1 (BCL2L1), heat shock protein 70 (HSPA1A), glutathione peroxidase 1 (GPX1) Citation: and superoxide dismutase 1 (SOD1) genes were assessed in fresh and vitrified-warmed Pereira BA, Zangeronimo MG, Castillo-Martín M, Gadani B, oocytes. In Experiment 2, fresh and vitrified-warmed oocytes were in vitro fertilized Chaves BR, Rodríguez-Gil JE, Bonet S and their developmental competence determined. Whereas the addition of IGF-I to and Yeste M (2019) Supplementing Maturation Medium With Insulin maturation medium had no effect on oocyte maturation, it caused an increase in the Growth Factor I and survival rate of vitrified-warmed oocytes. This effect was accompanied by a concomitant Vitrification-Warming Solutions With augment in the relative transcript abundance of HSPA1A and a decrease of BAX. Reduced Glutathione Enhances Survival Rates and Development Furthermore, the addition of GSH to vitrification-warming media increased survival rates Ability of in vitro Matured at post-warming. Likewise, the action of GSH was concomitant with an increase in Vitrified-Warmed Pig Oocytes. Front. Physiol. 9:1894. the relative abundance of GPX1 and a decrease of BAX transcript. Blastocyst rates doi: 10.3389/fphys.2018.01894 of vitrified-warmed oocytes did not differ from their fresh counterparts when IGF-I Frontiers in Physiology | www.frontiersin.org 1 January 2019 | Volume 9 | Article 1894 Pereira et al. Cryotolerance of Vitrified-Warmed Porcine Oocytes and GSH were combined. In conclusion, supplementing maturation medium with 100 ng·mL−1 IGF-I and vitrification-warming solutions with 2 mM GSH improves the quality and cryotolerance of IVM pig oocytes, through a mechanism that involves BAX, GPX1 and HSPA1A expression. Keywords: growth factors, IGF-I, antioxidants, GSH, apoptosis, cryotolerance, DNA fragmentation, swine INTRODUCTION supplementation of maturation and culture media with insulin- like growth factor I (IGF-I) stimulates oocyte maturation and Cryopreservation of gametes is considered an efficient tool promotes blastocyst development in several species (Kocyigit to maintain genetic resources, contributing to research and and Cevik, 2015; Pan et al., 2015; Arat et al., 2016; Chen development of assisted reproductive technologies (Zhou and et al., 2017). In pigs, although IGF-I has been reported to Li, 2009; Galeati et al., 2011). However, cryopreservation promote the synthesis of hyaluronic acid and the expansion of causes damages to the oocyte structure, chromosomes, and cumulus cells (Nemcova et al., 2007), its role in IVM remains microtubules, including the meiotic spindle (Shi et al., 2006; unclear and has yield inconsistent results. Nevertheless, several Wu et al., 2006; Fu et al., 2009). Furthermore, cold shock studies reported that the addition of IGF-I during in vitro alters mitochondrial activity, affecting apoptosis pathways (Dai maturation and culture decreases apoptosis in bovine oocytes et al., 2015), and also induces premature extrusion of cortical (Wasielak and Bogacki, 2007; Rodrigues et al., 2016; Ascari granules, thus reducing sperm penetration and further embryo et al., 2017) and in porcine blastocysts (Wasielak et al., 2013). development (Ghetler et al., 2006). Wasielak et al. (2013) also demonstrated that adding IGF- Pig oocytes are highly sensitive to cooling and freezing due 1 at a concentration of 100 ng/ml into maturation medium to the large amount of lipids present in the cytoplasm (Galeati increases the BCL2L1:BAX transcript ratio in pig blastocysts, et al., 2011), which increase their susceptibly to oxidative stress and the increased expression of anti-apoptotic genes, such as and lipid peroxidation. Furthermore, vitrified pig oocytes have BCL2, and a decreased expression of apoptotic-related genes, higher levels of reactive oxygen species (ROS) than their fresh such as BAX, indicates higher blastocyst quality (Chen et al., counterparts (Gupta et al., 2010). As a result, developmental 2017). Finally, besides reducing apoptosis, IGF-I also enhances competence of pig oocytes is seriously affected by vitrification the expression of cold-inducible RNA-binding protein (CIRBP), (Wu et al., 2013; Santos et al., 2017). Therefore, oxidative stress which protects cells from vitrification and warming (Pan et al., during pig oocyte vitrification and warming results in DNA 2015). damage and impairs fertilization and embryonic development Against this background, the hypotheses were: (1) adding (Galeati et al., 2011; Wu et al., 2013; Spricigo et al., 2017). IVM medium with IGF-I improves the cryotolerance of Glutathione (GSH) is a ubiquitous, major non-enzymatic pig oocytes via anti-apoptotic and heat shock signaling antioxidant that plays a crucial role as a cellular protector pathways; and (2) supplementation of vitrification–warming and in the maintenance of intracellular redox status (Hansen media with GSH protects the oocyte from oxidative stress. and Harris, 2014; Trapphoff et al., 2016). Glutathione may To test these hypotheses, the present study determined be found in its reduced form (GSH) or oxidized (glutathione whether supplementing IVM medium with 100 ng/mL IGF- disulfide, GSSG), and the GSH:GSSG ratio is used to estimate I and adding 2 mM GSH to vitrification–warming media the redox state of the cell. Such a role is important for alter the viability, DNA integrity, developmental competence the protection of the oocyte against oxidative stress during of vitrified-warmed IVM pig oocytes, as well as the relative vitrification (Mari et al., 2009). GSH is synthesized throughout transcript abundance of genes involved in antioxidant (GPX1 oocyte maturation and its highest concentration is reached and SOD1), apoptotic (BAX, BCL2L1) and stress responses at the MII stage. Variations in intracellular GSH content or (HSPA1A). GSH-related GSH/GSSG redox potential (EGSH ) can induce post-ovulatory aging, compromise male pronuclear formation, augment apoptosis and impair embryonic development (Li et al., MATERIALS AND METHODS 2012). Somfai et al. (2007) showed that in vitro maturation (IVM) and cryopreservation significantly reduce overall GSH Ethics and Reagents content in pig oocytes. Supplementing maturation media with The present study was carried out after institutional GSH improves mitochondrial function and regulation of redox approval by Universidade Federal de Lavras, Brazil homeostasis (Trapphoff et al., 2016). Moreover, the addition (UFLA). All experimental protocols accomplished the of GSH to cryopreservation media stabilizes the nucleoprotein Ethical Principles of Animal Experimentation adopted structure of frozen–thawed boar spermatozoa (Yeste et al., 2014) by the Institutional Animal Care and Use Committee and increases blastocyst development of vitrified-warmed mouse Guidelines from this institution (protocol number oocytes (Moawad et al., 2017). 043/14). The composition of in vitro maturation media has strong Unless otherwise specified, all reagents were purchased from impact on oocyte quality and cryotolerance. In this regard, Sigma–Aldrich (St Louis, MO, USA). Frontiers in Physiology | www.frontiersin.org 2 January 2019 | Volume 9 | Article 1894 Pereira et al. Cryotolerance of Vitrified-Warmed Porcine Oocytes In vitro Maturation (IVM) of manipulations were performed on a hot plate at 38.5◦ C under Cumulus–Oocyte Complexes (COCs) a laminar flow hood in a room at 25◦ C. Briefly, immediately after Ovaries were collected from pre-pubertal gilts at a local abattoir in vitro maturation, presumptive maturated denuded oocytes (Frigoríficos Costa Brava, S.A.; Girona, Spain) and immediately were transferred into equilibration solution (ES) consisting of transported to the laboratory, inside an isolated recipient filled 7.5% ethylene glycol (EG) and 7.5% dimethylsulfoxide (DMSO) with physiological saline solution supplemented with 1 mg·mL−1 in a holding medium, composed of TCM-199 HEPES and kanamycin sulfate and pre-warmed at 38◦ C. Cumulus–oocyte supplemented with 20% fetal calf serum (FCS; GIBCO BRL, complexes (COCs) were obtained by aspirating 3–6 mm follicles, Invitrogen, Barcelona, Spain). After 10–15 min at 38.5◦ C, oocytes using an 8-gauge needle attached to a 10 mL disposable syringe. were transferred into 20-µL drops of vitrification solution (VS) In each replicated, approximately 50 ovaries, from 25 different consisting of holding medium supplemented with 15% EG, 15% gilts, were aspired. After follicle aspiration, the conical tubes DMSO and 0.5 M sucrose. After 30–40 s, oocytes were loaded containing the aspirated fluid were rested in a water bath at into a manufactured Cryotop device with minimum volume 38.5◦ C for 10 min. After this time, the supernatant was removed of vitrification solution and plunged immediately into liquid to produce the follicular fluid necessary for supplementation nitrogen. The entire process, from VS exposure to plunging into of the in vitro maturation media. Additionally, the pellet liquid nitrogen was completed within 60 s. containing the COCs were transferred to a Petri dish (35 mm, Vitrified oocytes were warmed by submerging Cryotop Nunc, Denmark) prefilled with 3 mL Dulbecco’s phosphate- devices directly in thawing solution (holding medium buffered saline (DPBS) containing 1 mg·mL−1 polyvinyl alcohol supplemented with 1 M sucrose) at 39◦ C. After 1 min, oocytes (PVA), and then selected under a stereomicroscope. Only COCs were transferred into dilution solution (0.5 M sucrose dissolved with complete and dense cumulus oophorus and homogenous in holding medium) for 3 min. Subsequently, oocytes were cytoplasm were used. After three washes in the same medium, washed twice for 5 min in TCM-199 HEPES supplemented with groups consisting of 50 COCs were transferred into a Nunc 4- 20% FCS and then cultured in plain IVM medium for 2 h. well multidish containing 500 µL of modified North Caroline State University 37 (NCSU37) medium (Petters and Wells, In vitro Fertilization and Embryo Culture 1993), supplemented with 0.57 mM cysteine, 5 mg·mL−1 insulin, In vitro matured oocytes from all treatment groups were fertilized 50 µM β-mercaptoethanol and 10% (v/v) porcine follicular in vitro before and after vitrified-warmed process. Briefly, oocytes fluid (PFF). COCs were cultured at 38.5◦ C in a humidified were washed twice with pre-equilibrated modified Tyrode’s environment with 5% CO2 content in the air. The medium used albumin lactate pyruvate (TALP) prior to being transferred for the first 22 h of in vitro maturation was supplemented with in groups of 20 into four-well dishes containing 250 µL of 1 mM dibutyrylcAMP (dbcAMP), 10 IU·mL−1 equine chorionic fertilization medium per well. Fertilization medium consisted of gonadotropin (eCG; Foligon; Intervet International, Boxmeer, TALP medium described by Rath et al. (1999), supplemented Netherlands) and 10 IU·mL−1 human chorionic gonadotropin with 3 mg·mL−1 fatty acid-free bovine serum albumin (BSA) and (hCG; Chorulon; Intervet International, Boxmeer, Netherlands). 1.1 mM sodium pyruvate. After 20–22 h of culture, COCs were transferred into fresh Sperm-rich fractions were collected by the gloved-hand maturation medium and cultured for a 20–22 h period without technique from a mature Duroc boar known to be fertile. any supplementation (Funahashi et al., 1997). Besides the For in vitro fertilization, sperm cells were selected by washing hormonal supplementation traditionally used in the first 22–24 h, through a two-step (50% and 80%; v:v) Percoll gradient (Noguchi half of selected oocytes is maturated in presence of 100 ng.ml- et al., 2013). Briefly, 2 mL of 50% Percoll was layered on top of 1 of IGF-I, which were added in the maturation media in both 2 mL of 80% Percoll in a 15 mL conic centrifuge tube. Thereafter, periods, in other words, the IGF-I supplementation was made in 0.5 mL of diluted semen (1:1 in BTS) was added with care to the entire process. avoid mixing solutions. Samples were subsequently centrifuged at 700 × g and 24◦ C for 20 min. Supernatant layers were removed Evaluation of in vitro Maturation by aspiration; the resulting sperm pellet was re-suspended in In vitro maturation of oocytes was evaluated by orcein staining 10 mL pre-equilibrated TALP medium and then washed by (Hunter and Polge, 1966). Briefly, oocytes were mounted onto centrifugation at 500 × g and 24◦ C for 5 min. The resulting pellet glass slides (less than five oocytes per slide) under coverslip was re-suspended in the same medium and sperm concentration (supported with paraffin-vaseline corners) and fixed in ethanol: was determined with a Makler counting chamber (Sefi Medical acetic acid (3:1; v: v) for 24 h. Then, oocytes were stained with Instruments; Haifa, Israel). Finally, and after appropriate dilution 1% orcein (w: v) in 45% acetic acid (v: v) and assessed using in TALP medium, 250 µL of sperm suspension was added a phase-contrast microscope at 100x magnification. Oocytes to each fertilization well containing oocytes to obtain a final were classified according to the stage of nuclear maturation concentration of 1 × 106 spermatozoa·mL−1 . as germinal vesicle (GV), metaphase I (MI) and metaphase At 1.5 h post-insemination (h.p.i.), oocytes were washed and II/telophase I (MII/TI) (Figure 1). settled into culture with fresh TALP medium. After 7.5 h.p.i., extra spermatozoa were removed by repeated pipetting and Oocyte Vitrification and Warming presumptive zygotes were washed twice in culture medium and In vitro matured oocytes were vitrified using the Cryotop carrier then transferred to 25-µL culture droplets (15–20 embryos/drop) and the solution described by Kuwayama et al. (2005). All under mineral oil (Nidoil; Nidacon, Sweden). The basic culture Frontiers in Physiology | www.frontiersin.org 3 January 2019 | Volume 9 | Article 1894 Pereira et al. Cryotolerance of Vitrified-Warmed Porcine Oocytes FIGURE 1 | Classification of porcine oocytes using the orcein staining method: (A) germinal vesicle (GV); (B) metaphase I (MI); and (C) metaphase II (MII) stage. Magnification of 100x. Bar: 65 µm. CP, polar corpuscle. medium used for embryo development was a modified NCSU-23 USA) in PBS at 37◦ C in the dark for 5 min. Oocytes were washed medium (Petters and Wells, 1993) supplemented with 0.57 mM in PBS containing 0.3% polyvinylpyrrolidone (PBS–PVP) and cysteine, 5 mg·mL−1 insulin, 10 mL·mL−1 minimum essential then fixed with 4% paraformaldehyde (Electron Microscopy medium (MEM) non-essential amino acid solution, 20 mL·mL−1 Science, Fort Washington, PA, USA) in PBS at 4◦ C overnight. basal medium Eagle (BME) amino acid solution and 4 mg·mL−1 After fixation, oocytes were washed four times in PBS-PVP BSA. From Day 0 (the day of IVF) to Day 2, the medium used and permeabilised with 0.1% (v/v) Triton X-100 in PBS for 1 h. for embryo culture contained sodium pyruvate (0.17 mM) and Then, oocytes were washed twice in PBS–PVP and incubated sodium lactate (2.73 mM) as energy sources. From Day 2 to in TUNEL reaction cocktail at 37◦ C for 1 h in a dark and Day 7, the basic culture medium contained glucose (5.55 mM; humidified environment. Positive and negative control samples Castillo-Martin et al., 2014a). All incubations were performed at were included in each assessment. Positive control consisted of 38.5◦ C in a humidified environment with 5% CO2 in air. a previous treatment with DNase I (50 U·mL−1 ) in PBS–PVP at 37◦ C for 20 min in the dark. Negative control did not contain Evaluation of Fertilization and Embryo Development the terminal transferase. After washing in PBS–PVP, controls Presumptive zygotes were attached onto glass slides and fixed and samples were mounted with 4 µL Vectashield Medium with the same protocol used to evaluate oocyte maturation. (Vector Laboratories, Burlingame, CA, USA) containing 4′ , 6- At 18 h.p.i., oocytes were evaluated under a phase-contrast diamidino-2-phenylindole (DAPI, 1.5 mg/ml) on a microscopic microscope at 100× magnification and the following parameters slide, and then covered with a coverslip. Stained oocytes were were assessed: (1) penetration rate (number of fertilized examined under a fluorescence microscope (Zeiss Axio Imager oocytes/number of inseminated oocytes); (2) monospermy Z1; Carl Zeiss, Oberkochen, Germany), at excitation wavelengths rate (number of oocytes containing only one male-head of 365 nm for DAPI, 485 nm for TUNEL (conjugated with sperm pronucleus/number of penetrated oocytes); and (3) fluorescein isothiocyanate, FITC) and 580 nm for EthD-1. total efficiency of fertilization (number of monospermic Total number of oocytes (DAPI+ ; blue), number of non- oocytes/number of inseminated oocytes). Degenerated and viable oocytes (EthD-1+ ; red stain) and number of oocytes with immature oocytes were not considered. Embryo development fragmented DNA (TUNEL+ ; green) were counted (Figure 2). was assessed under stereomicroscope based on of cleavage (≥2- According to the obtained colorations, oocytes were classified cell stage) at 48 h.p.i. and blastocyst rates (number of blastocysts as: (a) viable oocytes with intact DNA (TUNEL− /EthD-1− ); (b) at day 7/number of cleaved embryos). non-viable oocytes with intact DNA (TUNEL− /EthD-1+ ) and non-viable oocytes with fragmented DNA (TUNEL+ /EthD-1+ ). Evaluation of DNA Fragmentation and Oocyte Membrane Integrity RNA Extraction and Quantitative To determine plasma membrane integrity and DNA Real-Time PCR Analysis (qPCR) fragmentation of in vitro matured fresh and vitrified- In vitro matured and vitrified-warmed oocytes from all warmed oocytes, ethidium homodimer-1 staining (EthD-1) treatments were collected for analysis. Immediately after was combined with TUNEL assay (in-situ Cell Death Detection maturation in vitro and vitrification recovery gene expression System; Roche Diagnostic, Indianapolis, IN, USA) (Fatehi et al., time denuded oocytes were washed three times in D-PBS 2005). Briefly, denuded oocytes were rinsed in D-PBS containing containing 1 mg·ml−1 PVA at 38.5◦ C, snap-frozen in liquid 1 mg·mL−1 PVA and subsequently incubated with 4 µM EthD-1 nitrogen and stored at −80◦ C until mRNA extraction and reverse (Molecular Probes, Thermo Fisher Scientific; Waltham, MA, transcription. Frontiers in Physiology | www.frontiersin.org 4 January 2019 | Volume 9 | Article 1894 Pereira et al. Cryotolerance of Vitrified-Warmed Porcine Oocytes FIGURE 2 | Classification of pig oocytes using simultaneous ethidium homodimer-1 (EthD-1) staining and TUNEL assay: (A) DAPI+ ; blue, stains all nuclei; (B) TUNEL+ ; green, fragmented DNA; and (C) EthD-1+ ; red stain–stains nuclei of non-viable oocytes. Magnification of 400x. Bar: 40 µm. Poly(A)-RNA extraction was performed with pools of 20 glutathione peroxidase (GPX1) and cytosolic copper-zinc- oocytes per experimental group, following the manufacturer’s containing superoxide dismutase (SOD1), plus an endogenous instructions, using the Dynabeads mRNA Direct Extraction Kit control gene (glyceraldehide-3-phosphate dehydrogenase, (Dynal Biotech; Oslo, Norway) with minor modifications. In GAPDH), were amplified (Table 1). The comparative threshold brief, each pool of oocytes was lysed in 50 µL of Lysis buffer cycle (CT ) method was used to quantify relative gene expression for 5 min; the resulting lysate was then hybridized with 10 µL levels and quantification was normalized using the endogenous pre-washed beads for 5 min. After hybridization, poly(A)-RNA- control (GAPDH). To determine the threshold cycle for each bead complexes were washed twice in 50 µL washing buffer A and sample, fluorescence data were acquired after each elongation twice in 50 µL washing buffer B. Next, samples were diluted in 16 step. Following the comparative CT method, the 1CT value µL elution buffer and heated to 70◦ C for 5 min. Following this, 4 was determined by subtracting the GAPDH-CT value of each µL qScript cDNA supermix (Quanta Biosciences; Gaithersburg, sample from the CT value of each target gene within the MD, USA) was added and the Reverse Transcription (RT) sample. Calculation of 11CT involved using the highest reaction was carried by out using oligo-dT primers, random sample 1CT value (i.e., the sample with the lowest target primers, dNTPs and qScript reverse transcriptase. The RT gene expression) as an arbitrary constant to subtract from reaction was performed in a thermocycler (Quanta Biosciences; all other 1CT sample values. Fold differences in relative Gaithersburg, MD, USA) at the following conditions: first step transcript abundance were calculated for target genes assuming of 5 min at 25◦ C, followed by 1 h at 42◦ C for RT of mRNA, and an amplification efficiency of 100% and using the formula 10 min at 70◦ C to inactivate the RT enzyme. After RT, cDNA 2(11CT ) . was diluted with 25 µL elution solution and stored at −20◦ C until use. Experimental Design The relative abundance of mRNA (cDNA) transcripts was Two experiments were designed to determine whether the determined by real-time quantitative PCR (qPCR) using the addition of IGF-I to conventional IVM medium and that of GSH 7500 Real Time PCR System (Applied Biosystems; Foster City, to vitrification-warming media improved oocyte survival and CA, USA). The qPCR reaction mix contained 10 µL Fast SYBR development capacity after vitrification and warming. Based on Green Master Mix (Applied Biosystems, Foster City, California, previous reports and preliminary experiments conducted in our USA), 0.25 µL forward primer and 0.25 µL reverse primer (Life lab, the treatments tested were IGF-I at 100 ng·mL−1 (Wasielak Technologies, Madrid, Spain) specific for the genes of interest et al., 2013) and GSH at 2 mM (0.62 mg·mL−1 ) (Yeste et al., and 2.5 µL cDNA template. Final volume of 20 µL was reached 2014). by adding nuclease-free water. PCR amplification was carried out In experiment 1, cumulus–oocyte complexes (COCs) obtained with one step of denaturation at 95◦ C for 5 min; 45 cycles of from pre-pubertal gilts ovary were selected and matured amplification with denaturation step at 94◦ C for 15 s, annealing in vitro in conventional IVM medium (control) or in the step for 30 s at the appropriate annealing temperature for same medium supplemented with 100 ng·mL−1 IGF-I. For primers; and extension step at 72◦ C for 40 s. The identity of PCR each replicated, around of 50 ovaries were aspirated, and products was verified with gel electrophoresis (2% agarose gel 220 oocytes were selected, which were divided into the two containing 0.1 µL·mL−1 SafeView; Applied Biological Materials, groups previously described and matured in vitro. Between Vancouver, Canada). Three technical replicates per biological 40 and 44 h after the onset of IVM, half of the oocytes in replicate and individual gene were evaluated. Furthermore, no- each treatment group (around 55 oocytes) were vitrified and RT control, where the reverse transcription was carried out warmed in conventional medium (control vitrified-warmed), without RT enzyme, and no template control (NTC), where PCR or in the same medium added with 2 mM GSH. The other was conducted without cDNA template, were included for each half of oocytes was used to evaluate maturation rates and probe set to ensure that no cross-contamination occurred (i.e., the quality of non-vitrified IVM oocytes. Before quality negative controls). evaluations post-vitrification, vitrified-warmed oocytes were Five separate genes, BCL-2 associated X protein (BAX), incubated for an additional 2-h period in their respective BCL2-like 1 (BCL2L1), heat shock protein 70 (HSPA1A), IVM medium and were then collected to assess viability Frontiers in Physiology | www.frontiersin.org 5 January 2019 | Volume 9 | Article 1894 Pereira et al. Cryotolerance of Vitrified-Warmed Porcine Oocytes TABLE 1 | Primers used for quantitative reverse transcription–polymerase chain reaction. NCBI official name (gene symbol) Primer sequence (5′ -3′ ) Amplicon GenBank Accession size (bp) no. Glyceraldehide-3-phosphate dehydrogenase F:CTCAACGACCACTTCGTCAA R:TCTGGGATGGAAACTGGAAG 233 NM_00120659.1 (GAPDH) BCL2-associated × protein (BAX) F:AACATGGAGCTGCAGAGGAT R:CGATCTCGAAGGAAGTCCAG 204 XM_003127290.2 BCL2-like 1 (BCL2L1) F:GGAGCTGGTGGTTGACTTTC R:CTAGGTGGTCATTCAGGTAAG 528 AF216205 Heat Shock Protein 70 kDA (HSPA1A) F:ATGTCCGCTGCAAGAGAAGT R:GGCGTCAAACACGGTATTCT 216 NM_001123127.1 Superoxide dismutase 1soluble (SOD1) F:GTGCAGGGCACCATCTACTT R:AGTCACATTGCCCAGGTCTC 222 NM_001190422.1 Glutathione peroxidase 1 (GPX1) F:CAAGAATGGGGAGATCCTGA R:GTCA TTGCGACACACTGGAG 217 NM_2142201.1 NCBI, National Center for Biotechnology Information F, Forward; R, Reverse; bp, base pairs. TABLE 2 | Effects of supplementing IVM medium with IGF-I, and adding vitrified-warmed solutions with GSH on cleavage rates and embryo development. Groups Oocytes D2 Cleaved D7 Blastocyst Blastocyst rate n n (%) n (%) % Fresh Control 163 92 (56.30 ± 1.70) ab 22 (13.49 ± 0.60) a 24.03 ± 0.91 ab IGF 167 95 (57.16 ± 1.75) a 29 (17.41 ± 0.56) a 30.56 ± 0.90 a Vitrified-warmed Control 95 24 (25.27 ± 1.50) c 5 (5.13 ± 1.72) c 20.00 ± 6.94 b IGF 104 34 (31.70 ± 2.38) cd 8 (6.04 ± 1.66) c 18.33 ± 5.09 b Control +GSH 98 31 (32.58 ± 1.82) cd 6 (7.50 ± 1.28) c 23.33 ± 4.08 ab IGF+GSH 105 36 (34.58 ± 1.82) bd 9 (8.58 ± 1.61) c 24.17 ± 4.72 ab Data are shown as mean ± s.e.m. Different letter indicate significant differences between treatments (P < 0.05). Blastocyst rate = blastocyst/cleaved. and DNA fragmentation (n = 12 replicates/30 oocytes per expression of BAX, BCL2L1, HSPA1A, GPX1, and SOD1 replicated) and gene expression (n = 4 replicates/20 oocytes per were determined with using a two-way ANOVA followed replicated). by Bonferroni post-hoc test for multiple comparisons. In Additionally, the experiment 2 was conducted for evaluated experiment 2, the same tests were used and independent the influence of IGF-I and GSH on development embryotic variables were penetration, monospermy and cleavage rates, capacity of vitrified-warmed oocytes. In this experiment, the total efficiency of fertilization, and blastocyst formation. process of maturation, vitrification and warming, is the same When, despite transformed, data did not fit with parametric of experiment 1. However, after 2 h of vitrification recovery, assumptions, a non-parametric Scheirer-Ray-Hare ANOVA for oocytes from each treatment group were in vitro fertilized and ranked data was run. The Mann-Whitney test was used for cultured, and the rates of fertilization, monospermy fecundation, pair-wise comparisons. cleavage and blastocyst development were determinate. The Data are expressed as means ± standard error for the mean number of oocytes evaluated in this experiment was described in (SEM). In all cases, P ≤ 0.05 was considered as significant. Table 2. Statistical Analyses RESULTS All statistical analyses were conducted using a statistical Effects of Supplementing IVM Medium package (IBM SPSS for Windows, Version 23.0; Armonk, NY, USA). All parameters were previously checked for With IGF-I and Vitrification-Warming normality and homogeneity of variances (homocedasticity) Solutions With GSH on Oocyte Maturation, using Shapiro-Wilk and Levene tests, respectively. When Viability and DNA Fragmentation necessary, data were transformed through arcsine square root A total of 654 oocytes from 12 replicates were evaluated after √ (arcsin x). 44 h of IVM. Supplementation of IVM medium with IGF-I did In experiment 1, the effects of supplementing IVM with not affect oocyte maturation, as the proportion of oocytes in all IGF-I on in vitro maturation were determined with a t-test nuclear stages was similar when control and IGF-I groups were for independent samples. The effects of treatment (i.e., IGF- compared (Figure 3). I, GSH, IGF-I+GSH) and vitrification (i.e., fresh vs. vitrified- With regard to oocyte viability and DNA fragmentation, warmed) on oocyte viability, DNA fragmentation and relative the percentages of viable, fresh oocytes with intact DNA was Frontiers in Physiology | www.frontiersin.org 6 January 2019 | Volume 9 | Article 1894 Pereira et al. Cryotolerance of Vitrified-Warmed Porcine Oocytes or without GSH. On the other hand, while the relative abundance of GPX1-transcripts was significantly higher after cryopreservation, supplementing vitrification-warming solutions with GSH led to the highest expression of this gene (P < 0.05; see Figure 5). Moreover, relative abundance of GPX1-transcripts was also significantly (P < 0.05) higher in vitrified-warmed oocytes that had been in vitro matured with IGF-I. Relative transcript abundance of BCL2L1 gene was significantly (P < 0.05) higher in vitrified-warmed oocytes than the fresh oocytes, regardless of supplementing IVM and vitrification-warming media with IGF-I and GSH, respectively. Conversely, although relative BAX-transcript abundance was significantly (P < 0.05) higher in control vitrified-warmed oocytes, previous in vitro maturation with IGF-I and addition FIGURE 3 | Effects of IGF-I supplementation on in vitro maturation of pig of vitrification-warming solutions with GSH did counteract that oocytes. Data are shown as mean ± s.e.m. GV, Germinal Vesicle; MI, increase (Figure 5). Therefore, the level of transcripts for the Metaphase I; MII, Metaphase II; Deg, degenerated. No significant differences BAX gene was similar between fresh and vitrified-maturated between control and IGF-I were observed. treated oocytes. Furthermore, the BAX:BCL2L1 ratio was significantly (P < 0.05) higher in fresh oocytes than in those vitrified after maturation with IGF-I or vitrified with GSH significantly higher (P < 0.05) than that observed for vitrified- (Figure 5). warmed oocytes. Non-vitrified oocytes presented similar viability and DNA fragmentation rates for both treatment groups (i.e. Effects of Supplementing IVM Medium With control and IGF-I) (Figure 4). IGF-I and Vitrification-Warming Solutions As far as in vitrified-warmed oocytes, previous in vitro With GSH on Monospermy and Penetration maturation in the presence of 100 ng·mL−1 IGF-I or supplementation of vitrification-warming solutions with Rates, and on Embryo Development 2 mM GSH (P < 0.05) increase the proportion of viable oocytes Addition of IVM with IGF-I did not influence monospermy, with intact DNA. Remarkably, the highest proportion of viable penetration, cleavage and blastocyst rates in embryos derived vitrified-warmed oocytes with intact DNA was found when from fresh oocytes (Figure 6). Monospermy, penetration they were simultaneously in vitro matured in the presence of and cleavage rates, as well as the blastocyst development, IGF-I and vitrified-warmed in a medium supplemented with were significantly (P < 0.05) lower in embryos derived GSH (Figure 4A). The same results were obtained when the from vitrified-warmed oocytes than in those derived from proportion of non-viable oocytes to fragmented DNA was their fresh counterparts (Table 2). However, penetration evaluated (Figure 4B). rates of vitrified-warmed control oocytes were significantly (P < 0.05) lower than those previously matured in the Effects of Supplementing IVM Medium presence of IGF-I (Figure 6). Furthermore, when assessing IVF rates for vitrified-warmed oocytes, cleavage rates were With IGF-I and Vitrification-Warming significantly (P < 0.05) higher in oocytes previously matured Solutions With GSH on the Expression of with IGF-I and vitrified-warmed with GSH than in control BAX, BCL2L1, HSPA1A, GPX1, and SOD1 oocytes (Figure 6). Conversely, neither the addition of Data regarding relative transcript abundances produced in IVM medium with IGF-I nor supplementing vitrification- response to the presence of both IGF-I in IVM medium warming solutions with GSH influenced monospermy and GSH in vitrification-warming media are shown in rates. Figure 5. Supplementation of IVM medium with IGF-I Regarding embryo development, the total number of had no effect on the expression profiles of BAX, BCL2L1, blastocysts formed was negatively affected by the vitrification- HSPA1A, GPX1, and SOD1 genes in fresh oocytes. In contrast, warming technique, regardless of the composition of IVM supplementing IVM maturation medium with IGF-I and and vitrification-warming media (Table 2). Nevertheless, when addition of vitrification-warming solutions with GSH (P < 0.05) blastocyst rates were evaluated, that is, the ratio of blastocyst positively affected the expression of BAX, HSPA1A, and GPX1 formed to cleavage oocytes (% blastocyst at day 7), significant in vitrified-warmed oocytes but did not alter that of the SOD1 (P < 0.05) differences between fresh and vitrified-warmed gene. oocytes groups were found. Indeed, fresh oocytes matured A higher expression of HSPA1A was observed after with IGF-I gave significantly (P < 0.05) higher blastocyst rates vitrification-warming in all treatment groups, but the extent than oocytes vitrified-warmed without GSH (Figure 6). In of that increase was significantly (P < 0.05) higher in those spite of the addition of IGF-I to the maturation medium and that were in vitro matured in the presence of IGF-I, with GSH in the vitrification and warming media did not improve Frontiers in Physiology | www.frontiersin.org 7 January 2019 | Volume 9 | Article 1894 Pereira et al. Cryotolerance of Vitrified-Warmed Porcine Oocytes modified composition of IVM and vitrification-warming media with IGF-I and GSH, respectively, appears to better preserve in vitro matured pig oocytes. This is especially important as, because of the composition of their cytoplasm and plasma membrane, oocyte cryopreservation in pigs is considered to be more difficult than in other mammalian species (Galeati et al., 2011). With regard to the addition of IGF-I to IVM medium, it is worth noting that previous studies have reported its positive effect on follicular cell proliferation, oocyte maturation and steroidogenesis (Nemcova et al., 2007; Mani et al., 2010; Xie et al., 2016; Sato et al., 2018). However, our results show that nuclear maturation rates of pig oocytes matured in the presence of 100 ng·mL−1 IGF-I do not differ from the control group. Other studies can help us explain these results. Oberlender et al. (2013b) divided recovered pig oocytes into two groups: (1) oocytes from small follicles (2–4 mm) and oocytes from large follicles (5–8 mm), and submitted them to in vitro maturation in the presence of IGF-I. These authors observed that the addition of IGF-I at concentrations around 100 ng·mL−1 to IVM medium increased the maturation rates of small follicles. In contrast, IGF-I had no effect on IVM when used on large follicles. These data indicate that during follicular growth, changes crucial for oocyte maturation occur in cumulus cells and in the factors present in the follicular fluid. As high quality oocytes from 3 to 6 mm follicles were used in this experiment, and the average maturation rate obtained was higher than 80%, regardless of IVM media composition, which is considered as good (Zhang et al., 2012), the effects of IGF-I on oocyte maturation could have been not apparent enough. In addition, the fact that IGF-I concentration in pig follicles with 4 mm or FIGURE 4 | Effects of supplementing IVM medium with IGF-I, and adding vitrified-warmed solutions with GSH on oocyte viability and DNA fragmentation larger is about 171 ng·mL−1 (Oberlender et al., 2013a) could before and after vitrification of porcine oocytes. Data are shown as mean ± explain why there were no significant effects of IGF-I on IVM s.e.m. Different letters indicate significant differences (P < 0.05) (A) rate. TUNEL-/EthD-1-: viable oocytes with intact DNA; (B) TUNEL+/EthD-1+: Besides the direct influence on oocyte maturation, the anti- non-viable oocytes with fragmented DNA. apoptotic effect of IGF-I leads to hypothesize that supplementing maturation media with this growth factor may increase oocyte cryotolerance. As expected, we observed that vitrification- the rate of cleavage and percentage of blastocyst formed, in warming significantly affected the viability and DNA integrity making the relation between these two parameters, vitrified- of pig oocytes. However, when these cells had been previously warmed oocytes in the presence of GSH presented blastocyst matured in a medium supplemented with IGF-I, the percentage rate similar to the group of fresh oocytes matured with IGF-I of viable oocytes with intact DNA after vitrification-warming (Table 2). was higher than that observed for oocytes matured and vitrified in standard media. These results match with previous studies DISCUSSION conducted with pig blastocysts in which supplementing culture medium with IGF-I was found to reduce DNA fragmentation Our results suggest that supplementing maturation medium and apoptosis indexes (Dhali et al., 2011; Ascari et al., 2017) by with IGF-I and vitrification-warming solutions with GSH downregulating the expression of BAX and upregulating that of improve the quality and cryotolerance of IVM pig oocytes. BCL-2 (Wasielak et al., 2013; Pan et al., 2015). To explain these Moreover, addition of IGF-I to IVM medium and/or of GSH results, one should bear in mind that BAX is a pro-apoptotic to vitrification-warming solutions also has some beneficial gene involved in cell death and oocyte degeneration. Following effect on survival rates and developmental competence, and death stimuli (temperature, toxicants or oxidative stress), the affects the relative transcript abundance of genes related to BAX-linked pathway is activated and the apoptosis cascade is apoptosis and heat stress. These results are important, as initiated (Finucane et al., 1999). In this study, the addition oocyte cryopreservation is known to decrease cell viability of IGF-I to oocyte maturation medium significantly reduced and DNA integrity, as well as the cleavage and blastocyst the relative abundance of BAX transcripts after vitrification- rates of embryos derived from these oocytes. Therefore, a warming, the levels being similar to those found in fresh oocytes. Frontiers in Physiology | www.frontiersin.org 8 January 2019 | Volume 9 | Article 1894 Pereira et al. Cryotolerance of Vitrified-Warmed Porcine Oocytes FIGURE 5 | Effects of supplementing IVM medium with IGF-I, and adding vitrified-warmed solutions with GSH on the relative expression of BAX, BCL2L1, HSPA1A, GPX1 and SOD1, and on the BAX: BCL2L1 ratio before and after vitrification of porcine oocytes. Data are shown as mean ± s.e.m. Different letters indicate significant differences between treatments (P < 0.05). The apoptotic process is related with the balance between changes in the expression of BCL2L1 were found, in a similar pro- and anti-apoptotic genes. While BAX family indicates the fashion to that observed for pre-implanted bovine embryos by activation of an apoptosis cascade, the members of the BCL-2 (Block et al., 2008). In contrast, Kim et al. (2006) evaluated the family (anti-apoptotic gene) form heterodimers with apoptotic effects of IGF-I on IVF pig embryos and observed that IGF- genes and block their function (Kim et al., 2006). However, no I enhanced the expression of BCL2L1 and decreased that of Frontiers in Physiology | www.frontiersin.org 9 January 2019 | Volume 9 | Article 1894 Pereira et al. Cryotolerance of Vitrified-Warmed Porcine Oocytes FIGURE 6 | Effects of supplementing IVM medium with IGF-I, and adding vitrified-warmed solutions with GSH on penetration, monospermy, cleavage and blastocysts rates before and after vitrification of porcine oocytes. Data are shown as mean ± s.e.m. Different letters indicate significant differences between treatments (P < 0.05). % blastocysts at day 7 = number of blastocyst at day 7: number cleavage oocytes. BAX. In addition to the expression of BAX and BCL2L1, we triggered by IGF-I is modulated by IGF-1-like signaling (IIS) also calculated the BAX: BCL2L1 ratio, which determines the pathway (Laviola et al., 2007), which positively regulates susceptibility of a cell to apoptosis and determines cell survival the activity of heat shock factor-1 (HSF-1) (Chiang et al., or death (Oltvai et al., 1993). In the current study, although no 2012). HSF-1, in turn, upregulates the transcription of genes differences were found in BCL2L1 expression, the BAX: BCL2L1 involved in the heat-shock response, such as HSPA1A (Chiang ratio has the lowest in vitrified-warmed oocytes maturated in et al., 2012). The present study showed that the relative presence of IGF-I and/or vitrified with GSH. This suggests transcript abundance of HSPA1A was higher in vitrified- that IGF-I is able to modulate the apoptotic response (Laviola warmed oocytes, especially in those previously cultured et al., 2007) and also supports the protective effect of GSH with IGF-I. (Hansen and Harris, 2014). Cryotolerance of oocytes does not only depend on their Vitrified-warmed oocytes matured with IGF-I presented quality, but also on the conditions provided during vitrification the highest relative transcript abundance of HSPA1A. Heat and warming processes. These procedures, as well as other shock proteins (HSPs) play a critical role in the response stressing factors, have been reported to disturb the oxidation– to environmental stressful stimuli, including the oxidative reduction (redox) status by both decreasing the reduced stress generated during oocyte maturation and embryo culture glutathione (GSH) content and increasing intracellular reactive (Bernardini et al., 2004) and the thermal stress caused by oxygen species (ROS) levels in mice (Moawad et al., 2017) vitrification-warming procedures (Castillo-Martin et al., 2015). and pig oocytes (Somfai et al., 2007; Gupta et al., 2010). HSPs are a set of highly conserved proteins synthesized in Intracellular GSH content is positively correlated with oocyte response to stress, which act as molecular chaperones to quality (Hara et al., 2014) and this study indicates that pig maintain cellular homeostasis. The intracellular response oocytes that are vitrified-warmed in GSH-supplemented media Frontiers in Physiology | www.frontiersin.org 10 January 2019 | Volume 9 | Article 1894 Pereira et al. Cryotolerance of Vitrified-Warmed Porcine Oocytes show better viability and DNA integrity than those vitrified- Moreover, when oocytes are vitrified-warmed with GSH, the warmed in standard media. These results agree with previous percentage of cleaved embryos that developed into blastocysts works in which GSH was used to improve gamete preservation. is similar to that of vitrified-warmed fresh oocytes, regardless of Trapphoff et al. (2016) observed that supplementing IVM the composition of maturation medium. Oocyte developmental media with GSH increases cryotolerance of mice oocytes competence is related to meiotic spindle and chromosomal by reducing ROS content and protecting the chromosomal configuration and vitrified-warmed IVM oocytes show lower structure. Picco et al. (2010) showed that addition of maturation blastocyst rates due to meiotic spindle disorganization and the medium with zinc increases intracellular GSH content and consequent chromosomal dispersion (Fu et al., 2009; Gupta et al., DNA integrity of cumulus cells and bovine oocytes, and 2010). Trapphoff et al. (2016) showed a protective effect of GSH this has a positive impact on embryo development. Yeste on spindle organization and chromosome alignment of mice et al. (2014) demonstrated that supplementing cryopreservation oocytes, and Moawad et al. (2017) found that developmental medium with 2mM GSH protects the nucleoprotein structure potential of mice embryos was higher when vitrified with GSH. and maintains the viability of frozen-thawed boar sperm. It is The spindle could be particularly protected by GSH because important to emphasize that, in this present study, the highest higher GSH content prevents oxidation of cysteine sulfhydryl- survival rates were found when pig oocytes were previously groups of αß tubulin dimers (Zhang et al., 2012). In spite matured with 100ng·mL−1 IGF-I and were vitrified-warmed of this, one should note that the effects of supplementing with 2 mM GSH. Therefore, both substances appear to have a vitrification-warming media with GSH could differ between synergistic effect. species, as (Hara et al., 2014) reported that high content of The pathway through which GSH protects the oocytes from GSH in matured bovine oocytes does not suppress the high the damage inflicted by vitrification-warming remains unknown. incidence of multiple aster formation or improves embryo What is known is that the generation of endogenous GSH in the development. oocytes is essential for their protection against the oxidative stress In conclusion, supplementation of IVM medium with 100 and other forms of cellular injury (Somfai et al., 2007; Trapphoff ng·mL−1 IGF-I and addition vitrification-warming solutions et al., 2016; Moawad et al., 2017). Therefore, and in the light with 2 mM GSH improve survival and DNA integrity rate of our results, it is reasonable to suggest that supplementation of vitrified-warmed oocytes, and also increases the relative of vitrification-warming media with GSH partly counteracts the transcript abundances of HSPA1A and GPX1, and decreases that damaging effects of vitrification by preventing lipid peroxidation of BAX. When added together to maturation and vitrification- in the oocyte and removing the excessive ROS in the medium. warming media, respectively, IGF-I and GSH increase cleavage Additionally, the positive effect of GSH on the viability and rates in comparison of vitrified-warmed oocytes control, and DNA integrity of vitrified-warmed oocytes observed in this study promoted similar values of blastocyst rates (formed blastocyst: could be explained by the increase in the relative transcript cleavage oocytes) between vitrified-warmed oocytes and fresh abundance of GPX1 and the decrease in that of BAX. Related with oocytes. Our results support the relevance of the in vitro this, relative GPX1-transcript abundance has been correlated maturation process for oocyte cryotolerance and demonstrates with embryo quality in cattle, with excellent/good blastocysts the suitability of IGF-I and GSH as additives for maturation and having higher expression of GPX1 in comparison with blastocysts vitrification-warming media. of lower quality (Cebrian-Serrano et al., 2013). Castillo-Martin et al. (2014b) found a positive correlation between GPX1 and survival rates of vitrified-warmed porcine blastocysts at 24 h AUTHOR CONTRIBUTIONS post-warming. Glutathione peroxidase is involved in the redox BP, MY, MZ, and JR-G designed the experiments. BP, MC-M, balance of cells and is responsible for scavenging hydrophilic BG, and BC carried out the lab work. BP wrote the manuscript peroxide species, such as hydrogen peroxide (H2 O2 ). Therefore, with the support from MY. MY and MZ supervised the project. with an increase in the antioxidant enzyme content, there is MC-M, SB, and JR-G helped supervise the project. a decrease in the intracellular peroxide levels. Moreover, high ROS levels causes injury on mitochondrial function, which can trigger the intrinsic apoptotic pathway in oocytes and granulosa ACKNOWLEDGMENTS cells (Dai et al., 2015). This helps explain our results as if the increase in relative GPX1-transcript abundance is involved in This study was supported by Spanish (Ministry of Economy the reduction of intracellular ROS concentration, the activation and Competitiveness, Spain; Grant Code: RYC-2014-15581) and of the apoptosis cascade would be reduced, which would Brazil governments (Scheme for Improvement of Higher Level agree with the observed decrease in the relative BAX-transcript Personnel, CAPES, Grant Code: PVE 88881.030399/2013-01; and abundance. National Council for Scientific and Technological Development, Our data indicate that neither supplementation of IVM with CNPq, Grant Code: 446288/2014-4 and PQ 305478/2015-0). The IGF-I nor addition of GSH to vitrification-warming media authors would like to thank the staff of TechnoSperm Lab, improve blastocyst development or cleavage rates of vitrified- University of Girona, for their technical support. The authors warmed oocytes. However, when pig oocytes are matured with also thank the slaughterhouse Frigoríficos Costa Brava, S.A. IGF-I and vitrified-warmed with GSH, cleavage rates are better (Riudellots de la Selva, Girona, Spain) for kindly providing the than matured oocytes vitrified-warmed in standard medium. pig ovaries. Frontiers in Physiology | www.frontiersin.org 11 January 2019 | Volume 9 | Article 1894 Pereira et al. Cryotolerance of Vitrified-Warmed Porcine Oocytes REFERENCES Galeati, G., Spinaci, M., Vallorani, C., Bucci, D., Porcu, E., and Tamanini, C. (2011). Pig oocyte vitrification by cryotop method: effects on viability, spindle and Arat, S., Caputcu, A. T., Cevik, M., Akkoc, T., Cetinkaya, G., and Bagis, H. (2016). chromosome configuration and in vitro fertilization. Anim. Reprod. Sci. 127, Effect of growth factors on oocyte maturation and allocations of inner cell 43–49. doi: 10.1016/j.anireprosci.2011.07.010 mass and trophectoderm cells of cloned bovine embryos. Zygote 24, 554–562. Ghetler, Y., Skutelsky, E., Ben Nun, I., Ben Dor, L., Amihai, D., and Shalgi, R. doi: 10.1017/S0967199415000519 (2006). Human oocyte cryopreservation and the fate of cortical granules. Fertil. Ascari, I. J., Alves, N. G., Jasmin, J., Lima, R. R., Quintao, C. C. R., Oberlender, G., Steril. 86, 210–216. doi: 10.1016/j.fertnstert.2005.12.061 et al. (2017). Addition of insulin-like growth factor I to the maturation medium Gupta, M. K., Ph, D., Uhm, S. J., Ph, D., Lee, H. T., and Ph, D. (2010). Effect of of bovine oocytes subjected to heat shock: effects on the production of reactive vitrification and beta-mercaptoethanol on reactive oxygen species activity and oxygen species, mitochondrial activity and oocyte competence. Domest Anim. in vitro development of oocytes vitrified before or after in vitro fertilization. Endocrinol. 60, 50–60. doi: 10.1016/j.domaniend.2017.03.003 Fertil. Steril. 93, 2602–2607. doi: 10.1016/j.fertnstert.2010.01.043 Bernardini, C., Fantinati, P., Zannoni, A., Forni, M., Tamanini, C., and Bacci, M. Hansen, J. M., and Harris, C. (2014). Glutathione during embryonic development. L. (2004). Expression of HSP70/HSC70 in swine blastocysts: effects of oxidative Biochim. Biophys. Acta 1850, 1–16. doi: 10.1016/j.bbagen.2014.12.001 and thermal stress. Mol. Reprod. Dev. 69, 303–307. doi: 10.1002/mrd.20143 Hara, H., Yamane, I., Noto, I., Kagawa, N., Kuwayama, M., Hirabayashi, M., et al. Block, J., Wrenzycki, C., Niemann, H., Herrmann, D., and Hansen, P. J. (2008). (2014). Microtubule assembly and in vitro development of bovine oocytes Effects of insulin-like growth factor-1 on cellular and molecular characteristics with increased intracellular glutathione level prior to vitrification and in vitro of bovine blastocysts produced in vitro. Mol. Reprod. Dev. 75, 895–903. fertilization. Zygote 22, 476–482. doi: 10.1017/S0967199413000105 doi: 10.1002/mrd.20826 Hunter, R. H., and Polge, C. (1966). Maturation of follicular oocytes in the pig after Castillo-Martin, M., Bonet, S., Morato, R., and Yeste, M. (2014a). Comparative injection of human chorionic gonadotrophin. J. Reprod. Fertil. 12, 525–531. effects of adding beta-mercaptoethanol or L-ascorbic acid to culture or doi: 10.1530/jrf.0.0120525 vitrification-warming media on IVF porcine embryos. Reprod. Fertil. Dev. 26, Kim, S., Lee, S. H., Kim, J. H., Jeong, Y. W., Hashem, M. A., Koo, O. J., 875–882. doi: 10.1071/RD13116 et al. (2006). Anti-apoptotic effect of insulin-like growth factor (IGF)-I Castillo-Martin, M., Bonet, S., Morato, R., and Yeste, M. (2014b). Supplementing and its receptor in porcine preimplantation embryos derived from in vitro culture and vitrification-warming media with l-ascorbic acid enhances survival fertilization and somatic cell nuclear transfer. Mol. Reprod. Dev. 73, 1523–1530. rates and redox status of IVP porcine blastocysts via induction of GPX1 and doi: 10.1002/mrd.20531 SOD1 expression. Cryobiology 68, 451–458. doi: 10.1016/j.cryobiol.2014.03.001 Kocyigit, A., and Cevik, M. (2015). Effects of leukemia inhibitory factor and Castillo-Martin, M., Yeste, M., Pericuesta, E., Morato, R., Gutierrez-Adan, A., insulin-like growth factor-I on the cell allocation and cryotolerance of bovine and Bonet, S. (2015). Effects of vitrification on the expression of pluripotency, blastocysts. Cryobiology 71, 64–69. doi: 10.1016/j.cryobiol.2015.05.068 apoptotic and stress genes in in vitro-produced porcine blastocysts. Reprod. Kuwayama, M., Vajta, G., Ieda, S., and Kato, O. (2005). Comparison of Fertil. Dev. 27, 1072–1081. doi: 10.1071/RD13405 open and closed methods for vitrification of human embryos and the Cebrian-Serrano, A., Salvador, I., Garcia-Rosello, E., Pericuesta, E., Perez- elimination of potential contamination. Reprod. Biomed. Online 11, 608–614. Cerezales, S., Gutierrez-Adan, A., et al. (2013). Effect of the bovine oviductal doi: 10.1016/S1472-6483(10)61169-8 fluid on in vitro fertilization, development and gene expression of in Laviola, L., Natalicchio, A., and Giorgino, F. (2007). The IGF-I signaling pathway. vitro-produced bovine blastocysts. Reprod. Domest. Anim. 48, 331–338. Curr. Pharm. Des. 13, 663–669. doi: 10.2174/138161207780249146 doi: 10.1111/j.1439-0531.2012.02157.x Li, S., Bian, H., Liu, Z., Wang, Y., Dai, J., He, W., et al. (2012). Chlorogenic Chen, P., Pan, Y., Cui, Y., Wen, Z., Liu, P., He, H., et al. (2017). Insulin-like acid protects MSCs against oxidative stress by altering FOXO family growth factor I enhances the developmental competence of yak embryos by genes and activating intrinsic pathway. Eur. J. Pharmacol. 674, 65–72. modulating aquaporin 3. Reprod. Domest. Anim. 52, 825–835. doi: 10.1111/rda. doi: 10.1016/j.ejphar.2011.06.033 12985 Mani, A. M., Fenwick, M. A., Cheng, Z., Sharma, M. K., Singh, D., Chiang, W.-C., Ching, T.-T., Lee, H. C., Mousigian, C., and Hsu, A.-L. (2012). and Wathes, D. C. (2010). IGF1 induces up-regulation of steroidogenic A complex containing DDL-1 and HSF-1 links insulin-like signaling to heat- and apoptotic regulatory genes via activation of phosphatidylinositol- shock response in C. elegans. Cell 148, 322–334. doi: 10.1016/j.cell.2011.12.019 dependent kinase/AKT in bovine granulosa cells. Reproduction 139, 139–151. Dai, J., Wu, C., Muneri, C. W., Niu, Y., Zhang, S., Rui, R., et al. (2015). Changes doi: 10.1530/REP-09-0050 in mitochondrial function in porcine vitrified MII-stage oocytes and their Mari, M., Morales, A., Colell, A., Garcia-Ruiz, C., and Fernandez-Checa, J. C. impacts on apoptosis and developmental ability. Cryobiology 71, 291–298. (2009). Mitochondrial Glutathione, a Key Survival Antioxidant. Antioxid. doi: 10.1016/j.cryobiol.2015.08.002 Redox Signal. 11, 2685–2700. doi: 10.1089/ars.2009.2695 Dhali, A., Anchamparuthy, V. M., Butler, S. P., Mullarky, I. K., Pearson, R. E., Moawad, A. R., Tan, S. L., and Taketo, T. (2017). Beneficial effects of and Gwazdauskas, F. C. (2011). Development and quality of bovine embryos glutathione supplementation during vitrification of mouse oocytes produced in vitro using growth factor supplemented serum-free system. Open at the germinal vesicle stage on their preimplantation development J. Anim. Sci. 1, 97–105. doi: 10.4236/ojas.2011.13013 following maturation and fertilization in vitro. Cryobiology 76, 98–103. Fatehi, A. N., Hurk, R. V. D., and Colenbrander, B. (2005). Expression of bone doi: 10.1016/j.cryobiol.2017.04.002 morphogenetic protein2 ( BMP2 ), BMP4 and BMP receptors in the bovine Nemcova, L., Nagyova, E., Petlach, M., Tomanek, M., and Prochazka, R. (2007). ovary but absence of effects of BMP2 and BMP4 during IVM on bovine Molecular mechanisms of insulin-like growth factor 1 promoted synthesis oocyte nuclear maturation and subsequent embryo Development. 63, 872–889. and retention of hyaluronic acid in porcine oocyte-cumulus complexes. Biol. doi: 10.1016/j.theriogenology.2004.05.013 Reprod. 76, 1016–1024. doi: 10.1095/biolreprod.106.057927 Finucane, D. M., Bossy-Wetzel, E., Waterhouse, N. J., Cotter, T. G., and Green, Noguchi, M., Yoshioka, K., Hikono, H., Iwagami, G., Suzuki, C., and Kikuchi, D. R. (1999). Bax-induced caspase activation and apoptosis via cytochrome K. (2013). Centrifugation on Percoll density gradient enhances motility , c release from mitochondria is inhibitable by Bcl-xL. J. Biol. Chem. 274, membrane integrity and in vitro fertilizing ability of frozen – thawed boar 2225–2233. doi: 10.1074/jbc.274.4.2225 sperm. Zygote 23, 68–75. doi: 10.1017/S0967199413000208 Fu, X.-W., Shi, W.-Q., Zhang, Q.-J., Zhao, X.-M., Yan, C. L., Hou, Y.-P., et al. Oberlender, G., Murgas, L. D., Zangeronimo, M. G., Da Silva, A. C., Menezes (2009). Positive effects of Taxol pretreatment on morphology, distribution Tde, A., Pontelo, T. P., et al. (2013b). Role of insulin-like growth factor-I and ultrastructure of mitochondria and lipid droplets in vitrification and follicular fluid from ovarian follicles with different diameters on porcine of in vitro matured porcine oocytes. Anim. Reprod. Sci. 115, 158–168. oocyte maturation and fertilization in vitro. Theriogenology 80, 319–327. doi: 10.1016/j.anireprosci.2008.12.002 doi: 10.1016/j.theriogenology.2013.04.018 Funahashi, H., Cantley, T. C., and Day, B. N. (1997). Synchronization of meiosis Oberlender, G., Murgas, L. D. S., Pontelo, T. P., Menezes, T. A., Zangeronimo, M. in porcine oocytes by exposure to dibutyryl cyclic adenosine monophosphate G., and Silva, A.C. (2013a). Porcine follicular fluid concentration of free insulin- improves developmental competence following in vitro fertilization. Biol. like growth factor-I collected from different diameter ovarian follicles. Pesqui. Reprod. 57, 49–53. doi: 10.1095/biolreprod57.1.49 Vet. Bras. 33, 1269–1274. doi: 10.1590/S0100-736X2013001000013 Frontiers in Physiology | www.frontiersin.org 12 January 2019 | Volume 9 | Article 1894 Pereira et al. Cryotolerance of Vitrified-Warmed Porcine Oocytes Oltvai, Z. N., Milliman, C. L., and Korsmeyer, S. J. (1993). Bcl-2 heterodimerizes in in vitro and in vivo matured mouse oocytes by supplementing with a vivo with a conserved homolog, Bax, that accelerates programmed cell death. glutathione donor prior to vitrification. Mol. Hum. Reprod. 22, 867–881. Cell 74, 609–619. doi: 10.1016/0092-8674(93)90509-O doi: 10.1093/molehr/gaw059 Pan, Y., Cui, Y., He, H., Baloch, A. R., Fan, J., Xu, G., et al. (2015). Developmental Wasielak, M., and Bogacki, M. (2007). Apoptosis inhibition by insulin-like growth competence of mature yak vitrified-warmed oocytes is enhanced by IGF-I factor (IGF)-I during in vitro maturation of bovine oocytes. J. Reprod. Dev. 53, via modulation of CIRP during in vitro maturation. Cryobiology 71, 493–498. 419–426. doi: 10.1262/jrd.18076 doi: 10.1016/j.cryobiol.2015.10.150 Wasielak, M., Fujii, T., Ohsaki, T., Hashizume, T., Bogacki, M., and Sawai, Petters, R. M., and Wells, K. D. (1993). Culture of pig embryos. J. Reprod. Fertil. K. (2013). Transcript abundance and apoptosis in day-7 porcine blastocyst Suppl. 48, 61–73. cultured with exogenous insulin-like growth factor-I. Reprod. Biol. 13, 58–65. Picco, S. J., Anchordoquy, J. M., De Matos, D. G., Anchordoquy, J. P., Seoane, A., doi: 10.1016/j.repbio.2013.01.173 Mattioli, G. A., et al. (2010). Effect of increasing zinc sulphate concentration Wu, G., Jia, B., Mo, X., Liu, C., Fu, X., Zhu, S., et al. (2013). Nuclear during in vitro maturation of bovine oocytes. Theriogenology 74, 1141–1148. maturation and embryo development of porcine oocytes vitrified by cryotop: doi: 10.1016/j.theriogenology.2010.05.015 effect of different stages of in vitro maturation. Cryobiology 67, 95–101. Rath, D., Long, C. R., Dobrinsky, J. R., Welch, G. R., Schreier, L. L., and Johnson, L. doi: 10.1016/j.cryobiol.2013.05.010 A. (1999). In vitro production of sexed embryos for gender preselection: high- Wu, J.-T., Chiang, K.-C., and Cheng, F.-P. (2006). Expression of progesterone speed sorting of X-chromosome-bearing sperm to produce pigs after embryo receptor(s) during capacitation and incidence of acrosome reaction induced transfer. J. Anim. Sci. 77, 3346–3352. doi: 10.2527/1999.77123346x by progesterone and zona proteins in boar spermatozoa. Anim. Reprod. Sci. 93, Rodrigues, T. A., Ispada, J., Risolia, P. H., Rodrigues, M. T., Lima, R. S., Assumpcao, 34–45. doi: 10.1016/j.anireprosci.2005.06.007 M. E., et al. (2016). Thermoprotective effect of insulin-like growth factor 1 Xie, L., Tang, Q., Yang, L., and Chen, L. (2016). Insulin-like growth factor on in vitro matured bovine oocyte exposed to heat shock. Theriogenology 86, I promotes oocyte maturation through increasing the expression and 2028–2039. doi: 10.1016/j.theriogenology.2016.06.023 phosphorylation of epidermal growth factor receptor in the zebrafish ovary. Santos, E., Somfai, T., Appeltant, R., Dang-Nguyen, T. Q., Noguchi, J., Kaneko, H., Mol. Cell. Endocrinol. 419, 198–207. doi: 10.1016/j.mce.2015.10.018 et al. (2017). Effects of polyethylene glycol and a synthetic ice blocker during Yeste, M., Estrada, E., Pinart, E., Bonet, S., Miro, J., and Rodriguez-Gil, J. E. (2014). vitrification of immature porcine oocytes on survival and subsequent embryo The improving effect of reduced glutathione on boar sperm cryotolerance development. Anim. Sci. J. 88, 1042–1048. doi: 10.1111/asj.12730 is related with the intrinsic ejaculate freezability. Cryobiology 68, 251–261. Sato, A., Sarentonglaga, B., Ogata, K., Yamaguchi, M., Hara, A., Atchalalt, K., et al. doi: 10.1016/j.cryobiol.2014.02.004 (2018). Effects of insulin-like growth factor-1 on the in vitro maturation of Zhang, W., Yi, K., Yan, H., and Zhou, X. (2012). Advances on in vitro production canine oocytes. J. Reprod. Dev. 64, 83–88. doi: 10.1262/jrd.2017-145 and cryopreservation of porcine embryos. Anim. Reprod. Sci. 132, 115–122. Shi, W.-Q., Zhu, S.-E., Zhang, D., Wang, W.-H., Tang, G.-L., Hou, Y.- doi: 10.1016/j.anireprosci.2012.05.008 P., et al. (2006). Improved development by Taxol pretreatment after Zhou, G. B., and Li, N. (2009). Cryopreservation of porcine oocytes: recent vitrification of in vitro matured porcine oocytes. Reproduction 131, 795–804. advances. Mol. Hum. Reprod. 15, 279–285. doi: 10.1093/molehr/gap016 doi: 10.1530/rep.1.00899 Somfai, T., Ozawa, M., Noguchi, J., Kaneko, H., Kuriani Karja, N. W., Farhudin, Conflict of Interest Statement: The authors declare that the research was M., et al. (2007). Developmental competence of in vitro-fertilized porcine conducted in the absence of any commercial or financial relationships that could oocytes after in vitro maturation and solid surface vitrification: effect be construed as a potential conflict of interest. of cryopreservation on oocyte antioxidative system and cell cycle stage. Cryobiology 55, 115–126. doi: 10.1016/j.cryobiol.2007.06.008 Copyright © 2019 Pereira, Zangeronimo, Castillo-Martín, Gadani, Chaves, Spricigo, J. F., Morato, R., Arcarons, N., Yeste, M., Dode, M. A., Lopez-Bejar, M., Rodríguez-Gil, Bonet and Yeste. This is an open-access article distributed under the et al. (2017). Assessment of the effect of adding L-carnitine and/or resveratrol terms of the Creative Commons Attribution License (CC BY). The use, distribution to maturation medium before vitrification on in vitro-matured calf oocytes. or reproduction in other forums is permitted, provided the original author(s) and Theriogenology 89, 47–57. doi: 10.1016/j.theriogenology.2016.09.035 the copyright owner(s) are credited and that the original publication in this journal Trapphoff, T., Heiligentag, M., Simon, J., Staubach, N., Seidel, T., Otte, is cited, in accordance with accepted academic practice. No use, distribution or K., et al. (2016). Improved cryotolerance and developmental potential of reproduction is permitted which does not comply with these terms. Frontiers in Physiology | www.frontiersin.org 13 January 2019 | Volume 9 | Article 1894