This is the accepted version of the article:
Thwaite, Rosemary; Berbel, Concepción; Aparicio, Manuel; [et al.]. «Nanos-
tructured recombinant protein particles raise specific antibodies against the
nodavirus NNV coat protein in sole». Fish and Shellfish Immunology, Vol. 99
(April 2020), p. 578-586. DOI 10.1016/j.fsi.2020.02.029


This version is available at https://ddd.uab.cat/record/233719

under the terms of the               license
                             Supplementary Material




Nanostructured recombinant protein particles raise specific antibodies against the
NNV coat protein in sole

Rosemary Thwaite, Concepción Berbel, Manuel Aparicio, Débora Torrealba, Mireia
Pesarrodona, Antonio Villaverde, Juan José Borrego, Manuel Manchado and Nerea Roher*

* Correspondence: Corresponding Author: nerea.roher@uab.es




Supplementary Figures and Tables



FIGURE S1: Soluble NNV coat protein production


FIGURE S2: Colour coding of sole


FIGURE S3: Efficiencies of S. senegalensis primers for qPCR.


FIGURE S4: Gene expression in spleen and headkidney post VNNV-CNP administration
             via both routes and two doses


TABLE S1: S. senegalensis primers for qPCR
FIGURE S1




FIGURE S1: Soluble NNV coat protein production. Using the VNNV-CNP clone, cultures were induced
at 37 ºC with 1 mM IPTG & then grown slowly overnight at 16 ºC.
A. Soluble (sol) & insoluble (insol) fractions of NNV coat proteinHis6 pre IPTG induction & 14 h
post IPTG at 16 ºC. Each well on western blot shows protein produced in an equivalent number of cells.
B. Chromatogram purification of NNV coat proteinHis6 by FPLC (fast protein liquid chromato-
graphy). Soluble protein purified using 0.1 M NiCl2 on 1 mL HiTrap Chelating HP affinity column, eluting
with imidazole gradient. mAU = milli-Absorbance Units. Prominent peaks: fractions 4-6, 10-15 & 18-21.
C. FPLC fractions (B) tested on western blot for presence of NNV coat proteinHis6 (~38 K Daltons),
using i) total protein detection ii) Anti-His antibody. M = stain free system total protein marker FT =
flow through, W = waste, H = protein marker for western, detecting Histag.
FIGURE S2




FIGURE S2: Colour coding of sole. A. Fish were colour tagged by injecting a thin line of dye (Visible
Implant Elastomer) under the ventral skin. B. Red at the distal end for fish destined for oral intubation. C.
Green at the proximal end for fish to be injected i.p .
FIGURE S3




FIGURE S3: Efficiencies of S. senegalensis primers for qPCR.
Primer efficiencies determined via qPCR using serial dilutions in triplicate of control cDNA. Efficiencies
(E= 10 -1/slope ) calculated via linear regression for primers:A. eef1-α B. cd8-α C. cd4 D. igm E. igt F. arg2
FIGURE S4




FIGURE S4: Gene expression post VNNV-CNP administration via both routes and two doses in A.
Spleen and B. Headkidney. Fish (~15 g) were administered 50 or 500 µg of VNNV-CNP in PBS on days
0 and 14 (booster) by i.p. injection (left) or oral intubation (right). At 3 days post booster tissues were
sampled from 4 fish/ treatment for RNA extraction. Gene expression determined by qPCR with eef1-α as
reference gene and PBS control as the calibrator group using the Livak method. Data are mean ± SD (n = 4).
Differences between each treatment mean & control were analysed by unpaired one-sided t-tests with
Welch’s correction for unequal variances. Significance levels *p < 0.05
TABLES



TABLE S1: S. senegalensis primers for qPCR

                                                            Amplicon       Reference/ Accession #/
 Gene       Sequence 5’-3’                                  Size (bp)      SoleaDB

 eef1a      F: GATTGACCGTCGTTCTGGCAAGAAGC                   142            Infante, 2008 [1]
            R: GGCAAAGCGACCAAGGGGAGCAT                                     Genebank: AB326302

 cd8a       F: GTCGCAGTTCTGCTCTCCGC                         97             solea_v4.1_unigene59609
            R: TCGGTTGCAGTAGAGGACGG

 cd4        F: AGCAGGGCAGAGAAGAAGACG                        142            solea_v4.1_unigene450963
            R: GCAGCTGGCCGGGATGTAAG

 igm        F: TGAAACATTGACACAGCCAGCC                       149            solea_v4.1_unigene691100
            R: CGTGTGAGCTTCCAATCCACTC

 igt        F: AGTGGTAAAGCGGCCTGGAG                         108            solea_v4.1_unigene625671
            R: GCCTTTCCTTCAGCTTGTCTG

 arg2       F: ACCGCGTCGTTAGCAGTTGA                         107            solea_v4.1_unigene32066
            R: TGCTCTGTGTCGTCCTTCGCC




[1] C. Infante, M.P. Matsuoka, E. Asensio, J.P. Canavate, M. Reith, M. Manchado, Selection of housekeeping genes
for gene expression studies in larvae from flatfish using real-time PCR, BMC Mol Biol 9 (2008) 28.