Original Research published: 01 October 2019 doi: 10.3389/fpls.2019.01219 CmVPS41 Is a General Gatekeeper for Resistance to Cucumber Mosaic Virus Phloem Entry in Melon Laura Pascual 1†, Jinqiang Yan 1‡, Marta Pujol 1,2, Antonio J. Monforte 3, Belén Picó 4 and Ana Montserrat Martín-Hernández 1,2* Edited by: 1Centre for Research in Agricultural Genomics (CRAG) CSIC-IRTA-UAB-UB, C/Vall Moronta, Edifici CRAG, Bellaterra Yiqun Weng, (Cerdanyola del Vallés), Barcelona, Spain, 2 Institut de Recerca i Tecnologia Agroalimentàries (IRTA), Campus UAB, Bellaterra, University of Wisconsin-Madison, Barcelona, Spain, 3 Instituto de Biología Molecular y Celular de Plantas (IBMCP), Universitat Politècnica de València (UPV)- United States Consejo Superior de Investigaciones Científicas (CSIC), Valencia, Spain, 4 COMAV, Institute for the Conservation and Reviewed by: Breeding of Agricultural Biodiversity, Universitat Politècnica de València (UPV), Camino de Vera s/n, Valencia, Spain Luming Yang, Henan Agricultural University, China Melon production is often compromised by viral diseases, which cannot be treated with Yong Xu, chemicals. Therefore, the use of genetic resistances is the main strategy for generating Beijing Academy of Agriculture and Forestry Sciences,China crops resistant to viruses. Resistance to Cucumber mosaic virus (CMV) in melon is *Correspondence: scarcely described in few accessions. Until recently, the only known resistant accessions Ana Montserrat Martín-Hernández were Freeman’s Cucumber and PI 161375, cultivar Songwhan Charmi (SC). Resistance montse.martin@irta.cat to CMV in melon is recessive and generally oligogenic and quantitative. However, in SC, Present address: † Laura Pascual, the resistance to CMV strains of subgroup II is monogenic, depending only on one gene, Department of Biotechnology–Plant cmv1, which is able to stop CMV movement by restricting the virus to the bundle sheath Biology, School of Agricultural, cells and preventing a systemic infection. This restriction depends on the viral movement Food and Biosystems Engineering, Universidad Politécnica de Madrid, protein (MP). Chimeric viruses carrying the MP of subgroup II strains, like the strain LS Madrid, Spain (CMV-LS), are restricted in the bundle sheath cells, whereas those carrying MP from Present address: ‡ subgroup I, like the strain FNY (CMV-FNY), are able to overcome this restriction. cmv1 Jinqiang Yan, Vegetable Research Institute, encodes a vacuolar protein sorting 41 (CmVPS41), a protein involved in the transport of Guangdong Academy of Agricultural cargo proteins from the Golgi to the vacuole through late endosomes. We have analyzed Science, Guangzhou, China the variability of the gene CmVPS41 in a set of 52 melon accessions belonging to 15 melon groups, both from the spp melo and the spp agrestis. We have identified 16 different Specialty section: This article was submitted to haplotypes, encoding 12 different CmVPS41 protein variants. Challenging members Plant Breeding, of all haplotypes with CMV-LS, we have identified nine new resistant accessions. The a section of the journal Frontiers in Plant Science resistance correlates with the presence of two mutations, either L348R, previously found Received: 18 June 2019 in the accession SC and present in other three melon genotypes, or G85E, present in Accepted: 04 September 2019 Freeman’s Cucumber and found also in four additional melon genotypes. Moreover, the Published: 01 October 2019 new resistant accessions belong to three different melon horticultural groups, Conomon, Citation: Makuwa, and Dudaim. In the new resistant accessions, the virus was able to replicate Pascual L, Yan J, Pujol M, Monforte AJ, Picó B and and move cell to cell, but was not able to reach the phloem. Therefore, resistance to Martín-Hernández AM (2019) phloem entry seems to be a general strategy in melon controlled by CmVPS41. Finally, CmVPS41 Is a General Gatekeeper for Resistance to Cucumber the newly reported resistant accessions broaden the possibilities for the use of genetic Mosaic Virus Phloem Entry in Melon. resistances in new melon breeding strategies. Front. Plant Sci. 10:1219. doi: 10.3389/fpls.2019.01219 Keywords: melon, genetic diversity, VPS41, Cucumber mosaic virus, Resistance, Phloem loading Frontiers in Plant Science | www.frontiersin.org 1 October 2019 | Volume 10 | Article 1219 Pascual et al. CMV Resistance in Melon Diversity INTRODUCTION The most studied resistance to CMV reported to date is that derived from the SC genotype. It is strain specific, recessive, Melon (Cucumis melo L.) belongs to the family Cucurbitaceae and complex, controlled by at least three quantitative trait loci and is one of the most productive crops in the world, with (QTLs) (Guiu-Aragonés et al., 2014). The major QTL is the gene above 30 million tones/year (FAOSTAT http://www.fao.org/ cmv1, which by itself confers resistance against CMV strains of faostat/en/). C. melo has been traditionally divided into two SG II (Essafi et al., 2009; Guiu-Aragonés et al., 2015). cmv1 is subspecies defined by the pubescence of the ovary, spp. melo and also necessary for resistance to strains of SG I, but in this case, spp. agrestis (Kirkbride, 1993), but most recent classifications it is not sufficient and requires the contribution of the other two use horticultural groups defined by vine, flowering, fruit traits, QTLs, as an example of the defense–counter defense established and geographic criteria. Pitrat (2017) described 19 horticultural between pathogen and host (Guiu-Aragonés et al., 2014). The groups including wild, feral, and domesticated melons: agrestis, recessive resistance genes against viruses usually encode host kachri, chito, tibish, acidulus, momordica, conomon, makuwa, proteins recruited by the virus to complete its cycle. Mutations chinensis, flexuosus, chate, dudaim, chandalak, indicus, ameri, in these genes may lead to resistance. Most recessive resistance cassaba, ibericus, inodorus, and cantalupensis. These groups genes identified encode either eukaryotic translation initiation represent the broad phenotypical variability in agronomical factors (eIFs) or other factors involved in virus accumulation traits, such as ripening, sugar accumulation, or fruit morphology (for a review, see (Hashimoto et al., 2016). However, unlike displayed by the cultivars and landraces of this species. Most previously reported recessive resistance genes, cmv1 is involved sources of resistance to viruses and pests identified so far belong in the transport of the virus and prevents systemic infection to the acidulus and momordica groups from India and to the (Guiu-Aragonés et al., 2016). In the inoculated leaf of the Far Eastern group of conomon, chinensis, and makuwa melons resistant plant, the CMV strain LS (SG II) is able to move from (those frequently referred to as conomon group) (Robinson and cell to cell up to the vein but remains restricted to the bundle Decker-Walters, 1997; Blanca et al., 2012; Leida et al., 2015). sheath (BS) cells and does not enter the phloem (Guiu-Aragonés One of the most devastating plant viruses for melon is Cucumber et al., 2016). Therefore, the plant is resistant to systemic infection. mosaic virus (CMV), which produces typical mosaic in leaves However, the strain FNY (SG I) can overcome this barrier and and fruits and stunting plants. CMV is the type member of the enter the phloem. The viral protein that determines if the virus Cucumovirus genus. It is a viral species with high sequence variability, is transported to the phloem is the movement protein (MP). resulting in large number of strains that can infect a broad range of A CMV carrying the MP of LS cannot be transported to the plant species, including economically important crops, such as other phloem when inoculated into a plant carrying cmv1. However, main cucurbits (watermelon, cucumber, squash, and zucchini) as a CMV clone carrying the MP from FNY will be translocated well as crops of the Solanaceae and Cruciferae families (Edwardson (Guiu-Aragonés et al., 2015). cmv1, therefore, is a gatekeeper and Christie, 1991). On the basis of their sequence, CMV strains that determines if the virus is either transported to the phloem are divided into two subgroups [subgroup I (SG I) and subgroup to produce a systemic infection (susceptible plant) or remains II (SG II)] showing ~70% sequence homology between groups restricted to the BS cells (resistant plant). This discrimination (Roossinck, 2001). Genetic resistances are the most successful occurs depending on the MP and only in the BS cells, since cmv1 way of preventing viral infections. However, modern commercial does not affect the cell-to-cell movement in other cells of the cultivars usually lack genetic resistances, and it is necessary to inoculated leaves. introgress them from landraces and wild accessions (Pitrat, 2008; Map-based cloning of cmv1 has shown that this gene encodes a Pitrat, 2017). Until recently, only a few melon genotypes, mostly vacuolar protein sorting 41 (CmVPS41) (Giner et al., 2017). This from Asia, have been reported as resistant to CMV. The most protein is normally involved in the transport of proteins in vesicles frequently resistance sources used in different studies have been the from the late Golgi to the vacuole as part of the “homotypic fusion Japanese Freeman’s Cucumber (Karchi et al., 1975) and PI 161375, and vacuole protein sorting” complex (Asensio et al., 2013; Pols the Korean cultivar “Songwhan Charmi” (Con-SCKo) (from now et al., 2013). CMV might, therefore, recruit CmVPS41 through on, SC) (Risser et al., 1977), classified as conomon and chinensis, its MP to be transported to the phloem. The polymorphism respectively (Pitrat, 2017). Genetic studies show that, in both L348R, present in SC, was reported as the causal mutation that cases, resistance is oligogenic, recessive (Pitrat and Lecoq, 1980), restricts phloem entry in this accession. (Giner et al., 2017). quantitative (Dogimont et al., 2000), and also strain specific (Diaz Here, we explore the possibilities ofCmVPS41 as target for et al., 2003). Other studies report resistance in several cultivars of resistance by sequencing it in 50 new melon genotypes. We have the makuwa group (Pitrat and Lecoq, 1980; Hirai and Amemiya, selected the accessions to represent 15 different horticultural 1989). Surveys carried out more recently have found other sources groups covering an ample spectrum of melon diversity. We report of resistance, mostly Indian cultivars of the momordica group but 14 new haplotypes and 9 newly discovered resistant accessions, also some Iranian accessions (Dhillon et al., 2007; Fergany et al., including Freeman’s Cucumber. The resistance to CMV shown 2011; Malik et al., 2014; Argyris et al., 2015). For most of them, the by these genotypes was demonstrated to be allelic with that of genetic control remains undetermined, and the strain specificity SC. Moreover, the resistance is manifested as a restriction in of these resistances was not reported. Therefore, the introduction phloem entry, as it occurs in the previously reported SC genotype of resistances to CMV in commercial cultivars is still challenging, (Guiu-Aragonés et al., 2016). These new alleles represent new and likely, the combination of genes/alleles from different sources opportunities for diversifying the resistance to CMV derived would contribute to a broad-based resistance against these viruses. from CmVPS41 during breeding programs. Frontiers in Plant Science | www.frontiersin.org 2 October 2019 | Volume 10 | Article 1219 Pascual et al. CMV Resistance in Melon Diversity MATERIALS AND METHODS fragments were purified with sepharose columns and sequenced by capillary electrophoresis at Macrogen (Macrogen Europe, Plant and Virus Material Amsterdam, The Netherlands). Sequences were analyzed with Melon genotypes used were a Spanish “Piel de Sapo” inbred Sequencher® version 5.0 sequence analysis software (Gene Codes line (In-PsSp) (from now on PS), traditionally included in the Corporation, Ann Arbor, MI, USA (http://www.genecodes.com) inodorus group and now classified within the ibericus group and aligned with PS exons in order to detect polymorphisms. The (Pitrat, 2017), the Korean accession PI 161375, cultivar Songwhan obtained information was used to reconstruct CmVPS41 complete Charmi (Con-SCKo) (from now on SC), belonging to the coding sequence for each accession and to define haplotypes. chinensis group, and 50 additional accessions listed in Table 1. Nucleotide sequences for each identified haplotype were translated These accessions represent many of the groups described by Pitrat with ExPASy translation tool (http://web.expasy.org/translate/). 2017: cantalupensis, ameri, chandalak, dudaim, chate, flexuosus, DNA or protein sequences were aligned using ClustalW conomon, makuwa, chinensis, momordica, acidulus, tibish, chito, (Thompson et al., 1994). Phylogenic trees from the nucleotide and agrestis. We included at least one accession per group and alignment were calculated employing neighbor-joining method, included a higher number of accessions from the groups where with Jukes–Center distance and 100 bootstraps. For proteins, we resistances had been previously described (conomon, makuwa, employed neighbor-joining method, with Tamura distance and chinensis). Most of the selected accessions were molecularly 100 bootstraps. For the CmVPS41 gene, haplotype networks were characterized previously (Leida et al., 2015) and classified in constructed using PopArt (Leigh and Bryant, 2015) employing seven structure groups. The selection included accessions from the minimum spanning method (Bandelt et al., 1999) Effects of all the structure groups detected, thus representing a wide range the polymorphisms in the CmVPS41 protein were predicted with of melon diversity (Table 1; Supplementary Table 1). Protein Variation Effect Analyzer (PROVEAN) [http://provean. CMV strain LS, belonging to SG II and provided by Dr. J. Diaz- jcvi.org/index.php, (Choi et al., 2012)] changes were considered Pendón (CSIC, EELM, Málaga, Spain), was used for inoculations. deleterious when the predicted PROVEAN score was lower than ‑2.5. The Plaza database, version 3.0 dicots (http://bioinformatics. psb.ugent.be/plaza/), was used to identify orthologues of the Sequencing CmVPS41, Analysis, and VPS41 gene in other plant species whose genome was available. Identification of Haplotypes and Proteins. CmVPS41 genomic sequence (http://melonomics.cragenomica. es/) was used to design seven primers pairs in order to amplify Inoculation With CMV And Virus Detection the complete coding sequence (Giner et al., 2017), using Inoculation and virus detection were done as previously described Primer3 software (Untergasser et al., 2012) (http://bioinfo. by Essafi and collaborators (2009), using at least six plants by tested ut.ee/primer3-0.4.0/) (Supplementary Table 2). PCR amplified genotype. Briefly, seeds were pregerminated by soaking them in TABLE 1 | Accessions analyzed in this work. Indicated are CmVPS41 gene haplotype, CmVPS41 protein allele, response to the inoculation with CMV-LS number of accessions tested, accessions code, assigned group according to previous structure analysis. Haplotype gene Protein type (12) CMV-LS* Accessions** Structure group*** Hap-1 Prot-1 S (2/4) Ib-PSSP, Am-Bol, Can-VedFran, Con-YaPuJa 3, A, 1, (1,6) Hap-2 Prot-2 S (8/26) 26 accessions**** 5, (7,6), (6,2), A, (6,5), 6, (6,3), (6,7,2), (5,4) Hap-2-C1012Irak Prot-2-C1012Irak S Dud-C1012Irak – Hap-2-Ksud Prot-2 – Tibish-Ksud 7 Hap-2-QPMAfg Prot-2 R Dud-QPMAfg 6,7,2 Hap-3 Prot-3 R (4/4) Con-SCKo, Con-GMJa, Con-Chi52Chi, Con-MielChi 6, (1,6), (6,5) Hap-4 Prot-4 R (4/4) Con-FreeCJa, Con-NanChi, Con-OgonChi, Con-ShiroJa 6 Hap-4-Pat81Ko Prot-4-Pat81Ko R Con-Pat81Ko 6 Hap-5 Prot-5 S (2/2) Flex-AryaInd, Ag-TriInd A Hap-5-Kakru Prot-5 S Ag-KakInd – Hap-5-TGR1551Zimb Prot-5 TGR1551Zimb S Ac-TGR1551Zimb 7,6 Hap-6 Prot-2 – Ag-15591Gha, Ag-TayCam 7 Hap-6-C38Nig Prot-6-C38Nig S Ag-C38Nig 7 Hap-6-C836CV Prot-6-C836CV S Ag-C836CV – Hap-7-CarBItA Prot-7-CarBIta S Chate-CarBIta 1,4,5 Hap-7-SanIlPhil Prot-7-SanIlPhil S Con-SanIlPhil 6,7 *Response to LS inoculation. S, susceptible; R, resistant. In parentheses, number of accessions tested out of total number of accessions with a given haplotype. **First part of accession code indicates melon type, last part country of origin. ***Structure groups according to Leida et al. (2015): 1 and 2: Cantalupensis accessions, French charentais and reticulatus, respectively, 3: Spanish inodorus, 4: Worldwide inodorus and ameri, 5: Asian ameri, 6: Oriental melons, conomon, chinensis, and makuwa, 7: African agrestis, A: Admixture, accessions that could not be associated to any of the groups. ****Con-LongtChi, Con-KNMJa, Mom-KhaInd, Dud-DudaimFra, Con-CUM206Chi, Mom-PI124Ind, Chi-VellInd, Dud-QAPMSwitz, Mom-PI414Ind, Con-GouChi, Con- Baish1Chin, Con-Baish2Chin, Con-LongtChi, Con_Xiao1Chin, Con-HerChin, Am-KizilUzbe, Con-BaishChin, Con-Co6Chi, Con-GapPhi, Con-PauPol, Con-XiaoChi, Dud-DudaimAfg, Mom-MR1Ind, Ag-WCHInd, Am-ChanRus, Con-OmGMJa. Frontiers in Plant Science | www.frontiersin.org 3 October 2019 | Volume 10 | Article 1219 Pascual et al. CMV Resistance in Melon Diversity water overnight and then kept for 2–4 days in 12 h light at 28°C. dudaim melon, Dud-C1012Irak, and one wild African agrestis, Seedlings were grown in growth chambers (Sanyo MLR-350H, Ag-C836CV (Table 1)]. Sanyo Electric Biomedical Co, Osaka, Japan) during the whole In the whole set of 52 accessions, 27 single nucleotide essay, in long-day conditions of 22°C for 16 h with 5,000 lx of light polymorphisms (SNPs) were identified (Figure 1), being 18 and 18°C for 8 h in the dark. Viral inocula were prepared from of them singletons and defining 14 new CmVPS41 haplotypes freshly symptomatic leaves of zucchini (“Chapin F1,” Semillas (Figure 1), different from those from PS (Hap-1) and SC (Hap-3) Fito SA, Barcelona) and rub inoculated onto the cotyledons of (Figure 2). The most represented haplotype (Hap-2) was present young melon plants still without leaves. Symptoms were scored in 26 melon genotypes (Table 1, Figure 2B). After removing the visually at 7, 14, and 21 days postinoculation (dpi), and viral singletons, seven core haplotypes remained, and two haplotype detection was done by double antibody sandwich ELISA in young blocks were evident, one from position 1 to 1,858 and another developed leaves from the six inoculated plants. Analysis was from 1,858 to 2,583 (Table 1, Figure 1B). done with CMV-specific polyclonal antisera (Loewe Biochemica The haplotype 1 (Hap-1) was present in the two modern GmbH, Otterfing, Germany) following manufacturer’s protocol. European cultivars, PS (the susceptible control) and Védrantais ELISA reactions were measured spectrophotometrically at 405 (Can-VedFran), representing the Spanish inodorus and nm using the VICTOR3 V multilabel plate reader (PerkinElmer). French cantalupensis groups, respectively (Table 1). Hap-1 ELISA was considered positive when absorbance at 405 nm was was also shared by two cultivars: the Japanese Yamato Purinsu larger than twice the negative control value. PS and SC were used (Con-YaPuJa), classified as makuwa, but grouped within the as susceptible and resistant controls, respectively. SC12-1-99 cantalupensis group by Leida et al. (2015), and the American NIL, derived from the NIL SC12-1 (Essafi et al., 2009), carrying a landrace Am-Bol, from Bolivia, which also showed genome shorter introgression of SC that contains the cmv1 gene, was also admixture in previous analysis (Table 1). used as resistant control. Negative controls were prepared from The haplotype 2 (Hap-2) was present in the vast majority of leaf tissue extracts of mock-inoculated plants. accessions, mostly from Asia, belonging to different horticultural types, such as the assayed Indian momordica, the chandalack and ameri accessions from Central Asia, and most of the makuwa and Crosses And Allelism Tests chinensis Far eastern melons (all in the well-defined structure A subset of the resistant accessions identified (at least one by group of oriental melons) (Table 1). Asian dudaim melons haplotype) was crossed with melon accessions PS and NIL SC12- (molecularly related to the oriental group, but with admixture 1-99. At least six F1 plants from each cross were tested against from other groups) also showed this haplotype, although two CMV-LS. After inoculation with CMV-LS, a resistance source of the dudaim accessions from the Near East had unique Hap-2 was considered allelic only when none of the F1 plants from derived haplotypes (Dud-C1012Irak and Dud-QPMAfg). the cross with SC-12-1-99 plants showed symptoms, and the F1 Hap-2 was also present in two small-fruited accessions from plants from the cross with PS were infected. India, the chito-type Velleri (Chi-VellInd) and the wild agrestis (Ag-WChInd). The only African type with Hap-2 was the Tibish Detection Of CMV-LS In The Phloem accession Tibish-KSud, considered a melon domesticated in First true leaf of six plants per genotype was inoculated with Africa from wild African agrestis (Endl et al., 2018) (Table 1, CMV-LS. After detection of yellow areas around the entrance Figure 2B). points, the petiole of this leaf was collected at 11 dpi. RNA The other five haplotypes likely arose by single nucleotide was isolated, and the presence of the virus in the phloem mutations from haplotype 2 (Figure 2B) mostly in positions was tested by reverse transcription PCR as described (Guiu- between 254 and 1,043, while no mutation was observed between Aragonés et al., 2015). CMV-LS, specific primer LS1-1400R positions 1,858 to 2,583, suggesting that the SNPs in this part of (GAAGCATTCCACATATCGTAC), was used for RT, and the the sequence are in high linkage disequilibrium, whereas SNPs in same primer together with LS1-900F (GTTTTATTTACAAG the first part of the gene are in linkage equilibrium. AGCGTACG) were used to amplify a 500-bp fragment of the Interestingly, two of these five haplotypes, haplotypes 3 (Hap- viral genome. 3, that of the resistant control SC) and 4 (Hap-4), were present in the remaining accessions of the oriental melon group from China, Korea, and Japan (conomon, chinensis, and makuwa) RESULTS that belong to the same structure group than Far Eastern melons displaying Hap-2 (Table 1). Identification Of New CmVPS41 Melon Haplotype 5 (Hap-5) was found in two wild Indian agrestis, Haplotypes And Protein Variants. trigonus and kakru (Ag-TriInd and Ag-KakInd), and in the To study the genetic variability of the melon VPS41gene, 52 unique accessions analyzed of the flexuosus (Flex-AryaInd) melon genotypes, including PS and SC, from 15 different melon and acidulus (Ac-TGR1551Zimb) groups, whereas haplotype 6 groups were chosen. The CmVPS41 genomic sequence was either (Hap-6) was characteristic of the wild Central African agrestis sequenced or was obtained from the available whole genome accessions (Table 1). The last haplotype (Hap-7) was found in sequences (Sanseverino et al., 2015) [those from the two controls, two accessions, one Italian (Chate-CarBIta) and one chinensis PS and SC, and from one cantalupensis melon, Can-VedFran, one type from the Philippines (Con-SanIlPhi) (Table 1). Frontiers in Plant Science | www.frontiersin.org 4 October 2019 | Volume 10 | Article 1219 Pascual et al. CMV Resistance in Melon Diversity FIGURE 1 | Haplotypes and frequency observed in the CmVPS41 gene from 52 melon genotypes. (A) Nucleotide polymorphisms present in the melon haplotypes analyzed. In gray, the polymorphisms found in the sequenced accessions. (B) Core haplotypes excluding singletons. nt: nucleotide number. The New CmVPS41 Haplotypes Produce have effects catalogued as neutral for the function of the protein. 10 New Variants. However, two of them had a strong theoretical deleterious effect, Out of the 27 polymorphisms found (including the two changes the G85E substitution, with a PROVEAN score of -7.008, and the in position 451), 15 produced synonymous substitutions and L348R substitution, with a PROVEAN score of -5.929, whereas one added an amino acid. The 11 nonsynonymous substitutions the D509K had a weak, almost neutral effect of ‑2.857. found produced amino acid changes with different effects on The L348R substitution is the previously reported in SC the final protein (Table 2, Figure 3). Eight of those substitutions and identified as the causal mutation of the resistance to Frontiers in Plant Science | www.frontiersin.org 5 October 2019 | Volume 10 | Article 1219 Pascual et al. CMV Resistance in Melon Diversity FIGURE 2 | (A) CmVPS41 phylogenetic tree of the different haplotypes. Branches where all the accessions showing a given haplotype are resistant are marked in red. (B) Reconstruction of haplotypes evolution in a network. Polymorphisms are indicated as vertical lines, black synonymous SNPs. Green, amino acid change with neutral effect according to the PROVEAN score. Red, amino acid change with deleterious effect. Indels are not analyzed. Each circle represents a different haplotype, and circle size is proportional to the number of accessions carrying the haplotype. Circles are colored by melon type. Haplotypes were all the accessions are resistant are written in red. TABLE 2 | Description of the amino acid changes predicted in the CmVPS41 protein. The effect according to Protein Variation Effect Analyzer (PROVEAN) is indicated. nt position Hap1 codon Alternative aa change Shift value Effect 65-66 GAC GAGGAC D22ED 3.231 Neutral 254 GGG GAG G85E ‑7,008 Deleterious 451 ACT TCT/CCT T151S/T151P 0,889/‑1.852 Neutral/neutral 784 CCA GCA P262A ‑0,903 Neutral 925 CCT TCT P309S ‑2,254 Neutral 1,043 CUA CGA L348R ‑5,929 Deleterious 1,527 AAC AAG N509K ‑2.857 Deleterious 1,858 TCA CCA S620P 1,203 Neutral 2,560 TCT ACT S854T ‑0,464 Neutral 2,822 ACA AAA T941K ‑0,545 Neutral 2,852 ATT AGT I951S ‑0,328 Neutral CMV-LS exhibited by this genotype (Giner et al., 2017). It share Hap-4. Two of the cultivars showing this mutation are is also present in other three genotypes (those sharing the the conomon Japanese cultivars Freeman’s Cucumber (Con- Hap-3), all belonging to the makuwa and chinensis groups: FreeCJa) and Shiro uri Okayama (Con-ShiroJa), as well as two the Japanese cultivar Ginsen makuwa (Con-GMJa), and the Chinese makuwa [Nanbukin (Con-NanChi) and Ogon9 (Con- Chinese cultivars Miel Blanc (Con-MielChi) and China51 OgonChi)] and one Korean chinensis (Pat 81 (Con-Pat81Ko). (Con-Chi51Chi) (Table 1). The latter was classified within The accessions sharing the same amino-acid sequence either in the French cantalupensis group by Leida et al. (2015), but Hap-3 or in Hap-4 represent true different accessions, as they showed a high degree of admixture with the oriental melons show clear phenotypic and molecular polymorphism (Leida group to which the other cultivars belong. The substitution et al., 2015; Supplementary Figure 1). Therefore, the haplotype G85E has not been previously reported and is present in five was fixed before the diversification of these cultivars. Far Eastern accessions, belonging to the conomon, makuwa, Our results indicate that the most common CmVPS41 and chinensis groups (oriental melons structure group), which haplotype (Hap-2) is not restricted to specific melon groups, Frontiers in Plant Science | www.frontiersin.org 6 October 2019 | Volume 10 | Article 1219 Pascual et al. CMV Resistance in Melon Diversity FIGURE 3 | Polymorphism in CmVPS41. (A) CmVPS41 genomic sequence. Boxes are exons. Polymorphisms with respect to In-PsSp CmVPS41 are marked. Black, synonymous substitutions. Green, amino acid change with neutral effect. Red, amino acid change with deleterious effect. (B) Secondary structure of CmVPS41 protein from PS. In blue, 𝛽 sheets; in red, α helix. All amino acid changes are indicated. Green, change with neutral effect. Red, change with deleterious effect. (C) Phylogenetic tree of the different protein alleles. In red, resistant genotypes. In blue, susceptible genotypes. The relative effect of their amino acid changes is shown by a gradient of red color, from neutral to deleterious, according to the values given in Table 2. being present in highly diverse Asian accessions from different Uri Okayama, Nanbukin, and Ogon 9. Pat81 carries an additional origins and representing different horticultural groups. However, acid change with respect to PS, I951S, that shows a very weak some less frequent haplotypes only occur or are more frequent in PROVEAN score on the protein. As the mutation G85E is specific groups, such as Hap-3 and Hap-4 in oriental melons and shared with Freeman’s Cucumber and the other three resistant Hap-5 and Hap-6 in wild Indian and African agrestis, respectively. genotypes, which lack any other mutation, it is reasonable to think that the polymorphism responsible for resistance in Pat81 is G85E, whereas I951S has no effect on the phenotype. The Only Melon Genotypes Carrying CmVPS41 substitution N509K reveals a deleterious, but almost neutral Variants With Strong PROVEAN Score Are score, and indeed, the only accession carrying it, an Italian Resistant To CMV-LS Landrace belonging to the ancient group of chate melons (Sabato Twenty-nine melon genotypes belonging to all melon groups and et al., 2019) (Chate-CarBIta, haplotype 7-CarBItA), is susceptible showing different CmVPS41 haplotypes were challenged with to CMV-LS (Table 1, Figure 3). Therefore, these observations CMV-LS to assess their resistance to this strain. As shown in suggest that only those amino acid variations with a strong Table 1, out of the 29 genotypes inoculated, 10 were resistant to PROVEAN score lead to resistance to CMV-LS. CMV-LS. Nine of them carry the amino acid substitutions L348R Interestingly, in the assayed collection, the dudaim cultivar (Ginseng makuwa, China 51, Miel Blanc, as well as the previously Queen’s pocket melon (Dud-QPMAfg) (Hap- 2) do not present described SC) or G85E (Freeman’s Cucumber, Shirouri Okayama, any amino acid change with a strong effect on the protein and Pat81, Nanbukin, and Ogon9), whereas none of the genotypes is, nevertheless, resistant to CMV-LS. QPM presents the most carrying other amino acid substitutions correlated with resistance frequent amino acid sequence. Out of the 29 genotypes analyzed, to CMV-LS. L348R and G85E are the polymorphisms showing showing this amino acid sequence, 9 of them were tested for the strongest PROVEAN score (Figure 3). resistance to CMV-LS, and only this dudaim cultivar was The role of L348R substitution on the resistance found in SC resistant to CMV-LS (Table 1), which may indicate that either the has previously been demonstrated (Giner et al., 2017). Therefore, resistance from this accession has another genetic control or the this substitution should also be responsible for the resistance phenotype is due to any other change, linked to 1,263 nucleotide of the three new carrier genotypes. Regarding the substitution synonymous mutation, not included in the current report. G85E, reported here for the first time, it is shared by Pat81 and Therefore, we have characterized the variability of the gene the other four genotypes with Hap-4, Freeman’s Cucumber, Shiro CmVPS41 in 50 new genotypes, 9 of them resistant to CMV-LS Frontiers in Plant Science | www.frontiersin.org 7 October 2019 | Volume 10 | Article 1219 Pascual et al. CMV Resistance in Melon Diversity which belong to 4 melon botanical groups: Ginsen makuwa, DISCUSSION China 51, Nanbukin and Ogon (makuwa), Miel blanc and Pat 81 (chinensis), Freeman’s Cucumber and Shiro Uri Okayama We have explored the polymorphism of the gene CmVPS41 in (conomon), and Queen’s pocket melon (dudaim), which could 52 melon genotypes belonging to a representation of most major be used in breeding programs, depending on the phenotype or horticultural groups reported in the species (Pitrat, 2017). In total, the need for additional resistances. 16 haplotypes have been observed, including PS and SC, leading to 12 different protein variants, including those already described from PS and SC (Giner et al., 2017). VPS41 is a protein involved in Allelism Tests intracellular trafficking of proteins and vesicles from late Golgi to To confirm that CmVPS41 was responsible for the resistant the vacuole that seems to have an essential role in the cell (Niihama phenotype in the newly reported melon accessions, plants et al., 2009) Attempts to overexpress CmVPS41 in melon under from Ginsen makuwa, Pat81, Freeman’s Cucumber, and the 35S promoter were unsuccessful (L. Pascual, unpublished), Queen’s pocket melon were crossed with the near isogenic whereas expression from its own promoter produced fully viable line SC12-1-99, which contains a small introgression from SC transgenic plants (Giner et al., 2017), suggesting that CmVPS41 carrying the CmVPS41 gene (Hap-3), in the PS background protein does not admit neither strong changes in its structure (Essafi et al., 2009). The same accessions were crossed with nor in its expression levels. In fact, out of the 12 polymorphisms the susceptible genotype PS as control. All PS F1 hybrid leading to amino acid changes, only two of them, G85E and plants were infected, confirming that the resistance in these L348R, highly conserved residues located in conserved regions accessions is recessive, as it is in SC (Pitrat and Lecoq, 1980; (Supplementary Figure 2, Giner et al., 2017), have a theoretical Guiu-Aragonés et al., 2014). However, each F1 progeny from strong effect on the protein, and both of them correlate with crosses with SC12-1-99 was resistant to CMV-LS systemic resistance to CMV-LS. No VPS41 structure has been resolved infection. Given that the resistance is recessive, this result in any species, and thus, we cannot model the influence of these confirms that in all tested accessions, it is controlled by the amino acid changes in the protein structure. However, secondary same gene. Interestingly, the F1 from Queen’s pocket melon structure prediction using PROFAcc (https://www.predictprotein. x SC12-1-99 is also resistant to CMV-LS. Therefore, it is org/) shows that there are two regions in the protein. From amino allelic also in this genotype, which implies that CmVPS41 acid 42 to 399, there is a region with only β sheets, whereas from from Queen’s pocket melon is responsible for the resistance to residue 405 to 825, there are only α helices. Both amino acid CMV-LS despite its predicted protein (Prot-2) being equal to 85 and 348 reside in the β sheets region, and both lay in loops other susceptible accessions (Table 1). between two β sheets (Figure 3B). As only subtle changes are allowed in VPS41 protein, it suggests that changes in loops are The New Resistant Genotypes Restrict more easily allowed than others in more structured regions. These CMV-LS Phloem Entry loops might lay in the areas involved in the interaction with the Resistance to CMV-LS in the accession SC acts at the level of viral MP, the determinant of virulence (Guiu-Aragonés et al., viral phloem entry (Guiu-Aragonés et al., 2016), whereas the 2015), so that these changes would affect only the viral infection virus can replicate and move cell to cell. To test if in the new without affecting the vital function of transporting cargo proteins resistant accessions CMV-LS was able to invade the phloem, to the vacuole. Interestingly, the two parts of the protein nearly the first true leaf of plants from accessions Ginsen makuwa, correspond to the two parts observed in the gene, since up to Pat81, Freeman’s Cucumber, and Queen’s pocket melon was nucleotide 1,828, there are more fixed SNPs than from nucleotide inoculated with CMV-LS. After 11 dpi, all accessions had 1,829 to the 3′ end of the gene. This way, the first half of the gene, developed yellow areas around the entrance points in the which appears to have admitted more mutations, corresponds to inoculated leaf, indicating that the virus was able to replicate the β-sheet structure and is where the causal mutations reside. The and move cell to cell in these accessions (Figure 4A), as had second part of the gene, which is in high linkage disequilibrium, been previously reported for SC (Guiu-Aragonés et al., 2016). corresponds to the α-helix region. It is possible that this second However, none of the accessions had developed symptoms of part of the gene is under stronger selection than the 5′ part. CMV infection except PS, used as positive control. Then, the Melon was likely domesticated twice: in Africa and Asia petiole of the inoculated leaf was collected, and the presence of (Endl et al., 2018) where wild accessions are frequently the virus in the phloem was tested by reverse transcription PCR. found. Different CmVPS41 haplotypes have been identified in As shown in Figure 4B, the virus was absent from the phloem wild types from different origins, while most of the analyzed of all resistant accessions, including the resistant control SC, cultivated accessions shared Hap-2. India, and specifically the whereas in PS, the virus had reached the phloem and could be highly variable momordica group, is considered the origin detected in the petiole of the inoculated leaf. This indicated of most Asian landraces and of the widely commercialized that the resistance to CMV-LS in the four tested accessions was cultivar groups (Blanca et al., 2012; Leida et al., 2015). acting at the level of phloem entry, as is also the case of SC, CmVPS41 seems to be uniform within the momordica group. where the virus is restricted in the BS cells of the minor veins The Hap-2, found in all momordica accessions, is also present (Guiu-Aragonés et al., 2016). Therefore, restriction to phloem in ameri, dudaim, and a large set of oriental melons. However, entry seems to be a common strategy for recessive resistance to the Far Eastern melons (accessions of the conomon/chinensis/ CMV in melon. makuwa groups from Japan, China, and Korea), characterized Frontiers in Plant Science | www.frontiersin.org 8 October 2019 | Volume 10 | Article 1219 Pascual et al. CMV Resistance in Melon Diversity FIGURE 4 | Resistance to CMV-LS in exotic melon genotypes. (A) Inoculated leaves from resistant melon genotypes at 11 dpi showing the halos where infection initiates. Black scale bars indicate 2 cm. In PS genotype, at 11 dpi, the whole plant is infected. (B) Reverse transcription PCR (RT-PCR) of petiole samples from inoculated leaves of two individual plants per genotype. Mo: Mock inoculated plant. C‑: negative control for PCR. M: size marker. On the left, sizes of relevant bands of the marker, in base pairs. by their low molecular diversity (Blanca et al., 2012; Esteras breeding for their resistance to fungus (Perchepied and Pitrat, et al., 2013; Leida et al., 2015), are highly variable for this gene, 2004; Roig et al., 2012). including accessions carrying three different haplotypes. Two The Hap-1, which leads to CMV susceptibility, is found in of them, Hap-3 and Hap-4, lead to CMV-LS resistance. These accessions representing not only the main European commercial Far Eastern cultivars were originated after the diversification of types, inodorus and cantalupensis, but also in South American melon from India towards Far East Asia (Gonzalo et al., 2019); and Asian landraces. Therefore, the new resistant accessions therefore, the mutations related to resistance either could arise sharing the previously characterized SC haplotype and the new in the early diversification of these groups or represent ancestral ones having the newly described haplotype characterized by a variability that has been maintained likely by selection. new deleterious mutation are interesting materials for breeding Apart from the previously studied SC, the Japanese cultivars commercial melons against CMV. Freeman’s Cucumber (Con-FreeCJa), Shiro uri Okayama Another interesting source of resistance is the dudaim-type (Con-ShiroJa), Ginsen makuwa (Con-GMJa), and the Chinese Queen’s pocket melon, which does not present any putative causal cultivar China51 (Con-Chi51Chi) were previously reported as mutation, showing the same protein found in other 25 susceptible resistant to CMV (Karchi et al., 1975; Pitrat and Lecoq, 1980; accessions. However, Queen’s pocket melon is resistant to CMV-LS, Provvidenti, 1998), although the resistance was not studied in and moreover, the resistance is allelic with that of SC as assessed by detail. The remaining accessions are new sources of resistance crossings with the resistant NIL SC12-1-99. Dudaim melons are to CMV, and some of them, such as Ogon 9 (Con-OgonChi) morphological and molecularly different from other melon groups and Pat 81 (Con-Pat81Ko), have been previously used in melon (Gonzalo et al., 2019). The resistance observed here could be due Frontiers in Plant Science | www.frontiersin.org 9 October 2019 | Volume 10 | Article 1219 Pascual et al. CMV Resistance in Melon Diversity to an independent mutation in a noncoding sequence not covered DATA AVAILABILITY STATEMENT in the current report. For example, it could be due to an alternative splicing which would produce a slightly different protein still All datasets generated for this study are included in the able to keep its role in vacuole trafficking. Alternatively, the silent manuscript/Supplementary Files. mutation at position 1,263 could have some effect in the RNA folding, with a role in the regulation of the protein. Further work is AUTHOR CONTRIBUTIONS needed to address if the mutation is located either in a noncoding regulatory sequence of CmVPS41 or in another tightly linked gene LP designed and carried out experiments and contributed and to understand the events underlying the resistance to CMV-LS to write the manuscript. JY did experimental work, MP in QPM genotype. However, the later possibility is very unlikely, supervised experimental work, and AM and BP contributed since, given the recessive nature of the resistance, it would mean to write the manuscript. AM-H designed experiments and that, in SC, the other gene would bear also a mutation leading wrote the manuscript. to resistance to CMV-LS, so that, in the F1, the mutation would be in homozygosis. However, in that case, the putative mutation should already be in homozygosis in SC and would have been responsible for the resistance in that genotype. As map-based FUNDING cloning demonstrated, the only gene responsible for the resistance AM-H was supported by the grants AGL2012-40130-C02-01 and to CMV-LS in SC was CmVPS41 (Giner et al., 2017). AGL2015-64625-C2-1-R from the Spanish Ministry of Economy VPS41-mediated resistance to CMV in the new resistant and Competitiviness (cofunded by FEDER funds) and by the genotypes restricts CMV phloem entry, to finally impede the CERCA Proframme/Generalitat de Catalunya. We acknowledge development of a systemic infection. Guiu-Aragonés et al, financial support from the Spanish Ministry of Economy and (2016) reported that, in the resistant introgression line SC12-1- Competitiveness, through the “Severo Ochoa Programme for 99 (carrying SC resistance gene), the virus movement is blocked Centres of Excellence in R&D” 2016-2019 (SEV‐2015‐0533). in the BS cells that surround the vein, and therefore, it does not AM was supported by grant AGL2015-64625-C2-2-R from reach the phloem to produce a systemic infection. Therefore, the Spanish Ministry of Economy and Competitivity. Grants our results with the new resistant genotypes again support the AGL2017-85563-C2-1-R by the Spanish Ministery of Science, role of CmVPS41in this resistance. Moreover, the fact that the Innovation and Universities (cofunded with FEDER funds) and new resistant accessions belong to four different melon groups by the PROMETEO project 2017/078 (to promote excellence suggests that restriction to systemic infection via restriction of groups) by the Conselleria d’Educació, Investigació, Cultura phloem entry as mechanism for resistance to CMV-LS appeared i Esports (Generalitat Valenciana) were supporting BP. JY was very early during the melon domestication or diversification. supported by a China Scholarship Council (CSC) fellowship. The role of CmVPS41 in resistance to CMV, and its generality in resistant melon accessions opens new possibilities for using different breeding approaches based on genes that control ACKNOWLEDGMENTS different steps of the viral cycle, to promote resistances to different viruses. Targeting eIFs genes has provided a useful We thank Fuensanta García and Eva Mª Martínez Pérez for tool against several viruses in melon (Rodríguez-Hernández technical support. et al., 2012; Chandrasekaran et al., 2016) and in other species (Sanfaçon, 2015). A strategy based on producing melon SUPPLEMENTARY MATERIAL plants pyramiding mutations in eIFs, which would target viral translation/replication, and in VPS41, targeting viral The Supplementary Material for this article can be found online movement, would speed up breeding strategies for sustainable at: https://www.frontiersin.org/articles/10.3389/fpls.2019.01219/ plant protection against viruses of different families. full#supplementary-material REFERENCES Blanca, J., Esteras, C., Ziarsolo, P., Pérez, D., Fernández-Pedrosa, V., Collado, C., et al. (2012). Transcriptome sequencing for SNP discovery across Cucumis Argyris, J. M., Pujol, M., Martín-Hernández, A. M., and Garcia-Mas, J. (2015). melo. BMC Genomics 13, 280. doi: 10.1186/1471-2164-13-280 Combined use of genetic and genomics resources to understand virus resistance Chandrasekaran, J., Brumin, M., Wolf, D., Leibman, D., Klap, C., Pearlsman, M., and fruit quality traits in melon. Physiol. Plant. 155, 4–11. doi: 10.1111/ppl.12323 et al. (2016). Development of broad virus resistance in non-transgenic Asensio, C. S., Sirkis, D. W., Maas, J. W., Egami, K., To, T.-L., Brodsky, F. M., et al. cucumber using CRISPR/Cas9 technology. Mol. Plant Pathol. 17 (7), 1140– (2013). Self-assembly of VPS41 promotes sorting required for biogenesis 1153. doi: 10.1111/mpp.12375 of the regulated secretory pathway. Dev. Cell 27, 425–437. doi: 10.1016/j. Choi, Y., Sims, G. E., Murphy, S., Miller, J. R., and Chan, A. P. (2012). Predicting the devcel.2013.10.007 functional effect of amino acid substitutions and indels. PLoS One 7, e46688. Bandelt, H., Forster, P., and Röhl, A. (1999). Median-joining networks for doi: 10.1371/journal.pone.0046688 inferring intraspecific phylogenies. Mol. Biol. Evol. 16, 37–48. doi: 10.1093/ Dhillon, N. P. S., Ranjana, R., Singh, K., Eduardo, I., Monforte, A. J., Pitrat, M., oxfordjournals.molbev.a026036 et al. (2007). Diversity among landraces of Indian snapmelon (Cucumis melo Frontiers in Plant Science | www.frontiersin.org 10 October 2019 | Volume 10 | Article 1219 Pascual et al. CMV Resistance in Melon Diversity var. momordica). Genet. Resour. Crop Evol. 54, 1267–1283. doi: 10.1007/ the Indo-Gangetic plains of India and their genetic relationship with USA s10722-006-9108-2 melon cultivars. Genet. Resour. Crop Evol. 61, 1189–1208. doi: 10.1007/ Diaz, J. A., Mallor, C., Soria, C., Camero, R., Garzo, E., Fereres, A., et al. (2003). s10722-014-0101-x Potential sources of resistance for melon to nonpersistently aphid-borne Niihama, M., Takemoto, N., Hashiguchi, Y., Tasaka, M., and Morita, M. T. (2009). viruses. Plant Dis. 87, 960–964. doi: 10.1094/PDIS.2003.87.8.960 ZIP genes encode proteininvolved inmembrane trafficking of the TGN–PVC/ Dogimont, C., Leconte, L., Perin, C., Thabuis, A., Lecoq, H., and Pitrat, M. vacuoles. Plant Cell Physiol. 50, 2057–2068. doi: 10.1093/pcp/pcp137 (2000). Identification of QTLs contributing to resistance to different strains Perchepied, L., and Pitrat, M. (2004). Polygenic inheritance of partial resistance to of Cucumber mosaic cucumovirus in melon. Acta Hortic 510, 391–398. doi: Fusarium oxysporum f. sp. melonis race 1.2 in melon. Phytopathology 94 (12), 10.17660/ActaHortic.2000.510.62 1331–1336. doi: 10.1094/PHYTO.2004.94.12.1331 Edwardson, J. R., and Christie, R. G., (1991). “Cucumoviruses,” in CRC handbook Pitrat, M. (2008). “Melon,” in Vegetables I: Asteraceae, Brassicaceae, of viruses infecting legumes. Eds. J. R. Edwardson and R. G. Christie (Boca Chenopodicaceae, and Cucurbitaceae. Ed. J. a. N., F. Prohens (New York: Raton, FL: CRC Press), 293–319. doi: 10.1201/9781351071192-16 Springer Science+Business Media, LLC), 283–315. Endl, J., Achigan-Dako, E. G., Pandey, A. K., Monforte, A. J., Pico, B., and Pitrat, M. (2017). “Melon genetic resources: phenotypic diversity and horticultural Schaefer, H. (2018). Repeated domestication of melon (Cucumis melo) in taxonomy,” in Genetics and genomics of Cucurbitaceae.. Eds. R. Grumet, N. Africa and Asia and a new close relative from India. Am. J. Bot. 105, 1662–1671. Katzir, and J. Garcia-Mas (Switzerland: Springer International Publisher AG). doi: 10.1002/ajb2.1172 doi: 10.1007/7397_2016_10 Essafi, A., Diaz-Pendon, J. A., Moriones, E., Monforte, A. J., Garcia-Mas, J., and Pitrat, M., and Lecoq, H. (1980). Inheritance of resistance to Cucumber mosaic Martin-Hernandez, A. M. (2009). Dissection of the oligogenic resistance to virus transmission by Aphis gossypii in Cucumis melo.. Phytopathology 70, 958– Cucumber mosaic virus in the melon accession PI 161375. Theor. Appl. Genet. 961. doi: 10.1094/Phyto-70-958 118, 275–284. doi: 10.1007/s00122-008-0897-x Pols, M. S., ten Brink, C., Gosavi, P., Oorschot, V., and Klumperman, J. (2013). The Esteras, C., Formisano, G., Roig, C., Díaz, A., Blanca, J., Garcia-Mas, J., et al. HOPS proteins hVps41 and hVps39 are required for homotypic and heterotypic (2013). SNP genotyping in melons: genetic variation, population structure, late endosome fusion. Traffic 14, 219–232. doi: 10.1111/tra.12027 and linkage disequilibrium. Theor. Appl. Genet. 126, 1285–1303. doi: 10.1007/ Provvidenti, R. (1998). A source of a high level of tolerance to Squash mosaic virus s00122-013-2053-5 in a melon from China. Cucurbit Genet. Cooperative Rep. 21, 29–30. Fergany, M., Balvir, K., Monforte, A. J., Pitrat, M., Rys, C., Lecoq, H., et al. Risser, G., Pitrat, M., and Rode, J. C. (1977). Etude de la résistance du melon (2011). Variation in melon (Cucumis melo) landraces adapted to the humid (Cucumis melo L.) au virus de la mosaïque du concombre. Ann Amél Plant 27, tropics of southern India. Genet. Resour. Crop Evol. 58, 225–243. doi: 10.1007/ 509–522. s10722-010-9564-6 Robinson, R. W., and Decker-Walters, D. S., (1997). Cucurbits. Wallingford, Oxon, Giner, A., Pascual, L., Bourgeois, M., Gyetvai, G., Rios, P., Picó, B., et al. (2017). A New York: Cab International. mutation in the melon vacuolar protein sorting 41 prevents systemic infection Rodríguez-Hernández, A., Gosalvez, B., Sempere, R., Burgos, L., Aranda, M., of Cucumber mosaic virus. Sci. Rep. 7, 10471. doi: 10.1038/s41598-017-10783-3 and Truniger, V. (2012). Melon RNA interference (RNAi) lines silenced for Gonzalo, M. J., Díaz, A., Dhillon, N. P. S., Reddy, U. K., Picó, B., and Monforte, Cm-eIF4E show broad virus resistance. Mol. Plant Pathol. 13, 755–763. doi: A. J. (2019). Re-evaluation of the role of Indian germplasm as center of melon 10.1111/j.1364-3703.2012.00785.x diversification based on genotyping-by-sequencing analysis. BMC Genomics Roig, C., Fita, A., Ríos, G., Hammond, J. P., Nuez, F., and Picó, B. (2012). Root 20, 448–448. doi: 10.1186/s12864-019-5784-0 transcriptional responses of two melon genotypes with contrasting resistance Guiu-Aragonés, C., Díaz-Pendón, J. A., and Martín-Hernández, A. M. (2015). to Monosporascus cannonballus (Pollack et Uecker) infection. BMC Genomics Four sequence positions of the movement protein of Cucumber mosaic virus 13, 601–601. doi: 10.1186/1471-2164-13-601 determine the virulence against cmv1-mediated resistance in melon. Mol. Plant Roossinck, M. J. (2001). Cucumber mosaic virus, a model for RNA virus evolution. Pathol. 16, 675–684. doi: 10.1111/mpp.12225 Mol. Plant Pathol. 2, 59–63. doi: 10.1046/j.1364-3703.2001.00058.x Guiu-Aragonés, C., Monforte, A. J., Saladié, M., Corrêa, R. X., Garcia-Mas, J., and Sabato, D., Esteras, C., Grillo, O., Peña-Chocarro, L., Leida, C., Ucchesu, M., et al. Martín-Hernández, A. M. (2014). The complex resistance to Cucumber mosaic (2019). Molecular and morphological characterisation of the oldest Cucumis cucumovirus (CMV) in the melon accession PI 161375 is governed by one gene melo L. seeds found in the Western Mediterranean Basin. Archaeol. Anthropol. and at least two quantitative trait loci. Mol. Breed. 34, 351–362. doi: 10.1007/ Sci. 11, 1–22. doi: 10.1007/s12520-017-0560-z s11032-014-0038-y Sanfaçon, H. (2015). Plant translationfactors and virus resistance. Viruses 7, 3392– Guiu-Aragonés, C., Sánchez-Pina, M. A., Díaz-Pendón, J., Peña, E. J., Heinlein, M., 3419. doi: 10.3390/v7072778 and Martín-Hernández, A. M. (2016). cmv1 is a gate for Cucumber mosaic virus Sanseverino, W., Hénaff, E., Vives, C., Pinosio, S., Burgos-Paz, W., Morgante, M., transport from bundle sheath cells to phloem in melon. Mol. Plant Pathol. 17, et al. (2015). Transposon insertions, structural variations, and SNPs contribute 973–984. doi: 10.1111/mpp.12351 to the evolution of the melon genome. Mol. Biol. Evol. 32, 2760–2774. doi: Hashimoto, M., Neriya, Y., Yamaji, Y., and Namba, S. (2016). Recessive resistance 10.1093/molbev/msv152 to plant viruses: potential resistance genes beyond translation initiation factors. Thompson, J. D., Higgins, D. G., and Gibson, T. J. (1994). CLUSTAL W: improving Front. Microbiol. 7, 1695–1695. doi: 10.3389/fmicb.2016.01695 the sensitivity of progressive multiple sequence alignment through sequence Hirai, S., and Amemiya, Y. (1989). Studies on the resistance of melon cultivars weighting, position-specific gap penalties and weight matrix choice. Nucleic to Cucumber mosaic virus (I) virus multiplication in leaves or mesophyll Acids Res. 22, 4673–4680. doi: 10.1093/nar/22.22.4673 protoplasts from a susceptible and a resistant cultivars. Ann. Phytopath. Soc. Untergasser, A., Cutcutache, I., Koressaar, T., Ye, J., Faircloth, B. C., Remm, M., Japan 55, 458–465. doi: 10.3186/jjphytopath.55.458 et al. (2012). Primer3—new capabilities and interfaces. Nucleic Acids Res. 40, Karchi, Z., Cohen, S., and Govers, A. (1975). Inheritance of resistance to Cucumber e115–e115. doi: 10.1093/nar/gks596 mosaic virus in melons. Phytopathology 65, 479–481. doi: 10.1094/Phyto-65-479 Kirkbride, J. H. (1993). Biosystematic monograph of the genus Cucumis Conflict of Interest: The authors declare that the research was conducted in the (Cucurbitaceae). Boone, North Carolina: Parkway Publishers. absence of any commercial or financial relationships that could be construed as a Leida, C., Moser, C., Esteras, C., Sulpice, R., Lunn, J. E., de Langen, F., et al. (2015). potential conflict of interest. Variability of candidate genes, genetic structure and association with sugar accumulation and climacteric behavior in a broad germplasm collection of Copyright © 2019 Pascual, Yan, Pujol, Monforte, Picó and Martín-Hernández. melon (Cucumis melo L.). BMC Genet. 16, 28. doi: 10.1186/s12863-015-0183-2 This is an open-access article distributed under the terms of the Creative Commons Leigh, J. W., and Bryant, D. (2015). Monte Carlo strategies for selecting parameter Attribution License (CC BY). The use, distribution or reproduction in other forums values in simulation experiments. Syst. Biol. 64, 741–751. doi: 10.1093/sysbio/ is permitted, provided the original author(s) and the copyright owner(s) are credited syv030 and that the original publication in this journal is cited, in accordance with accepted Malik, A. A., Vashisht, V. K., Singh, K., Sharma, A., Singh, D. K., Singh, H., academic practice. No use, distribution or reproduction is permitted which does not et al. (2014). Diversity among melon (Cucumis melo L.) landraces from comply with these terms. Frontiers in Plant Science | www.frontiersin.org 11 October 2019 | Volume 10 | Article 1219