This is the accepted version of the article: Chen, Wei Wei; Takahashi, Nozomu; Hirata, Yoshito; [et al.]. «A mobile ELF4 delivers circadian temperature information from shoots to roots». Nature plants, Vol. 6, issue 4 (April 2020), p. 416–426. DOI 10.1038/s41477-020-0634-2 This version is avaible at https://ddd.uab.cat/record/221269 under the terms of the license 1 A mobile ELF4 delivers circadian temperature information from shoots to roots 2 3 Wei Wei Chen1*, Nozomu Takahashi1*, Yoshito Hirata2,3, James Ronald4, Silvana Porco5, Seth 4 J. Davis4,6, Dmitri A. Nusinow7, Steve A. Kay5,8 and Paloma Mas1,9,†. 5 1 6 Centre for Research in Agricultural Genomics (CRAG), CSIC-IRTA-UAB-UB, Campus UAB, 7 Bellaterra, 08193 Barcelona, Spain. 2 8 Mathematics and Informatics Center, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, 9 Tokyo 113-8656, Japan. 3 10 Faculty of Engineering, Information and Systems, University of Tsukuba, 1-1-1 Tennodai, 11 Tsukuba, Ibaraki 305-8573, Japan. 4 12 Department of Biology, University of York, York, UK. 5 13 Keck School of Medicine, University of Southern California, Los Angeles, California 90089, 14 United States. 6 15 Key Laboratory of Plant Stress Biology, School of Life Sciences, Henan University, 16 Kaifeng 475004, China. 7 17 Donald Danforth Plant Science Center, St. Louis, MO 63132. 8 18 Institute of Transformative Bio-Molecules, Nagoya University, Nagoya 464-8601, Japan. 9 19 Consejo Superior de Investigaciones Científicas (CSIC), 08028 Barcelona, Spain. * 20 These authors contributed equally the manuscript. † 21 Correspondence to: paloma.mas@cragenomica.es 22 23 24 25 26 27 28 29 1 30 Abstract 31 The circadian clock is synchronized by environmental cues, mostly by light and temperature. 32 Elucidating how the plant circadian clock responds to temperature oscillations is crucial to 33 understand plant responsiveness to the environment. Here we found a prevalent temperature- 34 dependent function of the Arabidopsis clock component ELF4 (EARLY FLOWERING 4) in the 35 root clock. Although the root clock is able to run in the absence of shoots, micrografting assays 36 and mathematical analyses show that ELF4 moves from shoots to regulate rhythms in roots. 37 ELF4 movement does not convey photoperiodic information but trafficking is essential to 38 control the period of the root clock in a temperature-dependent manner. At low temperatures, 39 ELF4 mobility is favored, resulting in a slow-paced root clock while high temperatures decrease 40 movement, leading to a faster clock. Hence, the mobile ELF4 delivers temperature information 41 and establishes a shoot-to-root dialogue that sets the pace of the clock in roots. 42 43 44 Introduction 45 Nearly all photosensitive organisms have evolved timing mechanisms or circadian clocks able 46 to synchronize metabolism, physiology and development in anticipation to the 24-hour 47 light/dark cycles1. In Arabidopsis thaliana, the molecular clockwork is based on complex 48 regulatory networks of core clock components that generate rhythms in a myriad of biological 49 outputs2, 3. Appropriate phasing of biological processes relies on clock resetting by light and 50 temperature cues; a mechanism that requires effective changes in the expression and activity of 51 essential clock components4. Circadian clocks are also defined by a conserved feature known as 52 temperature compensation5. In contrast to the temperature dependency of many 53 physicochemical and biological activities, the circadian clock is able to maintain a constant 54 period over a range of physiological temperatures. By virtue of different transcriptional, post- 55 transcriptional and post-translational mechanisms6-9, the plant circadian system buffers the 56 circadian period length. Therefore, the circadian clock is able to sustain a period close to 24- 57 hours within a physiological range of temperatures. An ample collection of light-related 58 factors10-14 and clock-associated components9, 15, 16 has been shown to directly or indirectly 59 regulate clock temperature compensation in plants. 60 61 Among the Arabidopsis clock components, ELF4 (EARLY FLOWERING 4) was initially 62 identified by its role in photoperiod perception and circadian regulation17. Structural and 63 functional studies provided a view of the multiple entry points of ELF4 function within the 64 clock18. ELF4 protein assembles into a tripartite complex (Evening Complex, EC) together with 65 ELF3 and LUX ARRHYTHMO or PHYTOCLOCK1 (LUX/PCL1)19, 20. The complex regulates 2 66 growth and represses circadian gene expression21, 22. ELF4 promotes the nuclear localization of 67 ELF319 while LUX directly binds to the promoters of the target genes and thus facilitates the 68 recruitment of ELF4 and ELF320, 23. Loss-of-function mutants of any of the EC components lead 69 to arrhythmia17, 24-26. Through multiple interactions with light, clock and photomorphogenesis 70 related factors27, the EC is able to coordinate plant responses to environmental cues including 71 temperature15, 27-31 although ELF4, ELF3 and LUX also display independent functions from the 72 EC31-33. 73 74 Regarding the circadian structure and organization within the plant, it is broadly accepted that 75 every plant cell harbors a circadian oscillator. However, circadian communication or coupling 76 among cells and tissues varies at different parts of the plant34-38. For instance, while cotyledon 77 cells present circadian autonomy39, different degrees of cell-to-cell coupling have been reported 78 in leaves40-42, in the vasculature with neighbor mesophyll cells43, in guard cells44, in cells at the 79 root tip45, 46 and within the shoot apex47. Long-distance shoot-to-root photosynthetic signaling is 80 also important for clock entrainment in roots48 and light piping down the root49 contributes to 81 this entrainment. Micrografting assays and shoot excision47 suggest the existence of a long- 82 distance mobile circadian signal from shoots to roots. Here we report that ELF4 moves from 83 shoots to control the pace of the root clock in a temperature-dependent manner. 84 85 Results 86 Prevalent function of ELF4 sustaining rhythms in roots 87 We first approached the investigation of the circadian mobile signal by simultaneously 88 following rhythms in shoots and roots of intact plants47. The waveforms of the morning- 89 expressed CCA1 (CIRCADIAN CLOCK ASSOCIATED 1) and LHY (LATE ELONGATED 90 HYPOCOTYL) promoter activities displayed a long period, slightly reduced amplitude and 91 phase delay in roots (Rt) compared to shoots (Sh) (Fig. 1a-b and Extended Data Fig. 1a). The 92 mRNA rhythmic accumulation assayed by Reverse Transcription-Quantitative Polymerase 93 Chain Reaction (RT-QPCR) followed the same trend (Fig. 1c). Similar patterns were observed 94 for the promoter activity of the evening-expressed clock component TOC1/PRR1 (TIMING OF 95 CAB EXPRESSION1/PSEUDO RESPONSE REGULATOR1) (Extended Data Fig. 1b-c). 96 Therefore, the clock is fully operative in roots but its overall pace is slower and the phase 97 delayed compared to shoots. 98 99 Under free-running conditions, the circadian clock is unable to properly run in mutant plants of 100 any of the EC components17, 24-26. We therefore examined the role of the EC components in the 101 root clock, and in particular, we focused on ELF4. Circadian time course analyses showed that 102 although some very weak oscillations could be appreciated (Extended Data Fig. 1d), the CCA1 3 103 and LHY promoter activities and mRNA expression was suppressed in elf4-1 mutant compared 104 to WT roots (Fig. 1d and Extended Data Fig. 1e-g) following a similar trend to that described in 105 shoots22 (Extended Data Fig. 1h-j). Over-expression of ELF4 (ELF4-ox) lengthened the period 106 of LHY::LUC (Fig. 1e and Extended Data Fig. 1k) indicating that increased ELF4 activity in 107 roots makes the clock to run slow. The expression of PRR9 (PSEUDO-RESPONSE 108 REGULATOR 9), a previously described direct target of the EC in shoots, was clearly up- 109 regulated in elf4-1 mutant roots (Fig. 1f) suggesting that the EC also represses PRR9 in roots. 110 Thus, ELF4 plays an important regulatory function in the root clock: mutation compromises 111 rhythms while over-expression lengthens the circadian period. 112 113 RNA-Seq analyses of WT and elf4-1 mutant roots provided a genome-wide view of ELF4 114 function in roots (Supplementary Table 1). We found that about 15% of the root genes were 115 significantly mis-regulated by the absence of a functional ELF4, with a similar proportion of up- 116 regulated (1297) and down-regulated (1555) genes (Fig. 1g-h and Extended Data Fig. 2a). The 117 expression of core clock genes was amongst the most significantly mis-regulated (Fig. 1i, 118 Extended Data Fig. 2b-i) with a significant fraction of the mis-regulated genes being controlled 119 by the clock, with phase enrichments during the subjective morning and subjective midday (Fig. 120 1j-k). Functional analyses showed that in addition to the enrichment of genes related to the 121 circadian system and rhythmic processes, genes mis-expressed in elf4-1 mutant were ascribed to 122 several functional categories including among others responses to stimuli (Supplementary Table 123 1). Consistently, mis-expression of ELF4 affected physiological outputs such as the number of 124 lateral roots (Extended Data Fig. 2j). Together, the results indicate a prevalent function for 125 ELF4 sustaining rhythms in roots. 126 127 ELF4 moves from shoots to regulate oscillator gene expression in roots 128 Our previous study showed that a signal from shoots is important for circadian rhythms in roots 47 129 . Micrografting assays are a powerful tool to identify the nature of mobile signals. The grafting 130 technique per se does not alter the rhythms in roots47, as grafted WT scions into WT roots show 131 similar rhythms as non-grafted WT plants (Extended Data Fig. 3a and b). By micrografting 132 different genotypes, we found that grafts of ELF4-ox shoots into elf4-1 rootstocks [ELF4- 133 ox(Sh)/elf4-1(Rt)] (Extended Data Fig. 3c) were particularly efficient in recovering the rhythms 134 in roots (Fig. 2a and Extended Data Fig. 3d). The results are noteworthy as CCA1::LUC 135 rhythms are affected in elf4-1 mutant roots (Fig. 1d). Restoration of the rhythms was reflecting 136 the circadian function exclusively in roots as water instead of luciferin was applied to shoots 137 (ELF4-ox, Sh, H2O) to avoid luminescence signals leaking from shoots into roots of adjacent 138 wells. Rhythms in roots were also recovered when ELF4-ox scion was grafted into elf4-2 139 mutant (Extended Data Fig. 3e) rootstocks (Fig. 2b). To exclude the possibility that the 4 140 observed results were due to the high over-expression of ELF4-ox plants, we grafted WT shoots 141 into elf4-1 roots. Although the recovery of the rhythms was not as robust as with ELF4-ox 142 grafts, a rhythmic pattern was observed in roots (Fig. 2c). Thus, ELF4 mRNA or protein are 143 able to move from shoots to roots. This notion was reinforced by the results showing the 144 rhythmic recovery of elf4-1 rootstocks grafted with ELF4 Minigene (E4MG) scion (Fig. 2d and 145 Extended Data Fig. 3f). These results rule out the possibility that the recovery of the rhythms 146 was just due to the high over-expression of ELF4-ox scion. The influence of shoots as a driving 147 rhythmic force of elf4-1 rootstocks was also mathematically analyzed with recurrence plots 148 obtained by delay coordinates of the grafting time series. The waveforms of the driving 149 rhythmic force reconstructed from the driven system and their autocorrelation analyses showed 150 a strong periodicity after grafting (Extended Data Fig. 4a-h). In analyses with 10000 randomly 151 shuffled surrogates using as null hypothesis of no serial dependence, we obtained before 152 grafting a p-value of 0.2341 (black dash line) (Extended Data Fig. 4f) and 0.0004 (gray dash 153 line) after grafting (Extended Data Fig. 4h). The statistics are therefore consistent with the 154 notion that rhythms in roots are being forced by a signal from shoots. 155 156 To investigate whether the mRNA could be the mobile signal, we performed RT-QPCR time 157 course analyses of roots from ELF4-ox (Sh)/elf4-1(Rt) grafts. Our results showed no detectable 158 amplification of ELF4 mRNA at any time point analyzed (Fig. 2e), which suggest that ELF4 159 mRNA did not move through the graft junctions. To confirm this notion, we injected purified 160 ELF4 protein into elf4-1 mutant (Extended Data Fig. 5a-c). Injection in shoots was able to 161 restore rhythms in roots (Fig. 2f). The percentage of ELF4-injected plants with recovered 162 rhythms was low (5-8%) but was reproducibly observed in different biological replicates. The 163 fact that rhythms were actually restored (Relative Amplitude Errors, RAE<0.6) is supportive of 164 a mobile ELF4 protein from shoots to roots. Rhythmic recovery was not apparent when purified 165 GFP (GREEN FLUORESCENT PROTEIN) was injected (Fig. 2f). The movement of ELF4 166 protein was further assayed by using shoots of plants over-expressing ELF4 fused to GFP 167 grafted into elf4-1 mutant roots. Confocal imaging showed that ELF4-GFP fluorescent signals 168 accumulated in the vasculature of elf4-1 mutant rootstock, across the graft junctions (Fig. 2g-h 169 and Extended Data Fig. 5d-e). Furthermore, Western-blot analyses of roots from ELF4-GFP 170 (Sh)/elf4-1(Rt) micrografts showed that ELF4 protein was effectively detected as a band of the 171 expected size (arrows in Fig. 2i) not present in protein extracts of elf4-1 mutant roots (Fig. 2i). 172 Grafting ELF4-ox fused to three GFPs (ELF4-x3GFP) scion into elf4-2 mutant rootstock did not 173 lead to an obvious recovery of rhythms (Fig. 2j and Extended Data Fig. 5f) suggesting the 174 requirement of a mobile ELF4 protein. The ELF4-x3GFP is still functional as its over- 175 expression in the elf4-1 mutant background restored the hypocotyl phenotypes of elf4-1 mutant 176 (Extended Data Fig. 5g) and repressed PRR9 gene expression (Extended Data Fig. 5h-i). The 5 177 functional relevance of ELF4 movement was also verified in elf4-1(Sh)/elf4-1(Rt) grafts 178 showing the lack of rhythmic recovery in elf4-1 roots when elf4-1 was used as scion (Extended 179 Data Fig. 5j-k). Therefore, multiple series of evidence including the ELF4 injection data, the 180 grafting assays showing the recovery of the rhythms, the ELF4-GFP fluorescent signals across 181 the graft junctions, the detection of the ELF4 protein in roots of the grafted plants, the lack of 182 rhythmic recovery in roots of ELF4-x3GFP and in elf4-1 scion grafts, support the notion that 183 ELF4 protein moves from shoots to regulate rhythms in roots. Other mobile proteins such as FT 184 (FLOWERING LOCUS T), and HY5 (LONG HYPOCOTYL 5) share some features with ELF4 185 protein in terms of low molecular weight and high isoelectric point (Fig. 2k). 186 187 Blocking ELF4 movement by shoot excision alters circadian rhythms in roots 188 We next attempted to unveil the function of the mobile ELF4 by blocking ELF4 movement 189 through shoot excision. Analyses of the rhythms showed that excised roots sustained robust 190 oscillations (Extended Data Fig. 6a-b) confirming that the root clock is able to run in the 191 absence of shoots. However, comparison of intact versus excised roots uncovered a shorter 192 period in excised roots (Extended Data Fig. 6c-d). As accumulation of ELF4 results in long 193 periods in shoots22 and roots (Fig. 1e and Extended Data Fig. 1k), it is plausible that blocking 194 ELF4 movement by shoot excision leads to shorter periods in excised roots. If that is the case, 195 blocking ELF4 movement should also affect ELF4 target gene expression in excised roots. 196 Time course analyses by RT-QPCR revealed that the expression of PRR9 and PRR7 was up- 197 regulated in excised roots compared to intact roots (Extended Data Fig. 6e-f), which suggest 198 that in the absence of ELF4 movement from shoots, repression of these genes is alleviated in 199 roots. The use of ELF4-ox intact roots confirmed that PRR9 and PRR7 are targets of ELF4 as 200 their expression was clearly down-regulated in intact ELF4-ox roots compared to WT intact 201 roots (Extended Data Fig. 6g-h). Furthermore, ELF4-ox excised roots still showed repression of 202 target gene expression (Extended Data Fig. 6i-j) suggesting that excision per se is not 203 responsible for the up-regulation observed in WT excised roots. 204 205 To further uncover the function of ELF4 movement, we performed RNA-Seq analyses of WT 206 intact versus excised roots. Our results showed that as expected, a significant fraction of genes 207 was affected by excision (Suplementary Table 2). Comparative analyses of elf4-1 intact roots 208 with WT excised roots allowed us to discern the effects due to excision from those due to the 209 lack of ELF4 movement (Extended Data Fig. 7). Indeed, we focused on the differentially 210 expressed genes (DEGs) present in both excised WT and intact elf4-1 roots. As elf4-1 mutant 211 roots are intact, the overlapping DEGs are not affected by excision per se but rather by the lack 212 of ELF4 movement from shoots, which is shared by elf4-1 intact roots and WT excised roots. 6 213 Our comparative analyses of both datasets revealed that 67% of the DEGs in elf4-1 intact roots 214 are also differentially expressed in WT excised roots (Suplementary Table 3) (Extended Data 215 Fig. 7). The proportion of overlapped DEGs (67%) is highly significant (P-value < 0.0001, chi- 216 square test for equality of proportions) as compared to the proportion of overlapping genes 217 (26%) using a random gene list. The overlap is noteworthy due to the different genotypes (elf4- 218 1 mutant versus WT) and most importantly, the different conditions (intact versus excised). As 219 WT excised roots and elf4-1 intact roots share the lack of ELF4 movement from shoots, the 220 overlapping DEGs provides a hint about genes that directly or indirectly require ELF4 221 movement for proper expression in roots. Consistently, the overlap of DEGs included nearly all 222 of the core oscillator genes (Suplementary Table 3 and Extended Data Fig. 6k). A significant 223 fraction of overlapped DEGs also circadianly oscillated with phase enrichments during the 224 subjective morning and subjective midday (Extended Data Fig. 6l). Therefore, ELF4 movement 225 appears to be important for a fully functional clock in roots. 226 227 Mobile ELF4 does not regulate the photoperiodic-dependent phase in roots 228 In aerial tissues, the circadian clock controls the photoperiodic regulation of growth and 229 development50. To determine whether ELF4 movement is important to deliver photoperiodic 230 information, we analyzed rhythms under short day (ShD) and long day (LgD) conditions. In 231 roots, PRR9::LUC waveforms displayed a subtle phase delay under LgD compared to ShD (Fig. 232 3a) following a similar trend to that observed in shoots (Fig. 3b). Time course analyses by 233 Western-blot of roots of ELF4 Minigene plants20 confirmed the phase delay of ELF4 protein 234 accumulation under LgD compared to ShD (Fig. 3c-d). We reasoned that if ELF4 movement is 235 correlated with the photoperiodic-dependent phase delay, then excision of shoots might affect 236 the phase shift in roots. In agreement with the oscillations in promoter activity (Extended Data 237 Fig. 6c-d), the phase of ELF4 protein accumulation was advanced following excision under both 238 LgD and ShD (Extended Data Fig. 8a-d). Interestingly, under LgD conditions, excision 239 rendered a similar pattern of ELF4 accumulation than in intact roots under ShD (Fig. 3e-f). 240 Therefore, excision abolished the phase delay observed in intact root under LgD (compare Fig. 241 3c-d with Fig. 3e-f). The results suggest that the photoperiodic-dependent phase shift in roots is 242 hampered by blocking ELF4 movement. However, excised roots still showed the phase delay 243 under LgD compared to excised roots under ShD (Extended Data Fig. 8e-f). Furthermore, 244 analyses of rhythms under LgD conditions showed that plants mis-expressing ELF4 (ELF4-ox 245 and elf4-1 mutant) displayed very similar rhythms to WT both in shoots and roots (Fig. 3g-h) 246 suggesting that ELF4 function is not essential to sustain rhythms under entraining conditions. 247 Together, the results suggest that blocking ELF4 movement by excision advances the phase of 248 the root clock but the mobile ELF4 does not directly regulate the photoperiodic-dependent 249 phase shift in roots. 7 250 251 ELF4 movement contributes to the temperature-dependent changes in circadian period of 252 the root clock 253 As the EC also coordinates temperature responses, we examined whether a mobile ELF4 can 254 convey temperature information from shoots to roots. To that end, we first examined the effect 255 of different temperatures (28ºC, 18ºC and 12ºC) on circadian rhythms in roots. We found that 256 LHY::LUC circadian period length was shorter at high than at low temperatures (Extended Data 257 Fig. 9a-b). Shortening of period length at increasing temperature was also observed for other 258 circadian reporter lines (Extended Data Fig. 9c-f) indicating that at this developmental stage and 259 under our experimental conditions, the circadian clock in roots is not able to perfectly sustain 260 circadian period length within a range of temperatures. 261 262 As ELF4 accumulation lengthens period length, we next examined the possible contribution of 263 ELF4 to the long period phenotype at low temperatures. Changes in period length could be 264 mediated by increased ELF4 activity and/or by the increased protein movement from shoots to 265 roots. To examine these possibilities, we compared the effects of blocking ELF4 movement by 266 excision at low and high temperatures. Essentially, if the long period in roots at 12ºC is 267 independent of movement but results from the increased activity of ELF4, blocking movement 268 from shoots by excision should not have a major effect on period length. However, if ELF4 269 movement contributes to the period regulation, abolishing ELF4 traffic should lead to an 270 observable and differential effect on period length at different temperatures. 271 272 Our results showed that excision shortened the period length in WT roots and this effect was 273 significant at 12ºC as compared to the minor effect at 28ºC (Extended Data Fig. 10a-d). 274 Therefore, blocking ELF4 movement by excision shortens the long period of WT roots at 12ºC. 275 Analyses of other circadian reporter lines and at 18ºC also showed that excision shortened 276 period length compared to intact roots (Extended Data Fig. 10e-f). The results suggest a 277 temperature-dependent control of ELF4 movement that regulates period length in roots. To 278 further verify this notion, we examined rhythmic recovery in grafts of ELF4-ox scion into elf4-1 279 rootstock at low and high temperatures. Our results showed an evident rhythmic recovery at 280 12ºC but not at 28ºC (Fig. 4a-b). Furthermore, grafts of E4MG scion into elf4-1 rootstock also 281 efficiently recovered rhythms at 12ºC but not at 28ºC (Fig. 4c-d). ELF4 is still able to delay the 282 phase and lengthen the period at 28ºC (Fig. 4e and Extended Data Fig. 10g) suggesting that 283 movement rather than changes in activity are responsible for the observed effects. ELF4 protein 284 accumulation in roots of ELF4-ox scion into elf4-1 rootstock was higher at 12ºC than at 28ºC 285 (Figure 4f and Extended Data Fig. 10h-i) but ELF4 (E4MG) protein accumulation in shoots is 8 286 similar at different temperatures31 (Extended Data Fig. 10j). Therefore, ELF4 movement rather 287 than protein accumulation or activity appears to be regulated by temperature, contributing to the 288 temperature-dependent control of circadian period in roots. 289 290 Altogether, we propose a model by which mobile ELF4 (mbE4) from shoots to roots defines a 291 pool of active ELF4 protein that is competent to repress target circadian gene expression in 292 roots. ELF4 trafficking is favored at low temperatures, which results in a slow-paced clock (Fig. 293 4g) while high temperatures decrease the movement, leading to a fast root clock (Fig. 4h). The 294 temperature-dependent movement of ELF4 allows a shoot-to-root dialogue that controls the 295 pace of the clock and provides a mechanism by which temperature cues from shoots set the 296 circadian period length in roots. 297 298 Discussion 299 The simultaneous examination of rhythms in shoots and roots of single individual plants shows 300 that the promoter activities and mRNA accumulation of clock genes in roots display a longer 301 period and delayed phase compared to shoots. The trend was observed for morning- and 302 evening-expressed key oscillator genes suggesting that the overall circadian system in roots is 303 not as precise as in other parts of the plant (e.g. the shoot apex)47. Despite the long period, the 304 rhythms persist in roots for several days under LL, which is reminiscent of a fully functional 305 clock. The lack of precision might provide circadian flexibility for rapid adjustments and 306 improved responses in roots. Previous studies have reported spatial waves of clock gene 307 expression with and within organs40, 42, 45 that might be due to differences in period length and 308 variable local coupling. 309 310 The EC directly represses PRR9 and PRR7 expression19, 23, 29, 51, 52 and indirectly promotes the 311 expression of the morning-expressed oscillator genes CCA1 and LHY 51-54. Our analyses with 312 elf4-1 mutant and ELF4-ox plants demonstrate that ELF4 function in roots is also important for 313 proper repression of PRR9 and PRR7 and activation of CCA1 and LHY. ELF4 regulatory 314 function in roots appears to be similar to that previously described for the EC using whole 315 plants. Over-expression of ELF4 lengthens the period of the root clock suggesting that ELF4 316 slows down the circadian period in roots as in shoots22. The fact that accumulation of ELF4 317 lengthens the period agrees with the results showing that blocking movement by shoot excision 318 shortens the period. RNA-Seq analyses revealed that not only the expression of oscillator genes 319 is affected in elf4-1 roots but also a battery of genes involved in other pathways including 320 responses to stimuli. These pathways are also consistent with the EC function in responses to 321 environmental cues55. The mis-regulated genes in elf4-1 roots might be direct targets of ELF4 9 322 and/or indirect outputs of the clock in roots. One of these outputs might be lateral root 323 emergence as the number of lateral roots is affected in elf4-1 and ELF4-ox compared to WT. 324 Future studies are necessary to uncover the molecular and cellular mechanisms by which ELF4 325 regulates the number of lateral roots in Arabidopsis. 326 327 Micrografts of ELF4-ox scion into elf4-1 or elf4-2 rootstocks allow a remarkable recovery of 328 rhythms that is not observed when seedlings expressing ELF4 protein fused to 3 GFPs in 329 tandem is used as scion. These results suggest that ELF4 movement is indeed important for the 330 rhythmic recovery. Fluorescent signals accumulating in the vasculature of elf4-1 mutant 331 rootstock grafted with ELF4-GFP scion and the detection of the ELF4 protein in roots of the 332 micrografted plants also suggest that ELF4 moves from shoots to roots. This conclusion is 333 complemented with the grafting assays of elf4-1(Sh)/elf4-1(Rt) showing the lack of rhythmic 334 recovery in roots, and with the assays of ELF4 protein injection in shoots and the subsequent 335 rhythmic recovery in roots. Micrografts of E4MG and WT plants are also able to recover the 336 rhythms of the elf4-1 mutant roots, which indicate that the effects are not due to the over- 337 accumulation of ELF4-ox and suggest that the amount of mobile ELF4 that is required to 338 regulate the rhythms is probably not very high. Our experiments adding water to the scion or 339 using WT scion without LUC reporter exclude the possibility that rhythms in grafted roots are 340 due to leakage for the adjacent well containing the shoot. The fact that ELF4 protein shows 341 similar properties in terms of length, molecular weight and isoelectric point to other mobile 342 proteins56-59 also support the notion of ELF4 movement. We postulate that following movement, 343 the complex regulatory feedback loops at the core of the oscillator will be reset to control the 344 pace of the clock. Further experiments at different developmental stages and various growing 345 conditions (e.g. light and temperature) will be required to confirm whether the long distance 346 movement of ELF4 contributes or not to the spatial waves of clock gene expression observed in 347 roots42. 348 349 Excision blocks ELF4 movement from shoots and consequently, we observe that oscillator gene 350 expression and other output genes are affected in WT excised roots. Previous studies have also 351 used excision to define properties of the circadian function in roots42. Although many genes are 352 affected by excision, it is noteworthy that 67% of the genes mis-regulated in elf4-1 intact roots 353 are also mis-expressed in WT excised roots. Both conditions share the lack of ELF4 movement, 354 which suggest that the overlapped DEGs are due to the lack of a mobile ELF4 (note that the 355 RNA-Seq studies with elf4-1 mutant were performed with intact roots). The phase shifts 356 observed following excision prompted us to examine whether ELF4 movement contributed to 357 the photoperiodic-dependent phase shift. However, excised roots still sustained the phase delay 358 under LgD suggesting that other factors are responsible for this regulation. Light piping down 10 359 the root49 might be also important for synchronization. Regardless the mechanism, it is able to 360 overcome the mis-expression of ELF4 in shoots and roots as ELF4-ox and elf4-1 mutant plants 361 displayed similar rhythms to WT. Clear alteration of circadian expression under LL but not 362 under entraining conditions has been reported for other clock mutants and over-expressing 363 plants60. 364 365 The EC activity is down-regulated at high temperatures in whole seedlings29, 31. Shoot excision 366 shortened the period, suggesting that ELF4 movement is important in the control of circadian 367 period length. Period shortening is more significant at low than at high temperatures confirming 368 that ELF4 movement might be favored at low temperatures. The temperature-dependent control 369 of ELF4 movement is also supported by the increased accumulation ELF4 protein in grafted 370 roots at 12ºC compared to 28ºC. As ELF4 accumulation results in long period, the increased 371 movement leads to a clock that runs slower at low than at high temperatures. It would be 372 interesting to elucidate whether period sensitivity to temperature might provide an advantage for 373 optimal root responsiveness to temperature variations. 374 375 Methods 376 Plant material, growth conditions, constructs and physiological assays 377 Arabidopsis thaliana seedlings were stratified at 4°C in the dark for 2-3 days on Murashige and 378 Skoog (MS) agar medium with 3% of sucrose (MS3). Plates were transferred to chambers with 379 light- and temperature-controlled conditions with 25-50 μmol·quanta·m−2·s−1 of cool white 380 fluorescent light. Seedlings were synchronized under Light:Dark cycles, LD (12h light: 12h 381 dark) at 22°C. For experiments with different temperatures, seedlings were analyzed under 382 constant light conditions at 12ºC, 18ºC, 22ºC or 28ºC following synchronization under LD (12h 383 light: 12h dark) at 22ºC. For experiments with different photoperiods, seedlings were grown 384 under short days (ShD, 8h light: 16h dark) or long days (LgD, 16h light: 8h dark). Reporter 385 lines CCA1::LUC61, LHY::LUC19, PRR9::LUC62, TOC1::LUC6 and elf4-117, elf4-227, ELF4 386 Minigene20 and ELF4-GFP-ox19, 20 plants were described elsewhere. The ELF4 construct fused 387 to three Green Fluorescent Proteins (GFPs) in tandem was generated by PCR-mediated 388 amplification of the ELF4 coding sequence and subsequent subcloning into the PGWB514 389 gateway vector63, 64. The resulting plasmid was digested with PacI and SacI restriction enzymes 390 and ligated with the 3 GFPs insert from the pBS-x3GFP vector (Addgene). The construct was 391 transformed into elf4-1 mutant plants. Plants were transformed using Agrobacterium 392 tumefaciens (GV2260)-mediated DNA transfer65. For in vitro protein injection assays, the ELF4 393 coding sequence was subcloned into the pET MBP_1a vector (Novagen) after removing the 394 GFP by Nco I and Xho I restriction enzyme digestion. 395 11 396 For lateral root analyses, WT, elf4-1 and ELF4-ox seeds were surface-sterilized and plated onto 397 MS medium supplemented with 0.25% w/v sucrose and 1.5% agar. The top quarter of the agar 398 was removed and seeds pipetted evenly along this line. Plants were then grown vertically for 12 399 days before lateral roots were measured. Lateral roots were manually counted using a Nikon 400 SMZ800 dissecting microscope. Statistical analysis was completed using R (version 3.6), within 401 the R studio software package (version 1.1.4). For hypocotyl elongation measurements, WT, 402 elf4-1, ELF4-GFP-ox and ELF4-3xGFP-ox seeds transformed into the elf4-1 mutant 403 background were stratified on MS3 medium in the dark for 4 days at 4°C, exposed to white light 404 (40 μmol·quanta·m-2·s-1) for 6 h and maintained in the dark (22ºC) for 18 h before transferring 405 to chambers under Short-Day conditions (8h light:16h dark). Hypocotyl length was measured 406 using the ImageJ software (version 1.48v) (https://imagej.nih.gov/ij/) at 7 days after 407 stratification. Each experiment was repeated at least twice using 20-50 seedlings per genotype. 408 Statistical analyses were performed using the GraphPad Prism software (version 5.01; 409 GraphPad Software, Inc) using two-tailed t-tests with 95% of confidence. 410 411 In vivo luminescence assays 412 In vivo luminescence assays were performed as previously described47. Briefly, 7-15 day-old 413 seedlings synchronized under LD cycles at 22°C were transferred to 96-well plates and released 414 into the different conditions as specific for each experiment. Analyses were performed with a 415 LB960 luminometer (Berthold Technologies) using the Microwin software (Version 4.41; 416 Mikrotek Laborsysteme). The period, phase and amplitude were estimated using the Fast 417 Fourier Transform–Non Linear Least Squares (FFT NLLS) suite 6366 using the Biological 418 Rhythms Analysis Software System (version 3.0; BRASS, http://www.amillar.org). For the 419 simultaneous analysis of rhythms of shoots and roots from the same plant, the connection 420 between the two adjacent wells of the 96 well plates was serrated. Seedlings were then 421 horizontally positioned so the shoot was placed in one well and the roots in the contiguous well. 422 For excision analyses, roots were excised from shoots and placed into the 96 well plates for 423 luminescence analyses. Data from samples that appeared damaged or contaminated were 424 excluded from the analysis. For analyses of grafted samples, water instead of luciferin was 425 applied to the wells containing shoots to avoid possible leaking signals from shoots to roots as 426 specified. At least two biological replicates were performed per experiment, with measurements 427 taken from distinct samples grown and processed at different times. Each biological replicate 428 included 6 to 12 independent seedlings per condition and/or genotype. Statistical analyses were 429 performed using the GraphPad Prism software (version 5.01; GraphPad Software, Inc) using 430 two-tailed t-tests with 95% of confidence. 431 12 432 433 Protein purification and injection analyses 434 E. coli cells (BL21, Dh5α) were transformed and grown in LB medium (Tryptone 10 g/L, yeast 435 extract 5 g/L, NaCl 10 g/L pH 7.5) until OD600 values of 0.8-1.0. Isopropyl β-D-1- 436 thiogalactopyranoside (IPTG)-mediated induction of MBP-ELF4 and MBP-GFP was performed 437 at 28ºC for 6 h. Bacteria resupended in lysis buffer (50mM Tris-HCl, pH7-8, 5% glycerol, 438 50mM NaCl) were lysed by sonication for 2-3 minutes (30s on, 30s off, high intensity) using a 439 sonicator (Bioruptor, Diagnode). Recombinant proteins were purified using gravity flow 440 columns with amylose resin (New England Biolabs). MBP cleavage was performed by 441 incubation in cleavage buffer (50 mM Trizma-HCl, pH 8.0, 0.5 mM EDTA, and 1 mM DTT) 442 for 2 hours at 30ºC with native Tobacco Etch Virus (TEV) protease (Sigma-Aldrich). The 443 purified recombinant proteins were concentrated using Amicon centrifugal filters following the 444 manufacturer recommendations (Millipore). Protein yield was estimated by measuring 445 absorbance at 595 nm using a spectrophotometer (UV-2600, SHIMADZU). Proteins were also 446 examined by Coomassie-Brilliant Blue staining of polyacrylamide gels to confirm protein size 447 and integrity. Purified ELF4 was injected into leaves of 10-day old elf4-1 mutant seedlings 448 harboring the LHY::LUC reporter line. Similar concentration of GFP protein was also injected 449 as a negative control. Rhythms were subsequently examined in a LB960 luminometer (Berthold 450 Technologies) as described above. 451 452 Time course analyses of gene expression by RT-qPCR 453 Seedlings were synchronized under LD cycles in MS3 medium plates for 12-14 days and 454 subsequently transferred to LL. Shoots and roots from intact plants were taken every 4 hour 455 over the circadian cycle. For excised roots, shoots and roots were carefully separated with a 456 sterile razor blade and the excised roots were deposited on MS3 agar medium plates for 2 or 3 457 days as specified. RNA was purified using a Maxwell RSC Plant RNA kit following the 458 manufacturer’s recommendations (Promega). Single-stranded cDNA was synthesized using 459 iScript Reverse Transcription Supermix for RT-qPCR (Bio-Rad). qPCR analyses were 460 performed with cDNAs diluted 50 fold with nuclease free water using Brilliant III Ultra-Fast 461 SYBR Green qPCR Master Mix (Agilent) with a 96-well CFX96 Touch Real-Time PCR 462 detection system (Bio-RAD CFX96 Manager version 3.1, Bio-Rad). Each sample was run in 463 technical triplicates. The expression of PP2AA3 (PROTEIN PHOSPHATASE 2A SUBUNIT A3, 464 AT1G13320) or MON1 (MONENSIN SENSITIVITY1, AT2G28390)67 was used as a control. 465 Crossing point (Cp) calculation was used for quantification using the Absolute Quantification 466 analysis by the 2nd Derivative Maximun method. At least two biological replicates were 13 467 performed, with measurements taken from distinct samples grown and processed at different 468 times. 469 470 RNA Seq analyses 471 Roots from 14-day old intact WT, elf4-1 mutant and excised WT plants synchronized under LD 472 cycles in MS3 medium plates were transferred to LL conditions for 3 days. Roots were excised 473 just before transferring to LL. Samples were collected at the fourth day under LL at circadian 474 time 75 (CT75). Total RNA was isolated using a Maxwell RSC Plant RNA kit. RNA 475 sequencing was performed by IGATech (Italy). About 1-2 µg of high quality RNA (R.I.N. >7) 476 was used for library preparation with a TruSeq Stranded mRNA Sample Prep kit’ (Illumina, San 477 Diego, CA). Poly-A mRNA was fragmented for 3 minutes at 94°C. Purification was performed 478 with 0.8x Agencourt AMPure XP beads. Both RNA samples and final libraries were quantified 479 using the Qubit 2.0 Fluorometer (Invitrogen, Carlsbad, CA). Quality was tested using the 480 Agilent 2100 Bioanalyzer RNA Nano assay (Agilent technologies, Santa Clara, CA). Libraries 481 were then processed with Illumina cBot for cluster generation on the flowcell, following the 482 manufacturer’s instructions and sequenced on paired-end mode at the multiplexing level 483 requested on HiSeq2500 (Illumina, San Diego, CA). The CASAVA (1.8.2 version) of the 484 Illumina pipeline was used to process raw data for both format conversion and de-multiplexing. 485 486 Sequence analysis was performed using the A.I.R. software (version 1.0) 487 (https://transcriptomics.sequentiabiotech.com/) developed by Sequentia Biotech. Briefly, raw 488 sequence files were first subjected to quality control analysis by using FastQC (v0.10.1) before 489 trimming and removal of adapters with BBDuk (https://jgi.doe.gov/data-and-tools/bbtools/). 490 Reads were then mapped against the Arabidopsis thaliana genome (TAIR10 Genome Release, 491 ftp://ftp.arabidopsis.org/) with STAR (version 2.6)68. FeatureCounts (version 1.6.1)69 was then 492 used to obtain raw expression counts for each annotated gene. The differential expression 493 analysis was conducted with edgeR (version 3.18.1)70, using the TMM normalization method. 494 FPKM were obtained with edgeR. 495 496 The Integrative Genomics Viewer (IGV, version 2.4.13) 74, 75 497 (https://software.broadinstitute.org/software/igv/) was used to visualize the data . The 498 circadian phases were analyzed using the publicly available Gene Phase Analysis Tool 499 “PHASER” of the DIURNAL database (http://diurnal.mocklerlab.org/)76, 77 . Phase over 500 representation is calculated as the number of genes with a given phase divided by the total 501 number of genes over the number of genes called rhythmic and divided by the total number of 502 genes in the dataset. Functional categories of the DEG were obtained using the web tool 503 “BIOMAPS”(VirtualPlant, version 1.3)78, which renders over represented and significant 14 504 functional terms (Gene Ontology or MIPS) as compared to the frequency of the term in the 505 whole genome. 506 507 Western-blot assays 508 Approximately 50-100 mgs of roots from plants grown under the specified photoperiodic 509 condition were sampled every four hours over a 24-hour cycle. Samples were rapidly frozen 510 with liquid nitrogen and grounded with stainless steel beads (Millipore) in a tissue lyser 511 (QIAGEN, TissueLyser II). Tissue was subsequently resuspended in Protein Extraction Buffer 512 (PEB) containing 50 mM Tris-HCl pH 7.5, 150 mM NaCl, 0.5% NP40, 1 mM EDTA, and 513 protease inhibitors cocktail (1:100) and PMSF (1:1000). Protein extracts were centrifuged at 514 4 °C, measured for protein concentration using Bradford reagent (Bio-Rad) and normalized to 2 515 mg/ ml in 4 x SDS loading buffer (250 mM Tris-HCl, pH 6.8, 8% SDS, 0.08% bromophenol 516 blue, 40% glycerol). Samples were run on a 12% gel and analyzed by immunoblotting, fixed 30 517 min with 0.4% Glutaraldehyde solution (Sigma-Aldrich) and detected with an anti-HA antibody 518 (Roche) (1:2000 dilution) and a goat anti-rat horse peroxidase conjugated secondary antibody 519 (Sigma-Aldrich) (1:4000 dilution). For analyses of the grafted plants, roots from plants 520 synchronized under LD cycles were subsequently transferred to LL for 3 days at 12ºC, 22ºC or 521 28ºC. Samples were collected at CT81, rapidly frozen with liquid nitrogen and grounded with 522 stainless steel beads (Millipore) in a tissue lyser (QIAGEN, TissueLyser II). Powder extracts 523 were subsequently resuspended in Protein Extraction Buffer (PEB) containing 50 mM Tris-HCl 524 pH 7.5, 150 mM NaCl, 0.5% NP40, 1 mM EDTA, and protease inhibitors cocktail (1:100), 525 PMSF (1:1000), and MG132 (100uM). Protein extracts were centrifuged at 4 °C, measured for 526 protein concentration using Bradford reagent (Bio-Rad) and normalized to 2 µg/ µl in 4 x SDS 527 loading buffer (250 mM Tris-HCl, pH 6.8, 8% SDS, 0.08% bromophenol blue, 40% glycerol 528 and 5 mM β-mercaptoethanol). For detection of ELF4 protein fused to GFP, samples were run 529 on a 10% gel and was detected using an anti-GFP antibody (ab290, Abcam) (1:5000) and Goat 530 anti-Rabbit IgG (H+L) Secondary Antibody, HRP (31460, Lot: OG188649, Thermo Fisher 531 Scientific) (1:5000 dilution).. For detection of ELF4 protein fused to HA (ELF4 Minigene) in 532 shoots, samples were resuspended in Protein Extraction Buffer (PEB) containing 50mM 533 TrisHCl pH7.5, 150mM NaCl, 0.5% NP40, 1mM EDTA, protease inhibitors and proteasome 534 inhibitor (MG132, 100uM). Protein extracts in 4× SDS loading buffer (250 mM Tris-HCl, pH 535 6.8, 8% SDS, 0.08% bromophenol blue, 40% glycerol, 5 mM β-mercaptoethanol) were run on a 536 12% gel and analyzed by immunoblotting, fixed 30 min with 0.4% Glutaraldehyde solution 537 (Sigma-Aldrich) and detected with an Anti-HA antibody High Affinity from rat IgG1 538 (11867423001, Sigma-Aldrich) (1:2000) and a goat anti-rat horse peroxidase conjugated 539 secondary antibody (A9037, Sigma-Aldrich) (1:4000). The Image Lab software (version 5.2.1; 540 Bio-Rad) was used to image the Western-blots. Membranes were stained with a Ponceau S 15 541 solution following the manufacturer recommendations (Sigma). Proteins were also run on a 542 10% SDS-PAGE gel and stained with Coomassie-Brilliant Blue. At least two biological 543 replicates were performed per experiment and/or condition, with measurements taken from 544 distinct samples grown and processed at different times. 545 546 Micrografting assays 547 Micrografting was performed essentially as previously described47. Data from unsuccessful 548 grafted seedlings that failed to properly join together or grafts that were insufficiently clear to be 549 successful were discarded. Approximately 100-150 grafting events were performed for every 550 combination of grafts. The percentage of successfully micrografted plants was about 30-50 % 551 (possibly higher but only the clearly successful grafted plants were taken into account). From 552 the successfully grafted plants, 30-60 % showed different degrees of recovered rhythms. For in 553 vivo luminescence assays, shoots and roots of grafted plants were simultaneously examined 554 using the protocol described above. Water instead of luciferin was added to the wells containing 555 shoots to exclude the possibility that recovery of rhythms in roots were due to leaking signals 556 from shoots. As specified, some grafted shoots contained no reporter fused to luciferase. 557 558 Reconstruction of driving forces by recurrence plots 559 Common driving forces were estimated following a several-step procedure. Suppose that we 560 have the number K of simultaneous time series measurements { ( )| = 1,2, … , , = 561 1,2, … , } . First, we took time differences ̃ ( ) = ( + 1) − ( ) ( = 1,2, … , , = 562 1,2, … , − 1 ) of consecutive measurements and remove trends. Second, we used delay 563 coordinates79, 80 ( ) = ̃ ( ), ̃ ( + 1), ̃ ( + 2), ̃ ( + 3), ̃ ( + 4) of 5 dimensional space 564 ( = 1,2, … , , = 1,2, … , − 4) to obtain a recurrence plot81. A recurrence plot is a two- 565 dimensional figure proposed originally for visualizing time series data. Both axes are the same 566 time axis. If the Euclidean distance ‖ ( ) − ( )‖ < , where is a threshold and , ∈ 567 {1,2, … , − 4}, then we plot a point at ( , ). We denote this as ( , ) = 1. Otherwise, we 568 do not plot a point at ( , ). We denote this state as ( , ) = 0. We controlled the value of 569 the threshold for each component ∈ {1,2, … , } so that 5% points, except for the central 570 diagonal line, have points plotted. Third, we took the union for the recurrence plots to infer the 571 recurrence plot of the common driving force82. Namely we declare ( , ) = 1 if we have 572 ( , ) = 1 for at least one of ∈ {1,2, … , }. Otherwise, we have ( , ) = 0. In each of 573 the original recurrence plots, points are plotted where the driving force and the driven system 574 are both similar. By taking their union, we can extract pairs of times where only the driving 575 force is similar. Fourth, we applied the assumption of continuity and supplied the points at 576 (t,t+1) and (t+1,t) for each i83. Namely, we forcefully declare ( , + 1) = ( + 1, ) = 1 for 16 577 = 1,2, … , − 5. Fifth, we applied the method described82 to convert the recurrence plot of the 578 common driving force into time series. Here we describe the detail for this step: (i) we construct 579 a network where each node correspond to a time point and we connect two nodes and if #{ , ,…, | ( , ) ( , ) } 580 ( , ) = 1; (ii) we assign a distance for each edge as 1 − ; #{ , ,…, | ( , ) ( , ) } 581 (iii) we obtain the shortest distance for each pair of nodes on this graph (this process 582 approximates the geodesic distance between two time points); (iv) we apply the multi- 583 dimensional scaling to convert the distance matrix to a time series. Namely this fifth step works 584 as the inverse transform of a recurrence plot and we can reproduce a rough shape for the 585 original time series. This fifth step has two mathematical proofs84, 85. Lastly, we extracted the 586 component corresponding to the largest eigenvalue. The periodicity of the reconstructed 587 common driving force X(t) was evaluated using the autocorrelation function and 10000 random 588 shuffle surrogates86, for each of which the order of time points is randomly exchanged. Here, the 589 null hypothesis was that there was no serial dependence. The autocorrelation with time 590 difference k is the correlation coefficient between X(t) and X(t+k). Thus, it is close to 1 if X(t) 591 and X(t+k) are similar while it is close to 0 if they are not related to each other. If there is a 24h 592 periodicity in the driving force, the autocorrelation with 24h time difference should be a value 593 close to 1. 594 Confocal imaging 595 For in vivo confocal imaging, the roots of WT and ELF4-ox (fused to GFP) grafted shoots into 596 elf4-1 mutants were placed on microscope slides (Sigma). Fluorescent signals were imaged with 597 an argon laser (transmissivity: 40%; excitation: 515 nm; emission range: 530 630 nm) in a 598 FV 1000 confocal microscope (Olympus, Tokyo, Japan) using a FV-10-ASW4.2 Viewer 599 Manager software (Olympus) with a 40x/1.3 oil immersion objective. The image sizes were 600 about 640 x 640 (0.497 μm/pixel) and sampling speed of 4 μs/pixel. The results are 601 representative of at least three biological replicates for grafting and about three-four images per 602 grafts. 603 604 List of primers. List of primers used for expression analyses, cloning and generation of 3x GFP 605 construct. Name Sequence Experiment REF1(PP2A_A3)_EXP_F AAGCGGTTGTGGAGAACATGATACG Expression analysis REF1(PP2A_A3)_EXP_R TGGAGAGCTTGATTTGCGAAATACCG Expression analysis MON1_EXP_F AACTCTATGCAGCATTTGATCCACT Expression analysis MON1_EXP_R TGATTGCATATCTTTATCGCCATC Expression analysis PRR7_EXP_F AAGTAGTGATGGGAGTGGCG Expression analysis PRR7_EXP_R GAGATACCGCTCGTGGACTG Expression analysis PRR9_EXP_F ACCAATGAGGGGATTGCTGG Expression analysis 17 PRR9_EXP_R TGCAGCTTCTCTCTGGCTTC Expression analysis ELF4_EXP_F GACAATCACCAATCGAGAAT Expression analysis ELF4_EXP_R ATGTTTCCGTTGAGTTCTTG Expression analysis CCA1_EXP_F TCGAAAGACGGGAAGTGGAACG Expression analysis CCA1_EXP_R GTCGATCTTCATTGGCCATCTCAG Expression analysis LHY_EXP_F AAGTCTCCGAAGAGGGTCGT Expression analysis LHY_EXP_R GGCGAAAAGCTTTGAGGCAA Expression analysis ELF4_CLN_F CACCATGAAGAGGAACGGCGA Cloning ELF4_CLN_R AGCTCTAGTTCCGGCAGCACCA Cloning MBP-ELF4_CLN_F CATGCCATGGGCATGAAGAGGAACGGCGAG Cloning MBP-ELF4_CLN_R CCGCTCGAGTTAAGCTCTAGTTCCGGCAGCAC Cloning Generation of pGWB- PacI-pBS3xGFP-F GGTTAATTAACGCTGGAGGATCCATGTCTA c3xGFP Generation of pGWB- SacI-pBS3xGFP-R TCGAGCTCTCTAGAACTAGTGGATCTTTA c3xGFP 606 607 608 Reporting Summary. Further information on research design is available in the Nature 609 Research Reporting Summary linked to this article. 610 611 Data availability 612 Data and materials generated in this study are available without restriction and should be 613 requested to Paloma Mas: paloma.mas@cragenomica.es. NGS data are deposited in NCBI with 614 accession code PRJNA610472 (BioSample accessions SAMN14299292, SAMN14299293, 615 SAMN14299294). Source data are provided for all figures. 616 617 References 618 1. Zhang, E.E. & Kay, S.A. Clocks not winding down: unravelling circadian networks. 619 Nat. Rev. Mol. Cell. Biol. 11, 764-776 (2010). 620 2. Greenham, K. & McClung, C.R. Integrating circadian dynamics with physiological 621 processes in plants. Nat. Rev. Genet. 16, 598-610 (2015). 622 3. Nagel, Dawn H. & Kay, Steve A. Complexity in the wiring and regulation of plant 623 circadian networks. Curr. Biol. 22, R648-R657 (2012). 624 4. Oakenfull, R.J. & Davis, S.J. Shining a light on the Arabidopsis circadian clock. Plant 625 Cell Environ 40, 2571-2585 (2017). 626 5. Hogenesch, J.B. & Ueda, H.R. Understanding systems-level properties: timely stories 627 from the study of clocks. Nature Reviews Genetics 12, 407 (2011). 628 6. Portolés, S. & Más, P. The functional interplay between protein kinase CK2 and CCA1 629 transcriptional activity is essential for clock temperature compensation in Arabidopsis. 630 PLoS Genetics 6, e1001201 (2010). 631 7. Hansen, L.L., van den Burg, H.A. & van Ooijen, G. Sumoylation Contributes to 632 Timekeeping and Temperature Compensation of the Plant Circadian Clock. J Biol 633 Rhythms 32, 560-569 (2017). 634 8. Marshall, C.M., Tartaglio, V., Duarte, M. & Harmon, F.G. The Arabidopsis sickle 635 Mutant Exhibits Altered Circadian Clock Responses to Cool Temperatures and 636 Temperature-Dependent Alternative Splicing. 28, 2560-2575 (2016). 18 637 9. Salomé, P., Weigel, D. & McClung, C. The role of the Arabidopsis morning loop 638 components CCA1, LHY, PRR7, and PRR9 in temperature compensation. Plant Cell 639 22, 3650-3661 (2010). 640 10. Edwards, K.D., Lynn, J.R., Gyula, P., Nagy, F. & Millar, A.J. Natural allelic variation 641 in the temperature-compensation mechanisms of the Arabidopsis thaliana circadian 642 clock. Genetics 170, 387-400 (2005). 643 11. Edwards, K.D. et al. FLOWERING LOCUS C mediates natural variation in the high- 644 temperature response of the Arabidopsis circadian clock. Plant Cell 18, 639 - 650 645 (2006). 646 12. Ito, S. et al. FLOWERING BHLH transcriptional activators control expression of the 647 photoperiodic flowering regulator CONSTANS in Arabidopsis. 109, 3582-3587 (2012). 648 13. Gould, P.D. et al. Network balance via CRY signalling controls the Arabidopsis 649 circadian clock over ambient temperatures. 9, 650 (2013). 650 14. Nagel, D.H., Pruneda-Paz, J.L. & Kay, S.A. FBH1 affects warm temperature responses 651 in the Arabidopsis circadian clock. 111, 14595-14600 (2014). 652 15. Jones, M.A., Morohashi, K., Grotewold, E. & Harmer, S.L. Arabidopsis JMJD5/JMJ30 653 Acts Independently of LUX ARRHYTHMO Within the Plant Circadian Clock to 654 Enable Temperature Compensation. 10 (2019). 655 16. Gould, P.D. et al. The molecular basis of temperature compensation in the Arabidopsis 656 circadian clock. Plant Cell 18, 1177-1187 (2006). 657 17. Doyle, M.R. et al. The ELF4 gene controls circadian rhythms and flowering time in 658 Arabidopsis thaliana. Nature 419, 74-77 (2002). 659 18. Kolmos, E. et al. Integrating ELF4 into the circadian system through combined 660 structural and functional studies. HFSP journal 3, 350-366 (2009). 661 19. Herrero, E. et al. EARLY FLOWERING4 recruitment of EARLY FLOWERING3 in 662 the nucleus sustains the Arabidopsis circadian clock. Plant Cell 24, 428-443 (2012). 663 20. Nusinow, D.A. et al. The ELF4-ELF3-LUX complex links the circadian clock to 664 diurnal control of hypocotyl growth. Nature 475, 398-402 (2011). 665 21. Khanna, R., Kikis, E.A. & Quail, P.H. EARLY FLOWERING 4 functions in 666 phytochrome B-regulated seedling de-etiolation. Plant Physiol. 133, 1530-1538 (2003). 667 22. McWatters, H.G. et al. ELF4 is required for oscillatory properties of the circadian 668 clock. Plant Physiol. 144, 391-401 (2007). 669 23. Helfer, A. et al. LUX ARRHYTHMO encodes a nighttime repressor of circadian gene 670 expression in the Arabidopsis core clock. Curr. Biol. 21, 126-133 (2011). 671 24. Onai, K. & Ishiura, M. PHYTOCLOCK 1 encoding a novel GARP protein essential for 672 the Arabidopsis circadian clock. Genes Cells 10, 963-972 (2005). 673 25. Hazen, S.P. et al. LUX ARRHYTHMO encodes a Myb domain protein essential for 674 circadian rhythms. Proc. Natl. Acad. Sci. USA 102, 10387-10392 (2005). 675 26. Hicks, K.A. et al. Conditional circadian dysfunction of the Arabidopsis early-flowering 676 3 mutant. Science 274, 790-792 (1996). 677 27. Huang, H. et al. Identification of Evening Complex associated proteins in Arabidopsis 678 by affinity purification and mass spectrometry. M. Cell. Proteomics 15, 201-217 (2016). 679 28. Li, G. et al. Coordinated transcriptional regulation underlying the circadian clock in 680 Arabidopsis. Nat. Cell Biol. 13, 616-622 (2011). 681 29. Mizuno, T. et al. Ambient temperature signal feeds into the circadian clock 682 transcriptional circuitry through the EC night-time repressor in Arabidopsis thaliana. 683 Plant Cell Physiol. 55, 958-976 (2014). 684 30. Siddiqui, H., Khan, S., Rhodes, B.M. & Devlin, P.F. FHY3 and FAR1 act downstream 685 of light stable phytochromes. Front Plant Sci. 7, 175 (2016). 686 31. Ezer, D. et al. The evening complex coordinates environmental and endogenous signals 687 in Arabidopsis. Nat. Plants 3, 17087 (2017). 688 32. Kim, Y. et al. ELF4 Regulates GIGANTEA Chromatin Access through Subnuclear 689 Sequestration. Cell Reports 3, 671-677 (2013). 19 690 33. Nieto, C., López-Salmerón, V., Davière, J.-M. & Prat, S. ELF3-PIF4 Interaction 691 Regulates Plant Growth Independently of the Evening Complex. Current Biology 25, 692 187-193 (2015). 693 34. Sai, J. & Johnson, C.H. Different circadian oscillators control Ca(2+) fluxes and lhcb 694 gene expression. Proc. Natl. Acad. Sci. USA 96, 11659-11663 (1999). 695 35. Thain, S.C., Murtas, G., Lynn, J.R., McGrath, R.B. & Millar, A.J. The circadian clock 696 that controls gene expression in Arabidopsis is tissue specific. Plant Physiol. 130, 102- 697 110 (2002). 698 36. Michael, T.P., Salome, P.A. & McClung, C.R. Two Arabidopsis circadian oscillators 699 can be distinguished by differential temperature sensitivity. Proc. Natl. Acad. Sci. USA 700 100, 6878-6883 (2003). 701 37. Bordage, S., Sullivan, S., Laird, J., Millar, A.J. & Nimmo, H.G. Organ specificity in the 702 plant circadian system is explained by different light inputs to the shoot and root clocks. 703 New Phytol. 212, 136-149 (2016). 704 38. Muranaka, T. & Oyama, T. Heterogeneity of cellular circadian clocks in intact plants 705 and its correction under light-dark cycles. Sci. Adv. 2, e1600500 (2016). 706 39. Thain, S.C., Hall, A. & Millar, A.J. Functional independence of circadian clocks that 707 regulate plant gene expression. Curr. Biol. 10, 951-956 (2000). 708 40. Fukuda, H., Nakamichi, N., Hisatsune, M., Murase, H. & Mizuno, T. Synchronization 709 of plant circadian oscillators with a phase delay effect of the vein network. Phys. Rev. 710 Lett. 99, 098102 (2007). 711 41. Wenden, B., Toner, D.L.K., Hodge, S.K., Grima, R. & Millar, A.J. Spontaneous 712 spatiotemporal waves of gene expression from biological clocks in the leaf. Proc. Natl. 713 Acad. Sci. 109, 6757-6762 (2012). 714 42. Greenwood, M., Domijan, M., Gould, P.D., Hall, A.J.W. & Locke, J.C.W. Coordinated 715 circadian timing through the integration of local inputs in Arabidopsis thaliana. PLOS 716 Biology 17, e3000407 (2019). 717 43. Endo, M., Shimizu, H., Nohales, M.A., Araki, T. & Kay, S.A. Tissue-specific clocks in 718 Arabidopsis show asymmetric coupling. Nature 515, 419-422 (2014). 719 44. Yakir, E. et al. Cell autonomous and cell-type specific circadian rhythms in 720 Arabidopsis. Plant J. 68 520-531 (2011). 721 45. Gould, P.D. et al. Coordination of robust single cell rhythms in the Arabidopsis 722 circadian clock via spatial waves of gene expression. Elife 7, e31700 (2018). 723 46. Fukuda, H., Ukai, K. & Oyama, T. Self-arrangement of cellular circadian rhythms 724 through phase-resetting in plant roots. Phys. Rev. E. 86, 041917 (2012). 725 47. Takahashi, N., Hirata, Y., Aihara, K. & Mas, P. A hierarchical multi-oscillator network 726 orchestrates the Arabidopsis circadian system. Cell 163, 148-159 (2015). 727 48. James, A.B. et al. The circadian clock in Arabidopsis roots is a simplified slave version 728 of the clock in shoots. Science 322, 1832-1835 (2008). 729 49. Nimmo, H.G. Entrainment of Arabidopsis roots to the light:dark cycle by light piping. 730 Plant Cell Environ. 41, 1742-1748 (2018). 731 50. de Montaigu, A., Tóth, R. & Coupland, G. Plant development goes like clockwork. 732 Trends in Genetics 26, 296-306 (2010). 733 51. Kolmos, E. et al. A Reduced-Function Allele Reveals That EARLY FLOWERING3 734 Repressive Action on the Circadian Clock Is Modulated by Phytochrome Signals in 735 Arabidopsis. The Plant Cell (2011). 736 52. Dixon, L.E. et al. Temporal Repression of Core Circadian Genes Is Mediated through 737 EARLY FLOWERING 3 in Arabidopsis. Curr. Biol. 21, 120-125 (2011). 738 53. Kikis, E., Khanna, R. & Quail, P. ELF4 is a phytochrome-regulated component of a 739 negative feedback loop involving the central oscillator components CCA1 and LHY. 740 Plant Journal 44, 300-313 (2005). 741 54. Lu, S.X. et al. CCA1 and ELF3 Interact in the Control of Hypocotyl Length and 742 Flowering Time in Arabidopsis. 158, 1079-1088 (2012). 743 55. Huang, H. & Nusinow, D.A. Into the Evening: Complex Interactions in the Arabidopsis 744 Circadian Clock. Trends in Genetics 32, 674-686 (2016). 20 745 56. Corbesier, L. et al. FT Protein Movement Contributes to Long-Distance Signaling in 746 Floral Induction of Arabidopsis. 316, 1030-1033 (2007). 747 57. Jaeger, K.E. & Wigge, P.A. FT Protein Acts as a Long-Range Signal in Arabidopsis. 748 Current Biology 17, 1050-1054 (2007). 749 58. Mathieu, J., Warthmann, N., Küttner, F. & Schmid, M. Export of FT Protein from 750 Phloem Companion Cells Is Sufficient for Floral Induction in Arabidopsis. Current 751 Biology 17, 1055-1060 (2007). 752 59. Chen, X. et al. Shoot-to-Root Mobile Transcription Factor HY5 Coordinates Plant 753 Carbon and Nitrogen Acquisition. Current Biology 26, 640-646 (2016). 754 60. Flis, A. et al. Defining the robust behaviour of the plant clock gene circuit with absolute 755 RNA timeseries and open infrastructure. Open Biol 5 (2015). 756 61. Salomé, P.A. & McClung, C.R. PSEUDO-RESPONSE REGULATOR 7 and 9 are 757 partially redundant genes essential for the temperature responsiveness of the 758 Arabidopsis circadian clock. Plant Cell 17, 791-803 (2005). 759 62. Edwards, K.D. et al. Quantitative analysis of regulatory flexibility under changing 760 environmental conditions. Mol. Syst. Biol. 6 (2010). 761 63. Nakagawa, T. et al. Development of series of gateway binary vectors, pGWBs, for 762 realizing efficient construction of fusion genes for plant transformation. J. Biosci. 763 Bioeng 104, 34-41 (2007). 764 64. Nakagawa, T. et al. Improved gateway binary vectors: high-performance vectors for 765 creation of fusion constructs in transgenic analysis of plants. Biosci Biotechnol 766 Biochem. 71, 2095-2100 (2007). 767 65. Clough, S.J. & Bent, A.F. Floral dip: a simlified method for Agrobacterium-mediated 768 transformation of Arabidopsis thaliana. Plant J. 16, 735-743 (1998). 769 66. Plautz, J.D. et al. Quantitative analysis of Drosophila period gene transcription in living 770 animals. J. Biol. Rhythms 12, 204-217 (1997). 771 67. Czechowski, T., Stitt, M., Altmann, T., Udvardi, M.K. & Scheible, W.-R. Genome- 772 Wide Identification and Testing of Superior Reference Genes for Transcript 773 Normalization in Arabidopsis. Plant Physiology 139, 5-17 (2005). 774 68. Dobin, A. et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29, 15-21 775 (2013). 776 69. Liao, Y., Smyth, G.K. & Shi, W. featureCounts: an efficient general purpose program 777 for assigning sequence reads to genomic features. Bioinformatics 30, 923-930 (2014). 778 70. Robinson, M.D., McCarthy, D.J. & Smyth, G.K. edgeR: a Bioconductor package for 779 differential expression analysis of digital gene expression data. Bioinformatics 26, 139- 780 140 (2010). 781 71. Love, M.I., Huber, W. & Anders, S.J.G.B. Moderated estimation of fold change and 782 dispersion for RNA-seq data with DESeq2. Genome Biol. 15, 550 (2014). 783 72. Tarazona, S., García-Alcalde, F., Dopazo, J., Ferrer, A. & Conesa, A. Differential 784 expression in RNA-seq: A matter of depth. Genome Res. 21, 2213-2223 (2011). 785 73. Leng, N. et al. EBSeq: an empirical Bayes hierarchical model for inference in RNA-seq 786 experiments. Bioinformatics 29, 1035-1043 (2013). 787 74. Robinson, J.T. et al. Integrative genomics viewer. Nat. Biotech. 29, 24-26 (2011). 788 75. Thorvaldsdóttir, H., Robinson, J.T. & Mesirov, J.P. Integrative Genomics Viewer 789 (IGV): high-performance genomics data visualization and exploration. Brief. Bioinform. 790 14, 178-192 (2013). 791 76. Michael, T.P. et al. Network discovery pipeline elucidates conserved time-of-day- 792 specific cis-regulatory modules. PLoS Genetics 4, e14 (2008). 793 77. Mockler, T. et al. The DIURNAL project: DIURNAL and circadian expression 794 profiling, model-based pattern matching, and promoter analysis. Cold Spring Harb. 795 Symp. Quant. Biol. 72, 353-363 (2007). 796 78. Katari, M.S. et al. VirtualPlant: A software platform to support systems biology 797 research. Plant Physiol. 152, 500-515 (2010). 798 79. Takens, F. Detecting strange attractors in turbulence. Lecture Notes in Math 898, 366- 799 381 (1981). 21 800 80. Stark, J. Delay embeddings for forced systems I. Deterministic forcing. J. Nonlinear 801 Sci. 9, 255-332 (1999). 802 81. Marwan, N., Romano, C.M., Thiel, M. & Kurths, J. Recurrence plots for the analysis of 803 complex systems. Phys. Rep. 438, 237-329 (2007). 804 82. Hirata, Y., Horai, S. & Aihara, K. Reproduction of distance matrices and original time 805 series from recurrence plots and their applications. Eur. Phys. J. Spec. Top. 164, 13-22 806 (2008). 807 83. Tanio, M., Hirata, Y. & Suzuki, H. Reconstruction of driving forces through recurrence 808 plots. Phys. Lett. A 373, 2031-2040 (2009). 809 84. Hirata, Y., Komuro, M., Horai, S. & Aihara, K. Faithfulness of Recurrence Plots: A 810 Mathematical Proof. International Journal of Bifurcation and Chaos 25, 1550168 811 (2015). 812 85. Khor, A. & Small, M. Examining k-nearest neighbour networks: Superfamily 813 phenomena and inversion. Chaos (Woodbury, N.Y.) 26, 043101-043101 (2016). 814 86. Small, M. Applied Nonlinear Time Series Analysis: Applications in Physics, Physiology 815 and Finance. (World Scientific, 2005). 816 817 Acknowledgments 818 We thank members of the Mas laboratory for helpful discussion and suggestions. We also thank 819 Prof. T. Nakagawa (Shimane University) and Meiji Seika Kaisha, Ltd. for the Gateway vectors. 820 We thank J. E. Salazar-Henao for tips on the Western-blot protocol in roots and Dr. I. Rubio- 821 Somoza for sharing the GFP antibody. Research in Y.H. laboratory is supported by JSPS 822 KAKENHI (Grant Number JP18K11461). S.J.D laboratory is funded by the Biotechnology and 823 Biological Sciences Research Council (BB/N018540/1). S.A.K. acknowledges support from the 824 National Institute of Health (GM067837). The Mas laboratory is funded from the 825 FEDER/Spanish Ministry of Economy and Competitiveness, from the Ramon Areces 826 Foundation and from the Generalitat de Catalunya (AGAUR). P.M. laboratory also 827 acknowledges financial support from the CERCA Program/Generalitat de Catalunya and by the 828 Spanish Ministry of Economy and Competitiveness through the “Severo Ochoa Program for 829 Centers of Excellence in R&D” 2016–2019 (SEV-2015-0533). W.W.C. is a recipient of a CSC 830 (Chinese Scholarship Council) fellowship. 831 Author Contributions 832 W.W.C, N.T. and J.R. performed the biological experiments. Y.H. performed the mathematical 833 analysis. S.P., S.J.D., D.A.N. and S.A.K. contributed with reagents and comments. P.M. 834 designed the experiments and wrote the manuscript. All authors read, revised, and approved the 835 manuscript. 836 Competing interests 837 The authors declare no competing interests. 838 Additional information 839 Extended data is available for this paper at XXX. 840 Supplementary information is available for this paper at XXX. 22 841 Figure Legends 842 843 Fig. 1. Prevalent function of ELF4 sustaining circadian rhythms in roots. a, Luminescence 844 of CCA1::LUC (LUCIFERASE) oscillation simultaneously measured in shoots (Sh) 845 (n=9) and roots (Rt) (n=9). Root luminescence signals are represented in the right Y-axis. b, 846 Period (left Y-axis) estimates of CCA1::LUC rhythms in shoots and roots (n=8 for each) 847 and amplitude (right Y-axis) estimates of CCA1::LUC rhythms in shoots (n=7) and 848 roots (n=8); data are represented as the median ± max and min; 25-75 percentile). *** p- 849 value<0.0001; two-tailed t-tests with 95% of confidence. c, Circadian time course 850 analyses of CCA1 mRNA expression in WT Sh and Rt. d, Luminescence of 851 CCA1::LUC rhythms in WT (n=9) and elf4-1 Rt (n=8). e, Luminescence of LHY::LUC 852 rhythms in WT (n=8) and ELF4-ox Rt (n=9). f, Circadian time course analyses of PRR9 853 mRNA expression in roots of WT and elf4-1. Sampling was performed under constant 854 light conditions (LL) following synchronization under light:dark cycles (LD). a, c-f, 855 Data are represented as the means + SEM. g, Heatmap of the median-normalized expression (Z- 856 scaled FPKM values) of DEGs following a hierarchical clustering using the Euclidean 857 distance. h, Relationship between average expression and fold change for each gene. i, 858 Volcano plot showing fold-change versus significance of the differential expression test. 859 Black dots represent genes that are not differentially expressed, while red and green dots 860 are the genes that are significantly up- and down-regulated, respectively. Circadian 861 phases of j, up- and k, down-regulated DEG in elf4-1 roots. Radial axis represents the 862 subjective time (hours). White and gray areas represent subjective day and night, 863 respectively. The “n” values refer to independent samples. a-k, Data for all experiments 864 are representative of two biological replicates, with measurements taken from distinct 865 samples grown and processed at different times. 866 867 Fig. 2. ELF4 moves from shoots to regulate rhythms in roots. CCA1::LUC luminescence in 868 roots of ELF4-ox scion into a, elf4-1 (n=4) and b, elf4-2 (n=3) rootstocks. Water instead of 869 luciferin was added to the wells containing ELF4-ox shoots. CCA1::LUC luminescence in elf4- 870 1 rootstocks with c, WT (n=8) and d, ELF4 Minigene (ELF4MG) (n=10) scions. WT scions do 871 not express reporters and water instead of luciferin was added to the wells containing ELF4MG 872 shoots. a-d, Schematic drawings depicting the different scion/rootstock combinations are shown 873 above each graph. e, Circadian time course analyses of ELF4 mRNA expression in roots of WT, 874 elf4-1 and ELF4-ox scion and elf4-1 rootstocks. f, Luminescence of LHY::LUC rhythms in elf4- 23 875 1 roots after injection in shoots of purified ELF4 (n=4) or GFP proteins (n=8) and elf4-1 roots 876 as a control (n=6). g, Representative image showing the lack of fluorescence signals in roots of 877 WT scion and WT rootstock. h, Representative image showing fluorescence signals in roots of 878 ELF4-ox scion into elf4-1 rootstock. Scale bar: 100 µm. i, Western-blot analysis of ELF4-GFP 879 protein accumulation (arrows) in roots of ELF4-ox-GFP scion (E4ox) grafted into elf4-1 880 rootstock (e4-1) (two pools of independent grafting assays, #1 and #2, are shown). Asterisks 881 denote non-specific bands. j, CCA1::LUC luminescence in elf4-2 rootstocks grafted with 882 ELF4-x3GFP scions (n=5). Water instead of luciferin was added to the wells containing ELF4- 883 x3GFP shoots. a-f, j, Data are represented as the means + SEM. k, Protein features of various 884 plant mobile proteins. The “n” values refer to independent samples. a-j, Two biological 885 replicates were performed for all experiments, with measurements taken from distinct samples 886 grown and processed at different times. 887 888 Fig. 3. Mobile ELF4 does not regulate the photoperiodic-dependent phase in roots. 889 Luminescence analyses of PRR9::LUC rhythms in a, roots (n=5 for ShD, n=6 for LgD) and b, 890 shoots (n=6 for ShD, n=4 for LgD) of plants grown under short day (ShD) or long day (LgD) 891 conditions. c, Western-blot analyses and d, quantification of ELF4 protein accumulation in 892 ELF4 Minigene roots (E4MG Rt) of plants grown under ShD and LgD (also in Extended Data 893 Fig. 8a-d). e, Western-blot analyses and f, quantification of ELF4 protein accumulation in 894 E4MG roots of plants grown under ShD and excised roots under LgD (also in Extended Data 895 Fig. 8a-f). Arrows indicate the ELF4 protein. Luminescence of LHY::LUC oscillation in WT, 896 ELF4-ox and elf4-1 plants measured in g, shoots (Sh) (n=12) and h, roots (Rt) (n=12) under 897 LgD conditions. a-b, d, f, g-h, Data are represented as the means + SEM. Dashed lines indicate 898 dusk under LgD. The “n” values refer to independent samples. a-h, Two biological replicates 899 were performed for all experiments, with measurements taken from distinct samples grown and 900 processed at different times. 901 902 Fig. 4. Mobile ELF4 sets the temperature-dependent pace of the root clock. 903 Individual luminescence waveforms of CCA1::LUC rhythmic oscillation in ELF4-ox scion into 904 elf4-1 rootstocks at a, 12ºC (n=10) and b, 28ºC (n=8). Individual luminescence waveforms of 905 CCA1::LUC rhythmic oscillation in E4MG scion into elf4-1 rootstocks at c, 12ºC (n=7) and d, 906 28ºC (n=8).Water instead of luciferin was added to the wells containing ELF4-ox and E4MG 907 scions. e, Luminescence of LHY::LUC rhythmic oscillation in WT and ELF4-ox roots at 28ºC 908 (n=8 for WT, n=5 for ELF4-ox). Data are represented as the means + SEM. f, Western-blot 909 analysis of ELF4-GFP protein accumulation (arrow) in roots of ELF4-ox-GFP scion (E4ox) 910 grafted into elf4-1 rootstock (e4-1) at 12ºC and 28ºC. elf4-1 mutant protein extracts were used 24 911 as a control. Asterisks denote non-specific bands. Ponceau S staining of the membrane is shown 912 in the right panel. Schematic drawing depicting g, the increased shoot-to-root movement of 913 ELF4 (Sh-to-Rt mov, thick blue vertical arrows), increased PRR9 repression and the slow pace 914 of the root clock at low temperatures, and h, the decreased shoot-to-root movement (Sh-to-Rt 915 mov, thin red vertical arrows), decreased PRR9 repression and fast-paced root clock at high 916 temperature. The “n” values refer to independent samples. a-f, Two biological replicates were 917 performed for all experiments, with measurements taken from distinct samples grown and 918 processed at different times. 25 Figure 1 a b c Relative CCA1 expression Counts / seedling / 5 sec Period estimate (hours) 40000 5 2.5 125000 WT Sh CCA1::LUC 60000 WT Sh Amplitude estimate CCA1::LUC WT Rt 28 *** 4 WT Rt 2.0 100000 30000 40000 3 1.5 75000 20000 26 50000 2 1.0 *** 20000 10000 25000 24 1 0.5 0 0 0 0 0.0 24 48 72 96 120 Sh Rt Sh Rt 48 52 56 60 64 68 72 Time (h) Time (h) d e f Relative PRR9 expression Counts / seedling / 5 sec Counts / seedling / 5 sec 20000 40000 0.10 WT Rt CCA1::LUC WT Rt LHY::LUC WT Rt elf4-1 Rt ELF4-ox Rt 0.08 elf4-1 Rt 15000 30000 0.06 10000 20000 0.04 5000 10000 0.02 0 0 0.00 24 48 72 96 120 24 48 72 96 120 24 28 32 36 40 44 48 Time (h) Time (h) Time (h) g -1.0 0.0 1.0 WT elf4-1 h i j k 15 ns 1 Counts 1 200 - ELF4 up dow n 23 24 40 35 2 3 Expected 23 24 70 2 3 10 60 22 30 4 22 4 L o g 2 ( f o ld c h a n g e ) - LHY 50 150 25 40 -L o g 1 0 (F D R ) 5 21 20 5 21 5 30 15 20 10 6 20 20 6 0 100 5 10 GI 19 0 7 19 0 7 CCA1 - PRR7 -5 18 8 18 8 50 -1 0 17 9 17 9 16 10 16 10 0 -1 5 15 11 15 11 0 5 10 15 20 -1 0 -5 0 5 14 12 14 12 13 13 L o g 2 ( c o u n t s 1 * c o u n t s 2 ) /2 L o g 2 ( f o ld c h a n g e ) Figure 2 ELF4-ox ELF4-ox WT ELF4MG elf4-1 elf4-2 elf4-1 elf4-1 a b c d Counts / seedling / 5 sec 30000 300000 1200 6000 ELF4-ox (Sh, H2O) / elf4-1 (Rt) ELF4-ox (Sh, H20) /elf4-2 (Rt) WT (no reporter Sh) / elf4-1 (Rt) ELF4MG (Sh, H2O)/elf4-1 (Rt) 5000 20000 800 4000 200000 3000 10000 400 2000 100000 CCA1::LUC CCA1::LUC CCA1::LUC CCA1::LUC 0 1000 24 48 72 96 120 24 48 72 96 120 24 48 72 96 24 48 72 96 120 Time (h) Time (h) Time (h) Time (h) e f g h Injected protein in elf4-1 shoots WT(Sh)/WT(Rt) ELF4-ox-GFP(Sh)/elf4-1(Rt) Relative ELF4 expression Counts / seedling / 5 sec 4 WT Rt ELF4 LHY::LUC in roots ELF4-ox (Sh)/elf4-1 (Rt) 3000 GFP 3 elf4-1 Rt Empty vector 2000 2 1 1000 0 0 24 28 32 36 40 44 48 24 48 72 96 120 Time (h) Time (h) i grafts grafts j k E4ox/e4-1 e4-1 E4ox/e4-1 e4-1 E4ox e4-1 Counts / seedling / 5 sec 150000 #1 #2 E4-x3GFP (Sh, H2O)/elf4-2 (Rt) Length Mol. Weigth Isoelectric 75 Name (aa) (Da) point 100000 FT 175 19808.4 8.05 50* 50000 ELF4 111 12375.5 9.16 * 37 0 HY5 168 18463.1 10.19 24 48 72 96 120 Time (h) Figure 3 a b Counts / seedling / 5 sec Counts / seedling / 5 sec 300000 150000 ShD (Rt) PRR9::LUC ShD (Sh) PRR9::LUC LgD (Rt) 300000 LgD (Sh) 200000 100000 200000 100000 50000 100000 0 0 24 48 72 24 48 72 Time (h) Time (h) c E4MG Rt d Relative protein abundance 3 7 11 15 19 23 100 ShD E4MG Rt LgD ShD 75 50 LgD 25 0 0 4 8 12 16 20 24 Time (h) e E4MG Rt f Relative protein abundance 3 7 11 15 19 23 LgD excised E4MG Rt ShD ShD 100 50 LgD excised 0 0 4 8 12 16 20 24 g h Time (h) Counts / seedling / 5 sec WT (Sh) Counts / seedling / 5 sec 50000 WT (Rt) 25000 600000 ELF4-ox (Sh) 200000 ELF4-ox (Rt) 40000 20000 elf4-1 (Sh) elf4-1 (Rt) 400000 150000 30000 15000 100000 20000 10000 200000 50000 10000 5000 0 0 0 0 24 48 72 96 120 24 48 72 96 120 Time (h) Time (h) 4 a b Counts / seedling / 5 sec 6000 ELF4-ox (Sh, H2 O) / elf4-1 (Rt) 12ºC ELF4-ox (Sh, H2 O) / elf4-1 (Rt) 28ºC 50000 CCA1::LUC CCA1::LUC 40000 4000 30000 20000 2000 10000 0 0 24 48 72 96 120 24 48 72 96 120 Time (h) Time (h) c d Counts / seedling / 5 sec 10000 E4M G (Sh, H2 O) / elf4-1 (Rt) 12ºC E4M G (Sh, H2 O)/elf4-1 (Rt) 28ºC 8000 CCA1::LUC 8000 CCA1::LUC 6000 4000 4000 2000 0 0 24 48 72 96 120 24 48 72 96 120 Time (h) Time (h) e f Counts / seedling / 5 sec 20000 WT Rt 28ºC LHY::LUC 30000 12 12 28 28 12 12 28 28 ELF4-ox Rt 28ºC 15000 20000 75 10000 * 50 10000 5000 * 37 0 0 24 48 72 96 120 Time (h) g h 12°C 28°C Sh-to-Rt Sh-to-Rt mov mov ShE4 ShE4 MbE4 PRR9 MbE4 PRR9 slow-paced root clock fast-paced root clock