ORIGINAL RESEARCH published: 03 May 2019 doi: 10.3389/fphys.2019.00523 Transport and Recovery of Gilthead Sea Bream (Sparus aurata L.) Sedated With Clove Oil and MS222: Effects on Oxidative Stress Status Mariana Teles 1* † , Miguel Oliveira 2† , Ismael Jerez-Cepa 3 , Lorena Franco-Martínez 4 , Asta Tvarijonaviciute 4 , Lluis Tort 1‡ and Juan M. Mancera 3‡ 1 Department of Cell Biology, Physiology and Immunology, Universitat Autònoma de Barcelona, Barcelona, Spain, 2 Department of Biology, Centre for Environmental and Marine Studies, University of Aveiro, Aveiro, Portugal, 3 Departamento de Biología, Facultad de Ciencias del Mar y Ambientales, Instituto Universitario de Investigación Marina (INMAR), Campus de Excelencia Internacional del Mar (CEIMAR), Universidad de Cádiz, Cádiz, Spain, 4 Interdisciplinary Laboratory of Clinical Analysis INTERLAB-UMU, University of Murcia, Murcia, Spain Edited by: José Luis Soengas, University of Vigo, Spain The use of anesthesia is a common practice in aquaculture to sedate fish and mitigate Reviewed by: handling stress. Although the employ of anesthesia is considered beneficial for fish, Gianluca Polese, University of Naples Federico II, Italy as it reduces stress and improves welfare, at the same time it may induce hazardous Josef Velíšek, side-effects. The aim of the present study was to investigate the effects of clove University of South Bohemia, Czechia oil (CO) and tricaine methanesulfonate (MS222), two of the most used anesthetics, *Correspondence: on several oxidative stress related parameters in gilthead sea bream (Sparus aurata), Mariana Teles mteles0@gmail.com as these types of effects of anesthetics have been seldom investigated. To assess † These authors have contributed these effects, S. aurata juveniles were placed in a setup of mobile water tanks and were equally to this work transported during 6 h with either 2.5 mg/L CO or 5 mg/L MS222. After transport, half ‡ Senior authors of the fish were sampled, whereas the remaining fish were transferred to tanks without Specialty section: anesthetics where they were allowed to recover for 18 h before sampling. Changes This article was submitted to in the expression levels of several target genes related with the antioxidant response Aquatic Physiology, and cell-tissue repair were evaluated in the gills, liver and brain. Those transcripts a section of the journal Frontiers in Physiology included glutathione peroxidase 1 (gpx1), catalase (cat), glutathione S-transferase 3 Received: 21 January 2019 (gst3), glutathione reductase (gr), superoxide dismutase [Zn] (sod2), heat shock Accepted: 11 April 2019 protein-70 (hsp70), and metallothionein (mt). Antioxidant enzymatic activities glutathione Published: 03 May 2019 S-transferase, GST; catalase, CAT; and glutathione reductase, GR, levels of non- Citation: Teles M, Oliveira M, Jerez-Cepa I, enzymatic antioxidants (non-protein thiols – NPT), and pro-oxidative damage, assessed Franco-Martínez L, Tvarijonaviciute A, as lipid peroxidation (LPO), were determined in gills, liver and brain. Acetylcholinesterase Tort L and Mancera JM (2019) activity (AChE) was determined in plasma, gills, brain, muscle and heart as an indicator Transport and Recovery of Gilthead Sea Bream (Sparus aurata L.) of neuro-muscular alterations. In plasma, the total antioxidant capacity (TAC) and total Sedated With Clove Oil and MS222: oxidative status (TOS) were also measured. Results showed that the use of both Effects on Oxidative Stress Status. Front. Physiol. 10:523. anesthetic agents, CO and MS222, interferes with fish antioxidant status. All tested doi: 10.3389/fphys.2019.00523 biological matrices displayed alterations in antioxidant endpoints, confirming that these Frontiers in Physiology | www.frontiersin.org 1 May 2019 | Volume 10 | Article 523 Teles et al. Anesthetics’ Side-Effects on Transported Fish substances, although minimizing the effects of transport stress, may have long term effects on fish defenses. This result is of high relevance to aquaculture considering that the oxidative stress, may increase the susceptibility to different environmental or biotic stress and different types of pathologies. Keywords: anesthesia, clove oil, MS222, marine fish, antioxidants INTRODUCTION which can happen by activation of their synthesis or by an imbalance in the antioxidant defenses (Oliveira et al., 2013). The use of light anesthesia or sedation on fish is a common Among antioxidant defenses, non-enzymatic (e.g., non-protein practice in aquaculture to reduce the stress due to handling, thiols – NPT), as well as enzymatic responses (e.g., glutathione transport, vaccination and blood sampling by depressing reductase – GR; glutathione S-transferases – GST and catalase, fish central and peripheral nervous systems. Tricaine CAT) are frequently assessed as biomarkers of xenobiotic methanesulfonate (MS222) is one of the most widely used mediated oxidative stress (Oliveira et al., 2013). Overwhelmed anesthetics in fish and it is licensed for use in food fish in the antioxidant defenses may result in oxidative stress, which United States and the European Union (FDA, 1997; European may be responsible for pernicious effects like inactivation of Commission, 2010; Velisek et al., 2011; Priborsky and Velisek, enzymes and peroxidative damage (e.g., lipid peroxidation – 2018). Clove oil (CO) has been proposed as a natural alternative LPO). Metallothioneins (MT) are known to be over-expressed and safer anesthetic, easily available and less expensive than in organisms from environments with high metal concentrations MS222 with demonstrated efficiency in several fish species, (Viarengo et al., 1999). Nevertheless, they may also be used including gilthead sea bream, Sparus aurata (Tort et al., 2002; as biomarkers of a general stress response to environmental Vera et al., 2010; Bodur et al., 2018). This anesthetic is a natural contaminants (Oliveira et al., 2009). It has been demonstrated essential oil obtained from the clove tree (Syzygium aromaticum) that the MT gene promoter region contains not only genetic and has as active ingredients eugenol and iso-eugenol (Javahery elements responsive to metals, but also sequences thought to et al., 2012). This anesthetic has been used in several species, be involved in oxidative stress response (Oliveira et al., 2009). including S. aurata (Mylonas et al., 2005; Priborsky and Velisek, Heat shock proteins (HSP) are also markers of cellular stress. 2018). The iso-eugenol is also licensed for use in food fish in the Thus, both MT and HSP can also be used as biomarkers of a European Union (European Commission, 2011), but not clove general cellular stress response to drugs/xenobiotics. In blood oil. The two compounds, MS222 and CO, are administrated plasma, the total antioxidant capacity (TAC), that reflects the by immersion of fish in water with the dissolved anesthetic, combined action of different antioxidants and the total oxidant and thus mainly absorbed through the gills (Sneddon, 2012), status (TOS), that measures the different oxidant species present, biotransformed by the liver and probably the kidneys and mainly have been proposed as valuable endpoints to assess the oxidative excreted through the gills and, to a lesser extent, through the status in fishes after exposure to chemicals (Teles et al., 2016). urine and bile (Carter et al., 2011; Javahery et al., 2012). The aim of the present study was to investigate the potential The use of anesthesia is considered beneficial for fish as it side effects of MS222 and CO on the oxidative status (in gills, reduces stress in handling procedures; however, it may induce plasma, liver, and brain), neurotransmission (in gills, plasma, hazardous side-effects (Ross and Ross, 2008; Priborsky and liver, muscle, and heart), immune function (in plasma) and Velisek, 2018). It was previously demonstrated that MS222 cellular stress (in gills, liver, and brain) in gilthead sea bream induced an avoidance behavior in Danio rerio and Oryzias latipes (S. aurata) after a simulated transportation and a recovery period. (Readman et al., 2013, 2017), affected the natural cytotoxicity Sedation doses of anesthetics are proposed to reduce stress activity of head kidney leucocytes in S. aurata (Cuesta et al., during transport (Zahl et al., 2012; Vanderzwalmen et al., 2018), 2003), and upregulated gill osmoregulatory genes in Salmo salar and S. aurata is an important aquaculture species with a high (Chance et al., 2018). On the other hand, CO has been shown to commercial importance. The selection of tissues was based on induce changes in some hematological parameters in Carassius functions and anatomic locations. Gills were selected as they are a auratus (Abdolazizi et al., 2011), enhance several skin mucosal multifunctional organ with essential osmoregulatory, respiratory immune parameters in Oncorhynchus mykiss (Soltanian et al., and immunologic roles (Evans et al., 2005) in close contact with 2018) and induce the activity of serum and skin mucus natural the external medium and waterborne environmental substances hemolytic complement in S. aurata (Guardiola et al., 2018). (Oliveira et al., 2009); the liver is a major organ in terms of However, the potential side effects of these anesthetic compounds body weight, with relevant functions in energetics, intermediary on fish are not completely clear. These effects are species-specific metabolism, and storage of substances. The brain is the target and also dependent on compounds’ pharmacodynamics in the organ of anesthetic agent’s action in fish, and thus a potential organism, which are related to biological factors and water target of side effects that may include oxidative stress; and, finally, physico-chemical parameters (Ross and Ross, 2008). blood has an important role in the transfer of substances absorbed The toxicity of xenobiotics often depends on their capacity through the gills, skin and gut, and provides information on the to increase cellular levels of reactive oxygen species (ROS), overall health status of the animal. In this regard, these biological Frontiers in Physiology | www.frontiersin.org 2 May 2019 | Volume 10 | Article 523 Teles et al. Anesthetics’ Side-Effects on Transported Fish matrices were considered candidates for the detection of early frozen in liquid nitrogen. Gills, liver and brain were excised, warning signs of possible harmful effects of MS222 and CO used flash frozen in liquid nitrogen and posteriorly used for gene for the transport of S. aurata individuals. expression analysis and biochemical endpoints assessment. The experiment complied with the Guiding Principles for Biomedical Research Involving Animals (EU2010/63), the guidelines of the MATERIALS AND METHODS Spanish laws (law 32/2007 and RD 53/2013), and authorized by the Ethical Committee of the Universidad de Cádiz (Spain) Fish Husbandry and Experimental Design for the use of laboratory animals and the Ethical Committee Juveniles of S. aurata were obtained from Servicios Centrales de from the Andalusian Government (Junta de Andalucía reference Investigación en Cultivos Marinos (SCI-CM, CASEM, University number 28-04-15-241). of Cádiz, Puerto Real, Cádiz, Spain; Spanish Operational Code REGA ES11028000312). Immature gilthead sea bream (S. aurata) RNA Isolation, Retrotranscription, and juveniles (n = 72, 42.7 ± 6.8 g body mass, mean ± SD) were Real-Time Quantitative PCR transferred to the facilities from the Department of Biology at Total RNA was extracted from the selected tissues of control and the Faculty of Marine and Environmental Sciences (CASEM, R exposed fish using Tri Reagent (Sigma-Aldrich) and following University of Cádiz, Puerto Real, Cádiz, Spain) and acclimated manufacturer’s recommendations. RNA quantification was done to laboratory conditions for 7 days in four flow-through 500 L using a NanoDrop Spectrophotometer (Thermo Fisher Scientific, seawater tanks (approximate stocking density: 3.5 kg m−3 ), under United States) and RNA quality checked with Experion, using stable conditions of salinity (38), temperature (19◦ C), and natural the Experion Standard Sens RNA chip (Bio-Rad Laboratories, photoperiod for this season and latitude (May 2015; 13:11 h, United States). Reverse transcription was performed using 1 µg light:dark; 36◦ 310 4500 N, 6◦ 110 3100 W). Animals were fed two of the total RNA using the iScriptTM cDNA synthesis kit (Bio- times daily (1% of tank biomass per day) with commercial pellets Rad, United States) according to the manufacturer’s instructions. for S. aurata (Skretting España S.A., Spain). Efficiency of the amplification was determined for each primer For the transport simulation, fish were randomly placed pair using serial fivefold dilutions of pooled cDNA and calculated into a mobile setup of nine 15 L aquaria, and distributed in as E = 10 (−1/s), where s is the slope generated from the serial three different experimental groups in triplicate. Then, S. aurata dilutions. RT-qPCR was run in a Bio-Rad CFX384 Real-Time juveniles were transported for 6 h with either 2.5 mg of CO L-1 PCR Detection System (Bio-Rad, United States). Reactions were (extracted from cloves of Eugenia spp., Sigma-Aldrich C8392) or R done using iTaqTM Universal SYBR Green Supermix (Bio- 5 mg of MS222 L-1 (Sigma-Aldrich E10521), plus a control group Rad, United States) according to the manufacturer’s instructions. without anesthetics. Briefly, 1 cycle at 95◦ C for 5 min, 40 cycles at 95◦ C for 30 s, 60◦ C Tested concentrations are related to anesthesia induction for 30 s, and 72◦ C for 30 s were run; samples were performed characterization previously done in gilthead sea bream with in triplicates. Expression data, obtained from three independent both anesthetics. The selected doses of the anesthetics were half biological replicates, were used to calculate the threshold cycle of the lowest concentration that induced a light sedation in a (Ct) value. After checking for primers efficiency, RT-qPCR previous characterization performed (data not shown). Higher analysis of all the individual samples was determined following concentrations were not considered in this experimental design the same protocol described above. NormFinder was used to to avoid the induction of deeper sedation or anesthesia stages identify the most appropriate housekeeping gene among the during the transport of fish. tested 3: elongation factor-1α (ef1α), α-tubulin (tub), and β-actin No changes in behavioral or clinical effects due to anesthetics (act). Stability values of the individual candidate housekeeping administration were determined during the transport or recovery genes were: 0.018 for ef1α, 0.022 for act, and 0.028 for tub in period. All aquaria were fully oxygen-saturated with air stones. the gills; 0.017 for ef1α and act, and 0.018 for tub in the liver; Animals were fasted for 24 h before the assay. To simulate 0.022 for tub, 0.038 for act, and 0.052 for ef1α in the brain. The transport conditions, every 20 min the mobile setup of aquaria best combination of two-genes was act + tub with a stability was displaced for 5 min (mimicking noise and vibrational value of 0.017 and 0.010 for the gills ant the liver, respectively. disturbances due to shaking) followed by 15 min of resting. After For the brain, the best combination of two-genes was ef1α + 6 h half of the animals were euthanized and sampled (n = 12 act with a stability value of 0.029. The best combination of two per experimental group, n = 4 animals per tank), whereas the genes for each organ was used for normalization. Normalized remaining fish were transferred to similar clean-water aquaria gene expression calculated with the 11Ct method (Livak and to allow them to recover for 18 h, and then euthanized and Schmittgen, 2001). Primers information is given in Table 1. sampled as well. Sampled animals were netted and deeply anesthetized with 2-phenoxyethanol (1 mL L−1 , Sigma-Aldrich 77699) for blood collection. 2-phenoxyethanol was selected due Sample Preparation for to its low time to induce deep anesthesia (less than 1 min) and Biochemical Analyses to standardize the possible side-effects among groups (control, The samples of tissues for biochemical analysis were MS222 and CO). After blood collection (in less than 3 min since homogenized in potassium phosphate buffer (0.1 M, pH 7.4). capture), fish were euthanized by spinal cord sectioning. Plasma Aliquots of the homogenate were separated for non-protein was isolated by centrifugation (3 min, 10000 × g, 4◦ C), and thiols (NPT), lipid peroxidation (LPO) assessment and Frontiers in Physiology | www.frontiersin.org 3 May 2019 | Volume 10 | Article 523 Teles et al. Anesthetics’ Side-Effects on Transported Fish TABLE 1 | Sequences and efficiencies of primers used for quantitative real-time PCR analysis. Gene name Acronym GenBank ID Forward Reverse Elongation factor-1α ef1α AF184170 CCCGCCTCTGTTGCCTTCG CAGCAGTGTGGTTCCGTTAGC α-Tubulin tub AY326430 AAGATGTGAACTCCGCCATC CTGGTAGTTGATGCCCACCT β-Actin actin X89920 TCCTGCGGAATCCATGAGA GACGTCGCACTTCATGATGCT Glyceraldehyde 3-phosphate gapdh DQ641630 TGCCCAGTACGTTGTTGAGTCCAC CAGACCCTCAATGATGCCGAAGTT dehydrogenase Catalase cat JQ308823 TGGTCGAGAACTTGAAGGCTGTC AGGACGCAGAAATGGCAGAGG Superoxide dismutase (Mn) sod2 JQ308833 CCTGACCTGACCTACGACTATGG AGTGCCTCCTGATAT TTCTCCTCTG Glutathione peroxidase 1 gpx1 DQ524992 GAAGGTGGATGTGAATGGAAAAGATG CTGACGGGACTCCAAATGATGG Glutathione reductase gr AJ937873 TGTTCAGCCACCCACCCATCGG GCGTGATACATCGGAGTGAATGAAGTCTTG Glutathione-S-transferase 3 gst3 JQ308828 CCAGATGATCAGTACGTGAAGACCGTC CTGCTGATGTGAGGAATGTACCGTAAC Metallothionein mt U93206 CTCTAAGACTGGAACCTG GGGCAGCATGAGCAGCAG Heat shock protein 70 hsp70 EU805481 AATGTTCTGCGCATCATCAA GCCTCCACCAAGATCAAAGA post-mitochondrial fraction (PMS) isolation (30 min at was measured spectrophotometrically at 560 nm (Olympus 15,000 g, 4◦ C). Diagnostica, GmbH) using 800 nm as the reference, is related to the total amount of oxidant molecules present in the sample. The Biochemical Analyses assay was calibrated with hydrogen peroxide and the results were The protein content of the homogenates and PMS fractions was expressed in terms of micromole hydrogen peroxide equivalent determined. Protein content was determined by the Bradford per liter (µmolH2 O2 Equiv/L). Lipid peroxidation levels were (1976) method adapted to microplate. Prior to enzymatic determined according to the protocols described by Oliveira analysis, the content of protein in the samples was normalized et al. (2009). Absorbance was measured at 535 nm and LPO to 0.9 mg/mL. After enzymatic determinations, the protein was expressed as nmol of thiobarbituric acid reactive substances concentration in each sample was quantified again and the (TBARS) formed per mg of protein. measured value used to express the enzymatic activities per protein (Oliveira et al., 2012). Cholinesterase activity was Data and Statistical Analysis determined in the gills, brain and heart was determined according Statistical analysis was done using the IBM SPSS Statistics 22 to Ellman et al.’s (1961) method adapted to microplate, at 25◦ C. software package. One-way ANOVA was performed followed by In the blood, AChE was determined according to Tecles and the Dunnett’s test to signal significant differences between treated Cerón (2001) adapted for an automated analyzer (Olympus and control groups. Statistically significant differences between AU600; Olympus Diagnostica GmbH, Hamburg, Germany). The treated groups and their respective controls groups are denoted results were expressed as nmol of thiocholine formed per minute with asterisks. One asterisk indicates p < 0.05, two asterisks per mg of protein. Non-protein thiols content was estimated indicate p < 0.001. generally following the procedure described by Oliveira et al. (2010). Results were expressed as millimoles per milligram of protein. Catalase activity was determined by the method RESULTS of Claiborne (1985) adapted to microplate. Absorbance was recorded spectrophotometrically at 240 nm (25◦ C) and enzyme Molecular Responses activity expressed as micromoles H2 O2 consumed per minute In gills, organisms treated with MS222 increased gpx1 and per milligram protein. Glutathione S-transferase activity was gst3 mRNA levels significantly after 6 h transportation, with measured according to Habig et al. (1974) adapted to microplate. mRNA levels returning to control values after 18 h recovery Absorbance was recorded at 340 nm (25◦ C) and expressed as (Figure 1). However, gr, cat, and sod2 expression levels nmol CDNB conjugate formed per minute per mg of protein. significantly decreased after transportation and recovery period. Glutathione reductase activity was assayed by the method of Gill mt and hsp70 mRNA levels were unaltered (data not shown). Carlberg and Mannervik (1975) adapted to microplate. Enzyme For CO treated fish, the gill’s mRNA levels of gst3 enhanced activity was quantified by measuring NADPH decrease at after transportation, returning to control values after recovery. 340 nm (25◦ C) and expressed as nmol NADPH oxidized/min/mg However, the rest of transcripts assessed (gpx1, cat, gr, mt, and protein. TAC was assessed in the plasma as described by Erel hsp70) didn’t present any change. (2004), by measuring the 2,20 -azinobis-(3-ethylbenzothiazoline- Fish exposed to MS222 enhanced hepatic sod2 and gr mRNA 6-sulfonate) decolorization by antioxidants at 660 nm. The levels after 6 h of transportation, returning to control levels activity was expressed as mmol/L. TOS was measured in plasma after 18 h of recovery; while no alterations were observed in as described by Erel (2005). The method is based on the mRNA levels of gpx1 (Figure 1) as well as cat and gst3 (data reaction that the ferric ion makes a colored complex with not shown). Respect to the assessed cellular stress indicators, xylenol orange in an acidic medium. The color intensity, which although no significant effects were detected after transportation, Frontiers in Physiology | www.frontiersin.org 4 May 2019 | Volume 10 | Article 523 Teles et al. Anesthetics’ Side-Effects on Transported Fish FIGURE 1 | Relative mRNA levels of target genes measured on gills, liver and brain of S. aurata sedated with tricaine methanesulfonate (MS222) or clove oil (CO) after 6 h transportation and 18 h recovery. The horizontal line originating at y = 1 denote the control group against which the expression was normalized. Bars represent the mean value of six fish with standard error. An asterisk indicates statistical significances compared to the control group (p < 0.05). Only parameters that denote statistically significant changes are presented. Frontiers in Physiology | www.frontiersin.org 5 May 2019 | Volume 10 | Article 523 Teles et al. Anesthetics’ Side-Effects on Transported Fish MS222 stimulated significantly mt mRNA levels after recovery In terms of oxidative stress related parameters, plasma TAC period. Finally, hsp70 mRNA values were significantly higher and TOS levels in fish exposed to MS222 and CO were not than controls at both sampling periods. Concerning CO treated significantly affected, when compared to their respective controls animals, a significant increase in gpx1 mRNA levels was (data not shown). Gills enzymatic antioxidant defenses were not found after recovery period despite the lack of effects after responsive to MS222 treatment, whereas CO treated organisms transportation. All the other antioxidant related transcripts significantly increased CAT activity and decreased GST, at both presented no significant differences with respect to control at sampling periods; while GR was significantly enhanced after both sampling points. However, for the cellular stress indicators transportation (Figure 3). (mt and hsp70), CO enhanced significantly hepatic mRNA Considering hepatic enzymatic defenses, CAT and GST expression after transportation but expression returned to control activities in fish exposed to MS222 displayed a significant levels after recovery period. decrease after 6 h transportation returning to control levels after In the brain, the use of MS222 during transportation increased recovery. No significant differences were found between controls mRNA levels of mt, cat, and hsp70 after 6 h but returned and CO treated fish in terms of hepatic enzymatic antioxidant to control levels after recovery period (Figure 1). Expression defenses (Figure 3). The assessed antioxidant defenses were levels for gst3 were significantly higher than controls after 6 not responsive to the tested anesthetics in the brain (data not and 24 h; while the expression of gpx1 and gr displayed no shown). No significant differences between control and treated significant differences from control throughout the experiment. groups were found in the tested organs in terms of peroxidative CO, induced a similar pattern of change in expression levels of damage (data not shown). Respect to non-enzymatic antioxidant mt, gpx1, cat, gst3, and hsp70, with a significantly enhancement defenses, assessed in this study through the quantification of NPT after transportation and returning to control levels after recovery levels, differences to control situation were only found in the liver period (Figure 1). The expression of gr in the brain was unaltered of fish treated with MS222 after 6 h transportation, returning to throughout the experimental assay (data not shown). basal levels after recovery (Figure 3). Biochemical Responses The effects of MS222 and CO on neurotransmission indicators DISCUSSION were assessed through the measurement of AChE activity on different biological matrices (gills, plasma, brain, muscle, and This study aimed to evaluate potential oxidative side effects of the heart). Results showed that fish treated with MS222 significantly use of MS222 and CO anesthetics in a simulated transportation increased AChE activity in plasma both after 6 h transportation of fish. These substances are being used in practice to reduce risk and after recovery period (Figure 2). However, in the heart, of stress-induced problems such as injuries, feeding and immune AChE was significantly inhibited after transportation, returning depression that may induce relevant physiological alterations to control levels after 24 h recovery. Fish treated with CO only in fish and compromise its development, overall health and displayed significant differences to control in the heart, with a welfare (Ross and Ross, 2008; Priborsky and Velisek, 2018). decreased activity after transportation (Figure 2). In addition, slight sedation during transport has been proved to reduce the metabolic rate of fish, and consequently oxygen consumption and generation of waste products, improving water quality management (Zahl et al., 2012; Vanderzwalmen et al., 2018). Despite the recognized applications of anesthetics, the side effects of anesthesia are unknown in many fish species (Bowker et al., 2015), being responses to these chemicals species- and anesthetic-specific (Readman et al., 2017). Thus, it becomes highly relevant to characterize the potential side effects of MS222 and CO to aquaculture fish-species, like S. aurata, where the use of anesthetics is a possible solution to improve animal welfare (Ashley, 2007). Our study confirmed that the use of anesthetics may modulate fish antioxidant responses. This is particularly relevant considering that here may be energetic costs to re- establish the oxidative status and that oxidative stress has been associated with an increased susceptibility to different abiotic and biotic stressors, development of different pathologies and constraint on growth. FIGURE 2 | Cholinesterase activity in plasma and heart of S. aurata sedated The susceptibility of a given organ to a substance is modulated with tricaine methanesulfonate (MS222) or clove oil (CO) after 6 h by (i) the different predisposition to accumulate the substance, transportation and 18 h recovery. Bars represent the mean value of six fish (ii) its characteristic antioxidants basal levels, (iii) its adaptation with standard error. An asterisk indicates statistical significances compared to capacity and consequent antioxidant activation, and (iv) the the control group (p < 0.05). Only parameters that denote statistically significant changes are presented. metabolic rate, thus increasing the potential to produce ROS and challenge the respective defenses (Oliveira et al., 2008). Frontiers in Physiology | www.frontiersin.org 6 May 2019 | Volume 10 | Article 523 Teles et al. Anesthetics’ Side-Effects on Transported Fish FIGURE 3 | Oxidative stress related parameters in the gills and liver of Sparus aurata sedated with tricaine methanesulfonate (MS222) or clove oil (CO) after 6 h transportation and 18 h recovery. An asterisk indicates statistical significances compared to the control group (p < 0.05). Only parameters that denote statistically significant changes are presented. The assessed mRNA levels revealed that gills were more levels appeared/were enhanced after recovery period. These responsive to MS222 than to CO. responses support the idea that the liver presents basal The observed increased expression of gpx1 and gst3 suggests antioxidant levels capable of protecting the cells from MS222 production of reactive species (e.g., hydroperoxides) and induced damage, despite the occurrence of cellular stress, as activation of phase II biotransformation as well as an oxidative suggested by the mt and hsp70 altered levels after recovery. status that could impair gills’ sod2, cat, and gr mRNA levels. Supporting the idea of increased ROS levels is the induction However, hepatic expression levels of the assessed target genes of mt mRNA levels, which have been reported to respond to suggest that liver was less responsive to MS222 than gills. non-metal compounds able to cause oxidative stress in fish Only sod2, cat, and hsp70 were responsive after 6 h cells, despite its upregulation by metals (Oliveira et al., 2009). transportation, increasing mRNA levels. However, after the Despite the lack of inhibition of the assessed antioxidants’ mRNA recovery period, only hsp70 remained different from controls. levels, hsp70 mRNA expression after 6 h transportation suggests Despite not being responsive during transportation, mt mRNA the presence of stress. Contrary to the observed in the gills, Frontiers in Physiology | www.frontiersin.org 7 May 2019 | Volume 10 | Article 523 Teles et al. Anesthetics’ Side-Effects on Transported Fish brain cat expression levels increased after transportation that (Gabryelak et al., 1989) and thus to compromise their use as could indicate lower susceptibility, likely associated with higher biomarkers has been previously reported. Considering the effects basal levels of antioxidants and higher responsiveness than gills. on neurotransmission, data suggest that exposure to MS222 and The mRNA levels of gst3 in the brain were, like in the gills, CO may affect neurotransmission as significant decreases were significantly increased after 6 h transportation but, for this found in the heart, despite the lack of effects observed for the organ, mRNA levels remained higher than controls even after the other tissues. Furthermore, the increased levels of AChE found recovery period, suggesting the formation of hydroperoxides. The in the plasma of fish treated with MS222 may suggest pernicious mt and hsp70 levels in the brain were also responsive to MS222 effects of this anesthetic as previous studies have associated associated cellular stress. Concerning CO, gills’ gst3 expression increases in AChE activity with ongoing apoptotic processes in values displayed a pattern of response similar to MS222. However, the organism (Zhang et al., 2002, 2012) and production of free the mRNA levels of the other assessed endpoints were not altered radicals and oxidative stress (Ferreira et al., 2012). when compared to controls suggesting a lower ability of CO In conclusion, our results indicate that the use of both anes- to induce ROS. Nonetheless, changes in hepatic mt and hsp70 thetic agents, CO and MS222, interfere with fish antioxidant expression suggest the existence of cellular stress that, after 24 h, status. All tested biological matrices displayed alterations in disappears. However, gpx1 was increased in the recovery period, antioxidant endpoints, confirming that these substances, altho- probably due to an increased in ROS production. The brain ugh minimizing the effects of transport stress, may have long appears more sensitive to CO than to MS222, with increased term effects on fish defenses. These results are of high relevance expression of cat, gst3, mt, and hsp70 after 6 h that, after recovery to aquaculture considering that an altered oxidative stress, indu- return to control levels. ced by use of these anesthetics as stress-reducing agent during Considering the molecular responses, two of the most transport, may increase the susceptibility to different environ- commonly assessed enzymatic activities, GST and CAT, were mental or biotic stress and promote different types of pathologies. determined in the three organs, to understand the molecular responses. MS222 displayed no significant effects on gills’ GST activity, despite the increased expression of gst3 and, in the liver, ETHICS STATEMENT the 6 h exposure caused a decreased significantly enzymatic activity. The brain GST activity was also not affected by MS222 The experiment complied with the Guiding Principles for despite the observed increased expression of gst3. CAT activity Biomedical Research Involving Animals (EU2010/63), the in the gills and brain was not significantly altered by MSS222, guidelines of the Spanish laws (law 32/2007 and RD 53/2013), unlike hepatic GST activity that was inhibited after 6 h exposure and authorized by the Ethical Committee of the Universidad despite the non-significant decrease in gst3 mRNA expression. de Cádiz (Spain) for the use of laboratory animals and the Concerning CAT activity, only the liver was sensitive to the Ethical Committee from the Andalusian Government (Junta de treatment, with a significant decrease after 6 h and an increase Andalucía reference number 28-04-15-241). after the recovery period. Previous studies have reported the ability of MS222 to decrease CAT activity in the erythrocytes of the marine fish Dicentrarchus labrax (Gabryelak et al., 1989). AUTHOR CONTRIBUTIONS The non-enzymatic antioxidants in the liver and brain, show JM and IJ-C designed the experiments and performed the that liver was responsive to the MS222 6 h treatment, increasing experimental setup. IJ-C, MT, and MO conducted the the antioxidant defenses. With respect to CO, the biochemical experimental procedures. MT, MO, LF-M, and AT did the endpoints suggest an ability to inhibit GST activity and induce laboratorial analysis and analyzed the results. MT and MO wrote the activity of CAT in the gills, effects that remain even after the manuscript. LT and JM revised the manuscript. All authors the recovery period and were not associated with effects on non- read and approved the manuscript for publication. enzymatic antioxidants. In terms of peroxidative damage, the tested treatments revealed no effects. The TOS and TAC levels in the plasma, that have been proposed as a markers of the oxidative FUNDING status in fish, showed that the anesthetics displayed no significant differences to control. This work was supported by the “Plan Nacional de Investigación,” Overall, the data show that, under the present experimental Government of Spain (AGL2013-48835-C2-2-R and AGL2016- design, anesthetics are able to affect biochemical endpoints in 76069-C2-1-R). MT has a post-doctoral fellowship from FCT gills, liver and brain without significant consequences to the (SFRH/BPD/109219/2015) supported by the European Social health of the tested organisms. Based on the molecular endpoints, Fund and national funds from the “Ministério da Educação e CO appears to induce less effects or effects from which the fish are Ciência (POPH – QREN – Tipologia 4.1)” of Portugal. MO had able to more easily recover than MS222. This could be expected financial support of the program Investigador FCT, co-funded based on the reports in different in vitro assays that show that CO by the Human Potential Operational Programme and European can be an antioxidant, having reducing power, superoxide anion Social Fund (IF/00335-2015). LF-M was granted with predoctoral radical scavenging, hydrogen peroxide scavenging and metal contract “FPU” of the University of Murcia, Spain. AT has chelating activities (Gülçin et al., 2012). The ability of MSS22 to a post-doctoral fellowship “Juan de la Cierva Incorporacion” affect antioxidant defenses such as peroxide metabolism enzymes supported by the “Ministerio de Economía y Competitividad” Frontiers in Physiology | www.frontiersin.org 8 May 2019 | Volume 10 | Article 523 Teles et al. Anesthetics’ Side-Effects on Transported Fish (IJCI-2015-26301), Spain. MT, IJ-C, LT, and JM belong to ACKNOWLEDGMENTS the Fish Welfare and Stress Network (AGL2016-81808-REDT), supported by the Agencia Estatal de Investigación (MINECO, J. C. Balasch and C. Fierro-Castro are acknowledged Spanish Government). for their support. REFERENCES Gülçin, Ý, Elmastaş, M., and Aboul-Enein, H. Y. (2012). Antioxidant activity of clove oil – a powerful antioxidant source. Arab. J. Chem. 5, 489–499. Abdolazizi, S., Ghaderi, E., Naghdi, N., and Kamangar, B. B. (2011). Effects of clove Habig, W. H., Pabst, M. J., and Jakoby, W. B. (1974). Glutathione S-Transferases. oil as an anesthetic on some hematological parameters of Carassius auratus. The first enzymatic step in mercapturic acid formation. J. Biol. Chem. 249, J. Aquac. Res. Dev. 2:108. 7130–7139. Ashley, P. J. (2007). Fish welfare: current issues in aquaculture. Appl. Anim. Behav. Javahery, S., Nekoubin, H., and Moradlu, A. H. (2012). Effect of anaesthesia with Sci. 104, 199–235. doi: 10.1016/j.applanim.2006.09.001 clove oil in fish. Fish Physiol. Biochem. 38, 1545–1552. doi: 10.1007/s10695-012- Bodur, T., Afonso, J. M., Montero, D., and Navarro, A. (2018). Assessment 9682-5 of effective dose of new herbal anesthetics in two marine aquaculture Livak, K. J., and Schmittgen, T. D. (2001). Analysis of relative gene expression species: Dicentrarchus labrax and Argyrosomus regius. Aquaculture 482, data using real-time quantitative PCR and the 2-11CT method. Methods 25, 78–82. 402–408. Bowker, J. D., Trushenski, J. T., Glover, D. C., Carty, D. G., and Wandelear, N. Mylonas, C. C., Cardinaletti, G., Sigelaki, I., and Polzonetti-Magni, A. (2005). (2015). Sedative options for fish research: a brief review with new data on Comparative efficacy of clove oil and 2-phenoxyethanol as anesthetics in the sedation of warm-, cool-, and coldwater fishes and recommendations for the aquaculture of European sea bass (Dicentrarchus labrax) and gilthead sea bream drug approval process. Rev. Fish Biol. Fish. 25, 147–163. (Sparus aurata) at different temperatures. Aquaculture 246, 467–481. Bradford, M. M. (1976). A rapid and sensitive method for the quantitation of Oliveira, M., Ahmad, I., Maria, V. L., Pacheco, M., and Santos, M. (2010). microgram quantities of protein utilizing the principle of protein-dye binding. Antioxidant responses versus DNA damage and lipid peroxidation in golden Anal. Biochem. 72, 248–254. grey mullet liver: a field study at Ria de Aveiro (Portugal). Arch. Environ. Carlberg, I., and Mannervik, B. (1975). Purification and characterization of Contam. Toxicol. 59, 454–463. doi: 10.1007/s00244-010-9491-8 the flavoenzyme glutathione reductase from rat liver. J. Biol. Chem. 250, Oliveira, M., Gravato, C., and Guilhermino, L. (2012). Acute toxic effects of pyrene 5475–5480. on Pomatoschistus microps (Teleostei, Gobiidae): mortality, biomarkers and Carter, K. M., Woodley, C. M., and Brown, R. S. (2011). A review of tricaine swimming performance. Ecol. Indic. 19, 206–214. methanesulfonate for anesthesia of fish. Rev. Fish Biol. Fish. 21, 51–59. Oliveira, M., Maria, V. L., Ahmad, I., Serafim, A., Bebianno, M. J., Pacheco, M., Chance, R. J., Cameron, G. A., Fordyce, M., Noguera, P., Wang, T., Collins, C., et al. (2009). Contamination assessment of a coastal lagoon (Ria de Aveiro, et al. (2018). Effects of repeated anaesthesia on gill and general health of Atlantic Portugal) using defence and damage biochemical indicators in gill of Liza salmon, Salmo salar. J. Fish Biol. 93, 1069–1081. doi: 10.1111/jfb.13803 aurata - An integrated biomarker approach. Environ. Pollut. 157, 959–967. Claiborne, A. (1985). “Catalase activity,” in CRC Handbook of Methods in Oxygen doi: 10.1016/j.envpol.2008.10.019 Radical Research, ed. R. A. Greenwald (Florida, FL: CRC Press), 283–284. Oliveira, M., Pacheco, M., and Santos, M. A. (2008). Organ specific antioxidant Cuesta, A., Ángeles Esteban, M., and Meseguer, J. (2003). Effects of different responses in golden grey mullet (Liza aurata) following a short-term exposure stressor agents on gilthead seabream natural cytotoxic activity. Fish Shellfish to phenanthrene. Sci. Total Environ. 396, 70–78. doi: 10.1016/j.scitotenv.2008. Immunol. 15, 433–441. 02.012 Ellman, G. L., Courtney, K. D., Andres, V., and Featherstone, R. M. (1961). A new Oliveira, M., Ribeiro, A., Hylland, K., and Guilhermino, L. (2013). Single and and rapid colorimetric determination of acetylcholinesterase activity. Biochem. combined effects of microplastics and pyrene on juveniles (0+ group) of the Pharmacol. 7, 88–95. common goby Pomatoschistus microps (Teleostei, Gobiidae). Ecol. Indic. 34, Erel, O. (2004). A novel automated direct measurement method for total 641–647. antioxidant capacity using a new generation, more stable ABTS radical cation. Priborsky, J., and Velisek, J. (2018). A review of three commonly used fish Clin. Biochem. 37, 277–285. anesthetics. Rev. Fish. Sci. Aquac. 26, 417–442. Erel, O. (2005). A new automated colorimetric method for measuring total oxidant Readman, G. D., Owen, S. F., Knowles, T. G., and Murrell, J. C. (2017). Species status. Clin. Biochem. 38, 1103–1111. specific anaesthetics for fish anaesthesia and euthanasia. Sci. Rep. 7:7102. doi: European Commission (2010). Commission regulation (EU) No 37/2010 of 22 10.1038/s41598-017-06917-2 December 2009. Off. J. Eur. Union 2010, 1–72. doi: 10.1002/jssc.201100971 Readman, G. D., Owen, S. F., Murrell, J. C., and Knowles, T. G. (2013). Do fish European Commission (2011). Commission regulation (EU) No 363/2011 of 13 perceive anaesthetics as aversive? PLoS One 8:e73773. doi: 10.1371/journal. April 2011. Off. J. Eur. Union 2011, 28–29. pone.0073773 Evans, D. H., Piermarini, P. M., and Choe, K. P. (2005). The multifunctional fish Ross, L. G., and Ross, B. (eds) (2008). Anaesthetic and Sedative Techniques for gill: dominant site of gas exchange, osmoregulation, acid-base regulation, and Aquatic Animals. Hoboken, NJ: Blackwell Publishing Ltd. excretion of nitrogenous waste. Physiol. Rev. 85, 97–177. Sneddon, L. U. (2012). Clinical anesthesia and analgesia in fish. J. Exotic Pet Med. FDA (1997). Approved Aquaculture Drugs. U.S. Food Drug Adm. Available 21, 32–43. at: https://www.fda.gov/AnimalVeterinary/DevelopmentApprovalProcess/ Soltanian, S., Hoseinifar, S. H., and Gholamhosseini, A. (2018). Modulation of Aquaculture/ucm132954.htm (accessed November 12, 2018) rainbow trout (Oncorhynchus mykiss) cutaneous mucosal immune responses Ferreira, G. K., Carvalho-Silva, M., Gonçalves, C. L., Vieira, J. S., Scaini, following anesthesia: a comparative study on different anesthetic agents. Fish G., Ghedim, F. V., et al. (2012). l-Tyrosine administration increases Shellfish Immunol. 80, 319–324. doi: 10.1016/j.fsi.2018.06.032 acetylcholinesterase activity in rats. Neurochem. Int. 61, 1370–1374. doi: 10. Tecles, F., and Cerón, J. J. (2001). Determination of whole blood cholines- 1016/j.neuint.2012.09.017 terase in different animal species using specific substrates. Res. Vet. Sci. 70, Gabryelak, T., Zalesna, G., Roche, H., and Pérès, G. (1989). The effect 233–238. of MS 222 an anaesthetic on the peroxide metabolism enzymes in Teles, M., Fierro-Castro, C., Na-Phatthalung, P., Tvarijonaviciute, A., Trindade, T., erythrocytes of freshwater and marine fish species. Comp. Biochem. Physiol. C Soares, A. M. V. M., et al. (2016). Assessment of gold nanoparticle effects in 92, 5–8. a marine teleost (Sparus aurata) using molecular and biochemical biomarkers. Guardiola, F. A., Saraiva-Fraga, M., Cuesta, A., and Esteban, M. A. (2018). Changes Aquat. Toxicol. 177, 125–135. doi: 10.1016/j.aquatox.2016.05.015 in natural haemolytic complement activity induced by stress in gilthead Tort, L., Puigcerver, M., Crespo, S., and Padrós, F. (2002). Cortisol and seabream (Sparus aurata L.). Fish Shellfish Immunol. 78, 317–321. doi: 10.1016/ haematological response in sea bream and trout subjected to the anaesthetics j.fsi.2018.04.056 clove oil and 2-phenoxyethanol. Aquac. Res. 33, 907–910. Frontiers in Physiology | www.frontiersin.org 9 May 2019 | Volume 10 | Article 523 Teles et al. Anesthetics’ Side-Effects on Transported Fish Vanderzwalmen, M., Eaton, L., Mullen, C., Henriquez, F., Carey, P., Snellgrove, D., insulin-dependent diabetes mellitus pathogenesis. Acta Biochim. Biophys. Sin. et al. (2018). The use of feed and water additives for live fish transport. Rev. 44, 207–216. doi: 10.1093/abbs/gmr121 Aquac. 11, 263–278. doi: 10.1111/raq.12239 Zhang, X. J., Yang, L., Zhao, Q., Caen, J. P., He, H. Y., Jin, Q. H., et al. (2002). Velisek, J., Stara, A., Li, Z.-H., Silovska, S., and Turek, J. (2011). Comparison of the Induction of acetylcholinesterase expression during apoptosis in various cell effects of four anaesthetics on blood biochemical profiles and oxidative stress types. Cell Death Differ. 9, 790–800. biomarkers in rainbow trout. Aquaculture 310, 369–375. Vera, L. M., Ros-Sánchez, G., García-Mateos, G., and Sánchez-Vázquez, F. J. Conflict of Interest Statement: The authors declare that the research was (2010). MS-222 toxicity in juvenile seabream correlates with diurnal activity, conducted in the absence of any commercial or financial relationships that could as measured by a novel video-tracking method. Aquaculture 307, 29–34. be construed as a potential conflict of interest. Viarengo, A., Burlando, B., Dondero, F., Marro, A., and Fabbri, R. (1999). Metallothionein as a tool in biomonitoring programmes. Biomarkers 4, Copyright © 2019 Teles, Oliveira, Jerez-Cepa, Franco-Martínez, Tvarijonaviciute, 455–466. doi: 10.1080/135475099230615 Tort and Mancera. This is an open-access article distributed under the terms Zahl, I. H., Samuelsen, O., and Kiessling, A. (2012). Anaesthesia of farmed fish: of the Creative Commons Attribution License (CC BY). The use, distribution or implications for welfare. Fish Physiol. Biochem. 38, 201–218. doi: 10.1007/ reproduction in other forums is permitted, provided the original author(s) and the s10695-011-9565-9561 copyright owner(s) are credited and that the original publication in this journal Zhang, B., Yang, L., Yu, L., Lin, B., Hou, Y., Wu, J., et al. (2012). is cited, in accordance with accepted academic practice. No use, distribution or Acetylcholinesterase is associated with apoptosis in β cells and contributes to reproduction is permitted which does not comply with these terms. Frontiers in Physiology | www.frontiersin.org 10 May 2019 | Volume 10 | Article 523