This is the submitted version of the article: Portela A., Calvo-Lozano O., Estevez M., Medina Escuela A., Lechuga L.M.. Optical nanogap antennas as plasmonic biosensors for the detection of miRNA biomarkers. Journal of Materials Chemistry B, (2020). 8. : 4310 - . 10.1039/d0tb00307g. Available at: https://dx.doi.org/10.1039/d0tb00307g Please do not adjust margins ARTICLE Optical nanogap antennas as plasmonic biosensors for the detection of miRNA biomarkers Received 00th January 20xx, Accepted 00th January 20xx Alejandro Portela, Olalla Calvo-Lozano, M.-Carmen Estevez*, Laura M. Lechuga DOI: 10.1039/x0xx00000x Nanoplasmonic biosensors based on nanogap antennas structures usually demand complex and expensive fabrication processes in order to achieve a good performance and sensitve detection. We here report the fabrication of large-area nanoplasmonic sensor chips based on nanogap antennas by employing a customized, simple and low-cost colloidal lithography process. By precisely controlling the angle for tilted e-beam metal evaporation, an elliptical mask is produced, which defines the total length of the dipole antenna nanostructures while assuring that the plasmonic response is oriented in the same direction along the sensor chip. Large-area sensor chips of nanogap antennas formed by pairs of gold nanodisks separated by gaps with an average size of 11.6 ± 4.7 nm are obtained. The optical characterization of the nanogap antenna structures in an attenuated total reflection (ATR) configuration shows a bulk refractive index sensitivity of 422 nm/RIU, which is in agreement with FDTD numerical simulations. The biosensing potential of the cm2-sized nanostructured plasmonic sensor chips has been evaluated for the detection of miRNA-210, a relevant biomarker for lung cancer diagnosis, through a DNA/miRNA hybridization assay. A limit of detection (LOD) of 0.78 nM (5.1 ng mL-1) was achieved with no need of further amplification steps, demonstrating the high sensitivity of these plasmonic nanogap antennas for the direct and label-free detection of low molecular weight biomolecules as miRNAs. of noble metals have been widely studied.3,4 Plasmonic Introduction biosensors have demonstrated their full potential for Several disciplines related to biology, pharmaceutics and monitoring molecular recognition events by detecting the medicine require powerful biosensing tools for the study of refractive index (RI) variations occurring in the close vicinity of biomolecular interactions or for the detection and validation the plasmonic metal surface. Particularly, sensors based on of new biomarkers. To fulfil these demands, biosensor devices localized surface plasmon resonance (LSPR), excited on sub- with high sensitivity, competitive limit of detections (LOD) and wavelength nanostructures are powerful configurations with high robustness and reproducibility are needed. Furthermore, demonstrated excellent performance and great potential for ideally the sensing method should require a minimum sample integration and multiplexed analysis. Besides conventional pre-treatment, should be easy-to-use, and highly reliable. For designs (i.e nanoparticles, nanorods, nanopillars, etc), there all the above, optical biosensors are highly ranked among the are plenty of examples of LSPR sensor elements obtained after best choice for advanced biosensor platforms. Thanks to the precisely engineering nanostructures using different materials, progress on the last decade in the field of biophotonics, label- geometry, and arrangements (i.e. single, ordered, non- free biosensors have received tremendous momentum ordered).5-8 This is done usually aiming for enhanced achieving competitive results for the ultrasensitive detection sensitivity, by mainly addressing the generation of areas with of very small analytes at extremely low concentrations with no local field enhancement. LSPR sensing has led to the detection need of labelling.1,2 This introduces several advantages since a of small analytes such as short peptides chains, DNA label-free configuration leads to simplified sample fragments, small biomolecules, etc., deposited in a very low manipulation (skipping laborious steps required for adding concentration (even a single molecule level) on the interface of label tags), and it avoids possible interferences from the the plasmonics features.9-12 biomolecule tagging. Plasmonic gold nanogap antennas (i.e two nanostructures Plasmonic sensing exploiting the intrinsic sensitivity of separated by a nanogap of few nanometers) are resonant coupling of optical waves with the free electron cloud nanostructures supporting the confinement of a high local electromagnetic field within the nanoscale gap formed by the arms of a dipole antenna.13 The close proximity of the metallic a. Nanobiosensors nanoparticles (NPs) induces the plasmon coupling between and Bioanalytical Applications Group (NanoB2A), Catalan Institute of Nanoscience and Nanotechnology (ICN2), CSIC, CIBER-BBN and BIST, them, leading to the formation of new hybrid plasmon modes Campus UAB Bellaterra, 08193 Barcelona, Spain. that shown a strong field enhancement.14 Some applications of Please do not adjust margins Please do not adjust margins ARTICLE Journal Name these structures have already demonstrated their capabilities coating onto the PMMA layer of a cationic solution (PDDA, for plasmonic trapping15,16 and in surface enhancement of (poly (diallyldimethylammonium) chloride, 0.2 wt%, in H 2O) fluorescence and Raman spectroscopy.17,18 These effects are during 1 min, then rinsing with Milli-Q water and dried under remarkably observed on the visible light frequencies for gap N2 flow. A solution of nanoparticles (NPs) (sulfate latex beads, sizes below 20 nm, which represents a fabrication challenge 80 nm diameter; FisherScientific, Spain) is diluted in water when a large-area sensing surface is required.19,20 Most (0.01 wt%) and sonicated for 5 min prior to drop-coating (1 nanogap antennas structures explored for biosensing min) on the glass chip. The chip was then immersed in water applications have been fabricated through expensive and time- (95°C, 3 min) to fix the NPs on the PMMA layer prior to rinse consuming fabrication methods such as e-beam lithography19 again with Milli-Q water and dry under N2 flow. or focus ion beam (FIB),21 which hinders their further transfer The evaporation of a Titanium (Ti) sacrificial layer of 20 nm into more feasible and commercial-oriented products. thickness using an e-gun evaporator (EB273, Telemark, In this work we demonstrate the performance of a plasmonic Germany) allowed producing a round (i.e. normal 90° biosensor based on optical nanogap antennas with average evaporation) or an elliptical shape mask (i.e. by tilting the gap size of ≈ 12 nm that are fabricated using a low cost and sample stage respect to the normal 90° evaporation). A tape- high throughput nanofabrication process. Through numerical stripping was conducted to remove the NPs, leaving the Ti- EM field simulations, we confirm the improvement on hole mask with ellipsoidal shape features that exposes the sensitivity for gap sizes below 15 nm, which is attributed to the PMMA. Selective etching of the thin PMMA layer was achieved condition of the EM field generated. The fabrication protocol using a reactive ion etcher (RIE) (Oxford PlasmaPro®100 Cobra for obtaining large surface chips with these nanostructures Oxford Instruments, UK) using O2 plasma under the following and its flexibility for the modification of geometries (gap sizes conditions: 5 min RIE= 400 W, Pressure= 75 mTorr, O2-flux= 50 and length) has been also evaluated. This is supported by the sccm). The PMMA etched on the surrounding volume under experimental characterization of the fabricated nanogap the ellipsoidal-shaped holes leaves a small cavity underneath antennas, including the assessment of their bulk sensitivity. A the Ti layer where the glass substrate is exposed and complementary hybridization DNA/RNA assay for a relevant accessible for the Au evaporation. lung cancer biomarker (miRNA-210) is selected as an Tilted metal e-beam evaporation of Au 19 nm is conducted experimental demonstration of the capabilities of the optical two times, using equal values of opposite angles respect to the nanogap antenna biosensor for direct and label-free normal evaporation. In order to improve the Au adhesion to biodetection of low molecular weight analytes. the glass surface, the evaporation of each Au nanodisk forming the dimer is preceded by a deposition of a thin Ti layer (1 nm) using the same angles. In this way, the Ti/Au layers are Experimental deposited at each side of the nanoholes. A lift-off process is Nanolithography process and SEM characterization conducted by first rinsing in acetone followed by three short Nanoplasmonic chips of randomly distributed arrays of gold cycles (< 5 s) of sonication in acetone in order to detach any nanogap antennas (two nanodisks of variable shape and remaining Au and Ti coated on top of the PMMA layer. The diameter, height = 20 nm, separated by a nanogap of 12 nm) sensor chips were rinsed using isopropanol and dried under N2 were fabricated on glass substrates following a modified flow. protocol of the colloidal hole-mask lithography (HCL) process Numerical Simulations as described before.22 Thorough cleaning process of glass Near field analysis and far field spectra of single nanodisks (80 slides was performed using SDS (sodium dodecyl sulfate), HCl, nm diameter) and nanogap antennas (80 nm diameter each and Milli-Q water and drying under N2 flow. Then, the sensor arm separated by a 15 nm gap) were obtained using a 3D chips were sonicated for 5 min at 50 °C, first in acetone and finite-difference time-domain method (FDTD), (FDTD then in isopropanol, and finally dried under N2 flow. Surface Solutions, Lumerical Inc., Canada). The plasmonic features are silanization of the glass substrate was performed by immersing placed on top of a SiO2 surface and excited using a broadband the chip overnight in a solution of isobutyl (trimethoxy)silane light (550–900 nm), choosing a plane wave illumination source (10 μL of in 5 mL toluene) to improve the coating of a PMMA incident from the substrate. The light is linearly polarized (polymethyl methacrylate 950 K) layer. The glass substrate was parallel (in-plane) to the Au features. For the case of nanogap then rinsed with toluene and isopropanol and dried under N2 antennas, the electric field vector is set parallel (longitudinal) flow. A thin layer of PMMA diluted at 4% in anisole (thickness to the axis of the nanogap. In all cases a variable size about 210 nm), was spin-coated (4000 rpm, 1500 r s-2), onto rectangular mesh, with an initial 2 nm mesh, was defined on the glass-treated substrate, and immediately baked at 165°C the vicinity of the Au features (40 nm, where near-field during 3 min. A short O2 plasma treatment (10 s, Power = 75 produced by the localized plasmon resonance is certainly W, Pressure = 75 mTorr) was applied to increase the confined). Boundary conditions are set as perfectly matched hydrophilicity of the PMMA layer. This was followed by a drop- 2 | J. Name., 2012, 00, 1-3 This journal is © The Royal Society of Chemistry 20xx Please do not adjust margins Please do not adjust margins Journal Name ARTICLE layer (PML). Dielectric permittivity of Au is selected using min-1,) to disrupt the DNA-RNA interactions, remove the RNA standard values from Johnson & Christy.23 sequence and release the DNA capture probe for subsequent hybridization experiments. A reference non-complementary Optical setup and bulk sensitivity characterization sequence, (miRNA-205 5’UCCUUCAUUCCACCGGAGUCUG3’, An optical setup has been configured using a fibered broadband 100nM, IBIAN Technologies, Spain) was additionally injected to light source (Thorlabs, SLS201L). The fiber´s end is set into an evaluate the specificity of the sensor response to the target angle adjustable optomechanical support, together with a miRNA sequence. collimator lens and a linear polarizer. The beam is normally incident on the facet of a BK-7 trapezoidal prism with an 80° base angle. The sensor chip is placed onto the prism using Results and Discussion matching oil, and both are further clamped to a microfluidic Based on the colloidal hole-mask lithography process, we have cell where the plasmonic nanostructures are exposed to the produced large areas (≈4.8 cm2) of pseudo-ordered arrays of liquid sample solutions. The light reflected from the sensor NPs on glass substrate chips. By tilting evaporation of the Ti chip is then focused into an optical fiber connected to a USB sacrificial layer and relying on the remarkable anisotropy of spectrophotometer (FLAME-S-VIS-NIR-ES, Ocean Optics) the e-beam evaporation, we can precisely control the controlled by an in-house software program, which tracks and dimensions of the hole-mask. The tilted evaporation onto the plots the LSPR peak location in real-time. NPs produce a “shadow” of the NPs, resulting in an ellipsoidal A syringe pump is employed for the flow delivery of the shaped hole-mask as observed in the SEM image in Figure 1a. samples. An injection valve incorporating a loop (200 μL The SEM image was obtained prior to the removal of the NPs, volume) connected to both the pump and the inlet of the which are adhered onto the PMMA layer, and partially (top microfluidic cell was employed to deliver the samples to the and left side) covered by the Ti deposition. A schematic that microfluidic cell. The evaluation of the bulk sensitivity of the shows the possibility of tuning the long axis length of the sensor chips was performed as follows: Milli-Q water was set under continuous flow (35 µL·min-1) and solutions with known ellipsoid mask (Lmask) at the nanoscale level is depicted in values of RI (glycerol solutions at different concentrations) Figure 1b. Considering the anisotropic evaporation angle (ɸ) of were sequentially injected into the sensor surface, registering the Ti, a complementary angle (Ө) is formed between the the changes of the plasmonic spectra over time and tracking surface of the PMMA layer and the tangent plane defined by the shift of the LSPR extinction peak (Δλ). the evaporated Ti (with a point of tangency at T formed by the radius of the sphere). Hence, it is possible to express Lmask as a Surface biofunctionalization and DNA/RNA hybridization assay function of the angle (Ө) and the NP radius (r) as For the detection of the miRNA-210 (sequence: Lmask=2r/sin(Ө, which will ultimately define the length of the 5’CUGUGCGUGUGACAGCGGCUGA3’, produced by IBIAN nanogap antennas. Technologies, Spain) a complementary DNA/RNA hybridization assay was employed. A complementary DNA capture probe Several combinations of tilted hole-mask angle and Au containing a reactive thiol group which interacts with the gold evaporation angle (Figure 1c) were evaluated. For an 80 nm surface (5’SH-T15-AGCCGCTGTCACACGCACA3’, IBIAN diameter NPs, a 45° Ti evaporation produced a mask with an Technologies, Spain) was designed. The probe also average length of Lmask ≈ 115 nm. By using this mask, it is incorporated a spacer (sequence of 15 thymines) which keeps possible to produce nanogap antennas with arms ranging size away the DNA strand from the sensor surface in order to between 50 to 60 nm, which leads to a resonance spectrum in facilitate the accessibility of the target miRNA. After thorough the optimum range for LSPR sensing.24 On the other hand, the cleaning of the sensor chips with organic solvents (acetone and size of the latex NPs determines and keeps constant the ethanol) and O2 plasma cleaning (100W, 45sccm, 2 min), the transversal axis of the arms forming the dimers. As can be sensor chips were placed in the experimental setup and a observed in the SEM image in the Figure 1a, this method constant flow (18 µL min-1) of DEPC-H2O (Milli-Q water with enables all nanogap antennas to be oriented in the same 0.1 % DEPC (diethyl pyrocarbonate)) was fixed. A solution of direction, which makes optimum the polarization of all the the DNA probe (1 µM) prepared in PBS 50 mM (containing 100 nanogap antennas using linearly polarized light. Once the mask nM TCEP (tris(2-carboxyethyl) phosphine hydrochloride) to is produced, the O2 plasma etches the PMMA layer reduce eventual disulfide bonds formed between the thiol underneath the Ti, leaving the SiO2 surface accessible for groups) was injected to achieve its direct immobilization on deposition of the Au layer forming the dimers. the surface of the nanogap antennas. Several solutions of miRNA-210 at different concentrations were prepared in SSC- The optimal angle for the Au evaporation (+/- 10°) was defined 5X (sodium citrate buffer saline 75 mM) and sequentially after observing the minimum tilting angle from which, injected into the sensor chip. A calibration curve was obtained approximately 90% of nanogaps were defined (gap size > 0 and the LOD was determined by evaluating three times the nm). Moreover, it is crucial for this fabrication method to have value of the standard deviation of the Δλ signal of a blank a precise control on the orientation of the long axis of the sample. After the injection of each of these samples, the ellipsoidal mask respect to the edges of the glass chip. This fact surface was treated with a 5 mM NaOH solution (60 s , 18 µL is relevant for the geometrical conformation of the nanogap This journal is © The Royal Society of Chemistry 20xx J. Name., 2013, 00, 1-3 | 3 Please do not adjust margins Please do not adjust margins ARTICLE Journal Name antennas and also determines the resonance spectrum for the nanogap antennas with a gap size equal to 15 nm onto a glass polarization employed, as discussed in detail below. Figure 1d substrate shows a large confinement of a higher intensity EM shows a SEM image of a sensor chip containing nanogap field within the nanogap separating the two nanodisks (see antennas fabricated on glass substrate using the conditions Figure 2a), resulting on a higher sensitivity to changes of the RI described above. as illustrated in Figure 2b-d. Fig. 1. Fabrication of nanogap antennas. a) SEM image of the elliptical Fig. 2 a) Electric field profile of nanodisks (top) and nanogap antennas with a mask obtained after tilted evaporation of 20 nm of Ti; b) Sketch of the 15 nm gap (bottom) at their corresponding resonance wavelength. (b) FDTD flexibility for tuning the length of the long axis of the ellipsoid mask numerical simulations for single nanodisks and (c) for nanogap antenna, shape; c) Evaporation of gold using two opposite angles respect to the showing the spectral response to RI changes from 1.33 to 1.37; d) Sensitivity normal evaporation; d) SEM image of Au nanogap antennas over a to bulk RI changes for nanogap antennas and nanodisks. glass substrate; e) Photograph of a fabricated sensor chip. A ruler (mm) is shown as a reference scale. Typically, optical characterization of LSPR nanostructures are performed by means of a dark field scattering spectroscopy The deposition of 19 nm Au (each side) is performed as setup where the extinction spectrum of nanostructures results illustrated in Figure 1c at a rate of 0.05 nm/s. Prior to in a peak-shaped spectral response.25 Our experimental deposition of the Au forming the two arms of the nanogap characterization for bulk sensitivity and biosensing were antenna, a thin (1 nm) Ti adhesion layer is added keeping conducted using an attenuated total internal reflection (ATR) constant the evaporation angles. Finally, a lift-off process configuration, which allows probing the sample with the exposes the Au nanogap antennas, a fact that can be visually evanescent plasmonic field. In this case the evanescent field observed for the bluish tone of the sensor chip. Figure 1e strongly interacts with subwavelength features (i.e. the shows a photograph of a large nano-patterned substrate (2.2 x nanostructures) showing excited plasmonic resonance in the 2.2 cm2) sensor chip produced using the parameters detailed visible frequencies.18 Similarly to Kretschmann configuration, above. where signature from propagating plasmon resonance (SPP) can be observed on the reflected spectrum, we exploit this SEM images were used to measure the gap size, the total optical configuration to detect plasmonic internal reflection length and the diameters of each arm of the antenna. changes as sensed by the LSPR excited on the nanogap Variations in the dimensions of the antennas arms and the gap antennas. This optical configuration eliminates the constraints size are observed, which are mainly attributed to the size of transmission evaluation where the incident light has to go dispersion of the latex NPs employed in the fabrication. through the sample solution, where the microfluidic cell and Despite the differences observed in the dimensions and shape the analyte sample can affect the measurements, and between nanogap antennas, the samples evaluated showed circumvents the complexity and the precision alignment that nanogaps with average size of 11.6 ± 4.7 nm were defined required for dark field setups. with a yield above 87%. This fabrication strategy exhibits Figure 3a shows the schematic for the experimental setup. A slightly lower resolution than other expensive and time- collimated and TE polarized light is incident with a fixed angle consuming fabrication methods, such as e-beam lithography of 80° on the sensor chip using a trapezoidal prism. This for gap sizes of the same range.19 particular incident angle has been previously reported to FDTD simulations performed for these nanostructures were increase the sensitivity for a 6-7% surface nanodisks density.26 compared with discrete nanodisks (see Figure 2). Ideal The reflected light is collected by a lens, coupling the light into 4 | J. Name., 2012, 00, 1-3 This journal is © The Royal Society of Chemistry 20xx Please do not adjust margins Please do not adjust margins Journal Name ARTICLE an optical fiber, which is connected to the spectrophotometer. of these sensor chips. This tunability property of nanogap An ellipsoidal incident light spot of approximately 1.5 mm x 8.5 antennas excited under ATR configuration suggests the mm (short and long radius, respectively) results in the possibility of a “post-fabricated” fine-tuning, by rotating the excitation of a large number of nanogap antennas, which sensor chip placed on the prism until the resonance peak is contribute to the overall signal. Due to the relative low-density located on the intended position of the spectrum. This could (≈7%) of the nanogap antennas on the glass substrate, near- be a desirable condition for surface enhanced spectroscopies, field interaction between them can be neglected. where intensity enhancement of the system can be drastically changed if the resonance peak matches the excitation or emission wavelengths to be amplified. However, it can be noticed an undesirable broadening of the resonance peak for the parallel orientation exciting the gap mode. We attribute this effect on the figure of merit to the large influence of gap size variations on the spectral peak position, which, in turn, is caused by the deviation of the nanofabrication process. This fabrication effect has a larger influence on the spectral response in the gap mode than the one observed for perpendicular orientation where the spectrum is dominated by the dimensions of single nanodisks.20 It has been reported that deviation on the nanofabrication process can hamper the figure of merit of LSPR sensing.19 As expected, the evaluation of the sensitivity for parallel and perpendicular configurations shows a different sensitivity to RI bulk changes (ȠB). As can be noticed in Figure 4, there is a higher sensitivity for the TE polarized, parallel (422 nm/RIU) vs perpendicular (270 nm/RIU)) orientation respect to the axis of the nanogap antennas. Interestingly, the sensitivity for the perpendicular nanogap orientation is very close to the Ƞ B obtained for single nanodisks (291 nm/RIU) of similar sizes to those forming the dimers, using identical experimental conditions. This result suggests that if the gap mode is not excited, the system with Fig. 3. Optical setup and optical characterization of the nanogap nanogap antennas behaves similarly to a sensor with individual antennas. a) Schematic of the experimental setup. A fibered Au nanodisks. broadband light is collimated, linearly polarized (TE) and coupled with an 80° trapezoidal prism. Reflectivity spectrum is measured through a fiber-coupled spectrophotometer. b) Spectral characterization of the nanogap antennas in a water environment for different orientations of incident TE polarized light with respect to the nanogap axis. Experimental characterization of the produced nanogap antennas sensor chips was performed using the described optical setup using an in-plane (TE) linearly polarized light. A set of spectra for different angles of orientations of the nanogap respect to the electric field vector is presented in Figure 3b. Interestingly, the spectra showed a clear dependence of the orientation of the electric field respect to the axis of the nanogap. Presumably, the peak for the perpendicular (90°) nanogap orientation at 641 nm corresponds to the plasmon resonance excited in contiguous nanodisks with modes that weakly interact with each other, Fig. 4. Sensitivity to bulk RI changes using a set of glycerol solutions for perpendicular and parallel orientation of the nanogap respect to the while for parallel nanogap orientation (0°) the peak at 685 nm TE polarized light. The bulk sensitivity of single nanodisks obtained corresponds to the excitation of the gap mode in pairs of under the same experimental conditions is also shown for comparison. nanodisks. The change of the resonance peak location with the orientation can be exploited for tailoring the spectral response This journal is © The Royal Society of Chemistry 20xx J. Name., 2013, 00, 1-3 | 5 Please do not adjust margins Please do not adjust margins ARTICLE Journal Name resonance wavelength.24,27 On the other hand, it should be noticed that there is consistency on the increasing trend of RI sensitivity between the numerical FDTD simulations and experimental results for the comparison of nanodisks and nanogap antennas (see Fig 2d and Fig. 4). Although there are significant differences between the absolute values obtained theoretically, we attribute these disagreements to the excitation conditions used (normal illumination), since the convergence of the numerical models for this FDTD is limited for TIR illumination conditions. Finally, in order to demonstrate the biosensing performance of the sensor chips, we selected the miRNA-210, a relevant biomarker for several types of cancer. Detection of miRNAs is challenging given their low expression, small size (20−24 nucleotides in length) and close similarity with other miRNAs. For the miRNA detection, the nanogap antennas are biofunctionalized with DNA capture probes that contain the complementary sequence to the target miRNA. The specific miRNA interacts with the immobilized capture probe and generates a change on the RI directly related to the miRNA concentration in the sample. Figure 5a shows the dynamic response of the LSPR peak Δλ during the injection of the DNA capture probe at a 1 μM concentration. An initial baseline is defined at 0 nm as registered for the running buffer flow. Then a large response of about 5 nm is observed starting after 250 s and lasting approximately for 700 s, corresponding to the bulk change sensed by the nanogap antennas. After about 750 s this value rapidly decreases as the microfluidic cell is filled again with the running buffer. The remaining difference of about 1.5 nm on Δλ signal respect to the baseline corresponds to the total change of the RI in the surface of the nanogap antennas, induced by the immobilization of the DNA probe. Once the immobilization of the capture probe is achieved, sequential injection of miRNA-210 at different concentrations (0.78 nM, 1.56 nM, 6.25 nM, 25 nM, 50 nM, 100 nM) is conducted. After each hybridization event and prior to injecting the following concentration, the sensor surface is regenerated with a NaOH solution (as detailed in the experimental section), which allows the total dissociation of the miRNA-210 from the capture probe. Figure 5b shows the change of the Δλ signal for each concentration of miRNA-210. No changes on the Δλ signal are observed after injection of a control sample corresponding to a non-complementary miRNA Figure 5. a) Dynamic monitoring of Δλ during the in-situ immobilization (miRNA-205) as can be also observed in this figure (black of the SH-DNA probe (1 μM) by the attachment of the thiol group to sensorgram). The calibration curve obtained from the set of Au nanogap antennas. b) Sensorgrams obtained after injection of miR- miRNA-210 concentrations is shown in Figure 5c reaching an 210 at different concentrations. A no complementary sequence estimated LOD of 0.78 nM. It should be noticed that the signals (miRNA-205) injected at 100 nM is also included (reference obtained in Figure 5b correspond to the direct detection of the sensorgram in black). c) Calibration curve for miRNA-210, each point target miRNA-210 with no need of further amplification steps. represents the mean ± SD of 3 replicates. Most of published studies targeting the detection of miRNA have used different amplification strategies12 by means of proteins28,29 or The magnitude of changes observed on the sensitivity for the enzymes.29 Our results have achieved a LOD < 1 nM without any of parallel and perpendicular orientation is much larger than the these amplification steps, which is one order better than the LOD improvement attributed to the red-shift (43 nm) on the reported previously for miRNA-21012 prior the amplification steps. 6 | J. Name., 2012, 00, 1-3 This journal is © The Royal Society of Chemistry 20xx Please do not adjust margins Please do not adjust margins Journal Name ARTICLE On the other hand, although for single nanostructure spectroscopy 4. J. Homola, S.S. Yee and G. Gauglitz, Sens. Act. B, 1999, 54, 3-15 there are recent reports of sensitive detection of miRNA using 5. K.L. Kelly, E. Coronado, L.L. Zhao, G.C. Schatz, J. Phys. Chem. B., nanospheres (3 nM)30 or Au-nanocubes (pM range),31 our biosensor 2003, 170(3), 668-677. provides an alternative simple design not comprising complex 6. H. Yockell-Lelièvre, F. Lussier, J.-F. Masson, J. Phys. Chem. C, optical read-out configurations, which make it a very suitable 2015, 119, 28577-28585. candidate for integration as a point of care testing device (POCT). 7. N. Pazos-Perez, L. Guerrini, R.A. Alvarez-Puebla, ACS Omega, 2018, 3, 17173-17179 8. W. Li, L. Zhang, J. Zhou and H. Wu, J. Mater. Chem. C, 2015, 3, Conclusions 6479-6492 We have developed a method to produce a large-area of 9. B. Sepúlveda, P.C. Angelomé, L.M. Lechuga and L.M. Liz-Marzán, plasmonic nanogap antennas with interesting features for Nano Today, 2009, 4, 244-251 direct label-free biosensing. Nanogap antennas are fabricated 10. A.B. Taylor and P. Zijlstra, ACS Sensors, 2017, 2, 1103-1122 using a hole-mask colloidal lithography process that allows 11. D. Raghu, J. A. Christodoulides, M. Christophersen, J.L. Liu, customization of the geometry of the nanodisks and the G.P. Anderson, M. Robitaille, J.M. Byers and M.P. Raphael, nanogap separating them. Nanogap antennas were optically Plos One, 2018, 13(8), e0202773 characterized using an ATR optical setup, where the plasmonic 12. E. Mauriz, P. Dey and L.M. Lechuga, Analyst, 2019, 144, resonance showed the possibility of controlling their spectrum 7105-7129 location by changing their orientation with respect to the TE 13. P. Muehlschlegel, H.-J. Eisler, O.J. Martin, B. Hecht, D. Pohl, polarized incident light. Higher bulk sensitivity was obtained Science, 2005, 308, 1607-1609. for the parallel nanogap orientation (422 nm/RIU) vs the 14. E. Prodan, C. Radloff, N.J. Halas and P. Nordlander, Science, perpendicular orientation (278 nm/RIU). This result suggests 2003, 302, 419-422. that the improvement in performance is owed to the field 15. W. Zhang, L. Huang, C. Santschi and O.J. Martin, Nano Lett., enhancement generated by the gap effect. The biosensing 2010, 10, 1006-1011. performance of these sensor chips was demonstrated by the 16. M. Righini, P. Ghenuche, S. Cherukulappurath, V. direct detection of a low molecular weight analyte, miRNA- Myroshnychenko, F.J. García de Abajo and R. Quidant, Nano 210, reaching a LOD of only 0.78 nM. Based on the advantages Lett., 2003, 9, 3387-3391. that these nanostructures can offer (low fabrication cost and 17. A. Portela, T.a. Yano, C. Santschi, O.J. Martin, H. Tabata and good performance), further development of nanogap antennas M. Hara, J. Biophoton., 2017, 10, 294-302. for the detection of multiple biomarkers has a promising 18. L. Novotny and N. van Hulst, Nat. Photon., 2010, 5, 83-90. future in the field of clinical biosensing. 19. A. Portela, T. Yano, C. Santschi, H. Matsui, T. Hayashi, M. Hara, O.J.F. Martin and H. Tabata, Appl. Phys. Lett., 2014, 105, 091105. Conflicts of interest 20. H. Fischer and O.J.F. Martin, Opt. Expr., 2008 16, 9144-9154. There are no conflicts of interest to declare. 21. L. Tang, S.E. Kocabas, S. Latif, A.K. Okyay, D.-S. Ly-Gagnon, K.C. Saraswat and D.A. Miller, Nat. Photon., 2008, 2, 226- 229. Acknowledgements 22. H. Fredriksson, Y. Alaverdyan, A. Dmitriev, C. Langhammer, We acknowledge the financial support from PreDICT project D.S. Sutherland, M. Zaech and B. Kasemo, Adv. Mater., 2007, from the Spanish Research Agency (AEI), Ministry of Science, 19, 4297-4302. Innovation and Universities (TEC2016-78515-R). The ICN2 is 23. P.B. Johnson and R.-W. Christy, Phys. Rev. B, 1972, 6, 4370. funded by the CERCA programme / Generalitat de Catalunya. 24. M.A. Otte, B. Sepúlveda, W. Ni, J.P. Juste, L.M. Liz-Marzán, The ICN2 is supported by the Severo Ochoa Centres of L.M. Lechuga, ACS Nano, 2010, 4, 349-357. Excellence programme, funded by AEI (grant no. SEV-2017- 25. D.Y. Lei, A.I. Fernández-Domínguez, Y. Sonnefraud, K. 0706). Appavoo, R.F. Haglund Jr, J.B. Pendry and S.A. Maier, ACS Nano, 2012, 6, 1380-1386. 26. M. Soler, P. Mesa-Antunez, M.-C. Estevez, A.J. Ruiz-Sanchez, Notes and references M.A. Otte, B. Sepulveda, D. Collado, C. Mayorga, M.J. Torres 1. P. Gabriel, Nanobiophotonics, New York, McGraw-Hill and E. Perez-Inestrosa, Biosens. Bioelectron., 2015, 66, 115- Education, 2010. 123. 2. Label-free biosensing: Advanced materials, devices and 27. M.M. Miller and A.A. Lazarides, J. Phys. Chem. B, 2005, 109, applications, 2018, Eds. M.J. Schöning and A. Poghossian, 21556-21565. Springer, 2018 28. X. Ding, Y. Yan, S. Li, Y. Zhang, W. Cheng, Q. Cheng and S. 3. K.A. Willets and R.P. Van Duyne, Ann. Rev. Phys. Chem., 2007, Ding, Anal. Chim. Acta, 2015, 874, 59-65. 58, 267-297. This journal is © The Royal Society of Chemistry 20xx J. Name., 2013, 00, 1-3 | 7 Please do not adjust margins Please do not adjust margins ARTICLE Journal Name 29. S. Schmieder, J. Weißpflog, N. Danz, M. Hübner, S. Kreth, U. Klotzbach and F. Sonntag, Eng. Life Sci. 2017, 17, 1264-1270. 30. Y. Hu, L. Zhang, Y. Zhang, B. Wang, Y. Wang, Q. Fan, W. Huang and L. Wang, ACS Appl. Mater. Interf., 2015, 7, 2459- 2466. 31. L. Zhang, J. Wang, J. Zhang, Y. Liu, L. Wu, J. Shen, Y. Zhang, Y. Hu, Q. Fan, W. Huang, L. Wang, ACS Sensors, 2017, 2, 1435- 1440. 8 | J. Name., 2012, 00, 1-3 This journal is © The Royal Society of Chemistry 20xx Please do not adjust margins