This is an open access article published under a Creative Commons Attribution (CC-BY) License, which permits unrestricted use, distribution and reproduction in any medium, provided the author and source are cited. Article www.acsnano.org Splenic Capture and In Vivo Intracellular Biodegradation of Biological-Grade Graphene Oxide Sheets Leon Newman,# Dhifaf A. Jasim,# Eric Prestat, Neus Lozano, Irene de Lazaro, Yein Nam, Bakri M. Assas, Joanne Pennock, Sarah J. Haigh, Cyrill Bussy,* and Kostas Kostarelos* Cite This: ACS Nano 2020, 14, 10168−10186 Read Online See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles. Downloaded via UNIV AUTONOMA DE BARCELONA on February 8, 2021 at 12:18:42 (UTC). ACCESS Metrics & More Article Recommendations * sı Supporting Information ABSTRACT: Carbon nanomaterials, including 2D graphene- based materials, have shown promising applicability to drug delivery, tissue engineering, diagnostics, and various other biomedical areas. However, to exploit the benefits of these materials in some of the areas mentioned, it is necessary to understand their possible toxicological implications and long- term fate in vivo. We previously demonstrated that following intravenous administration, 2D graphene oxide (GO) nano- sheets were largely excreted via the kidneys; however, a small but significant portion of the material was sequestered in the spleen. Herein, we interrogate the potential consequences of this accumulation and the fate of the spleen-residing GO over a period of nine months. We show that our thoroughly characterized GO materials are not associated with any detectable pathological consequences in the spleen. Using confocal Raman mapping of tissue sections, we determine the sub-organ biodistribution of GO at various time points after administration. The cells largely responsible for taking up the material are confirmed using immunohistochemistry coupled with Raman spectroscopy, and transmission electron microscopy (TEM). This combination of techniques identified cells of the splenic marginal zone as the main site of GO bioaccumulation. In addition, through analyses using both bright-field TEM coupled with electron diffraction and Raman spectroscopy, we reveal direct evidence of in vivo intracellular biodegradation of GO sheets with ultrastructural precision. This work offers critical information about biological processing and degradation of thin GO sheets by normal mammalian tissue, indicating that further development and exploitation of GO in biomedicine would be possible. KEYWORDS: 2D materials, degradation, macrophage, toxicology, nanomedicine G raphene-based materials (GBMs) have potential for exciting applications including those related to medical technologies, such as improved drug delivery.1−4 A key concern, however, is the implications of interactions of these engineered nanomaterials with the mammalian biological accumulation after i.v. administration is not restrictive only to GBMs;6 it has been reported for various other nanomateri- als.10,11 In terms of physicochemical characteristics, we showed that thicker GBMs such as multilayer graphene oxide (GO) sheets are more likely to be trapped within the capillary beds of milieu.5 Understanding the fate of GBMs after administration the lungs compared with single-to-few-layer GO sheets, after to the body and the materials’ tendencies to accumulate within systemic administration.12 Single-to-few-layer GO sheets, on the organs and cells, especially those of the mononuclear phagocytic other hand, have a greater capacity to be excreted via the urinary system (MPS), such as the lungs, liver and spleen, and the effects tract and for the small fraction of this material that remained in thereof,6,7 are key in defining whether GBMs will be suitable for biomedical applications. Preferential accumulation of nanomaterials in one component Received: April 24, 2020 of the MPS over another is typically influenced by the route of Accepted: July 13, 2020 administration and the physicochemical characteristics of the Published: July 13, 2020 materials administered.8 We and others have reported the accumulation of functionalized GBMs in the spleen following intravenous (i.v.)6,9 and intraperitoneal administration.7 Splenic © 2020 American Chemical Society https://dx.doi.org/10.1021/acsnano.0c03438 10168 ACS Nano 2020, 14, 10168−10186 ACS Nano www.acsnano.org Article Figure 1. Physicochemical characterization of GO, prior to injection. (a) AFM image, with corresponding graphs showing the distribution of sheet thickness and lateral dimensions. (b) TEM. (c) Raman spectroscopy with I(D)/I(G) ratio. (d) Electron diffraction pattern with the corresponding SAED aperture micrograph given in Figure S1. Further physicochemical characterization is shown in Figure S2. the body, this was shown to accumulate predominantly within aspect that is particularly sensitive to variations in physicochem- the spleen.9,12 ical characteristics is the in vivo long-term fate and, in particular, The spleen is a highly specialized organ; it forms a major part the biodegradability of the materials.5,17,18 of the MPS and has major functions in the innate and adaptive The degradability of GO, as well as related carbon branches of the immune system.13 It is adapted to filtering blood nanomaterials, has been reported in the literature under different via the strategic placement of an array of phagocytic cells, such as conditions mimicking biological processes. Various studies specialized macrophages. These phagocytic cells act to “clean” describe degradative processes mediated by oxidizing chem- the blood of foreign-body invaders and particulates. The filtered icals,19−22 as well as free radicals (reactive oxygen species or blood is then returned to the main circulation via the efferent reactive nitrogen species) generating enzymes, including some splenic vein.13 The spleen also contains large numbers of that are relevant to mammals.17,18,23−26 Such studies have lymphoid cells and antigen-presenting cells, such as dendritic suggested that the colloidal characteristics of GO dispersions, cells. If foreign-body invaders or particulates, such as GBMs, are and the material characteristics that control these, are important recognized by these cells as antigens, they may induce antigen- determinants of the biodegradability of the materials.17 Low specific immune responses.14,15 Besides immune-related func- levels of surface functionalization and increased thickness are, tions, the spleen also plays an important role in the maintenance for instance, likely to promote poor dispersibility and of a healthy red blood cell (RBC) population and the storage of aggregation/agglomeration of the materials, thereby hindering iron.13 their enzyme-mediated biodegradation; the contrary would Accumulation of GBMs within the spleen following promote it.17,18 However, these studies provide limited administration has been reported to be without toxicological information as to the potential of GBMs to degrade in vivo. consequences.7 At the same time, however, various reports have In this respect, the most advanced study so far describes the detailed extensive immune responses characterized by upregu- biodegradability of carboxylated graphene (GO-like materials) lation of inflammatory markers as well as histopathological over a period of three months in mice, using confocal Raman changes 6 following the administration of GBMs. Such spectroscopy.6 The authors reported the continuing but discrepancies are often linked to the inhomogeneity in incomplete biodegradation of thick graphene-based aggregates physicochemical properties, such as thickness, lateral dimen- in different organs of the MPS with ensuing development of sions, and levels of surface functionalization, of the administered associated pathological features.6 Noticeably, the spleen was GBMs between investigations.8,16 Thick, large, or poorly shown to degrade the accumulated material at a faster rate functionalized sheets are more likely to have detrimental compared with other components of the MPS.6 consequences compared with thin, small, well-functionalized, In order to develop GO as a potential vehicle for therapeutics and highly dispersed materials. Variations in GBM character- or diagnostics, more work is required to determine the exact istics can, therefore, determine the impact of the materials on degree of biodegradability of these materials in vivo. In previous biological systems8 and consequently affect its applicability in reports, we demonstrated that after i.v. administration, single-to- biomedical research particularly with regard to systemic drug few-layer GO sheets are largely excreted via the kidneys and delivery. urinary tract.9,27 We quantified the amount of material excreted GO sheets are a promising class of GBMs that have been as well as that retained in the body and examined the interaction investigated extensively in biomedicine; like other GBMs, they of GO with the kidneys and its toxicological consequences.27 are often complex and poorly characterized, leading to Importantly, we showed that a small, yet significant, proportion discrepancies in the literature in terms of toxicology. One of this thin material was sequestered within the spleen. Herein, 10169 https://dx.doi.org/10.1021/acsnano.0c03438 ACS Nano 2020, 14, 10168−10186 ACS Nano www.acsnano.org Article Figure 2. Effect of GO on spleen structure. H & E-stained spleen sections (5 μm thick) are shown after injection of GO (2.5, 5, and 10 mg/kg), Dex 5% (negative control), and LPS 5 mg/kg (positive control) after (a) 24 h and (b) one month postinjection. The first column is composed of 20× magnification images. Scale bars represent 100 μm. The middle and last columns show 60× magnifications of red and white pulps, respectively. The scale bars represent 50 μm. The inset images show 300× magnified regions with scale bars that represent 5 μm. (c) Quantification of the total cells with brown pigmentation detected in spleen sections. Data are represented as mean ± standard error (SE). Statistical significance was assessed via the Kruskal−Wallis multiple comparison test and Dunns’ posthoc test (*p < 0.05, ***p < 0.005 vs age- matched negative control). There were n = 3−4 mice per group. we build on these previous findings and report a much-needed Among GBMs, GO sheets are the most studied oxidized long-term study investigating both the impact and in vivo derivatives of sp2-hybridized carbon nanomaterials for bio- biodegradability of the portion of the small and thin GO sheets medical applications. This is due to their relatively hydrophilic sequestered within the spleen over nine months following i.v. nature and amenability to surface functionalization.28 These administration in mice. features give GO sheets a strong capacity particularly regarding the design of two-dimensional nanoscale carriers for drugs and RESULTS AND DISCUSSION other pharmaceutical agents.2,29,30 However, information Two criteria are preferable in the development of engineered concerning the in vivo safety profile and fate over time of GO nanomaterials for biomedical applications: a safe in vivo profile sheets is limited.5 Considering our previous study, which in the context of the designated application and the capacity for demonstrated that the spleen is the primary organ of effective, or controlled, biodegradation or body elimination.5 accumulation of the GO dose fraction not excreted via the 10170 https://dx.doi.org/10.1021/acsnano.0c03438 ACS Nano 2020, 14, 10168−10186 ACS Nano www.acsnano.org Article kidney after i.v. administration in mice,9 the primary objective of (Figure S2D) and fluorescence (Figure S2E) spectroscopies the present study was to understand the impact of this further revealed characteristic absorption and fluorescence accumulation on the spleen structure and function and to reveal curves expected for GO. the in vivo fate (i.e., biodegradability) of the GO sequestered Polar oxygen-containing functionalities, as detected on our within the spleen. GO material, are known to minimize the thermodynamic consequences of hosting hydrophobic carbon-based materials in BIOLOGICAL-GRADE GO SHEETS HAVE IDEAL the hydrogen-bonding network of aqueous environments.38 In FEATURES FOR BIOMEDICAL STUDIES our case, this allowed the formulation of a well-dispersed GO Various reports have detailed the importance of properly aqueous preparation. Overall, the characterization results defining and characterizing GBMs in biomedical research.5,16,31 demonstrate the successful preparation of colloidal dispersions Characteristics such as lateral dimensions, thickness, and surface of GO nanosheets suitable for i.v. administration.8,33 Based on functionalization are key determinants of the impact of GBMs the literature and our previous work, small, well-dispersed, and on biological systems.8 Following the production of an aqueous thin GO sheets are less likely to cause adverse reactions due to GO suspension, an extensive physicochemical characterization physical entrapment in capillaries and other small blood of the GO sheets was performed. First, atomic force microscopy vessels.12 Small, well-dispersed sheets are also more likely to (AFM) and transmission electron microscopy (TEM) were be excreted via the kidneys and urinary tract,12 and regarding the used to confirm the synthesis of single-to-few-layer GO sheets small portion of material that remains within the body, these with lateral dimensions below 2 μm with a log-normal have a greater chance of interacting with cells without causing distribution (Figure 1A and B). Previous studies recommend damage.39 that when injecting colloidal particles intravenously, the material dimensions should not exceed the diameter of a capillary (5−7 GO SHEETS HAVE LIMITED EFFECT ON SPLEEN μm).32 This is because the materials must be able to journey HISTOPATHOLOGY through these narrow blood vessels following administration Following characterization and confirmation that the GO sheets without getting trapped, for example, in the lung capillary were of small lateral dimensions, single-to-few layers, and bed.8,32,33 extensively surface oxidized, dispersed material was adminis- Spectroscopic analysis was then performed and consistent trated to mice via i.v. injection. Based on the material with that expected of GO: an sp2-hybridized carbon hexagonal physicochemical features, the GO sheets were expected to lattice interspersed with oxygen functionalities. Raman spec- accumulate over time in the spleen, as previously reported by us9 troscopy showed enhanced scattering in the D band relative to and others7,40 independently. However, we could not find any the G band (Figure 1C), which indicated the presence of defects study that examined the consequences of GO accumulation on within the graphitic backbone of GO. This finding was the splenic structure or function at the administered doses used corroborated by the hexagonal electron-diffraction pattern, here (2.5, 5, or 10 mg/kg).9,27 which showed diffusivity within the diffraction rings, suggestive This prompted us to explore the possible effects of the of the presence of crystalline and noncrystalline regions within accumulated material, first on spleen histology. Using H & E the GO sheets (Figure 1D). The corresponding electron staining, we observed no histopathological changes or tissue micrograph is provided in Figure S1. Attenuated total damages at either 24 h (Figure 2A) or one month (Figure 2B) reflectance Fourier-transform infrared spectroscopy (ATR FT- after GO administration at doses of 2.5, 5, or 10 mg/kg. IR) indicated that these defective regions were occupied by Magnified regions of both red and white pulps were various oxygen-containing functional groups (Figure S2A). For histologically normal in GO-injected mice and showed no instance, stretching vibrations of the O−H bond were observed apparent difference compared with those of mice injected with as a broad band between 3000 and 3700 cm−1;34 these likely the vehicle control, namely, dextrose 5% (Dex 5%, negative originated from hydroxyl and carboxyl groups and residual control). In contrast, mice injected with bacterial lipopolysac- tightly bound water molecules. Aliphatic C−H stretching charide 5 mg/kg (LPS, positive control; used widely to study vibrations were observed as a minor band around 2815 acute toxicological responses)41 exhibited a reduction in the cm−1,35 while stretching vibrations originating potentially from extent of hematoxylin staining, especially in the red pulp, which CO groups, present in carbonyl and carboxyl groups, were is indicative of cell death. These findings were consistent with demonstrated by a sharp peak at approximately 1725 cm−1.28,34 other reports,7 although some have demonstrated GO-induced Evidence of in-plane vibrations in cyclic aromatic networks were structural changes associated with significant pathological also observed as very weak bands between 1500 and 1600 implications.42 Differences in observations between studies are cm−1,28,36 although, O−H bending modes in adsorbed water thought to be due to differences in the physicochemical molecules, expected around 1625 cm−1, may have also characteristics of the GBMs used, particularly thickness, lateral contributed.28,37 Bending vibrations of O−H present in dimensions, and dispersibility.8 hydroxyls were detectable as a strong band around 1400 In addition to a normal histological appearance of the spleen, cm−1.28,37 Evidence of ether groups could also be detected; they we observed that with increasing doses of GO (2.5, 5, or 10 mg/ have previously been reported to result in intense absorption kg), there was an increase in the number of individual cells bands around 1045 and 965 cm−1, which correspond to C−O showing brown pigmentation in comparison to the controls stretching vibrations;28,34 epoxides may finally have contributed (insets in Figure 2A (24 h) and 2B (1 month)). All cells that to vibrations around 850 cm−1.28 These inferences were visually appeared brown were counted (Figure 2C), with no supported by thermogravimetric analysis (TGA) (Figure S2B) specific exclusion criteria applied to reduce bias. At 24 h after and X-ray photoelectron spectroscopy (XPS) (Figure S2C-i and GO administration, increase in pigmentation was particularly C-ii) data. TGA data also indicated that these defected regions, apparent in the red pulp and marginal zone regions of the spleen. occupied by oxygen-containing functionalities, constituted This increase in pigmentation in GO-treated animals compared about 40% w/w of total GO. Ultraviolet−visible (UV−vis) with controls was more pronounced at one month, compared 10171 https://dx.doi.org/10.1021/acsnano.0c03438 ACS Nano 2020, 14, 10168−10186 ACS Nano www.acsnano.org Article Figure 3. Effect of GO on spleen function, after 24 h and one month postinjection of GO at different concentrations (2.5, 5, 10 mg/mL) compared with control mice, Dex 5% (negative control), and LPS 5 mg/kg-injected (positive control) mice. (a) Blood smears stained with H & E at two magnifications, 60× (scale bar 50 μm) and inset images 300× (scale bar 5 μm). The graph represents the percentage of deviant RBCs (reticulocytes, abnormal and aged RBCs) from the total RBC counts; the black arrows indicate some of the deviant RBCs detected in LPS- injected mice. The graph was obtained after counting >500 cells from each mouse (n = 3 per group). (b) Pearls’ Persian blue-stained spleen tissue sections (5 μm thick) at two magnifications, 20× (scale bar, 100 μm) and inset images 100× (scale bar, 20 μm). Blue spots demonstrate regions of Persian blue-stained hemosiderin. The graph represents the percentage of total imaged tissue that stained blue, indicating the presence of hemosiderin. This was obtained by measuring the intensity of the blue-stained regions from 3 or 4 images from each mouse captured at 20× (n = 3, 4 mice per group) by Fuji Image J analysis. (c) Spleen T-lymphocyte cell counts, CD4+ T-helper cell counts plot (left), and cytotoxic CD8+ cell count plot (right). Cell counting was performed by flow cytometry. Three repeat counts were performed for each group of mice (n = 3). (d) Gene expression levels of pro-inflammatory cytokines IL-6, IL-1β, and TNF-α and gene expression levels of anti-inflammatory cytokines IL-10 and TGF-β. (a) and (b) represent the spleen hematological function, while (c) and (d) represent the spleen immunological functions. In (a), (b), and (c) data are represented as mean ± standard error (SE), while for the RT-q-PCR in (d), data are represented as mean ± standard deviation (SD). Statistical significance was performed by using the Kruskal−Wallis multiple comparison test and Dunn’s posthoc test, while the Welch ANOVA and Games−Howell’s posthoc test was used in D. In all cases statistics are *p < 0.05, **p < 0.01, ***p < 0.005 vs negative control. 10172 https://dx.doi.org/10.1021/acsnano.0c03438 ACS Nano 2020, 14, 10168−10186 ACS Nano www.acsnano.org Article with 24 h. At one month, the presence of brown-pigmented cells The other aspect of hematological function58 of the spleen is was also evident in the white pulp at the maximum dose (10 mg/ its capacity to serve as a reservoir for biologically important kg). In our previous study, a similar appearance of dark brown/ metals, such as iron in the form of hemosiderin in red pulp black pigmented cells was noted in the red pulp of spleens of macrophages.59−61 Figure 3B presents Perls’ Prussian blue mice injected with functionalized GO sheets (f GO).9 Other staining that was used to detect the hemosiderin content studies have also reported dark local regions in the H & E stained (stained in blue; quantification presented in bar chart) in mouse tissue sections of organs (including lungs and liver) following spleen sections at 24 h and one month after injection with administration of GO or f GO.43−45 The dark local regions in different concentrations of GO (2.5, 5, or 10 mg/kg). As these studies were attributed to accumulation of foreign carbon expected, the levels of hemosiderin increased with the age of the nanostructures.46 However, at this level of information, dark or mice (as seen in Dex 5%-treated animals between the 24 h and brown regions could be indicative of substances other than GO, 30 day time points). As also expected, there was a significant such as iron, which is known to be stored in the spleen as reduction in the amount of hemosiderin in LPS-treated mice; hemosiderin, preferentially in the red pulp.47,48 In addition to this can be attributed to the marked cell death known to be the microarchitecture, the general appearance of the whole induced by LPS.62 At 24 h and one month, neither a decrease spleen was examined (Figure S3). During the early stages, i.e., 24 nor increase in hemosiderin was observed in GO-treated mice, h after injection, there was a notable darkening of the spleens regardless of dose, when compared with age-matched Dex 5%- particularly following the injection of the highest GO doses. treated mice. Wen et al. demonstrated a similar dark black coloration of the Taken together, these results indicated that the spleen was whole spleen in mice injected with f GO. This darkening also able to maintain both a healthy RBC population (Figure 3A) and increased when the administrated dose (up to 16 mg/kg) its iron-storage capability (Figure 3B) after GO administration increased.49 irrespective of the dose used. Other studies have reported a To further assess the possible impact of GO i.v. injection at the similar absence of changes in the overall spleen hematological tissue level, terminal deoxynucleotidyl transferase (TdT) dUTP parameters of mice injected with a single dose of GBMs of up to nick-end labeling (TUNEL) staining was performed on spleen 10 mg/kg after 48 h43 and 10 days,63 or even with doses as high sections (Figures S4 and S5). While the LPS-positive control as 60 mg/kg after 24 h.64 The same finding is true after repeated was clearly inducing a higher number of TUNEL-positive cells administration of 10 mg/kg every 2 days for up to 22 days,65 15 compared with the negative control, GO was consistently mg/kg every other day for 14 days,66 or even after repeated oral inducing a higher number of TUNEL-positive apoptotic cells administration of high doses of GO (60 mg/kg) every 24 h for (about twice the amount found in negative control) for both five consecutive days.67 time points tested, only at the highest tested dose (i.e., 10 mg/ In addition to providing information about the hematological kg). Although the total number of TUNEL-positive apoptotic function of the spleen, the Perls’ Prussian blue staining provided cells in GO groups was still within the norms expected for the additional information concerning the identity of the brown- spleen,50,51 but significantly lower than in the LPS control, these pigmented features, previously observed in the splenic marginal findings were suggestive that 10 mg/kg could likely be the zones of GO-treated mice (Figure 2). Most of the brown lowest-observed-adverse-effect level (LOAEL) for the tested material in the red pulp was stained blue and, therefore, was material in this animal model. confirmed to be hemosiderin. In contrast, in cells of the splenic marginal zone, or their close vicinity, brown material (unstained GO SHEETS HAVE LIMITED EFFECTS ON SPLENIC by the Perls’ Prussian blue dye) continued to be observed in spleen sections of GO-treated mice, compared with control FUNCTION groups. This further confirmed that the brown-pigmented In order to further study the effect of GO on the spleen and material present in the marginal zones of GO-treated mice was clarify the possible risk associated with the 10 mg/kg dose, the not hemosiderin but more likely GO. two main splenic functions, namely, hematological and We then investigated the immunological function of the immunological, were interrogated. The hematological function spleen (Figure 3C and D). Emphasis was put on cell-mediated concerns primarily the ability of the red pulp macrophages to immunity, which was measured by determining the populations eliminate aberrant and old RBCs.52−56 Figure 3A presents of T lymphocytes, specifically CD4+ and CD8+ cells as the major optical microscopy images of H & E-stained blood smears of immune component of the splenic white pulp.68,69 Cell- mice injected with GO at doses of 2.5, 5, or 10 mg/kg, at 24 h mediated immunity has a crucial role in the recognition and and one month compared with those of mice injected with Dex elimination of antigenic substances such as abnormal cells and 5% (negative control) or 5 mg/kg LPS (positive control). Black foreign matter.15 Cell counts for both T helper CD4+ and T arrows indicate deviant RBCs in a representative LPS-injected cytotoxic CD8+ cells are presented in Figure 3C (representative mouse blood smear. Quantification of the deviant RBCs is flow cytometry plots outlining CD4+ and CD8+ populations are provided as bar chart in the same figure. Aberrant RBCs provided in Figure S6). The graph shows that there were normally do not account for more than 3% of total RBCs.57 The moderate changes in CD4+ and CD8+ cell populations in mice graph, therefore, presents evidence of normal levels of aberrant injected with GO (2.5, 5, and 10 mg/kg) at both 24 h and one RBCs (about 3%)57 for all groups injected with GO, regardless month after administration when compared with the age- of the concentrations, at both 24 h and one month after matched negative controls (Dex 5%). In contrast, LPS-injected administration. The LPS-injected group (positive control), mice showed a significant reduction in both cell populations however, exhibited elevated levels of abnormal RBCs (7%) (Figure 3C). These data were in agreement with the findings of relative to the negative control (Dex 5%) and significantly above Wang et al., who showed no changes in CD4+ and CD8+ T-cell the physiological level (3%).57 This was expected, as LPS populations in spleens of mice injected with two different types administration has been shown to result in increased RBC of graphene nanosheets at 1 mg/kg after i.v. injection.45 deformation.41 Interestingly, the same study demonstrated that there was a 10173 https://dx.doi.org/10.1021/acsnano.0c03438 ACS Nano 2020, 14, 10168−10186 ACS Nano www.acsnano.org Article Figure 4. Localization and abundance of GO in spleen tissue at different time points following the administration of 7.5 mg/kg GO. (a) Confocal Raman correlation maps of GO Raman signatures detected in mice spleen sections at different time points (day 1, 30, and 270) post-GO administration. The horizontal length scale bar represents 200 μm. The vertical heat scale bar (black−white) indicates 40−80% correlation with spectra of starting material shown in Figure 1c. (b) Overlay image of the immunostaining of MZM (green) and nuclei (blue) with bright field images, together with correlative Raman spectra of regions of interest, at different time points (day 1, 30, and 270). The white circles and their corresponding numerical identities indicate different regions of interest where the Raman spectra were acquired. The corresponding numbered spectra are inset in the respective images. Scale bars represent 50 μm. (c) The percentage of cell-sorted MZMs that screened Raman positive for GO over time (n = 20 spectra for each of three animals at each time point). (d) Apoptotic cell density detected as per the TUNEL assay, for GO and Dex 5% treated groups at different time points (day 1, 30, and 270). Statistical significances were tested using the Kruskal−Wallis multiple comparison test with Dunn’s posthoc test. A full breakdown of the results of the statistical analysis for graphs C and D is provided in Tables S1 and S2, respectively. In all cases, statistical significance was defined where p < 0.05. significant rise in both CD4+ and CD8+ T cells after Such results illustrate how different types of carbon nanoma- administration of multiwalled carbon nanotubes (CNTs) at the same dose and that this rise persisted for more than 7 days.45 terials (GBMs or CNTs) may interact with biological systems in 10174 https://dx.doi.org/10.1021/acsnano.0c03438 ACS Nano 2020, 14, 10168−10186 ACS Nano www.acsnano.org Article different ways and, thereby, result in different biological mouse spleen50,51 (Figure S5); and our previous observations27 outcomes.5 of uncharacteristic mouse growth curves at this dose after one To expand our study on the immunological function of the month. All observations suggested that 10 mg/kg might be the spleen, we analyzed the gene expression profiles of various LOAEL dose in mice for this material over the long term. cytokines, including pro-inflammatory (IL-6, IL-1β, and TNF- Therefore, we selected a lower dose (i.e., 7.5 mg/kg) to reduce α) and anti-inflammatory (IL-10 and TGF- β) mediators. Rise in the long-term risk to the animals’ health. This was important, as cytokine expression is typical evidence of CD4+ T-cell activation we intended to study biodegradation over nine months, while and is known to mediate CD8+ cells’ and B-cells’ functions.14 not compromising our ability to detect and track the fate of GO Herein, no significant differences in the levels of the pro- during this long period. In agreement with this approach, no inflammatory cytokines IL-6 and TNF-α were detected at any impact on the growth curve of the GO-injected mice was time point in mice injected with GO (2.5, 5, or 10 mg/kg) observed compared with the vehicle (Dex 5%) control-injected compared with mice injected with Dex 5% (Figure 3D). This mice (Figure S7) over the nine-month period. was in agreement with the findings of Wang et al., who also did Using confocal Raman mapping to track the injected GO not detect any change in cytokine levels following the i.v. sheets in spleen sections, it was confirmed without ambiguity injection of graphene nanosheets, even 1 week after admin- that the observed brown material in the splenic marginal zone istration.45 There was, however, a significant increase at 24 h in had typical Raman spectroscopic fingerprints of GO (Figure 4A, IL-1β expression for all GO-injected mice (Figure 3D); this day 1). Previous literature studies have reported similar increase was also noted by Orecchioni et al. at 24 h after the accumulation in this region for other engineered nanoparticles, incubation of GO with human immune cells.70 After one month, including lipid-based nanoparticles10,78 and CNT.40,79 In the IL-1β levels returned to normal in mice treated with the lowest spleen, the marginal zone is densely populated with various concentrations of GO (2.5 and 5 mg/kg), indicating that this strategically located phagocytic cells.10 The next step was, effect was transient and due to a mild inflammatory response therefore, to determine the precise identity of the specific cells occurring soon after injection. However, at 10 mg/kg and in within the splenic marginal zone that sequestered GO. Using contrast to the 2.5 and 5 mg/kg doses, IL-1β levels were immunofluorescence in correlation with conventional (point- significantly reduced at the one-month time point. Noticeably, and-shoot) Raman spectroscopy in spleen sections, we found there was also a significant reduction in anti-inflammatory that GO was sequestered primarily within a subset of splenic cytokine expression at 24 h, in particular IL-10 in mice injected macrophages. These were shown to be the marginal zone with 2.5, 5, and 10 mg/kg of GO, and TGF-β in mice injected macrophages (MZM), which stained positive for the ERTR-9 with 10 mg/kg of GO. Levels of both IL-10 and TGF-β were also antigen,10 and were shown to contain GO by Raman analysis significantly reduced at the one-month time point for all tested (Figure 4B). Preferential uptake of GO by MZMs was further GO doses. confirmed using fluorescence-activated cell sorting (FACS) Such cytokine suppressive effects of GO have been previously followed by conventional Raman spectroscopy on isolated reported by Sydlic et al. following the administration of GO at 20 splenocyte subpopulations (Figure 4C and Figure S8). mg/kg.71 The authors attributed such effects to a protective Within the spleen, MZMs make up a small fraction of the total mechanism associated with the adverse effects of GO.71 splenocytes and are situated throughout the middle and outer Suppression of cytokine expression could also be due to direct portion of the marginal zone.80 In these regions of the spleen, inhibitory effects of GO on secreting cells (e.g., primarily blood, previously flowing under high pressure due to the macrophages in the case of TGF-β72 or monocytes and restrictive diameter of the terminal arterioles, emerges from the macrophages in case of both IL-1073 and IL-1β74) by a white pulp and into the sinuses of the marginal zone.13 Due to mechanism that does not involve secondary regulatory effects75 the open nature of this region, there is a lack of resistance, which or decreased responsiveness of such cells.76 T cells are the main causes the blood to experience a dramatic deceleration in flow source of IL-6,77 while TNF-α is primarily secreted by velocity, resulting in a local decrease in blood pressure.10,13 macrophages but can also be produced by other cells, such as Highly phagocytic MZMs take this opportunity to remove CD4+ T cells. T-cell populations were, however, unaltered in the unwanted particulates, including cellular debris and exogenous present study (Figure 3C); reduction in cytokine expression particulates from the blood.10,13 We infer that GO sheets after GO treatment may, therefore, indicate the involvement of circulating in the blood may have in the same way been taken up the innate immune system in regulating the effects of GO.70 by the MZMs, which have been repeatedly shown to internalize More in-depth work is warranted to assess this possibility. engineered nanoparticles, including liposomes,10,11 polystyrene microspheres,10 or CNTs,40 after i.v. administration. GO SHEETS ACCUMULATE PREFERENTIALLY IN We then attempted to probe the fate of the GO accumulated in the marginal zone over time (from day 1 to day 270 after MARGINAL ZONE MACROPHAGES AFTER I.V. administration, Figure 4A and B). Comparing spleen sections ADMINISTRATION, BUT PROGRESSIVELY DISAPPEAR from GO-injected mice analyzed at the different time points, we FROM THE SPLEEN OVER NINE MONTHS observed a clear decrease in the abundance of detectable GO Following the determination of the impact of GO on mouse and a corresponding loss in the GO Raman spectral integrity spleen, we analyzed the sub-splenic biodistribution of the from day 1 to day 270. Results from confocal Raman mapping of material to reveal its long-term fate within this organ. For this spleen sections (Figure 4A) agreed with that of conventional experiment, we used 7.5 mg/kg of GO, rather than the maximum (point and shoot) Raman spectroscopy on individual 10 mg/kg dose used in the above experiments. This selection splenocytes (Figure 4B). In both cases, while the Raman was based on observations that 10 mg/kg could induce signature of GO was easy to identify at 24 h, the same signature moderate but potentially significant modifications of the could hardly be detected at the later time points. The greatest immunological function of the spleen (Figure 3D); increase loss in GO-positive cells was observed during the first month cell apoptosis, despite being within a physiological range for after administration (between day 1 and day 30), but it 10175 https://dx.doi.org/10.1021/acsnano.0c03438 ACS Nano 2020, 14, 10168−10186 ACS Nano www.acsnano.org Article Figure 5. Splenic biodegradation of GO over nine months following i.v. administration at a dose of 7.5 mg/kg. (a) (i) Splenic sections of mice that were stained with H & E; scale bars represent 50 μm. Inset images show the presence of GO material in the vicinity of cells of the marginal zone; scale bars represent 10 μm. (ii) Average Raman spectra of GO present in physically homogenized spleen tissue at different time points, n = 10 ROI × 3 mice. (iii) TEM micrographs of GO sequestered within the vesicular compartments of marginal zone splenocytes over time; scale bars represent 1 μm. The inset shows a magnification of the GO material at the respective time points; scale bars represent 500 nm. (iv) Representative electron diffraction pattern line profiles of GO at different time points postadministration, with the respective diffractograms inset; scale bars represent 10 1/nm. (b) Average number of dark areas present in the splenic marginal zone at each time point (n = 5 ROI × 3 mice) (*p < 0.05).(c) Evolution of the Raman I(D)/I(G) ratio over nine months (n = 10 ROI × 3 mice). Statistical significances for graphs B and C are given in Tables S3 and S4, respectively. continued to decrease over the remaining course of the detection of Raman spectroscopy.81 On the other hand, it could experiment (Figure 4C). be explained by the elimination of the material. Indeed, it has Observation of loss of GO Raman signature may on one hand been previously shown that nanomaterials traveling through be due to biodegradation of the material, leaving only a trace blood can be noncovalently attached to RBCs.82 If this was the amount of GO crystalline regions that were below the limit of case for GO, the sheets would be held in the RBC reservoir of the 10176 https://dx.doi.org/10.1021/acsnano.0c03438 ACS Nano 2020, 14, 10168−10186 ACS Nano www.acsnano.org Article spleen and would exit the organ carried by healthy RBCs without more sparingly (Figure S10). The number of dark regions was, being captured by phagocytic cells. However, this hypothesis therefore, quantified (Figure 5B) and revealed a clear association would not fit with the biodistribution pattern observed herein, between the higher number of dark regions in the marginal zone since the majority of RBCs within the spleen are present in the and GO administration, compared with vehicle controls. red pulp13 and not in the marginal zone where GO appeared to Importantly and consistent with the idea of progressive accumulate (Figure 3D). Our previous studies9,27 have also degradation of GO, the number of marginal zone dark regions shown that a large portion of administrated GO sheets are in GO-treated mice decreased over time (more sharply during excreted via the urinary tract (without causing damage to the the first 30 days), reaching values similar to those found in Dex kidneys) soon after i.v. administration; this would not be 5%-treated mice by day 270 (Figure 5B). possible if large amounts of GO were bound to RBCs. This To further confirm that progressive degradation of GO suggests that GO sheets are more likely relatively free and not entrapped in the spleen was taking place in GO-injected animals, carried by RBCs when circulating in the blood, leading to their conventional Raman spectroscopy was used to detect the typical capture by MZMs when reaching the spleen. Raman fingerprints of GO in physically homogenized spleen Another possibility that would explain an over-time tissue of mice injected with GO at different time points and for elimination would be GO sheets inducing significant tissue up to nine month after administration. This allowed us to probe damage upon accumulation, which in turn would cause release GO biodegradation at the whole organ level, to reveal the full of splenic content, including iron (hemosiderin)83 and the extent of degradation for all the GO sheets entrapped in the captured GO. However, our results showed no detectable spleen. In agreement with previous data (Figure 4), we found damage to the spleen (or decrease of hemosiderin) for up to one that the intensity of the Raman signature of GO dramatically month (Figures 2 and 3), when the greatest loss of GO signal decreased over time (Figure 5A-ii). By nine months, the GO was observed. Similarly, no significant differences in the number Raman signature was barely recognizable, lacking all typical of apoptotic cells were found in the spleen of GO-injected mice spectral features of GO crystals. For reference, the complete even after nine months (Figure 4D), although there was an series of averaged spectra (n = 30) over the nine month study is initial slight but statistically insignificant increase at day 1. provided in Figure S11. However, the extent of cell death was within the norm expected Going further in the analysis of the collected Raman spectra, for spleen tissue.50,51 In addition, on examining the TUNEL- we extracted the peak intensity for the characteristic D vs G staining images, it is apparent that apoptosis was not bands of GBMs (D band at ∼1350 cm−1; G band at ∼1580 predominant in the marginal zone (Figure S9), where the cm−1) and calculated the I(D)/I(G) intensity ratio for each time densest accumulation of GO was observed, at any time point. point (Figure 5C). The data revealed that over nine months the Without completely negating the possibility of concomitant GO Raman signature in the spleen followed the expected three- elimination of the material via mechanisms that would require stage classification of disorder for graphitic carbon crystals.84 further investigation, the absence of compelling evidence to This theory is known as the amorphous trajectory of carbon and support elimination of the material leads us to conclude that describes the transformation of sp2-hybridized carbon structures biodegradative processes were the more likely leading cause for into a mainly tetrahedral sp3 amorphous carbon phase.84 Prior to the loss of GO Raman signature in spleen sections. This injection, the GO material displayed a prominent D peak conclusion is supported by several studies showing that thin and (Figure 1), which is due to the breathing modes of sp2- well-dispersed GO sheets, similar to those used in the present hybridized carbon bonds present in the structure’s hexagonal study, are more likely to undergo biodegradation compared with rings. In order for the D peak to be visualized, charge carriers thicker and aggregated GO sheets in the presence of oxidative must be inelastically scattered by a phonon and then undergo a enzymes.17,18 In particular, myeloperoxidase, an enzyme second elastic scattering by a defect within the material.85 The typically produced by granulocytes and macrophages, including presence of such a heightened D peak indicated, therefore, that MZMs, was shown to be unable to degrade highly aggregated prior to injection the GO sheets were significantly defective from GO, but efficiently catalyzed degradation of well-dispersed GO a crystal point of view. This is expected considering the materials,17 such as those used herein. Such studies emphasize conditions of the modified Hummers’ method used to oxidize the key role of the hydrophilicity, negative surface charge, and and exfoliate graphite to form GO.28,34,86 From day 1 to day 7 colloidal stability of aqueously dispersed GO in relation to after administration, the I(D)/I(G) ratio of GO in the spleen biodegradation. In addition to this, the spleen has been began to rise (Figure 5C), indicating that the degree of defects previously shown to have a stronger capacity to biodegrade within the material had increased, as expected per the first stage GBMs (especially GO-like, carboxylated graphene)6 than other of the amorphous trajectory of carbon and in correlation with components of the MPS such as the lungs and liver.6,42 predictions of the Tuinstra−Koenin (TK) equation.87 The TK equation relates the size of sp2-hybridized crystal domains within GO SHEETS BIODEGRADE IN THE MARGINAL ZONE graphitic materials as they become increasingly defective. The MACROPHAGES OVER NINE MONTHS equation predicts that as the size of the sp2-hybridized crystal To further characterize the progressive in vivo biodegradation of domain decreases, the I(D)/I(G) ratio will increase until a GO over nine months, we looked in more detail at the spleen minimum crystal domain size is reached. After this point, the marginal zone cells in which GO sheets accumulate preferen- I(D)/I(G) is expected to decrease as the spectral peaks are tially. First, using H & E staining, we found evidence of the gradually attenuated and the spectra are such that the consistent presence of slightly darkened regions within the assumptions of the TK equation no longer apply.84 marginal zones of the spleen, at all tested time points (Figure 5A- The rise in the I(D)/I(G) ratio continued at a slow pace for i). This agreed with the data presented in Figures 2−4, in which another week after injection (from day 7 to 14; Figure 5C). This dark regions were observed across the whole spleen. However, slow pattern can be explained by the presence of oxidized debris, these dark regions were present not only in GO-injected mice physisorbed to the surface of GO sheets. Such debris may have (Figure 5A-i) but also in the Dex 5%-administered mice, albeit degraded first, thereby offering protection to the underlying GO 10177 https://dx.doi.org/10.1021/acsnano.0c03438 ACS Nano 2020, 14, 10168−10186 ACS Nano www.acsnano.org Article sheet, hence slowing the initial biodegradative process. The at longer time points, there was an overall decrease in the presence of oxidized debris may be alluded to by the XPS O/C abundance of material as well as the intensity measured for the atomic ratio (O/C = 0.5) measured in the GO material, prior to diffraction peaks associated with GO. This was attributed to a injection in animals. A previous study88 showed that GO, progressive attenuation of the crystallinity of the GO to a more prepared through a modified Hummers’ method, often contains amorphous structure due to biodegradation,17 as discussed significant quantities of physisorbed oxidized debris. These above and supported by the Raman results (Figures 5C and debris consist mainly of highly oxidized nanometer-sized S11). In further support of these findings, evidence of the polyaromatic molecules; their presence on GO sheets can lead formation of holes within the planar structure of GO sheets was to high O/C ratios of around 0.4 or above. When such GO identified at day 30 (Figure S14). These formations were not materials are subjected to base washing, shown to remove these apparent prior to injection or at early time points, i.e., before day physisorbed oxidized debris, significant reductions in the XPS- 30, and could not be attributed to electron beam damage during derived O/C ratio to values of approximately 0.3 or below are image acquisition. Beyond 30 days, cell-entrapped GO sheets observed.88 This is due to the lower abundance of oxygen in the appeared too damaged to allow TEM imaging of further sample following the removal of the oxidized debris by the base degradation (i.e., more advanced holey formation) of the planar washing. The protective effect of these oxidized debris may also structure. These observations and their time line may suggest a be enhanced by the in vivo-derived protein corona, which is structural biodegradation-related GO transition state, whereby expected to form around any nanomaterial on contact with defects accumulate within the material and then erode away, biological fluids such as blood. resulting initially in the creation of large holes within the GO After day 14, the I(D)/I(G) ratio was observed to decrease sheets and ultimately the complete loss of their planar structure. (in particular between day 14 and 30; Figure 5C), as expected as Importantly, the structural changes in GO planes observed in part of the second stage of the amorphous trajectory of carbon. It spleen sections could not be found in GO sheets incubated at 37 can be explained by the increasing presence of defects within the °C in the dark for nine months (i.e., material not injected in 2D structure of GO sheets, which eventually results in the animals; Figures S15 and S16), indicating that elements of the presence of significant amounts of amorphous carbon structures, spleen biological milieu are likely responsible for these structural to such an extent that the assumptions of the TK equation no changes. longer apply.84,89 This inference is supported by studies in which Similar results have been documented several times in vitro ion beams of increasing energies were directed at graphene when sp2-hybridized carbon nanomaterials, including GBMs, sheets. In these cases, the ions caused knock-on damage, were exposed to oxidizing chemicals,19 peroxidase family resulting in defects within the graphene sheets and consequent enzymes,17,18,23 and other enzymes such as cellular nicotinamide alterations in the Raman spectral features over time,85 which adenine dinucleotide phosphate-oxidase (NADPH oxidase) or followed a similar pattern to what we observed herein for the induced nitrogen oxide synthase (iNOS).92 In terms of a spleen-bound GO. The results of these ion-beam studies were possible mechanism by which the GO sheets were being also discussed relative to the amorphous trajectory of carbon and biodegraded intracellularly, based on the extensive work predictions of the TK equation.85 Several enzyme- and cell- concerning CNT degradation in macrophages,93 it can be based studies investigating the biodegradation of GBMs also envisioned that following phagocytosis in MZMs membrane- displayed a similar pattern of Raman I(D)/I(G) ratio changes, bound NADPH oxidase was activated and catalyzed the albeit under much shorter time frames.18,90 production of superoxide. Superoxide dismutase could then The presence of an increasing amount of defects and disorder convert the superoxide into hydrogen peroxide, which could within the spleen-bound GO may also explain the increasingly react with free radical nitric oxide to generate reactive difficult-to-detect GO Raman signals beyond 24 h (as observed peroxynitrite. Peroxidase enzymes such as myeloperoxidase in both conventional Raman spectroscopy (1 μm2 spot size; (MPO) may also have a role in catalyzing production of Figure 4B, Figure 5A-ii) and confocal Raman mapping (mm2 hypochlorite from peroxide and chloride ions, even though wide tissue section area; Figure 4A)). Indeed, as time macrophages, including MZMs, contain lower levels of MPO progressed, attenuation of the two characteristic Raman than other immune cells such as neutrophils.94 Another scattering peaks continued to occur, with subsequent decreases possibility is that Fe ions, present within macrophages,94 in the I(D)/I(G) ratio (Figure 5C) until both peaks were hardly catalyzed the breakdown of peroxide to hydroxyl radicals. As a detectable. By day 270, attenuation of both D and G bands was result of these different processes, free radicals and reactive consistent across samples with limited exceptions, indicating species, including peroxynitrite, hypochlorite, and hydroxyl that the crystalline structure of the accumulated material had radicals, could then attack reactive sites such as epoxide groups been largely lost (Figure 5A-ii). present on the planes of GO sheets, resulting in hole formation We finally wanted to confirm visually that biodegradation of (as observed herein via TEM) and the eventual breakdown of GO was occurring within the splenocytes and not extracellularly. the whole graphitic lattice. Further research is, however, BF-TEM was used to image GO directly within the ultra- warranted to confirm which molecular mechanism(s) is(are) structure of tissue-fixed cells. An acceleration voltage of 80 kV leading to biodegradation of GO in the mouse spleen. was used, in order to reduce knock-on damage.91 Cell-entrapped An interesting and related question is the nature of the GO appeared to lose its characteristic appearance and become resulting molecular byproducts of biodegradation and whether increasingly defective over time (Figures 5A-iii and S12). This they could be eliminated or not. Although we have not was further validated by the evolution of the electron diffraction determined the molecular identity or fate of these in vivo patterns of intracellularly entrapped GO, which became generated degradation products, our study reveals that their increasingly difficult to acquire (Figures 5A-iv and S13). At likely production and presence did not obviously jeopardize the day 1, it was relatively easy to locate intracellular GO structures splenic health or growth curve of mice. Similarly, and in support and acquire hexagonal diffraction patterns characteristic of GO of our findings, previous studies have reported that the in vivo within cellular compartments (Figure 5A-iii and A-iv). However, administration of carbon nanomaterial biodegradation by- 10178 https://dx.doi.org/10.1021/acsnano.0c03438 ACS Nano 2020, 14, 10168−10186 ACS Nano www.acsnano.org Article products, generated in vitro, lack toxic consequences for animal EXPERIMENTAL SECTION subjects.95,96 However, further studies would help determine the Graphene Oxide Preparation. The oxidation of graphite was exact cellular mechanisms that catalyze the observed biode- based on a modified Hummers’ method.86 Briefly, a mixture of 0.8 g of gradation of GO, as well as the precise molecular identity and flake graphite (Graflake 9580, Brazil) and 0.4 g of sodium nitrate fate of the resulting degradation byproducts, for the latter, using (NaNO3) was maintained at approximately 0 °C using an ice bath. GO synthesized from 13C-labeled graphite for instance. Then 18.4 mL of 96% sulfuric acid (H2SO4) was added to the mixture Besides the Raman, TEM, and electron diffraction properties while stirring, followed by the gentle addition of 2.4 g of potassium of GBMs probed herein, the materials’ photothermal properties permanganate (KMnO4). The mixture was taken from the ice bath. could also be exploited in future studies to similarly reveal After 30 min, the mixture increased in viscosity and resulted in the biodegradation; this would particularly be relevant to reduced formation of a dark-colored paste. A volume of 37 mL of Milli-Q H2O was added. An increase in temperature to 80 °C was observed, and this GO.97,98 Such a concept was previously applied to function- continued until 98 °C. The temperature was maintained at 98 °C for 30 alized CNTs in 2D microglial cell cultures.99 In this study, min. After this duration, the mixture was diluted with a volume of 112 photothermal imaging was used to track the fate of CNTs over mL of warm Milli-Q H2O. A 12 mL aliquot of 30% H2O2 was added time, revealing their progressive disappearance from the subsequently. The suspension was centrifuged and pelleted repeatedly phagocytic cells. The same technique could, therefore, be at 7690g for 20 min; the supernatant was then removed and replaced applied to quantitatively determine the dynamics of biode- with Milli-Q H2O. This process was repeated until the acidic pH of the gradation of GBMs in biological systems. supernatant was neutralized (pH 7, 20 °C) and a viscous orange/brown In order to obtain more quantitative results regarding gel layer of single-to-few-layer GO appeared on top of the graphite biodegradation, as most of the techniques used herein were at oxidation byproducts. This gel-like layer was carefully extracted with best only providing semiquantitative assessment, the use of warm water to yield a dispersion of GO. A known volume of this aqueously dispersed material was freeze-dried, and the dry material simpler biological models, such as in vitro 3D cell culture models, weighed. This allowed the concentration of the extracted GO material should be explored. In these models, the applied/administrated to be determined. The concentration of the material was found to be 2.4 dose, the delivered dose, and the cellular dose of nanomaterials mg/mL. The aqueously dispersed GO was then subjected to may be easier to determine. Indeed, 3D cell culture models ultrasonication for 5 min (VWR, 80W) to prepare the desired small represent a convenient midway point between 2D cell culture sheet size GO. The internal batch reference of GO used in the present models (which does not replicate adequately cell−cell and cell− study is GO (f1s). Samples were characterized via AFM, TEM, selected matrix interactions or the complex diffusion/transport processes area electron diffraction (SAED), ATR FT-IR, TGA, XPS, UV−vis, and seen in 3D tissues)100,101 and true in vivo animal models. fluorescence spectroscopy to confirm successful synthesis of single to Previous reports have demonstrated significant differences in the few layer small GO sheets. interaction of nanomaterials with 2D cell cultures compared Atomic Force Microscopy. Sample preparation was completed on freshly cleaved mica, treated with 40 μL of poly-L-lysine (Sigma- with 3D cell cultures.100 This highlights the benefit of the latter Aldrich, UK). The poly-L-lysine was used to present a positively charged as a more predictive and representative biological model, surface that would allow the adhesion of GO. Aliquots (10 μL) of GO particularly when quantitatively determining critical doses of (100 μg/mL) were transferred onto the mica-poly-L-lysine surface and administered materials, and the dynamics of material degrada- left to adsorb for 2 min. Unbound structures were removed by gentle tion in cells, as recently reported for biosynthesized magnetic rinsing with 2 mL of Milli-Q H2O and left to dry at room temperature. A iron nanoparticles.102 multimode atomic force microscope (Bruker, UK) was applied in tapping mode, in order to avoid damaging the samples, for height (trace CONCLUSIONS and retrace) and amplitude measurements. Measurements were performed using an Otespa tapping mode tip (Bruker, UK). The We have provided evidence that following i.v. administration the following parameters were employed: scan rate, 1 Hz; lines per scan, small proportion of GO sheets that were not initially excreted 512; integral gain, 1; proportional gain, 5; amplitude set point, 150 mV but accumulated in the spleen did not induce histopathologic (maintained approximately constant between all measurements). Scans damage. Importantly, we report the maintenance of the were taken at 50, 20, 10, 5, and 2 μm (aspect ratio 1:1). Postimage functional (both hematological and immunological) integrity processing was completed using the Bruker Nanoscope Analysis version of the spleen at doses as high as 10 mg/kg, although at the 1.4 software (Bruker, UK) and included section analysis for measuring highest dose administered slight immunological variations were the cross-sectional height of samples. observed. Using confocal Raman mapping, as well as Transmission Electron Microscopy for Material Character- immunohistochemistry and conventional Raman spectroscopy ization. A 20 μL aliquot of sample (200 μg/mL) was placed on a carbon-coated copper grid (CF400-Cu) (Electron Microscopy in combination, to map the splenic distribution of GO, we Services, UK) and left to adsorb for 2 min. Filter paper (Merk- identified that a subpopulation of splenic macrophages, known Millipore, UK) was used to gently remove the excess dispersed material. as the marginal zone macrophages, were the predominant cells Then samples were observed with a FEI Tecnai 12 BioTWIN responsible for bioaccumulating the material. Finally, using an microscope (FEI, NL) at an acceleration voltage of 100 kV. Images array of techniques including Raman spectroscopy and TEM were taken with a Gatan Orius SC1000 CCD camera (Gatan, UK). For coupled with electron diffraction, we tracked the fate of the SAED of GO sheets, material samples was prepared as described above, bioaccumulated GO over nine months and provide compelling however, on Quantifoil S 7/2 copper grids (Electron Microscopy evidence, down to the ultrastructural level, to suggest the in vivo Services, USA). SAED patterns were acquired on a FEI Talos 200X biodegradation of GO to such an extent that the material lost its (FEI, Eindhoven, NL), operating at 80 kV and using electron dose rates detectable graphitic crystalline structure. This further suggests ranging between 45 and 84 e−·A−1 s−1. This microscope was equipped with a FEI Ceta CMOS camera. Patterns were acquired from 0.5 μm2 that the initial accumulation of GO in the spleen was a transient areas, corresponding to the 40 μm selected-area aperture. An event. This important result supports the development of acquisition time of 1 s was used. thoroughly characterized GO sheets for biomedical technologies Raman Spectroscopy for Material Characterization. Samples and is highly encouraging especially for systemic drug delivery were prepared for analysis by drop casting 20 μL of GO (100 μg/mL) purposes, where the biocompatibility and biodegradability of dispersion onto a glass slide. Samples were left to dry for at least 2 h at nanocarriers are a key advantage.103 37 °C. Spectra were collected using a DXR Raman microscope 10179 https://dx.doi.org/10.1021/acsnano.0c03438 ACS Nano 2020, 14, 10168−10186 ACS Nano www.acsnano.org Article (Thermo Fisher Scientific, UK) using a λ = 633 nm laser. Spectra were function and structural studies, mice (n = 3) were intravenously considered between 250 and 3500 cm−1, enabling the visualization of administered with GO (2.5, 5, and 10 mg/kg) or Dex 5% (negative the D and G scatter bands. Prior to the measurements, the Raman control) and were culled for the different experiments after 24 h and 1 system was energy calibrated to a polystyrene reference material. The month. LPS (E. coli O127:B8, L4516-1MG; Sigma-Aldrich, UK) (5 calibrated instrument had an energy resolution of 2.5 cm−1. Spectra mg/kg) at 24 h was used as the positive control. These mice were were collected at a laser power of 0.4 mW with a magnification lens of maintained for only 24 h, since the mice showed symptoms of distress 50× (numerical aperture: 0.75) with a 25 s exposure time and averaged and were therefore culled at this time point. LPS is known to illicit over five locations. Raman spectra were corrected for tissue inflammatory responses following injection and is commonly used as a autofluorescence using a sixth-order polynomial baseline correction; positive control in this respect. Relevant to our study, LPS can induce all spectra were normalized to the G peak for I(D)/I(G) calculation increased levels of red blood cell deformity, pro-inflammatory using Origin Pro 8.5.1. software (Origin Lab, USA). cytokines, and apoptosis;41,62 this is expected to result in alterations Attenuated Total Reflection Fourier Transform Infrared to both structure and function of the spleen. Administration of LPS as a Spectroscopy. A drop of GO dispersion was placed into a Tensor positive control, therefore, allowed us to compare and gauge the 27 FTIR machine (Bruker, UK) and dried for 5 min at 60 °C until a potential toxicological effects of GO on spleen structure and function. powder remained. Spectroscopic analysis was carried out between 750 For longer term degradation studies, mice (n = 3) were administered and 4000 cm−1. Data processing was completed using OriginPro 8.5.1. with either 7.5 mg/kg or Dex 5% (negative control). The mass software (Origin Lab, USA). concentrations of GO in the injection was 0.75 mg/mL, corresponding Thermogravimetric Analysis. Lyophilized GO (2 mg) was to 150 μg of GO per injection. Mice were then culled at different time weighed into a ceramic crucible set at 25 °C in a TGA 400 points (1, 7, 14, 30, 90, 180, and 270 days following the single thermogravimetric analyzer (PerkinElmer, UK). Samples were initially administration) via being subject to terminal anesthesia followed by held at 100 °C for 5 min to reduce the presence of residual water. The cervical dislocation. For all experiments, mice were continuously temperature was then increased at a rate of 10 °C per minute from 25 to monitored and weighed every 4 days during the first month and weekly 995 °C, with a nitrogen flow of 20 mL/min. Measurements were thereafter. considered between 100 and 800 °C to avoid water interference. Data Spleen Histopathological Analysis. Spleens of mice were fixed processing was completed using OriginPro 8.5.1. software (Origin Lab, with 4% paraformaldehyde and dehydrated through increasing USA). concentrations of alcohol (ethanol 50−100%) and embedded by X-ray Photoelectron Spectroscopy. The chemical composition paraffin wax. Sections of 5 μm were cut on a microtome (Leica, UK), of the GO sheets was studied by XPS at the NEXUS facility (the UK’s stained with hematoxylin and eosin stain (H & E), coverslipped with National EPSRC XPS Users’ Service, hosted by nanoLAB in Newcastle- resinous mounting media, and allowed to dry for 48 h at 37 °C. Images upon-Tyne). XPS spectra was recorded using a Thermo Theta Probe were collected using a 20× objective in a 3D Histech Panoramic 250 XPS spectrometer with a monochromatic Al Kα source of 1486.68 eV. Flash slide scanner. Images were processed and analyzed using The survey XPS spectra were acquired with a pass energy (PE) of 200 Pannoramic Viewer (http://www.3dhistech.com/) and Fiji/ImageJ eV, a 1 eV step size, and a 50 ms dwell time and averaged over five scans. software (version 1.5c; National Institutes of Health, USA). All three The etching step was 90 s. The high-resolution C 1s XPS spectra were mice were examined per condition. acquired with a PE of 40 eV, a step size of 0.1 eV, and a 100 ms dwell Blood Smear Analysis. Blood was collected from mice via cardiac time and averaged over 20 scans. Spectra from insulating samples were puncture and immediately drawn into a capillary tube. One drop of charge-corrected by shifting all peaks to the adventitious carbon C 1s blood (approximately 4 mm in diameter) was placed on a clean slide spectral component, with the binding energy set to 284.6 eV. The (near the end). The drop was spread by another glass slide placed at a CasaXPS software was used to process the spectra acquired at NEXUS. 45° angle and pressed into the drop of blood, allowing it to spread via Processing steps included the C 1s XPS spectral deconvolution and capillary action. The slides were then fixed with cold methanol assignment of the different deconvoluted spectral components as per (precooled to −20 °C) and allowed to dry at room temperature. The the binding energies at which they arise. These assignments were made samples were stained by H & E stain and imaged as described above. in accordance with NIST’s XPS databases: π−π*: 290−290.2, O−C Reticulocytes and abnormal and aged RBCs were considered as deviant O: 289.7−288.2 eV, CO: 288.1−287.4 eV, C−O: 286.8−286.2, C− RBCs,52−56,104 and their percentage of the total RBCs was calculated. C and CC: 284.6 eV. The full width half-maximum of each More than 500 cells were counted for each mouse (n = 3 for each deconvoluted peak, other than that of the π−π*, was constrained to the group). same extent, and a Shirley background was taken. The peak for C−C/ Perls’ Persian Blue Analysis of Spleen Sections. Paraffin- CC was of an asymmetric line shape, while the rest were of the embedded sections of spleens were sectioned at 5 μm and then standard Gaussian−Lorentzian line shape. dehydrated as described above. The sections were stained with a freshly UV/Visible Spectroscopy. The UV−vis absorbance spectra of GO prepared mixture of aqueous solutions of 20% hydrochloric acid and were measured by a Varian Cary win UV 50 Bio spectrophotometer 10% potassium ferrocyanide trihydrate (Sigma-Aldrich, UK) at a (Agilent Technologies, UK). The GO samples were diluted in water volume ratio of 1:1, followed by counter staining with nuclear fast red from 7.5 to 20 μL/mL prior to measurement in a 1 mL glass cuvette 0.2% aqueous solution. The slides were dehydrated through 95% and with a 1 cm path length. Dual-beam mode and baseline correction were 100% ethanol solutions, respectively, with two consecutive changes for used throughout the measurements to scan the peak wavelength and each concentration. They were then coverslipped with resinous maximum absorbance between 200 and 600 nm. mounting media and left to dry overnight. Images were collected as Fluorescence Spectroscopy. Fluorescence emission spectra of described above. The percentage of blue pigmentation was analyzed by GO were measured over a concentration range between 75 and 200 μg/ Fiji/ImageJ software (version 1.5c; National Institutes of Health, USA). mL, using an LS-50B spectrofluorimeter (PerkinElmer, UK), with both This was obtained from three to four images from each mouse captured excitation and emission slits set at 20 nm. The excitation wavelength at 20× after setting a threshold (n = 3 mice per group). used was 525 nm. Spleen Single-Cell Suspension Preparation. Half spleens were Animal Handling Procedures. Eight-week-old C57BL/6 mice extracted from mice and placed immediately in RPMI 1640 media (18.1 ± 0.7 g) were obtained from Harlan (Oxfordshire, UK), allowed (Sigma-Aldrich, UK) supplemented with 10% FBS (Gibco, Thermo to acclimatize for 1 week, and maintained under a 12 h light−dark cycle Fisher Scientific, UK) and 1% penicillin and streptomycin (Sigma- at a steady temperature and humidity. Mice were allowed access to food Aldrich, UK). Single-cell suspensions were obtained by gently passing and water ad libitum for the duration of the investigation. All the spleens through a 100 μm cell strainer (BD Falcon cell sieve). The experiments were conducted in accordance with the UK Home Office cell suspension was centrifuged at 400g for 5 min, and the supernatant Code of Practice (1989) for the housing and care of animals in scientific was discarded. The cells were resuspended in fresh media, and the procedures in accordance with prior approval from the UK Home contaminating RBCs were removed by adding 3−4 mL of red blood cell Office (Project License Number: P6C826A12). For short-term splenic lysis buffer (Roche, UK) and allowed to react at 4 °C for 5 min. The cell 10180 https://dx.doi.org/10.1021/acsnano.0c03438 ACS Nano 2020, 14, 10168−10186 ACS Nano www.acsnano.org Article suspension was then centrifuged (400g for 5 min), and the cells were analyzed in the same way to ensure no cross contamination as a quality pelleted while the supernatant was discarded. The cell pellet was then check. resuspended and washed in fresh media twice. The splenocytes were Immunofluorescence with Raman Spectroscopy. Mice were counted using a cytometer, aliquoted, and further processed as needed. culled, and the spleens were immediately extracted and washed in 1× T-Lymphocyte Counts by Flow Cytometry. Splenocytes were PBS (Sigma-Aldrich, UK). One quarter of the spleen was immediately first preincubated with anti-CD16/32 antibodies at 2 μg/mL transversely immersed into the O.C.T. compound and snap-frozen in (eBioscience, UK, ref #16-0161-85) for 20 min on ice, in order to isopropanol (Sigma-Aldrich, UK) that was precooled to liquid-nitrogen block nonspecific binding sites. The cells were washed (centrifuged at temperatures. The spleens were next sectioned into 5 μm sections via 400g for 5 min) and then labeled with the antibody mixture of anti- cryomicrotomy, and the sections were collected onto glass slides CD4-PE at 0.25 μg/mL (eBioscience, UK, ref #12-0041-82) and anti- (VWR, UK). Afterward, the tissue sections were fixed using 300 μL of CD8a at 0.25 μg/mL. PerCP-Cy5.5 (eBioscience, UK, ref #45-0081- ice-cold methanol (Sigma-Aldrich, UK) for 10 min. The methanol was 82) was further incubated with the cells on ice for another 20 min. Cells removed, and the fixed tissues were incubated in blocking buffer (1% were then washed and resuspended in buffer (1% sodium azide and 1% bovine serum albumin (fraction v, Sigma-Aldrich, UK), 0.1% Triton FBS in 1× PBS) for acquisition. Flow cytometry analysis was carried out X100 in 1× PBS) for 1 h in a humidification chamber. Tissue sections using a BD FACSVerse flow cytometer (Becton Dickinson, Oxford, were washed in a washing buffer that consisted of 0.1% Triton X100 in UK). Single-color control samples were used to set compensation. PE 1× PBS, three times for 5 min each. The washing buffer was removed, and PerCE-Cy5.5 fluorescence was detected with 574/26 nm and 690/ and the tissue was incubated with the biotinylated Anti-SIGN Related 1 50 nm band-pass filters, respectively, after excitation with a 488 nm blue antibody [ER-TR9] (#AB51819, Abcam, UK) diluted in blocking laser. Data were analyzed and statistics were generated using the buffer to 3.3 μg/mL for 2 h at room temperature in a humidification FACSuite v1.6 software (Becton Dickinson, Oxford, UK). chamber. The antibody solution was removed, and the tissue sections Spleen Cytokine Gene Expression by RT-qPCR. An Aurum were gently washed with the washing buffer three times for 5 min each. Total RNA minikit (Biorad, UK) was used to extract the total RNA of 2 The tissue sections were incubated with the revealing agent, × 106 isolated splenocytes. The RNA concentration and quality were Fluorescein Avidin DCS (Vector Laboratories, UK), which was diluted analyzed using UV spectrophotometry (BioPhotometer, Eppendorf, to 22 μg/mL with HEPES-buffered saline (pH 8.2, 20 °C), for 2 h in a UK). cDNA synthesis was performed from 1 μg of RNA sample with an humidification chamber. The tissue was then washed with washing iScript cDNA synthesis kit (Bio-Rad, UK) according to the buffer, and excess liquid was removed using a cotton bud. The tissue manufacturer’s instructions. The protocol for reverse transcription sections were coverslipped with Prolong gold antifade including DAPI was set as follows: 25 °C for 5 min, 42 °C for 30 min, 85 °C for 5 min, (Thermo Fisher Scientific, UK). The sample was left in the dark at and 4 °C for 5 min. A 2 μL amount of cDNA sample was used for each room temperature for a 24 h period. Fluorescence microscopy was real-time qPCR reaction performed with iQ SYBR Green Supermix completed, and the regions where ERTR-9 staining was detected were (Bio-Rad, UK). Experimental duplicates of each sample were run on a marked on a customized grid. Controls consisting of either the revealing CFX-96 real time system (Bio-Rad, UK) with the following protocol: agent (Fluorescein Avidin) alone without biotinylated antibody (to 95 °C for 3 min, one cycle; 95 °C for 10 s, 60 °C for 30 s: repeated for 40 ensure no signal was originating from the unspecific binding of the cycles. Melt curve analysis was conducted at the end of the protocol to revealing agent) or tissues from animals treated with dextrose 5% were confirm amplification of a single product. β-Actin was used as a included in this experiment, in order to exclude false-positive readings. The coverslips were later gently removed by incubating the slides in 1× housekeeping gene, and gene expression levels were normalized to the PBS overnight at room temperature. Following this treatment, the Dex 5%-injected control group. Primer sequences were as follows: β- coverslips could be removed via gravity; care was taken not to damage actin, Fwd 5′ GACCTCTATGCCAACACAGT 3′ and Rv 5′ the fixed tissue. The exposed tissues were gently washed with Milli-Q AGTACTTGCGCTCAGGAGGA 3′; IL-6, Fwd 5′ ATGGATG- water and left to dry at 37 °C for 1−2 h. Using the marked grids the CTACCAAACTGGA 3′ and Rv 5′ CCTCTTGGTTGAAGATATGA same regions identified by fluorescence microscopy were analyzed by a 3′; TNFα, Fwd 5′ CAGACCCTCACACTCAGATCATCT 3′ and Rv “point-and-shoot” polystyrene calibrated DXR Raman microscope 5′ CCTCCACTTGGTGGTTTGCTA 3′; IL-1β, Fwd 5′ GGACAG- (Thermo Fisher Scientific, UK) using a laser at λ = 633 nm, 0.4 mW, AATATCAACCAACAAGTGATA 3′ and Rv 5′ GTGTGCC- 50× (numerical aperture of 0.75) and an exposure time of 25 s and GTCTTTCATTACACAG 3′; IL-10, Fwd 5′ GGTTGCCAAGCC- averaged over three readings; the energy resolution of the instrument TTATCGGA 3′ and Rv 5′ ACCTGCTCCACTGCCTTGCT 3′; was 2.5 cm−1. This allowed the colocalization of the Raman signature of TGF-β, Fwd 5′ GACCAGCCGCCGCCGCAGG 3′ and Rv 5′ GO with the immunofluorescence signal of ERTR-9-positive marginal AGGGCTGTCTGGAGTCCTC 3′. zone macrophages. The spleens of at least three mice, with two or more Confocal Raman Mapping of Tissue Sections. Mice were culled splenic sections, were imaged. and spleens were immediately extracted and washed in 1× phosphate Fluorescence-Activated Cell Sorting with Raman Spectros- buffered saline (PBS) (Sigma-Aldrich, UK). One quarter of each copy. A single-cell suspension of splenocytes was obtained as described extracted spleen was immediately transversely immersed into the above. The isolated cells were then stained with the relevant antibodies optimal cutting temperature (O.C.T. compound, Tissue-Tek) media mentioned below as per the manufacturer’s instructions. FACS was and then snap-frozen in isopropanol (Sigma-Aldrich, UK) precooled to then performed on live cells on a BD Influx cell sorter (BD Biosciences, liquid nitrogen temperatures. The spleens were cut into 5 μm thick Oxford, UK). Fluorescently conjugated antibodies (Miltenyi Biotec sections via cryomicrotomy (Leica, UK) and placed onto glass slides. Limited, UK) were excited, and their emission was collected under the The tissue sections were then fixed using 300 μL of ice-cold methanol following conditions: CD45-VioBlue, violet laser, band-pass 460/50; (Sigma-Aldrich, UK) for 10 min. The sections were subsequently gently F4/80-v770-PE, yellow-green laser, 750LP; CD11c-FITC, blue laser, washed in 1× PBS twice in order to remove the O.C.T. compound. band-pass 530/40; CD209-PE, yellow-green laser, band-pass 585/29; Milli-Q water was used to remove any salt crystals from the PBS. The CD169b, red laser, band-pass 670/30. Cells were gated on an initial sample was redoused with 300 μL of ice-cold methanol and dried for 1 h scatter gate to exclude debris. Lymphocytes were identified as CD45+/ at 37 °C to dehydrate the sample. Raman scanning was completed on side scatter low and granulocytes were CD45+/side scatter high. F4/ regions of the spleen tissue including the red and white pulp regions. 80+/CD11c− macrophages were gated from the granulocyte gate and Raman scanning was completed using a polystyrene calibrated DXRxi CD11c+/F4/80− dendritic cells were gated from this population too. Raman mapping system (Thermo Scientific, UK) using the following The CD209+ and CD169b+ cells were identified as being F4/80−/ conditions: λ = 633 nm, 1 mW, objective 50× (numerical aperture: CD11c− and identified by plotting them against each other. Baseline 0.75), pixel size = 3 μm. The software was used to generate Raman voltages were set using unlabeled cells, and positive populations were correlation maps based on the correlation of the acquired signal with identified using full minus one (FMO) controls. Cells were filtered the spectra of the starting material shown in Figure 1C. The instrument through a 50 μm mesh prior to being sorted through a 100 μm diameter had an energy resolution of 2.5 cm−1. Dex 5%-treated animals were nozzle at 20 PSI pressure, which generated a drop drive frequency of 38 10181 https://dx.doi.org/10.1021/acsnano.0c03438 ACS Nano 2020, 14, 10168−10186 ACS Nano www.acsnano.org Article kHz. Sort side streams were optimized to enable five separate order polynomial baseline correction, and the ratio of intensity of the D populations to be collected simultaneously from each individual and G peaks, I(D)/I(G), was calculated and averaged for n = 10 spectra sample. Up to 20 000 cells were collected depending on the frequency for each of the three mice. We also scanned Dex 5%-treated animals in of the cell subpopulation in the sample. The event rate was maintained the same way to ensure no cross contaminations as a quality check. at 2000−3000 events per second to minimize aberrant droplet Histological Marginal Zone Analysis. For each time point in the formation and ensure a high degree of purity in the sorted cells. Cells degradation study, a quarter of the spleen was fixed with 4% were collected into 1.5 mL tubes containing 1× PBS and then deposited paraformaldehyde and dehydrated through increasing concentrations onto glass slides via a Cytospin apparatus using a centrifuge set to 350g. of ethanol (50−100%) and embedded in paraffin wax. Sections of 5 μm The cells were fixed onto the glass slide with a drop of ice cold thickness were cut and collected onto glass slides and then stained with methanol. Once dry, the sample was analyzed via Raman microscopy H & E stain. The stained sections were then coverslipped with resinous using a DXR Raman microscope (Thermo Fisher Scientific, UK) mounting media and allowed to dry for 48 h at 37 °C. Images were calibrated to polystyrene with an energy resolution of 2.5 cm−1. collected using a 20× objective and a 3D Histech Panoramic 250 Flash Measurements used a laser at λ = 633 nm, 0.4 mW, 50× (numerical slide scanner. Images were processed and analyzed to determine the aperture of 0.75), and an exposure time of 25 s and averaged over three average number of dark regions in the splenic marginal zone (n = 5 readings. The percentage of scanned cells in which GO was detected marginal zones for each of the three mice) using Panoramic Viewer was determined at each time point, n = three mice × 20 cells. Cells (http://www.3dhistech.com/) and Fiji/ImageJ software (version 1.5c; isolated from Dex 5%-treated mice were processed in the same way and National Institutes of Health, USA). scanned to ensure there was no cross contamination of GO between TEM on Splenic Tissue Sections. For each time point analyzed, a samples. quarter of each of the extracted and washed murine spleens was fixed in TUNEL Staining. Spleen sections were embedded in paraffin wax, paraformaldehyde (4% (w/v))/glutaraldehyde (2.5% (w/v)) (Sigma- sectioned to 5 μm thickness on a microtome (Leica, UK), and placed on Aldrich, UK) for 24 h. Following fixation, specimens were cut into 2−3 glass slides. The sections then underwent deparafinization via two mm blocks using a sterile surgical blade. Each specimen was washed immersions in xylene for 5 min each, followed by washing in 100% several times with deionized water, submitted to a second fixation with methanol for 5 min. The samples were subsequently rehydrated by reduced osmium tetroxide (OsO4) (Agar Scientific, UK) for 90 min, passing them through a series of decreasing concentrations of alcohol then rinsed with deionized water and dehydrated through a series of concentrations (100%, 95%, 85%, 70%, 50%) for 3 min at each concentration-graded ethanol (Thermo Fisher Scientific, UK) concentration. The sections were further washed in 0.85% NaCl for 5 solutions, 30%, 50%, 70%, 90%, and 100%. The specimens were min. The rehydrated sections were fixed in 4% formaldehyde (ref incubated at each concentration for 15 min; dilutions were made in #28908; Thermo Fisher Scientific, UK) for 15 min. The remaining Milli-Q water. This was followed by the incubation of the specimen in formaldehyde was then removed by washing in PBS 1× (Sigma-Aldrich, 100% acetone (Thermo Fisher Scientific, UK) for 15 min. Each UK) twice for 5 min each. The excess PBS was removed gently with specimen was infiltrated with increasing concentrations of polypropy- filter paper, being careful to not touch the sections. The glass slides with lene TAAB 812 hard resin (TAAB Laboratories Ltd., UK) (25%, 50%, their fixed sections were then placed on a flat surface, and 10 μL of a 20 75%, and 100%, using acetone as the diluent) for 12 h at each grade. μg/mL proteinase-K solution was placed on each tissue section. The Next, specimens were left in 100% resin for a further 6 h at room slides were left with the proteinase K solution for an optimized time of 8 temperature. Specimens were, thereafter, orientated in the embedding min. Proteinase K was removed by washing with PBS for 5 min. Then mold filled with fresh 100% resin, such that transversal sectioning of the the tissue was covered with 100 μL of equilibrium buffer and left to spleen sample would be possible. The resin (with the orientated equilibrate for 5 min. The equilibrium buffer was removed, and 50 μL of sample) was then cured at 60 °C for 48 h to allow resin polymerization. rTdT incubation buffer was added onto each slide and left for 60 min in TEM imaging was performed on ultrathin sections (approximately 40− a humidification chamber at 37 °C. The slides were next immersed in 70 nm thickness) obtained using an Ultracut E ultramicrotome physiological saline (sodium chloride) 2× to terminate the reaction. (Reichert-Jung, Austria) and a diamond knife (Diatome 45°, Leica, The slides were then washed in PBS 1× (Sigma, UK) twice for 5 min UK). Ultrathin sections were collected onto coatless 200-mesh thin and then washed twice in Milli-Q water for another 5 min each. The copper 3.05 mm grids (Electron Microscopy Services, USA) and slides were, thereafter, incubated in 4% Sudan black (in ethanol) for 10 observed under a FEI Tecnai T-12 BioTWIN TEM (FEI, Eindhoven, min to eliminate RBC-derived fluorescence, followed by washing seven NL) equipped with an Orius CCD SC100 camera (Gatan, UK) at 100 times in PBS 1× (Sigma, UK) for 3 min each and three washes in Milli- kV. The use of this microscope and grids allowed efficient observation Q water for 3 min each. The slides were coverslipped with Prolong gold of the whereabouts and tracking of the GO within tissue. We also antifade including DAPI (Thermo Fisher Scientific, UK) and left at scanned Dex 5%-treated animals in the same way to ensure no cross room temperature in the dark for 24 h. Images were collected using a contamination as a quality check. 20× objective in a 3D Histech Panoramic 250 Flash slide scanner. Electron Diffraction of GO in Tissue Sections. Tissues were Images were processed and analyzed using Pannoramic Viewer (http:// fixed and resin-embedded, and ultrathin sections were prepared for www.3dhistech.com/) and Fiji/ImageJ software (version 1.5c; Na- TEM, as described above. In this experiment, the ultrathin sections tional Institutes of Health, USA). Three mice were examined per were collected onto Quantifoil S 7/2 copper grids (Electron condition. A total of five images of 300 μm2 were analyzed per mouse. Microscopy Services, USA). TEM and SAED shown in Figures 5A-iv, The number of TUNEL-positive cells was blindly counted by three S13, and S14 were performed on a FEI Talos 200X (FEI, Eindhoven, independent investigators, and the counts of the three individuals were NL) operating at 80 kV and using electron dose rates ranging between averaged for each image. 45 and 84 e−·A−1 s−1. TEM images and SAED patterns were acquired Raman Spectroscopy on Homogenized Spleens. For each using a FEI Ceta CMOS camera on an area of 3.14 × 10−2 and 0.5 μm2 time point analyzed, a quarter of the extracted and washed individual corresponding to the selected-area apertures of 10 and 40 μm, murine spleens were homogenized mechanically onto a glass slide and respectively. An acquisition time of 1 s was used for the collection of left to dry for 30−60 min at room temperature and pressure. This was TEM images and SAED patterns. However, for the acquisition of SAED completed in order to assess the state of the overall GO content of the patterns with a 10 μm selected-area aperture, the acquisition time was spleen, instead of cell-specific content. Raman spectroscopy was set to 8 s. performed on the tissue homogenates using a polystyrene calibrated Statistical Analysis. All experimental data are represented as mean DXR Raman microscope (Thermo Fisher Scientific, UK) using a λ = ± standard error (SE) or mean ± standard deviation (SD) as stated in 633 nm laser a 50× objective lens (numerical aperture of 0.75) and a each section, with at least n = 3, 4. Statistical significance was laser power of 0.4 mW with an exposure time of 25 s. The energy determined by the Kruskal−Wallis nonparametric test with Dunn’s resolution was 2.5 cm−1. Raman scattering signals were acquired in at posthoc test or a Mann−Whitney U test for pairwise comparisons where least 10 different regions per mouse with three biological replicas. appropriate. For RT-qPCR data Levene’s test for homogeneity of Raman spectra were corrected for tissue autofluorescence using a sixth- variances was performed, if it showed significance (p < 0.05); then 10182 https://dx.doi.org/10.1021/acsnano.0c03438 ACS Nano 2020, 14, 10168−10186 ACS Nano www.acsnano.org Article Welch ANOVA and a Games-Howell’s posthoc test were performed. Bakri M. Assas − Lydia Becker Institute of Immunology and SPSS software, version 22.0, was used to perform this analysis. In all Inflammation, and Division of Infection, Immunity and experiments, probability values of <0.05 were considered significant. Respiratory Medicine, School of Biological Sciences, Faculty of Biology, Medicine and Health, The University of Manchester, ASSOCIATED CONTENT Manchester M13 9PT, United Kingdom; Department of * sı Supporting Information Immunology, Faculty of Applied Sciences, King Abdulaziz The Supporting Information is available free of charge at University, Jeddah 21589, Saudi Arabia https://pubs.acs.org/doi/10.1021/acsnano.0c03438. Joanne Pennock − Lydia Becker Institute of Immunology and Tables providing information regarding statistical robust- Inflammation, and Division of Infection, Immunity and ness of the results presented in Figures 4C,D and 5B,C; Respiratory Medicine, School of Biological Sciences, Faculty of figures presenting additional physicochemical character- Biology, Medicine and Health, The University of Manchester, ization data of starting GO material, including FT-IR, Manchester M13 9PT, United Kingdom TGA, XPS, fluorescence, and absorbance; additional data Sarah J. Haigh − Department of Materials, School of Natural related to the analysis of the structure and function of the Sciences, The University of Manchester, Manchester M13 9PL, spleen following GO administration; 9-month growth United Kingdom; orcid.org/0000-0001-5509-6706 curve of mice administered with GO or Dex 5%; Complete contact information is available at: information on the abundance of GO in cells of the https://pubs.acs.org/10.1021/acsnano.0c03438 spleen, determined by FACS; images of TUNEL staining of murine sections over 9 months; additional information Author Contributions regarding the biodegradation of GO, including additional L.N. and D.J. designed, planned, performed most of the histological images, Raman spectra, TEM micrographs, experimental work and data analysis, and drafted the manuscript. and SAED diffractograms; data regarding physicochem- E.P. performed and assisted in the analysis of TEM and electron ical characterization of GO material incubation in water at diffraction of GO in tissue sections. N.L. prepared the GO 37 °C in the dark for 9 months (PDF) samples and helped in the physicochemical characterization of the samples. I.dL. performed the RT-qPCR experiment and data AUTHOR INFORMATION analysis. Y.N. assisted in the TUNEL staining of the spleen Corresponding Authors tissues. M.B.A. helped perform and gave advice on spleen cell Cyrill Bussy − Nanomedicine Lab, National Graphene Institute sorting and spleen cytokine extractions. J.P. helped in the initial and Faculty of Biology, Medicine & Health, The University of stages of the project with planning the spleen cell experiments, Manchester, Manchester M13 9PT, United Kingdom; extractions, and flow cytometry. S.J.H. provided guidance on orcid.org/0000-0001-8870-443X; Email: cyrill.bussy@ TEM experiments and discussed the findings. C.B. and K.K. manchester.ac.uk conceptualized the study, designed, planned, and discussed the Kostas Kostarelos − Nanomedicine Lab, National Graphene findings, reviewed and edited the manuscript, and overall Institute and Faculty of Biology, Medicine & Health, The supervised the work. University of Manchester, Manchester M13 9PT, United Author Contributions Kingdom; Catalan Institute of Nanoscience and Nanotechnology # L. Newman and D.A. Jasim contributed equally to this work. (ICN2), Barcelona 08193, Spain; orcid.org/0000-0002- 2224-6672; Email: kostas.kostarelos@manchester.ac.uk Notes The authors declare no competing financial interest. Authors Leon Newman − Nanomedicine Lab, National Graphene Institute and Faculty of Biology, Medicine & Health, The ACKNOWLEDGMENTS University of Manchester, Manchester M13 9PT, United This work was partially supported by the EPSRC NOWNANO Kingdom DTC program and grants EP/K016946/1 and EP/M010619/1. Dhifaf A. Jasim − Nanomedicine Lab, National Graphene This work has received funding from the European Union’s Institute and Faculty of Biology, Medicine & Health, The Horizon 2020 Research and Innovation Programme under University of Manchester, Manchester M13 9PT, United Grant Agreement numbers GrapheneCore1 (696656) and Kingdom GrapheneCore2 (785219). D.J. and K.K. would like to Eric Prestat − Department of Materials, School of Natural acknowledge the support by the UKRI, EPSRC from the Sciences, The University of Manchester, Manchester M13 9PL, Programme Grant 2D-Health (EP/P00119X/1). The DTRA, United Kingdom USA (grant HDTRA1-12-1-0013), is also acknowledged for Neus Lozano − Nanomedicine Lab, National Graphene Institute partial support. The authors would like to acknowledge the staff and Faculty of Biology, Medicine & Health, The University of in the Faculty of Biology, Medicine and Health EM Facility, Manchester, Manchester M13 9PT, United Kingdom; Catalan particularly Dr. Aleksandr Mironov and Ms. Samantha Forbes, Institute of Nanoscience and Nanotechnology (ICN2), Barcelona for their expertise and assistance, and the Wellcome Trust for 08193, Spain equipment grant support to the EM Facility. The University of Irene de Lazaro − Nanomedicine Lab, National Graphene Manchester Bioimaging Facility microscopes used in this study Institute and Faculty of Biology, Medicine & Health, The were purchased with grants from the BBSRC, Wellcome Trust, University of Manchester, Manchester M13 9PT, United and the University of Manchester Strategic Fund. The authors Kingdom; orcid.org/0000-0002-2775-0173 wish to acknowledge Mr. R. Meadows from the Bioimaging Yein Nam − Nanomedicine Lab, National Graphene Institute and Facility. The authors are also thankful to Mr. P. Walker, from the Faculty of Biology, Medicine & Health, The University of Histology Facility, University of Manchester, for his expert Manchester, Manchester M13 9PT, United Kingdom advice and assistance in tissue histology. The authors also thank 10183 https://dx.doi.org/10.1021/acsnano.0c03438 ACS Nano 2020, 14, 10168−10186 ACS Nano www.acsnano.org Article Dr. N. Hodson from the Bio-AFM Facility for assistance and Mechanism of Graphene Oxide Degradation Via the Photo-Fenton advice regarding the AFM instrumentation. Reaction. J. Phys. Chem. C 2014, 118, 10519−10529. (21) Zhou, X.; Zhang, Y.; Wang, C.; Wu, X.; Yang, Y.; Zheng, B.; Wu, H.; Guo, S.; Zhang, J. Photo-Fenton Reaction of Graphene Oxide: A REFERENCES New Strategy To Prepare Graphene Quantum Dots for DNA Cleavage. (1) Novoselov, K. S.; Falko, V. I.; Colombo, L.; Gellert, P. R.; Schwab, ACS Nano 2012, 6, 6592−6599. M. G.; Kim, K. A Roadmap for Graphene. Nature 2012, 490, 192−200. (22) Xing, W.; Lalwani, G.; Rusakova, I.; Sitharaman, B. Degradation (2) Kostarelos, K.; Novoselov, K. S. Graphene Devices for Life. Nat. of Graphene By Hydrogen Peroxide. Part. Part. Syst. Charact. 2014, 31, Nanotechnol. 2014, 9, 744−745. 745−750. (3) Sun, X.; Liu, Z.; Welsher, K.; Robinson, J. T.; Goodwin, A.; Zaric, (23) Lalwani, G.; Xing, W.; Sitharaman, B. Enzymatic Degradation of S.; Dai, H. Nano-Graphene Oxide for Cellular Imaging and Drug Oxidized and Reduced Graphene Nanoribbons By Lignin Peroxidase. J. Delivery. Nano Res. 2008, 1, 203−212. Mater. Chem. B 2014, 2, 6354−6362. (4) Plachá, D.; Jampilek, J. Graphenic Materials for Biomedical (24) Ding, Y.; Tian, R.; Yang, Z.; Chen, J.; Lu, N. NADPH Oxidase- Applications. Nanomaterials 2019, 9, 1758. Dependent Degradation of Single-Walled Carbon Nanotubes In (5) Kostarelos, K.; Novoselov, K. S. Materials Science. Exploring the Macrophages. J. Mater. Sci.: Mater. Med. 2017, 28, 7. Interface of Graphene and Biology. Science 2014, 344, 261−263. (25) Elgrabli, D.; Dachraoui, W.; Marmier, H. d.; Ménard-Moyon, C.; (6) Girish, C. M.; Sasidharan, A.; Gowd, G. S.; Nair, S.; Koyakutty, M. Bégin, D.; Bégin-Colin, S.; Bianco, A.; Alloyeau, D.; Gazeau, F. Confocal Raman Imaging Study Showing Macrophage Mediated Intracellular Degradation of Functionalized Carbon Nanotube/Iron Biodegradation of Graphene In Vivo. Adv. Healthcare Mater. 2013, 2, Oxide Hybrids Is Modulated By Iron Via Nrf2 Pathway. Sci. Rep. 2017, 1489−500. 7, 40997. (7) Yang, K.; Wan, J.; Zhang, S.; Zhang, Y.; Lee, S.-T.; Liu, Z. In Vivo (26) Lu, N.; Li, J.; Tian, R.; Peng, Y.-Y. Binding of Human Serum Pharmacokinetics, Long-Term Biodistribution, and Toxicology of Albumin to Single-Walled Carbon Nanotubes Activated Neutrophils Pegylated Graphene In Mice. ACS Nano 2011, 5, 516−522. To Increase Production of Hypochlorous Acid, the Oxidant Capable of (8) Bussy, C.; Jasim, D.; Lozano, N.; Terry, D.; Kostarelos, K. The Degrading Nanotubes. Chem. Res. Toxicol. 2014, 27, 1070−1077. Current Graphene Safety Landscape - A Literature Mining Exercise. (27) Jasim, D. A.; Murphy, S.; Newman, L.; Mironov, A.; Prestat, E.; Nanoscale 2015, 7, 6432−6435. McCaffrey, J.; Ménard-Moyon, C.; Rodrigues, A. F.; Bianco, A.; Haigh, (9) Jasim, D. A.; Menard-Moyon, C.; Begin, D.; Bianco, A.; S.; Lennon, R.; Kostarelos, K. The Effects of Extensive Glomerular Kostarelos, K. Tissue Distribution and Urinary Excretion of Intra- Filtration of Thin Graphene Oxide Sheets On Kidney Physiology. ACS venously Administered Chemically Functionalized Graphene Oxide Nano 2016, 10, 10753−10767. Sheets. Chem. Sci. 2015, 6, 3952−3964. (28) Rodrigues, A. F.; Newman, L.; Lozano, N.; Mukherjee, S. P.; (10) Aichele, P.; Zinke, J.; Grode, L.; Schwendener, R. A.; Kaufmann, Fadeel, B.; Bussy, C.; Kostarelos, K. A Blueprint for the Synthesis and S. H.; Seiler, P. Macrophages of the Splenic Marginal Zone are Essential Characterisation of Thin Graphene Oxide With Controlled Lateral for Trapping of Blood-Borne Particulate Antigen but Dispensable for Dimensions for Biomedicine. 2D Mater. 2018, 5, No. 035020. Induction of Specific T Cell Responses. J. Immunol. 2003, 171, 1148− (29) Georgakilas, V.; Otyepka, M.; Bourlinos, A. B.; Chandra, V.; Kim, 1155. N.; Kemp, K. C.; Hobza, P.; Zboril, R.; Kim, K. S. Functionalization of (11) Liu, D.; Mori, A.; Huang, L. Large Liposomes Containing Graphene: Covalent and Non-Covalent Approaches. Chem. Rev. 2012, Ganglioside GM1 Accumulate Effectively In Spleen. Biochim. Biophys. 112, 6156−6214. Acta, Biomembr. 1991, 1066, 159−165. (30) Vacchi, I. A.; Spinato, C.; Raya, J.; Bianco, A.; Menard-Moyon, C. (12) Jasim, D. A.; Boutin, H.; Fairclough, M.; Ménard-Moyon, C.; Chemical Reactivity of Graphene Oxide Towards Amines Elucidated Prenant, C.; Bianco, A.; Kostarelos, K. Thickness of Functionalized Graphene Oxide Sheets Plays Critical Role In Tissue Accumulation and By Solid-State NMR. Nanoscale 2016, 8, 13714−13721. (31) Bianco, A.; Cheng, H.-M.; Enoki, T.; Gogotsi, Y.; Hurt, R. H.; Urinary Excretion: A Pilot Pet/Ct Study. Appl. Mater. Today 2016, 4, 24−30. Koratkar, N.; Kyotani, T.; Monthioux, M.; Park, C. R.; Tascon, J. M. D.; (13) Mebius, R. E.; Kraal, G. Structure and Function of the Spleen. Zhang, J. All In the Graphene Family − A Recommended Nat. Rev. Immunol. 2005, 5, 606−616. Nomenclature for Two-Dimensional Carbon Materials. Carbon 2013, (14) Zhu, J.; Paul, W. E. CD4 T Cells: Fates, Functions, and Faults. 65, 1−6. Blood 2008, 112, 1557−1569. (32) Ilium, L.; Davis, S. S.; Wilson, C. G.; Thomas, N. W.; Frier, M.; (15) Harty, J. T.; Tvinnereim, A. R.; White, D. W. CD8+ T Cell Hardy, J. G. Blood Clearance and Organ Deposition of Intravenously Effector Mechanisms In Resistance To Infection. Annu. Rev. Immunol. Administered Colloidal Particles. The Effects of Particle Size, Nature 2000, 18, 275−308. and Shape. Int. J. Pharm. 1982, 12, 135−146. (16) Wick, P.; Louw-Gaume, A. E.; Kucki, M.; Krug, H. F.; Kostarelos, (33) Bussy, C.; Ali-Boucetta, H.; Kostarelos, K. Safety Considerations K.; Fadeel, B.; Dawson, K. A.; Salvati, A.; Vázquez, E.; Ballerini, L.; for Graphene: Lessons Learnt From Carbon Nanotubes. Acc. Chem. Res. Tretiach, M.; Benfenati, F.; Flahaut, E.; Gauthier, L.; Prato, M.; Bianco, 2013, 46, 692−701. A. Classification Framework for Graphene-Based Materials. Angew. (34) Jasim, D.; Lozano, N.; Kostarelos, K. Synthesis of Few-Layered, Chem., Int. Ed. 2014, 53, 7714−7718. High-Purity Graphene Oxide Sheets From Different Graphite Sources (17) Kurapati, R.; Russier, J.; Squillaci, M. A.; Treossi, E.; Ménard- for Biology. 2D Mater. 2016, 3, No. 014006. Moyon, C.; Del Rio-Castillo, A. E.; Vazquez, E.; Samorì, P.; Palermo, (35) Figueiredo, J. L.; Pereira, M. F. R.; Freitas, M. M. A.; Ó rfão, J. J. V.; Bianco, A. Dispersibility-Dependent Biodegradation of Graphene M. Modification of the Surface Chemistry of Activated Carbons. Oxide By Myeloperoxidase. Small 2015, 11, 3985−3994. Carbon 1999, 37, 1379−1389. (18) Kotchey, G. P.; Allen, B. L.; Vedala, H.; Yanamala, N.; Kapralov, (36) Eigler, S.; Dotzer, C.; Hirsch, A.; Enzelberger, M.; Müller, P. A. A.; Tyurina, Y. Y.; Klein-Seetharaman, J.; Kagan, V. E.; Star, A. The Formation and Decomposition of CO2 Intercalated Graphene Oxide. Enzymatic Oxidation of Graphene Oxide. ACS Nano 2011, 5, 2098− Chem. Mater. 2012, 24, 1276−1282. 2108. (37) Xu, Y.; Bai, H.; Lu, G.; Li, C.; Shi, G. Flexible Graphene Films Via (19) Newman, L.; Lozano, N.; Zhang, M.; Iijima, S.; Yudasaka, M.; the Filtration of Water-Soluble Noncovalent Functionalized Graphene Bussy, C.; Kostarelos, K. Hypochlorite Degrades 2D Graphene Oxide Sheets. J. Am. Chem. Soc. 2008, 130, 5856−5857. Sheets Faster Than 1D Oxidised Carbon Nanotubes and Nanohorns. (38) Raghav, N.; Chakraborty, S.; Maiti, P. K. Molecular Mechanism npj 2D Mater. Appl. 2017, 1, 39. of Water Permeation In a Helium Impermeable Graphene and (20) Bai, H.; Jiang, W.; Kotchey, G. P.; Saidi, W. A.; Bythell, B. J.; Graphene Oxide Membrane. Phys. Chem. Chem. Phys. 2015, 17, Jarvis, J. M.; Marshall, A. G.; Robinson, R. A.; Star, A. Insight Into the 20557−20562. 10184 https://dx.doi.org/10.1021/acsnano.0c03438 ACS Nano 2020, 14, 10168−10186 ACS Nano www.acsnano.org Article (39) Vranic, S.; Rodrigues, A. F.; Buggio, M.; Newman, L.; White, M. (58) Gottlieb, Y.; Topaz, O.; Cohen, L. A.; Yakov, L. D.; Haber, T.; R. H.; Spiller, D. G.; Bussy, C.; Kostarelos, K. Live Imaging of Label- Morgenstern, A.; Weiss, A.; Chait Berman, K.; Fibach, E.; Meyron- Free Graphene Oxide Reveals Critical Factors Causing Oxidative- Holtz, E. G. Physiologically Aged Red Blood Cells Undergo Stress-Mediated Cellular Responses. ACS Nano 2018, 12, 1373−1389. Erythrophagocytosis In Vivo But Not In Vitro. Haematologica 2012, (40) Chen, S.; Xiong, C.; Liu, H.; Wan, Q.; Hou, J.; He, Q.; Badu- 97, 994−1002. Tawiah, A.; Nie, Z. Mass Spectrometry Imaging Reveals the Sub-Organ (59) Knutson, M.; Wessling-Resnick, M. Iron Metabolism In the Distribution of Carbon Nanomaterials. Nat. Nanotechnol. 2015, 10, Reticuloendothelial System. Crit. Rev. Biochem. Mol. Biol. 2003, 38, 61− 176−182. 88. (41) Copeland, S.; Warren, H. S.; Lowry, S. F.; Calvano, S. E.; Remick, (60) Kohyama, M.; Ise, W.; Edelson, B. T.; Wilker, P. R.; Hildner, K.; D. Acute Inflammatory Response To Endotoxin In Mice and Humans. Mejia, C.; Frazier, W. A.; Murphy, T. L.; Murphy, K. M. Role for Spi-C Clin. Diagn. Lab. Immunol. 2005, 12, 60−67. In the Development of Red Pulp Macrophages and Splenic Iron (42) Sasidharan, A.; Swaroop, S.; Koduri, C. K.; Girish, C. M.; Homeostasis. Nature 2009, 457, 318−321. Chandran, P.; Panchakarla, L. S.; Somasundaram, V. H.; Gowd, G. S.; (61) Franken, L.; Klein, M.; Spasova, M.; Elsukova, A.; Wiedwald, U.; Nair, S.; Koyakutty, M. Comparative In Vivo Toxicity, Organ Welz, M.; Knolle, P.; Farle, M.; Limmer, A.; Kurts, C. Splenic Red Pulp Biodistribution and Immune Response of Pristine, Carboxylated and Macrophages are Intrinsically Superparamagnetic and Contaminate Pegylated Few-Layer Graphene Sheets In Swiss Albino Mice: A Three Magnetic Cell Isolates. Sci. Rep. 2015, 5, 12940. Month Study. Carbon 2015, 95, 511−524. (62) Nolan, Y.; Vereker, E.; Lynch, A. M.; Lynch, M. A. Evidence That (43) Qu, G.; Wang, X.; Liu, Q.; Liu, R.; Yin, N.; Ma, J.; Chen, L.; He, Lipopolysaccharide-Induced Cell Death Is Mediated By Accumulation J.; Liu, S.; Jiang, G. The Ex Vivo and In Vivo Biological Performances of of Reactive Oxygen Species and Activation of P38 In Rat Cortex and Graphene Oxide and the Impact of Surfactant On Graphene Oxide’s Hippocampus. Exp. Neurol. 2003, 184, 794−804. Biocompatibility. J. Environ. Sci. 2013, 25, 873−881. (63) Wu, H.; Shi, H.; Wang, Y.; Jia, X.; Tang, C.; Zhang, J.; Yang, S. (44) Yang, K.; Gong, H.; Shi, X.; Wan, J.; Zhang, Y.; Liu, Z. In Vivo Hyaluronic Acid Conjugated Graphene Oxide for Targeted Drug Biodistribution and Toxicology of Functionalized Nano-Graphene Delivery. Carbon 2014, 69, 379−389. Oxide in Mice After Oral and Intraperitoneal Administration. (64) Kanakia, S.; Toussaint, J. D.; Mullick Chowdhury, S.; Tembulkar, Biomaterials 2013, 34, 2787−2795. T.; Lee, S.; Jiang, Y. P.; Lin, R. Z.; Shroyer, K. R.; Moore, W.; (45) Wang, X.; Podila, R.; Shannahan, J. H.; Rao, A. M.; Brown, J. M. Sitharaman, B. Dose Ranging, Expanded Acute Toxicity and Safety Intravenously Delivered Graphene Nanosheets and Multiwalled Pharmacology Studies for Intravenously Administered Functionalized Carbon Nanotubes Induce Site-Specific Th2 Inflammatory Responses Graphene Nanoparticle Formulations. Biomaterials 2014, 35, 7022− Via the Il-33/St2 Axis. Int. J. Nanomed. 2013, 8, 1733−1748. 7031. (46) Li, B.; Yang, J.; Huang, Q.; Zhang, Y.; Peng, C.; Zhang, Y.; He, Y.; (65) Nurunnabi, M.; Khatun, Z.; Huh, K. M.; Park, S. Y.; Lee, D. Y.; Shi, J.; Li, W.; Hu, J.; Fan, C. Biodistribution and Pulmonary Toxicity of Cho, K. J.; Lee, Y.-k. In Vivo Biodistribution and Toxicology of Intratracheally Instilled Graphene Oxide In Mice. NPG Asia Mater. Carboxylated Graphene Quantum Dots. ACS Nano 2013, 7, 6858− 2013, 5, No. e44. 6867. (47) Suttie, A. W. Histopathology of the Spleen. Toxicol. Pathol. 2006, (66) Chong, Y.; Ma, Y.; Shen, H.; Tu, X.; Zhou, X.; Xu, J.; Dai, J.; Fan, 34, 466−503. S.; Zhang, Z. The In Vitro and In Vivo Toxicity of Graphene Quantum (48) Masuda, T.; Satodate, R.; Tsuruga, K.; Kasai, T. Quantitative Dots. Biomaterials 2014, 35, 5041−5048. Assessment of a Change of Hemosiderin Deposition With Age In (67) Zhang, D.; Zhang, Z.; Liu, Y.; Chu, M.; Yang, C.; Li, W.; Shao, Y.; Splenic Compartments of Rats. Tohoku J. Exp. Med. 1993, 170, 169− Yue, Y.; Xu, R. The Short- and Long-Term Effects of Orally 179. (49) Wen, K. P.; Chen, Y. C.; Chuang, C. H.; Chang, H. Y.; Lee, C. Y.; Administered High-Dose Reduced Graphene Oxide Nanosheets On Tai, N. H. Accumulation and Toxicity of Intravenously-Injected Mouse Behaviors. Biomaterials 2015, 68, 100−113. (68) de Porto, A. P. N. A.; Lammers, A. J. J.; Bennink, R. J.; ten Berge, Functionalized Graphene Oxide In Mice. J. Appl. Toxicol. 2015, 35, 1211−1218. I. J. M.; Speelman, P.; Hoekstra, J. B. L. Assessment of Splenic Function. (50) Sharron, M.; Hoptay, C. E.; Wiles, A. A.; Garvin, L. M.; Geha, M.; Eur. J. Clin. Microbiol. Infect. Dis. 2010, 29, 1465−1473. Benton, A. S.; Nagaraju, K.; Freishtat, R. J. Platelets Induce Apoptosis (69) Langeveld, M.; Gamadia, L. E.; ten Berge, I. J. T-lymphocyte During Sepsis In a Contact-Dependent Manner That Is Inhibited By Subset Distribution In Human Spleen. Eur. J. Clin. Invest. 2006, 36, GPIIB/IIIA Bockade. PLoS One 2012, 7, No. e41549. 250−256. (51) Figgett, W. A.; Fairfax, K.; Vincent, F. B.; Le Page, M. A.; Katik, I.; (70) Orecchioni, M.; Jasim, D. A.; Pescatori, M.; Manetti, R.; Fozza, Deliyanti, D.; Quah, P. S.; Verma, P.; Grumont, R.; Gerondakis, S.; C.; Sgarrella, F.; Bedognetti, D.; Bianco, A.; Kostarelos, K.; Delogu, L. Hertzog, P.; O’Reilly, L. A.; Strasser, A.; Mackay, F. The TACI G. Molecular and Genomic Impact of Large and Small Lateral Receptor Regulates T-Cell-Independent Marginal Zone B Cell Dimension Graphene Oxide Sheets On Human Immune Cells From Responses Through Innate Activation-Induced Cell Death. Immunity Healthy Donors. Adv. Healthcare Mater. 2016, 5, 276−287. 2013, 39, 573−583. (71) Sydlik, S. A.; Jhunjhunwala, S.; Webber, M. J.; Anderson, D. G.; (52) Schnitzer, B.; Rucknagel, D. L.; Spencer, H. H.; Aikawa, M. Langer, R. In Vivo Compatibility of Graphene Oxide With Differing Erythrocytes: Pits and Vacuoles as Seen With Transmission and Oxidation States. ACS Nano 2015, 9, 3866−3874. Scanning Electron Microscopy. Science 1971, 173, 251−252. (72) Assoian, R. K.; Fleurdelys, B. E.; Stevenson, H. C.; Miller, P. J.; (53) Holroyde, C. P.; Gardner, F. H. Acquisition of Autophagic Madtes, D. K.; Raines, E. W.; Ross, R.; Sporn, M. B. Expression and Vacuoles By Human Erythrocytes. Physiological Role of the Spleen. Secretion of Type Beta Transforming Growth Factor By Activated Blood 1970, 36, 566−575. Human Macrophages. Proc. Natl. Acad. Sci. U. S. A. 1987, 84, 6020− (54) Dameshek, W. Hypersplenism. Bull. N. Y. Acad. Med. 1955, 31, 6024. 113−136. (73) Said, E. A.; Dupuy, F. P.; Trautmann, L.; Zhang, Y.; Shi, Y.; El- (55) William, B. M.; Corazza, G. R. Hyposplenism: A Comprehensive Far, M.; Hill, B. J.; Noto, A.; Ancuta, P.; Peretz, Y.; Fonseca, S. G.; Van Review. Part I: Basic Concepts and Causes. Hematology 2007, 12, 1−13. Grevenynghe, J.; Boulassel, M. R.; Bruneau, J.; Shoukry, N. H.; Routy, (56) Doll, D. C.; List, A. F.; Yarbro, J. W. Functional Hyposplenism. J.-P.; Douek, D. C.; Haddad, E. K.; Sekaly, R.-P. Programmed Death-1- South. Med. J. 1987, 80, 999−1006. Induced Interleukin-10 Production By Monocytes Impairs CD4+ T (57) Russell, E. S.; Neufeld, E. F.; Higgins, C. T. Comparison of Cell Activation During HIV Infection. Nat. Med. 2010, 16, 452−459. Normal Blood Picture of Young Adults From 18 Inbred Strains of Mice. (74) Lopez-Castejon, G.; Brough, D. Understanding the Mechanism Exp. Biol. Med. 1951, 78, 761−766. of IL-1Beta Secretion. Cytokine Growth Factor Rev. 2011, 22, 189−195. 10185 https://dx.doi.org/10.1021/acsnano.0c03438 ACS Nano 2020, 14, 10168−10186 ACS Nano www.acsnano.org Article (75) Malstrom, C.; James, S. Inhibition of Murine Splenic and (94) Hirayama, D.; Iida, T.; Nakase, H. The Phagocytic Function of Mucosal Lymphocyte Function By Enteric Bacterial Products. Infect. Macrophage-Enforcing Innate Immunity and Tissue Homeostasis. Int. Immun. 1998, 66, 3120−3127. J. Mol. Sci. 2018, 19, 92. (76) Ertel, W.; Kremer, J. P.; Kenney, J.; Steckholzer, U.; Jarrar, D.; (95) Kagan, V. E.; Konduru, N. V.; Feng, W.; Allen, B. L.; Conroy, J.; Trentz, O.; Schildberg, F. W. Downregulation of Proinflammatory Volkov, Y.; Vlasova, I. I.; Belikova, N. A.; Yanamala, N.; Kapralov, A.; Cytokine Release In Whole Blood From Septic Patients. Blood 1995, Tyurina, Y. Y.; Shi, J.; Kisin, E. R.; Murray, A. R.; Franks, J.; Stolz, D.; 85, 1341−1347. Gou, P.; Klein-Seetharaman, J.; Fadeel, B.; Star, A.; et al. Carbon (77) Trinschek, B.; Luessi, F.; Haas, J.; Wildemann, B.; Zipp, F.; Nanotubes Degraded By Neutrophil Myeloperoxidase Induce Less Wiendl, H.; Becker, C.; Jonuleit, H. Kinetics of IL-6 Production Defines Pulmonary Inflammation. Nat. Nanotechnol. 2010, 5, 354−359. T Effector Cell Responsiveness To Regulatory T Cells In Multiple (96) Osmond-McLeod, M. J.; Poland, C. A.; Murphy, F.; Waddington, Sclerosis. PLoS One 2013, 8, No. e77634. L.; Morris, H.; Hawkins, S. C.; Clark, S.; Aitken, R.; McCall, M. J.; (78) Seiler, P.; Aichele, P.; Odermatt, B.; Hengartner, H.; Zinkernagel, Donaldson, K. Durability and Inflammogenic Impact of Carbon Nanotubes Compared With Asbestos Fibres. Part. Fibre Toxicol. 2011, R. M.; Schwendener, R. A. Crucial Role of Marginal Zone Macrophages 8, 15. and Marginal Zone Metallophils In the Clearance of Lymphocytic (97) Sahadev, N.; Anappara, A. A. Enhanced Photothermal Effect In Choriomeningitis Virus Infection. Eur. J. Immunol. 1997, 27, 2626− Reduced Graphene Oxide In Solid-State. J. Appl. Phys. 2017, 122, 2633. 185103. (79) Gherman, C.; Tudor, M. C.; Constantin, B.; Flaviu, T.; Stefan, R.; (98) Wu, J.; Li, Z.; Li, Y.; Pettitt, A.; Zhou, F. Photothermal Effects of Maria, B.; Chira, S.; Braicu, C.; Pop, L.; Petric, R. C.; Berindan-Neagoe, Reduced Graphene Oxide On Pancreatic Cancer Technol. Cancer Res. I. Pharmacokinetics Evaluation of Carbon Nanotubes Using FTIR Treat. 2018, 17 DOI: 10.1177/1533034618768637. Analysis and Histological Analysis. J. Nanosci. Nanotechnol. 2015, 15, (99) Russier, J.; Oudjedi, L.; Piponnier, M.; Bussy, C.; Prato, M.; 2865−2869. Kostarelos, K.; Lounis, B.; Bianco, A.; Cognet, L. Direct Visualization of (80) Birjandi, S. Z.; Ippolito, J. A.; Ramadorai, A. K.; Witte, P. L. Carbon Nanotube Degradation In Primary Cells By Photothermal Alterations in Marginal Zone Macrophages and Marginal Zone B Cells Imaging. Nanoscale 2017, 9, 4642−4645. In Old Mice. J. Immunol. 2011, 186, 3441−3451. (100) Lee, J.; Lilly, G. D.; Doty, R. C.; Podsiadlo, P.; Kotov, N. A. In (81) Schultz, Z. D.; Stranick, S. J.; Levin, I. W. Tip Enhanced Raman Vitro Toxicity Testing of Nanoparticles In 3D Cell Culture. Small 2009, Spectroscopy and Imaging: An Apical Illumination Geometry. Appl. 5, 1213−1221. Spectrosc. 2008, 62, 1173−1179. (101) Nunes, A. S.; Barros, A. S.; Costa, E. C.; Moreira, A. F.; Correia, (82) Anselmo, A. C.; Gupta, V.; Zern, B. J.; Pan, D.; Zakrewsky, M.; I. J. 3D Tumor Spheroids as In Vitro Models to Mimic In Vivo Human Muzykantov, V.; Mitragotri, S. Delivering Nanoparticles To Lungs Solid Tumors Resistance To Therapeutic Drugs. Biotechnol. Bioeng. While Avoiding Liver and Spleen Through Adsorption On Red Blood 2019, 116, 206−226. Cells. ACS Nano 2013, 7, 11129−11137. (102) Curcio, A.; Van de Walle, A.; Serrano, A.; Preveral, S.; Péchoux, (83) Wang, J.; Ma, H.; Boor, P. J.; Ramanujam, V. M. S.; Ansari, G. A. C.; Pignol, D.; Menguy, N.; Lefevre, C. T.; Espinosa, A.; Wilhelm, C. S.; Khan, M. F. Up-Regulation of Heme Oxygenase-1 in Rat Spleen Transformation Cycle of Magnetosomes In Human Stem Cells: From After Aniline Exposure. Free Radical Biol. Med. 2010, 48, 513−518. Degradation To Biosynthesis of Magnetic Nanoparticles Anew. ACS (84) Ferrari, A. C.; Robertson, J. Interpretation of Raman Spectra of Nano 2020, 14, 1406−1417. Disordered and Amorphous Carbon. Phys. Rev. B: Condens. Matter (103) Lammers, T.; Kiessling, F.; Hennink, W. E.; Storm, G. Drug Targeting To Tumors: Principles, Pitfalls and (Pre-) Clinical Progress. Mater. Phys. 2000, 61, 14095−14107. J. Controlled Release 2012, 161, 175−187. (85) Thomsen, C.; Reich, S. Double Resonant Raman Scattering In (104) Lipson, R. L.; Bayrd, E. D.; Watkins, C. H. The Graphite. Phys. Rev. Lett. 2000, 85, 5214−5217. Postsplenectomy Blood Picture. Am. J. Clin. Pathol. 1959, 32, 526−532. (86) Ali-Boucetta, H.; Bitounis, D.; Raveendran-Nair, R.; Servant, A.; Van den Bossche, J.; Kostarelos, K. Graphene Oxide: Purified Graphene NOTE ADDED AFTER ASAP PUBLICATION Oxide Dispersions Lack In Vitro Cytotoxicity and In Vivo Pathogenicity. Adv. Healthcare Mater. 2013, 2, 433−441. This paper was published ASAP on July 28, 2020. The caption to (87) Tuinstra, F.; Koenig, J. L. Raman Spectrum of Graphite. J. Chem. Figure 5 was corrected. The revised paper was reposted on Phys. 1970, 53, 1126−1130. August 11, 2020. (88) Chen, X.; Chen, B. Direct Observation, Molecular Structure, and Location of Oxidation Debris On Graphene Oxide Nanosheets. Environ. Sci. Technol. 2016, 50, 8568−8577. (89) Lucchese, M. M.; Stavale, F.; Ferreira, E. H. M.; Vilani, C.; Moutinho, M. V. O.; Capaz, R. B.; Achete, C. A.; Jorio, A. Quantifying Ion-Induced Defects and Raman Relaxation Length In Graphene. Carbon 2010, 48, 1592−1597. (90) Mukherjee, S. P.; Gliga, A. R.; Lazzaretto, B.; Brandner, B.; Fielden, M.; Vogt, C.; Newman, L.; Rodrigues, A. F.; Shao, W.; Fournier, P. M.; Toprak, M. S.; Star, A.; Kostarelos, K.; Bhattacharya, K.; Fadeel, B. Graphene Oxide Is Degraded By Neutrophils and the Degradation Products are Non-Genotoxic. Nanoscale 2018, 10, 1180− 1188. (91) Smith, B. W.; Luzzi, D. E. Electron Irradiation Effects In Single Wall Carbon Nanotubes. J. Appl. Phys. 2001, 90, 3509−3515. (92) Elgrabli, D.; Dachraoui, W.; Ménard-Moyon, C.; Liu, X. J.; Bégin, D.; Bégin-Colin, S.; Bianco, A.; Gazeau, F.; Alloyeau, D. Carbon Nanotube Degradation In Macrophages: Live Nanoscale Monitoring and Understanding of Biological Pathway. ACS Nano 2015, 9, 10113− 10124. (93) Yang, M.; Zhang, M. Biodegradation of Carbon Nanotubes By Macrophages. Front. Mater. 2019, 6, DOI: 10.3389/fmats.2019.00225. 10186 https://dx.doi.org/10.1021/acsnano.0c03438 ACS Nano 2020, 14, 10168−10186