ORIGINAL RESEARCH published: 31 July 2020 doi: 10.3389/fpls.2020.01156 KatE From the Bacterial Plant Pathogen Ralstonia solanacearum Is a Monofunctional Catalase Controlled by HrpG That Plays a Major Role in Bacterial Survival to Hydrogen Peroxide Marı́a Laura Tondo 1,2†, Roger de Pedro-Jové 3,4†, Agustina Vandecaveye 5, Edited by: Benjamin Gourion, Laura Piskulic 6, Elena G. Orellano 1,5* and Marc Valls 3,4* UMR2594 Laboratoire Interactions 1 Área Biologı´a Molecular, Facultad de Ciencias Bioquı´micas y Farmacéuticas, Universidad Nacional de Rosario, Rosario, Plantes-Microorganismes (LIPM), France Argentina, 2 Instituto de Ingenierı´a Ambiental, Quı´mica y Biotecnologı´a Aplicada (INGEBIO), Facultad de Quı´mica e Ingenierı´a del Reviewed by: Rosario, Pontificia Universidad Católica Argentina (UCA), Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET), Anna Katherine Block, Rosario, Argentina, 3 Centre for Research in Agricultural Genomics (CSIC-IRTA-UAB-UB), Catalonia, Spain, 4 Department of Center for Medical, Agricultural and Genetics, University of Barcelona, Barcelona, Spain, 5 Instituto de Biologı´a Molecular y Celular de Rosario, Consejo Nacional de Veterinary Entomology, United States Investigaciones Cientı´ficas y Técnicas (CONICET), Rosario, Argentina, 6 Área Estadı´stica y Procesamiento de Datos, Facultad de Claudia S. L. Vicente, Ciencias Bioquı´micas y Farmacéuticas, Universidad Nacional de Rosario, Rosario, Argentina Instituto Nacional Investigaciao Agraria e Veterinaria (INIAV), Portugal Ralstonia solanacearum is the causative agent of bacterial wilt disease on a wide range of *Correspondence: Elena G. Orellano plant species. Besides the numerous bacterial activities required for host invasion, those orellano@ibr-conicet.gov.ar involved in the adaptation to the plant environment are key for the success of infection. R. Marc Valls marcvalls@ub.edu solanacearum ability to cope with the oxidative burst produced by the plant is likely one of † These authors have contributed the activities required to grow parasitically. Among the multiple reactive oxygen species equally to this work (ROS)-scavenging enzymes predicted in the R. solanacearum GMI1000 genome, a single monofunctional catalase (KatE) and two KatG bifunctional catalases were identified. In this Specialty section: This article was submitted to work, we show that these catalase activities are active in bacterial protein extracts and Plant Pathogen Interactions, demonstrate by gene disruption and mutant complementation that the monofunctional a section of the journal catalase activity is encoded by katE. Different strategies were used to evaluate the role of Frontiers in Plant Science KatE in bacterial physiology and during the infection process that causes bacterial wilt. We Received: 21 May 2020 Accepted: 16 July 2020 show that the activity of the enzyme is maximal during exponential growth in vitro and this Published: 31 July 2020 growth-phase regulation occurs at the transcriptional level. Our studies also demonstrate Citation: that katE expression is transcriptionally activated by HrpG, a central regulator of R. Tondo ML, de Pedro-Jové R, Vandecaveye A, Piskulic L, solanacearum induced upon contact with the plant cells. In addition, we reveal that even Orellano EG and Valls M (2020) KatE though both KatE and KatG catalase activities are induced upon hydrogen peroxide From the Bacterial Plant Pathogen treatment, KatE has a major effect on bacterial survival under oxidative stress conditions Ralstonia solanacearum Is a Monofunctional Catalase Controlled and especially in the adaptive response of R. solanacearum to this oxidant. The katE by HrpG That Plays a Major Role in mutant strain also exhibited differences in the structural characteristics of the biofilms Bacterial Survival to Hydrogen Peroxide. Front. Plant Sci. 11:1156. developed on an abiotic surface in comparison to wild-type cells, but not in the overall doi: 10.3389/fpls.2020.01156 amount of biofilm production. The role of catalase KatE during the interaction with its host Frontiers in Plant Science | www.frontiersin.org 1 July 2020 | Volume 11 | Article 1156 Tondo et al. Ralstonia solanacearum KatE Catalase plant tomato is also studied, revealing that disruption of this gene has no effect on R. solanacearum virulence or bacterial growth in leave tissues, which suggests a minor role for this catalase in bacterial fitness in planta. Our work provides the first characterization of the R. solanacearum catalases and identifies KatE as a bona fide monofunctional catalase with an important role in bacterial protection against oxidative stress. Keywords: Ralstonia solanacearum, bacterial wilt, oxidative burst, KatE catalase, host adaptation INTRODUCTION cultivar, while a bi-phasic ROS generation with peak levels at 12 and 36 hpi was observed after infection of a resistant tomato Ralstonia solanacearum is a gram-negative, soil-borne b- variety (Mandal et al., 2011). The second phase of ROS proteobacterium that causes the bacterial wilt disease in more accumulation, usually more prolonged and higher in than 200 plant species, including economically important food magnitude, has been correlated with disease resistance via the crops such as potato, tomato, peanut, and eggplant (Allen et al., hypersensitive response during incompatible and non-host 2004). In addition to its extremely wide host range, R. interactions (Lamb and Dixon, 1997). solanacearum exhibits an increasingly broad geographic The oxidative burst fulfils multiple functions to plant cells distribution and is able to survive for long periods in undergoing pathogen attack. ROS promote the oxidative cross- waterways, soil and in symptomless or latently infected plants linking of plant cell walls to slow pathogen entry and spread, and (Denny, 2006; Genin and Denny, 2012). act as key signal molecules that mediate the activation of plant Upon interaction with a susceptible host, the pathogen defence responses and systemic resistance (Lamb and Dixon, initiates the infection by entering the roots. After colonisation 1997). In addition, the high reactivity of ROS with cellular of the intercellular spaces of the root cortex, the bacterium enters macromolecules, including DNA and proteins, make ROS the xylem vessels, spreading rapidly, and systemically through effective antimicrobial agents capable of either killing the the vascular system. Intensive bacterial multiplication and pathogen or slowing down its growth (Peng and Kuc, 1992). production of large amounts of exopolysaccharides (EPSs) To counter-attack ROS, oxidative stress response genes were blocks water traffic in vascular bundles, ultimately resulting in shown to be expressed in plant-associated bacteria during the complete wilting, plant death, and the release of the pathogen interaction with their hosts (Smith et al., 1996; Santos et al., 2001; back to the soil (Genin and Denny, 2012). R. solanacearum Okinaka et al., 2002; Saenkham et al., 2007; Tamir-Ariel et al., requires multiple virulence factors that act additively to facilitate 2007). Particularly, an in vivo expression technology (IVET) infection of the host plant. Bacterial motility mediated by flagella screen performed in R. solanacearum during pathogenesis of and type IV pili, plant cell wall-degrading enzymes, and type II- tomato plants revealed that at least 15 out of 153 in planta- secreted proteins enable bacterial penetration into root tissues. expressed genes encoded proteins involved in the oxidative stress Secretion of type III effectors inside plant cells evades plant response, further supporting the notion that an oxidative immune responses and allows disease development (Peeters challenge is associated with plant infection (Brown and Allen, et al., 2013). In the plant environment, R. solanacearum must 2004; Flores-Cruz and Allen, 2009). overcome different types of metabolic stresses in order to survive Hydrogen peroxide (H2O2), the major ROS of the oxidative and proliferate. One of these challenges is the exposure to plant- burst, is an electrically neutral and relatively stable species that generated reactive oxygen species (ROS) that accumulate in the can penetrate through cell membranes and diffuse to reach apoplast as part of the primary defence response to pathogen distant cellular components (Wojtaszec, 1997). H 2 O 2 invasion (Lamb and Dixon, 1997). concentrations must be kept at low levels inside bacterial cells ROS are unavoidable by-products of plant metabolic due to its ability to oxidize ferrous ions to generate highly pathways generated as a result of successive one-electron reactive hydroxyl radicals (·OH; Fenton reaction), and to react reductions of molecular oxygen (O2). Under physiological with iron-sulphur clusters of key metabolic enzymes (Mishra and steady state conditions, ROS accumulation is prevented by the Imlay, 2012). Among the bacterial enzymes evolved to remove action of protective antioxidant systems often confined to ROS and avoid toxicity, catalases (E.C. 1.11.1.6; H2O2:H2O2 specific compartments. However, adverse environmental oxidoreductase) constitute the primary scavengers of H2O2 by factors including pathogen infection disturb this fine balance catalyzing its dismutation to water and oxygen. Based on between production and scavenging of ROS leading to a rapid phylogenetic analyses, three distinct catalase families can be increase in intracellular ROS levels or “oxidative burst” (Apel distinguished: typical (monofunctional) heme catalases (KatEs), and Hirt, 2004). In plants challenged with pathogenic bifunctional heme catalase-peroxidases (KatGs), and (non- microorganisms, including fungi, bacteria, and viruses, the heme) manganese catalases (MnCats) (Zá mocky et al., 2012). oxidative burst proved to be one of the earliest events after Most sequenced bacterial genomes encode multiple catalase elicitation (Wojtaszek, 1997). In the interaction of R. isozymes that operate in different physiological or environmental solanacearum with tomato plants, a single-phase ROS increase conditions (Mishra and Imlay, 2012). Induction of specific catalases was detected at 24 h post-inoculation (hpi) of a susceptible has been observed when bacteria detect environmental ROS and Frontiers in Plant Science | www.frontiersin.org 2 July 2020 | Volume 11 | Article 1156 Tondo et al. Ralstonia solanacearum KatE Catalase upon entry into the stationary phase (Loewen, 1997; Mishra and catalases are up-regulated by the transcriptional regulator OxyR, Imlay, 2012). In addition, recent reports have demonstrated the whose deletion impaired bacterial virulence (Flores-Cruz and role of particular catalases during pathogenesis, enhancing the Allen, 2011). These observations collectively suggest a role for bacterial ability to overcome host-induced oxidative burst catalases during the infection process, but the contribution of (Jittawuttipoka et al., 2009; Tondo et al., 2010; Mishra and Imlay, these enzymes to bacterial wilt disease has not been investigated. 2012). The available R. solanacearum GMI1000 genome encodes Here we present a thorough study of the R. solanacearum numerous predicted ROS-scavenging enzymes, including three KatE. We prove that this gene encodes a bona fide catalase putative catalases. The RSc0775 (KatGb) and RSc0776 (KatGa) enzyme responsible for one of the two catalase activities detected open reading frames (ORFs) encode predicted bifunctional in this pathogen, describe its expression pattern and study its role catalase-peroxidases in the bacterial chromosome; whereas during bacterial life in planta. RSp1581 (KatE) codes for a predicted typical monofunctional catalase and is located in the megaplasmid, which harbors most R. solanacearum pathogenicity functions (Salanoubat et al., 2002; MATERIALS AND METHODS Genin and Denny, 2012). Our previous transcriptomic studies in R. solanacearum Bacterial Strains, Plasmids, and Growth extracted from roots of early infected potato plants indicated Conditions that the transcription of katE and, to a lesser extent, katGb is Relevant characteristics of the plasmids and bacterial strains used induced during plant colonisation compared to growth in rich in this work are described in Table 1. The wild-type strain medium (Puigvert et al., 2017). We also identified katE among GMI1000 of R. solanacearum and its hrpG-derivative have been the genes specifically induced by HrpG, a key R. solanacearum previously described (Boucher et al., 1985; Valls et al., 2006). The pathogenicity regulator that responds to direct bacterial contact complemented (DhrpG + hrpG) strain was obtained by with plant cells (Valls et al., 2006). In addition, R. solanacearum electroporation of the DhrpG mutant with pLT-HrpG, a vector TABLE 1 | Bacterial strains, plasmids, and primers used in this study. Strain/plasmid Relevant genotype and description Source/reference Ralstonia solanacearum GMI1000 Wild-type strain Boucher et al., 1985 DkatE katE deletion mutant in the GMI1000 background, Gmr This study DkatE + katE DkatE strain complemented with katE from pRCT-katE, Gmr, Tcr This study DhrpG hrpG deletion mutant in the GMI1000 background Valls et al., 2006 DhrpG + hrpG DhrpG strain complemented with the overexpressing plasmid pLT-HrpG, Tcr This study Escherichia coli JM109 HsdR17 endA1 recal thi gyrA96 relA1 recA1 supE44 Promega Corp. l-D(lac-proAB), [F’, traD36, proA+B+, lacIqZDM15] Plasmids pGEM-T Easy PCR cloning and sequencing vector, Apr Promega Corp. pGEM-UkatE PCR-amplified (945-bp) katE upstream fragment, cloned in pGEM-T easy, Apr This study pGEM-DkatE PCR-amplified (892-bp) katE downstream fragment, cloned in pGEM-T easy, Apr This study pCM351 Allelic exchange vector, Apr, Tcr, Gmr Marx and Lidstrom, 2002 pCM-UDkatE Upstream (945-bp) and downstream (892-bp) fragments of katE cloned into EcoRI/NotI and This study HpaI/SacI sites of pCM351, Apr, Tcr, Gmr pRCT pRC containing tetracycline resistance and cloning sites, Apr, Clr, Tcr Monteiro et al., 2012b pRCT-katE PCR-amplified (1960-bp) fragment containing katE ORF and promoter sequence, cloned into HpaI/BglII This study sites of pRCT, Apr, Clr, Tcr pLT-HrpG pLAFR3 derivative including the HrpG coding sequence under the control of the Ptac promoter Valls et al., 2006 pJBA128 Vector containing gfpmut3 under a constitutive PlacUV5 promoter, Tcr Lee et al., 2005 Primer name Sequencea Amplified fragment katEU-F 5’ tagaattcGGATACTGACCGTTGCCATC 3’ (EcoRI) This study katEU-R 5’ tagcggccgcGAGTCTCCTGTGGGGATGAG 3’ (NotI) This study katED-F 5’ tagttaacGCTGCAGGACTGATGATGTG 3’ (HpaI) This study katED-R 5’ tagagctcGGTCACGGATATCGAACCAC 3’ (SacI) This study UkatEU-F 5’ GAATGCTTTCCGCCTTGATATC 3’ This study Gent-R 5’ CCTGCTGCGTAACATCGTTGC 3’ This study ckatE-F 5’ tagttaacTGTTTGAAGACGGTGACGTT 3’ (HpaI) This study ckatE-R 5’ taagatctTCAGTCCTGCAGCTTCG 3’ (BglII) This study katE_qPCR-F 5’ TGAACAAGAACCCGGAGAAC 3’ This study katE_qPCR-R 5’ TGTCGGCATACGAGAAGATG 3’ This study Apr, Gmr, Tcr: resistance to ampicillin (Ap), gentamicin (Gm) and tetracycline (Tc), respectively; PCR, polymerase chain reaction. a Capital letters correspond to nucleotides of the R. solanacearum GMI1000 genome sequence and small letters to nucleotides added to facilitate cloning (restriction sites underlined). Frontiers in Plant Science | www.frontiersin.org 3 July 2020 | Volume 11 | Article 1156 Tondo et al. Ralstonia solanacearum KatE Catalase that overexpress HrpG from the isopropyl-b-D-thiogalactopyranoside into pGEM-T easy (Promega Corp.) creating pGEM-UkatE and (IPTG)-inducible Ptac promoter. The plasmid and transformation pGEM-DkatE for the upstream and downstream regions of the procedures are described in (Valls et al., 2006). R. solanacearum katE gene, respectively; and the identity of the inserts were strains were routinely grown at 28°C in tetrazolium chloride (TZC) confirmed by sequencing with vector primers SP6 and T7. agar plates (Kelman, 1954), complete BG medium (10 g/L Inserts were then excised by double digestion with EcoRI/NotI bactopeptone, 1 g/L yeast extract, 1 g/L casamino acids, 0.5% (upstream region) and HpaI/SacI (downstream region), and glucose), or MP minimal medium supplemented with 20 mM L- inserted into the multiple cloning sites of pCM351 (Marx and glutamate as a carbon source (Plener et al., 2010). To induce HrpG Lidstrom, 2002) on both sides of the gentamicin resistance expression in the complemented DhrpG + hrpG strain IPTG was cassette, creating pCM-UDkatE. This construction was then added to the cultures at a final concentration of 100 mM. Gentamicin linearized by EcoRI and introduced into the wild type R. and tetracycline were used for selection of R. solanacearum strains (5 solanacearum GMI1000 by natural transformation following the and 10 µg/mL in liquid and solid cultures, respectively). Bacterial protocol described by Boucher and associates (Boucher et al., growth was monitored by measuring optical density at 600 nm. 1985). Double recombination events were selected by gentamicin Escherichia coli strains were grown at 37°C in Luria-Bertani (LB) resistance on TZC agar plates and the correct insertion in the broth supplemented with appropriate antibiotics (Sambrook and genome was confirmed by PCR using primers UkatEU-F and Russell, 2001). Gent-R, which hybridize upstream of the upper region used for the homologous recombination and in the gentamicin resistance Molecular Biology and Microbiological cassette, respectively (Table 1). This mutant strain, denoted as DkatE, was used for phenotypic characterization. Techniques For DkatE complementation, a 1960-bp DNA fragment Molecular cloning procedures, including DNA restriction and containing the katE coding region and extending 430 pb analysis, DNA ligation, preparation of competent cells, and upstream of the 5’ end of the ORF was PCR amplified with transformation of E. coli by electroporation, were performed primers ckatE-F and ckatE-R (Table 1). The amplified sequence according to standard protocols (Ausubel et al., 1994; Sambrook included the putative promoter region of the katE gene as and Russell, 2001). Plasmid DNA was isolated using Wizard Plus predicted with SoftBerry (www.softberry.com). This amplicon SV Minipreps DNA Purification System (Promega Corp., was double digested with HpaI/BglII and cloned into the Madison, WI). Restriction enzymes, DNA ligase, and other integration element of the suicide vector pRCT (Monteiro DNA enzymes were used according to the manufacturers’ et al., 2012b) to generate recombinant plasmid pRCT-katE. recommendations. Total genomic DNA from R. solanacearum This plasmid was then linearized by NcoI and introduced into was isolated from fresh bacterial cultures as described by Chen the mutant strain DkatE by natural transformation as described and Kuo (Chen and Kuo, 1993). For RNA extraction and above. Complemented strains were selected by tetracycline quantitative real-time PCR analysis, total RNA was extracted resistance on TZC agar plates. The complemented mutant using the SV Total RNA Isolation Kit (Promega) following strain selected for further studies was designated DkatE + katE. manufacturer’s instructions for Gram-negative bacteria. cDNA was synthesized using the High Capacity cDNA reverse Enzyme Activity Assay and Staining transcriptase kit (Applied Biosystems) following manufacturer’s R. solanacearum soluble cell extracts were prepared from 10 mL instructions. The Sybr Green Master Mix (Sigma Aldrich) was used cultures harvested by centrifugation at 4,000 g for 10 min at 4°C. for quantitative real-time PCR with the LightCycler 480 Instrument Bacteria were washed and resuspended in 500 mL of ice-cold (Roche Life Science) using the katE_qPCR-F and katE_qPCR-R 50 mM potassium phosphate buffer (pH 7.0) containing 1 mM oligonucleotides as primers. Per each biological condition, PMSF, and then disrupted by intermittent sonication. Suspensions duplicates were run and the phosphoserine aminotransferase were clarified by centrifugation at 12,000 g for 20 min at 4°C. gene (serC) was used as a reference gene for normalisation of Protein concentrations in soluble cell extracts were determined by expression as described in (Monteiro et al., 2012a). the Sedmak and Grossberg method (Sedmak and Grossberg, 1977) with bovine serum albumin as standard. Catalase activity in cell Construction of the R. solanacearum extracts was monitored through the decomposition of hydrogen DkatE Mutant and Complemented Strain peroxide by following the decrease in absorbance at 240 nm (Beers The R. solanacearum DkatE mutant strain was generated by and Sizer, 1952). The assays were performed at 25°C in 50 mM inserting a gentamicin resistance cassette in substitution of the potassium phosphate buffer (pH 7.0) containing 10 mM H2O2. To open reading frame RSp1581 in the GMI1000 strain. Primers were calculate the catalase specific activity an extinction coefficient of designed in order to amplify 945-bp (primer pair katEU-F/katEU- 43.6 M-1 cm-1 at 240 nm was used. One unit of catalase activity was R) and 892-pb (primer pair katED-F/katED-R) fragments located defined as the amount of activity required to decompose 1 mmol of upstream and downstream of the gene RSp1581, respectively H2O2 per minute under the assay conditions. (Table 1). Specific restriction sites were incorporated to each For evaluation of catalase activity in gels, soluble protein primer to be used in subsequent cloning steps. PCR amplifications extracts (15–25 mg) were separated by continuous electrophoresis were performed with the proofreading Phusion DNA polymerase in 8% (w/v) non-denaturing polyacrylamide gels in glycine buffer (New England Biolabs, Inc., Ipswich, MA, U.S.A.) following the (pH 9.5). To eliminate the likelihood of multiple, potentially manufacturer’s conditions. The resulting fragments were cloned artifactual catalase bands, non-denaturing gels were electrophoresed Frontiers in Plant Science | www.frontiersin.org 4 July 2020 | Volume 11 | Article 1156 Tondo et al. Ralstonia solanacearum KatE Catalase at a constant current of 10 mA. Staining for catalase activity was Biofilm quantification analyses were carried out following performed as previously described (Scandalios, 1968). crystal violet assay. In short, CPG overnight cultures were Peroxidase activity staining was performed according to Kang adjusted in CPG to an OD600 of 0.1. Next, 95 µL of fresh CPG and associates (Kang et al., 1999) with some modifications. and 5 µL of the adjusted culture to OD600 of 0.1 were Briefly, aliquots of cell extracts containing 100 mg of soluble added in each of the 96-well polystyrene microplates (Greiner, protein were electrophoresed on 8% (w/v) native polyacrylamide Kremsmünster, Austria) and incubated without shaking at 30°C gels as previously described. Gels were then incubated in 0.1 M during 24 h. After incubation, biomass growth was measured at Tris-HCl (pH 7.5) containing 0.1 mg/mL 3,3’-diaminobenzidine, OD600. Next, 100 µL of 0.1% crystal violet stain was added to 9 mM H2O2, and 0.4 mg/mL NiCl2 for approximately 30 min in each well and incubated at room temperature for 30 min. Wells the dark, until appearance of the bands. were washed three times with MQ-water and the stained biofilm Coomassie-stained gels were run in parallel to those used for was solubilised with 100 µL of 95% ethanol and measured at catalase and peroxidase activity measurements to ascertain OD 580 . Measurements were performed using SpectraMax comparable protein loadings between samples. multi-plate reader and the results normalised to biomass (OD580/OD600). Bacterial Survival in the Presence of Hydrogen Peroxide Pathogenicity and Bacterial Multiplication To test bacterial resistance to hydrogen peroxide R. solanacearum Assays in Tomato overnight cultures were inoculated into fresh BG medium and The susceptible tomato (Solanum lycopersicum) cv. Marmande grown to early exponential phase (6.5 h at 28°C and 200 rpm). cultivar was grown under long-day light conditions at 25°C and Aliquots of the cultures were diluted and plated on BG-agar in 60% relative humidity. Prior to infection, three- to four-week-old order to quantify the bacterial population and then hydrogen plants were acclimated for 3 days at 27°C with constant light peroxide was added to the cultures at final concentrations of 1 and conditions (12 h light/12 h darkness). For the pathogenicity 2.5 mM. After 15 min of exposure to the oxidant, samples were assays, plants not watered for two days were drench inoculated removed, washed once with fresh medium, serially diluted and without root wounding with 40 mL of the bacterial suspension plated on BG-agar plates. adjusted to 107 CFU/mL from an overnight culture. 20–25 plants For the induction experiments, R. solanacearum cultures were were inoculated per strain and wilting symptoms were recorded grown to early exponential phase (6.5 h) and incubated with sub- per plant using an established semi-quantitative wilting scale lethal concentrations of hydrogen peroxide (25, 50, and 100 mM) ranging from 0 (no wilting) to 4 (death) (Monteiro et al., 2012b). for an additional hour before being used in the killing For bacterial growth assays in planta, tomato leaves were experiments. After the induction treatment, aliquots of the vacuum-infiltrated submerging the aerial plant into water or 105 cultures were washed, diluted and plated on BG-agar plates. CFU/mL bacterial suspensions for 20 s. In both cases, the Cultures were then treated with a lethal concentration of H2O2 adjuvant Silwet L-77 was added (80 mL/L suspension) to (5 mM) for 15 min, after which samples were taken, washed once facilitate infiltration. At day 0 and 3 post infiltration, bacterial with fresh medium, serially diluted and plated on BG-agar plates. concentrations in the plant tissues were measured. To this end, In all cases, growth of liquid cultures was monitored three 5-mm diameter disks per biological replicate were taken spectrophotometrically by optical density at 600 nm (OD600). from infiltrated leaves, homogenised and 10 µL of serial ten-fold Colonies were counted after 72 h incubation at 28°C. The dilutions were plated in selective plates. The plates were percentage of survival was defined as the number of colony incubated at 28°C until colonies could be counted. Three forming units (CFU) after treatment divided by the number of biological replicas were used per bacterial strain. CFU prior to treatment ×100. Statistical Analyses Biofilm Observation and Quantification Quantitative analyses were performed with at least three independent For analyses of biofilm formation R. solanacearum strains were biological samples. Data were subjected to a multifactorial mixed modified to express the green fluorescent protein (GFP) by model ANOVA and Tukey’s multiple comparison tests along with electroporation with plasmid pJBA128 (Lee et al., 2005). Saturated residual analysis and validation using Infostat software (Infostat cultures of the GFP-labeled bacteria in BG medium were adjusted to 2006H, http://www.infostat.com.ar). an optical density at 600 nm of 0.1 and diluted 1:20 in fresh CPG medium (1 g/L casamino acids, 5 g/L glucose and 10 g/L bacteriological peptone). Then, 300 mL of the bacterial suspensions were placed onto chamber-covered glass slides (nu155411, Lab-Tek, RESULTS NUNC, Naperville. IL, U.S.A.) that were statically incubated in a humidified PVC box at 28°C. All microscopic observations were R. solanacearum RSp1581 Encodes an performed on a Zeiss LSM880 confocal laser scanning microscope Active Monofunctional Catalase Induced (Carl Zeiss, Jena, Germany) equipped with an argon laser and During Exponential Growth detector and filter sets for monitoring of GFP expression (excitation, In order to investigate the role of katE in the R. solanacearum 488 nm; emission, 517 nm). The images obtained were analyzed physiology and plant interaction, we generated a katE deletion with ImageJ software (https://imagej.nih.gov). mutant by genetic replacement of the RSp1581 open reading Frontiers in Plant Science | www.frontiersin.org 5 July 2020 | Volume 11 | Article 1156 Tondo et al. Ralstonia solanacearum KatE Catalase frame by a gentamicin resistance cassette in the GMI1000 strain Figure 1C, mRNA levels of katE significantly decreased in background. The resulting mutant, named DkatE, exhibited stationary wild type cells, being approximately 5-fold lower in typical colony morphology on tetrazolium chloride (TZC)- the stationary phase with respect to early exponential growth phase. containing agar plates and similar growth curves to its wild- This expression pattern was similar in the complemented DkatE type parental strain, demonstrating that disruption of katE does strain whereas expression was undetectable in the katE mutant. not affect bacterial growth in vitro (Supplementary Figure 1). To analyze the effect of katE deletion on R. solanacearum KatE Expression Is Transcriptionally catalase activity, soluble protein extracts from cultures grown in Activated by the HrpG Regulator BG medium to early exponential and stationary phase were Using genome-wide expression analyses in R. solanacearum, we separated on non-denaturing polyacrylamide gels and stained previously identified katE among a group of virulence and for catalase activity. As shown in Figure 1A, we detected two environmental adaptation genes specifically regulated by the distinct catalase bands at both growth stages in the wild-type HrpG transcriptional regulator (Valls et al., 2006). To better strain GMI1000. On the contrary, the upper, slow-migrating investigate the role of HrpG in the regulation of katE, we band was completely absent in the DkatE mutant, suggesting that measured katE transcript levels in the wild-type GMI1000 strain, this band corresponds to the KatE isozyme. As a final proof that a hrpG deletion mutant (DhrpG) and the complemented mutant the RSp1581 open reading frame is functional and encodes this strain overexpressing this regulator (DhrpG + hrpG). katE mRNA enzyme, complementation of DkatE with a single copy of the levels were significantly lower in the DhrpG strain with respect to the open reading frame under its own promoter restored the catalase wild-type or the complemented overexpressing strain (Figure 2A). activity pattern. Soluble protein extracts of the wild type, DkatE This effect was more pronounced (significant differences in 95% and complemented (DkatE + katE) strains were also run in Tukey HSD test) in minimal medium -known to specifically induce parallel on a non-denaturing polyacrylamide gel stained for HrpG activity- than in cells grown in rich BG medium (Figure 2A). peroxidase activity (Figure 1B). This assay revealed that the To evaluate the influence of this regulation at the protein level, we fast-migrating catalase band detected in all three strains exhibits then measured the effect of hrpG on the catalase activity. peroxidase activity as well, suggesting that it corresponds to one Measurements of catalase activity in native polyacrylamide gels of the KatG isozymes identified in the R. solanacearum genome revealed the same expression pattern obtained for katE transcripts, (Salanoubat et al., 2002). In adittion, the upper KatE band did with markedly lower levels in the DhrpG background that could be not appear in the peroxidase assay further corroborating its complemented by overexpression of this regulator (Figure 2B). monofunctional enzymatic nature. These results show a clear correlation between hrpG and katE The activity levels of KatE observed in native gels (Figure 1A) transcript levels and with the catalase activity as well. seemed to indicate that expression of this gene in R. solanacearum is regulated by growth phase, as previously reported for other R. solanacearum KatE Activity Is bacterial species (Loewen, 1997; Vattanaviboon and Mongkolsuk, Enhanced Upon H2O2 Treatment and 2000; Tondo et al., 2010). To test this hypothesis, we measured the Protects Against Oxidative Stress katE mRNA levels in early exponential and stationary phase To assess the involvement of catalases in the R. solanacearum cultures by quantitative real-time RT-PCR. As illustrated in oxidative stress response, we exposed early exponential phase A B C FIGURE 1 | Catalase/peroxidase activity patterns and katE expression in R. solanacearum. Equal amounts of total soluble protein extracts (25 µg) from wild-type GMI1000 strain (WT), the katE deletion mutant (DkatE), and the complemented (DkatE + katE) strain grown in BG medium to early exponential or stationary growth phases were separated on non-denaturing polyacrylamide gels stained for catalase (A) and peroxidase (B) activities. (C) katE mRNA levels measured by quantitative real-time PCR from cultures grown in the same conditions described in A. In the Y-axis is represented the 2DCt normalised expression from three biological replicas with two technical replicas each. Experiments in A and B were repeated at least three times with similar results. Frontiers in Plant Science | www.frontiersin.org 6 July 2020 | Volume 11 | Article 1156 Tondo et al. Ralstonia solanacearum KatE Catalase was observed in the katE mutant after peroxide exposure, suggesting an impaired ability to face the oxidative challenge. A Resistance of bacterial cells to lethal doses of H2O2 was then evaluated. As illustrated in Figure 3C, the DkatE mutant exhibited increased sensitivity to the oxidant compared to the parental wild-type strain, a phenotype that was more pronounced at higher H2O2 doses and maximal at the highest concentration tested (2.5 mM). Moreover, pre-adaptation of the cultures with a sub-lethal concentration of H2O2 (100 µM) led to a significant increase in the resistance of wild-type cells to an elevated dose (5 mM) of the agent (Figure 3D). This effect, commonly known as adaptive response, was not observed in the DkatE strain, which did not evidence higher tolerance to the oxidant after the adaptation treatment, reinforcing the notion that katE encodes the only catalase activity that contributes to bacterial adaptation to an oxidative environment. B Biofilm Formation Is Affected by the Deletion of katE Bacterial antioxidant activities have been shown to influence biofilm formation (Kim et al., 2006; Simmons and Dybvig, 2015; Tondo et al., 2016). To analyze the structural characteristics of the R. solanacearum biofilm, we generated Green Fluorescent Protein (GFP)-labeled strain derivatives (Table 1) and observed their growth development on chambered cover glass slides by confocal laser scanning microscopy over a 5-day period. At two days post inoculation (dpi), formation of cell aggregates was apparent for the wild-type strain (Figure 4A), and a well- established biofilm with more complex structures was clearly observed at 5 dpi. In contrast, the katE mutant failed to form a FIGURE 2 | Expression of katE in the wild-type (WT), DhrpG mutant, and structured biofilm after 5 days, exhibiting minor aggregation and complemented overexpressing (DhrpG + hrpG) strains. (A) mRNA levels of reduced interstitial spaces. Besides observing the biofilm structure, katE were measured by quantitative real-time PCR in RNAs extracted from we also quantified the amount of biofilm produced by measuring R. solanacearum cells grown in rich BG or minimal medium supplemented the intensity of crystal violet staining after growth on 96-well with glutamate. In the Y-axis is represented the 2DCt normalised expression plates. As shown in Figure 4B, these experiments resulted in from three biological replicas with two technical replicas each. The asterisk indicates the strain showing statistically significant differences to the other two comparable quantities of biofilm in the wild type, the katE mutant strains tested in the same condition (95% Tukey HSD test). (B) Catalase and its genetically complemented derivative, demonstrating that activity patterns in native gels. Equal amounts of soluble proteins (25 µg) were KatE influences the development of biofilm structures but does separated by 8% non-denaturing PAGE and stained for catalase activity. A not alter the overall amount of biofilm produced. simultaneously run Coomassie-stained gel (not shown) indicated equal protein loadings between samples. This experiment was repeated three times with similar results. Pathogenicity Tests As mentioned previously, katE transcription is activated by the master regulator of pathogenicity HrpG (Figure 2). In addition, cultures to a range of sub-lethal doses (25, 50, and 100 µM) of our preliminary data show that katE from R. solanacearum strain H2O2 for 1 h and the catalase activity patterns were compared to UY031 is highly expressed when the bacterium grows in the untreated control cultures on native polyacrylamide gels. As plant apoplast and in the xylem (unpublished data). This shown in Figure 3A, the activity of the two detected catalase information, together with our finding that catalase activity bands increased upon H2O2 treatment, suggesting a clear was key to survive oxidative stress led us to test whether it is induction of both isoforms under oxidative stress. To further required for R. solanacearum GMI1000 pathogenicity on tomato, evaluate the contribution of KatE to this response, we quantified its natural host. Plants of the susceptible tomato cultivar the catalase activity levels in the wild type, the DkatE mutant and Marmande were inoculated with suspensions of the wild type, the complemented (DkatE + katE) strains grown in the mutant, and complemented strains by soil drenching and conditions previously stated (Figure 3B). H2O2 treatment symptom appearance was recorded over time (Figure 5A). No caused a ~5-fold increase of catalase activity in the wild-type statistical differences in wilting symptoms in plants inoculated strain, being this increment almost equivalent at all H2O2 with the wild type, the katE disruption mutant or the concentrations tested. On the contrary, no catalase induction complemented strain were observed in three biological replicas, Frontiers in Plant Science | www.frontiersin.org 7 July 2020 | Volume 11 | Article 1156 Tondo et al. Ralstonia solanacearum KatE Catalase A B C D FIGURE 3 | Hydrogen peroxide response in wild type, the DkatE mutant, and its complemented counterpart. (A) Catalase activities detected after exposure to sub- lethal levels of hydrogen peroxide. Equal amounts (15 µg) of soluble protein extracts from early exponential phase cultures exposed to 25, 50, and 100 µM of H2O2 for 60 min, and from an untreated control (C), were separated on a native polyacrylamide gel stained for catalase activity. (B) Catalase activities quantified through H2O2 decomposition in soluble cell extracts obtained from cells treated as in A. (C) Sensitivity of R. solanacearum strains to 1 and 2.5 mM H2O2. Cells in early exponential phase of growth were exposed to the indicated concentrations of H2O2 for 15 min. The number of Colony Forming Units (CFU) was determined for each culture before and after the peroxide treatment by plating of appropriate dilutions. The percentage of survival is defined as the number of CFU after treatment divided by the number of CFU prior to H2O2 exposure ×100. (D) Sensitivity of pre-adapted cultures of WT, DkatE, and the complemented DkatE + katE strains to 5 mM H2O2. Exponential phase cultures were first adapted with 100 µM H2O2 for 60 min and then exposed to 5 mM H2O2 for 15 min. The number of CFU was determined for each culture before and after the 5 mM H2O2 treatment by plating of appropriate dilutions and percentage of survival calculated as the number of CFU after treatment divided by the number of CFU prior to treatment ×100. Data represent the mean and standard deviation of three independent experiments. Different letters indicate significant differences among strains and/or treatment according to the Tukey’s multiple comparison test (p<0.0001). suggesting no major role of the gene in the virulence of R. Wojtaszek, 1997). In this context, the antioxidant system adequacy solanacearum GMI1000. The importance of apoplastic ROS led by the invading microorganism must be fundamental to minimize us to quantify whether bacterial fitness was affected during the oxidative stress generated by the host plant, thus achieving the growth in this plant compartment. To this end, we infiltrated establishment of the infection. In this work, we demonstrated that susceptible tomato leaves with solutions of the wild type, the monofunctional KatE and bifunctional KatG catalase activities can DkatE, and the complemented strain and quantified bacterial be detected in R. solanacearum soluble protein extracts using non- concentrations in recovered leaf disk samples immediately after denaturing polyacrylamide gels (Figure 1A). Furthermore, a single inoculation and at three days post inoculation (dpi). Results from mutant in the katE gene was generated and genetically a representative experiment are presented in Figure 5B and show complemented corroborating that the upper band revealed in that no differences in bacterial multiplication in the apoplast the native gel corresponds to the KatE catalase. were observed for any of the three tested strains. We evaluated catalase activities during the different growth phases, detecting that the monofunctional catalase was induced during exponential growth (Figures 1A, C). These results DISCUSSION collectively suggest that katE expression is growth phase regulated at the transcriptional level. Similar results were previously reported It has been shown that hydrogen peroxide is a central component for other bacteria such as E. coli, Xanthomonas campestris pv. of the oxidative burst during plant-pathogen interaction, as it campestris and Xanthomonas citri subsp. citri, although the accumulates in plants attacked by pathogenic microorganisms expression pattern of particular catalase isozymes may vary including fungi, bacteria and viruses (Baker and Orlandi, 1995; between species (Loewen, 1997; Vattanaviboon and Mongkolsuk, Frontiers in Plant Science | www.frontiersin.org 8 July 2020 | Volume 11 | Article 1156 Tondo et al. Ralstonia solanacearum KatE Catalase A B FIGURE 4 | Effect of katE disruption on R. solanacearum biofilm formation ability. (A) GFP-labeled wild-type and DkatE strains were grown on chambered cover slides and visualized under confocal laser scanning microscopy after 2 and 5 days of bacterial growth. Left panels show the biofilms developed at the bottom of the chambered cover slides with a magnification of 400X and right panels show a 2X zoom of the regions marked in the previous panels. Scale bars, 50 mm. (B) Biofilm quantification. Bacterial suspensions were grown for 24 h in 96 well plates at 30°C, stained with crystal violet and the biofilm was quantified as the OD580 normalized by the bacterial growth measured at OD600. Boxplots of the values obtained per each tested strain from 5-6 biological replicas (N=5-6) are presented. A B FIGURE 5 | Effect of katE in R. solanacearum virulence and fitness in the apoplast. (A) Bacterial pathogenicity assay on tomato. Wilting symptoms were recorded after soil-drench inoculation with the wild type R. solanacearum GMI1000 strain (black line), the katE disruption mutant derivative (grey line) and its complemented strain (dotted black line). Disease symptoms are plotted over time in a scale ranging from 0 (no symptoms) to 4 (wilted plant). Each data point represents the average of 20-25 plants and their standard errors. Three independent biological replicates were performed with similar results. (B) Bacterial growth in leave tissues. Tomato plants were vacuum infiltrated with 105 CFU/mL suspensions of GMI1000, the katE mutant, and the complemented strain. Leaf disks were sampled at day 0 and 3 post inoculation, and bacterial counts in the tissue were determined as CFU from plated dilutions normalized to the disk area sampled (N=3). All experiments were repeated three times with similar results. 2000; Tondo et al., 2010). In X. citri subsp. citri, katE gene was also medium. Finally, katE expression seems to be controlled mostly regulated by growth phase but contrary to the pattern observed in R. at the transcriptional level, as the levels of the KatE enzyme mostly solanacearum, it exhibited an strong induction in stationary phase correlate with its mRNA abundance, although protein stability may cells (Tondo et al., 2010). be increased post-translationally in minimal medium, as indicated Our results show that katE is transcriptionally activated by by the fact that it can be detected in the DhrpG mutant strain grown HrpG but also responds to other inducing cues besides the growth in this condition, where it shows minimal transcription levels phase, as shown by the higher transcriptional output observed upon (Figures 2A, B). growth in BG rich medium than in minimal medium, a condition On the other hand, we studied the participation of the two known to induce HrpG activity (Figure 2A). This specific induction Ralstonia catalases in the resistance against the oxidizing in rich medium independently of HrpG is corroborated by the high compound hydrogen peroxide. R. solanacearum exponential katE mRNA levels in the DhrpG mutant strain grown in this cultures were exposed to sub-lethal doses of peroxide, detecting Frontiers in Plant Science | www.frontiersin.org 9 July 2020 | Volume 11 | Article 1156 Tondo et al. Ralstonia solanacearum KatE Catalase a clear induction of both catalase isoforms under oxidative stress measurement of its virulence and fitness. Again, disruption of (Figure 3A). These results are in agreement with those obtained katE did not cause any effect (Figure 5B). Although bacterial by Florez-Cruz and Allen, who observed an OxyR-dependent multiplication in the host is not always correlated with its induction of katE and katG mRNA levels after exposure to H2O2 aggressiveness (Angot et al., 2006), this result was somehow (Flores-Cruz and Allen, 2009). Here, the contribution of KatE to unexpected due to the important role played by the KatE catalase this response was analyzed (Figure 3B). Quantification of R. in in vitro protection to oxidative stress, a condition that is solanacearum catalase activity in the DkatE mutant showed that commonly encountered by bacteria inside the plant host (Lamb it is almost residual and that its induction is undetectable (Figure and Dixon, 1997). 3B). The catalase activity was recovered in the complemented In addition, the katE mutant strain did not show reduced strain, where katE was reintroduced into the mutant ability to produce biofilms, another important trait for the background, and showing that KatE plays a significant role in wilting disease development (Figure 4). Biofilm-growing cells the R. solanacearum protection to oxidative stress. To prove this, usually experience endogenous oxidative stress and many bacterial cultures were confronted to lethal doses of H2O2 antioxidant systems were shown to be induced under this detecting that the DkatE mutant was more susceptible to the growth condition (Resch et al., 2005; Ram et al., 2005; oxidative compound than the wild type strain (Figure 3C). This Mikkelsen et al., 2007; Shanks et al., 2007; Chung et al., 2016). is in agreement with the reported observations that disruption of In fact, the role of catalase and superoxide dismutase in the the monofunctional catalase katE in X. citri subsp. citri and katB development of mature biofilms was previously demonstrated in in Pseudomonas syringae pv. tomato DC3000 rendered these X. citri subsp. citri and E. coli, respectively (Kim et al., 2006; bacteria more susceptible to oxidative stress (Tondo et al., 2010; Tondo et al., 2016). According to our results, disruption of katE Guo et al., 2012). The other monofunctional catalase in P. in R. solanacearum only alters the structure of the biofilm syringae pv. tomato (KatE), which is clearly less induced by produced on an abiotic surface, but not the overall quantity of exposure to exogenous H2O2, also showed a minor role in biofilm production. This is in agreement with previous reports resistance to the oxidative compound (Guo et al., 2012). indicating that perturbations of the physiological steady-state The adaptive response to oxidative agents has been previously levels of ROS or the addition of catalase to the medium affects the proposed to play a fundamental role in plant-pathogen quality and structural characteristics of the biofilms developed by interactions, allowing bacteria to withstand increased oxidative Azotobacter vinelandii (Villa et al., 2012) and Mycoplasma stress conditions (Ausubel, 2005). Exposure to sub-lethal pneumoniae (Simmons and Dybvig, 2015), with diverse effects concentrations of oxidative stress agents usually have a on the amounts of biofilm produced. priming effect on bacteria, which then tolerate higher doses of However, the minor role that KatE seems to play in planta is in the same oxidant (adaptive response), and even others (cross- agreement with a previous screening for R. solanacearum genes protection). These responses are due to the induction of essential for growth in planta, in which katE was not identified numerous genes involved in oxidant removal and damage (Brown and Allen, 2004). The two possible explanations for the repair, including catalases (Demple, 1991; Tartaglia et al., undetectable effect of R. solanacearum katE disruption on plant 1991). Evaluation of this response in R. solanacearum showed infection are, that ROS are not key players in the defence against that katE mutant does not significantly induce catalase activity this pathogen in tomato cv Marmande or that functional upon treatment with low doses of H2O2 and its remained activity redundancy with other genes with catalase activity exists. The is not enough to protect bacteria against higher doses of the three catalases in P. syringae pv. tomato DC3000 are all plant oxidant (Figures 3B, D). Consequently, even though KatG induced and play non-redundant roles in virulence (Guo et al., activity was found induced in peroxide-treated cultures 2012). Our results corroborate the hypothesis proposed by Guo et according to in-gel catalase staining, our results suggest a al. that catalases play different roles in each plant pathogen where minor role for the additional KatG catalases in the response to they independently adapted to overcome the plant defensive H2O2, being KatE the only catalase activity contributing to the production of H2O2. Our ongoing characterisation of the KatG bacterial adaptive response to an oxidative environment. catalases-peroxidases will be essential to shed light into Our finding that KatE catalase activity was essential for this question. survival in oxidative environments and the fact that ROS is a major player in plant defence responses (Wojtaszec, 1997; Flores-Cruz and Allen, 2009) led us to investigate its role in DATA AVAILABILITY STATEMENT bacterial virulence. Surprisingly, we found no effect of the katE mutation on pathogenicity assays on tomato (Figure 5A). This All datasets presented in this study are included in the article/ could be due to the limited sensitivity of soil drench inoculation Supplementary Material. and disease scoring to detect minor differences in bacterial pathogenicity. An alternative explanation is that ROS accumulate mainly in the apoplast (Lamb and Dixon, 1997) AUTHOR CONTRIBUTIONS and R. solanacearum grows mostly inside the xylem vessels of host plants. Thus, we measured the capacity of the bacterium to MLT, MV, and EO conceived and designed the work. MLT, RP-J, multiply in the tomato apoplast as a more quantitative and AV performed the experiments. LP and RP-J contributed to Frontiers in Plant Science | www.frontiersin.org 10 July 2020 | Volume 11 | Article 1156 Tondo et al. Ralstonia solanacearum KatE Catalase statistical analyses. EO and MV provided reagents and materials. ACKNOWLEDGMENTS All authors contributed to analysis and interpretation of results. MLT, RP-J, MV, and EO wrote the manuscript. All authors We are grateful to Nú ria S. Coll and the Bacterial Pathogens and contributed to the article and approved the submitted version. Plant Cell Death Team (Center for Research in Agricultural Genomics, CRAG) for critical comments and Jordi Corral (Autonomous University of Barcelona) for useful suggestions. We also thank Rodrigo Vena (IBR-CONICET) for confocal FUNDING microscopy analyses. This work was supported by the Agencia Nacional de Promoció n Cientı́fica y Tecnoló gica (ANPCyT PICT 2014-2487 to EO and PICT 2014-2485 to MLT) and the Spanish Ministry of Economy SUPPLEMENTARY MATERIAL and Competitiveness (AGL2016-78002-R and PID2019- The Supplementary Material for this article can be found online 108595RB-I00 to MV). We also acknowledge financial support at: https://www.frontiersin.org/articles/10.3389/fpls.2020.01156/ from the “Severo Ochoa Program for Centers of Excellence in full#supplementary-material R&D” (SEV/2015/0533), and the CERCA Program from the Catalan Government (Generalitat de Catalunya). The funders SUPPLEMENTARY FIGURE 1 | Growth curves of R. solanacearum GMI1000 had no role in study design, data collection and analysis, decision wild-type (WT), katE mutant (DkatE) and complemented (DkatE + katE) strains in BG medium. R. solanacearum cultures were grown aerobically at 28°C with shaking at to publish, or preparation of the manuscript. EO and MLT are 200 rpm. Aliquots were taken at the indicated times and measured for colony- staff members and AV is Fellow of the Consejo Nacional de forming capacity by serial dilution and plating on BG-agar. Colonies were counted Investigaciones Cientı́ficas y Té cnicas (CONICET, Argentina). after 48 h incubation at 28°C. REFERENCES Flores-Cruz, Z., and Allen, C. (2009). Ralstonia solanacearum encounters an oxidative environment during tomato infection. Mol. Plant-Microbe Interact. Allen, C., Prior, P., and Hayward, A. C. (2004). Bacterial Wilt Disease and the 22, 773–782. doi: 10.1094/MPMI-22-7-0773 Ralstonia solanacearum Species Complex (St. Paul (Minnesota): American Flores-Cruz, Z., and Allen, C. (2011). Necessity of OxyR for the hydrogen peroxide Phytopathological Society Press). stress response and full virulence in Ralstonia solanacearum. Appl. Environ. Angot, A., Peeters, N., Lechner, E., Vailleau, F., Baud, C., Gentzbittel, L., et al. Microbiol. 77, 6426–6432. doi: 10.1128/AEM.05813-11 (2006). Ralstonia solanacearum requires F-box-like domain-containing type III Genin, S., and Denny, T. P. (2012). Pathogenomics of the Ralstonia solanacearum effectors to promote disease on several host plants. Proc. Natl. Acad. Sci. U.S.A. species complex. Annu. Rev. Phytopathol. 50, 67–89. doi: 10.1146/annurev- 103 (39), 14620–14625. doi: 10.1073/pnas.0509393103 phyto-081211-173000 Apel, K., and Hirt, H. (2004). Reactive oxygen species: metabolism, oxidative Guo, M., Block, A., Bryan, C. D., Becker, D. F., and Alfano, J. R. (2012). stress, and signal transduction. Annu. Rev. Plant Biol. 55, 373–399. Pseudomonas syringae catalases are collectively required for plant doi: 10.1146/annurev.arplant.55.031903.141701 pathogenesis. J. Bacteriol. 194, 5054–5064. doi: 10.1128/JB.00999-12 Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, Jittawuttipoka, T., Buranajitpakorn, S., Vattanaviboon, P., and Mongkolsuk, S. J. A., et al. (1994). Current Protocols in Molecular Biology (New York: John (2009). The catalase-peroxidase KatG is required for virulence of Xanthomonas Wiley and Sons). campestris pv. campestris in a host plant by providing protection against low Ausubel, F. M. (2005). Are innate immune signaling pathways in plants and levels of H2O2. J. Bacteriol. 191, 7372–7377. doi: 10.1128/JB.00788-09 animals conserved? Nat. Immunol. 6, 973–979. doi: 10.1038/ni1253 Kang, K.-S., Lim, C.-J., Han, T.-J., Kim, J.-C., and Jin, C.-D. (1999). Changes in the Baker, C. J., and Orlandi, E. W. (1995). Active oxygen in plant pathogenesis. Annu. isozyme composition of antioxidant enzymes in response to aminotriazole in Rev. Phytopathol. 33, 299–321. doi: 10.1146/annurev.py.33.090195.001503 leaves of Arabidopsis thaliana. J. Plant Biol. 42, 187–193. doi: 10.1007/ Beers, R. F. Jr, and Sizer, I. W. (1952). A spectrophotometric method for BF03030477 measuring the breakdown of hydrogen peroxide by catalase. J. Biol. Chem. Kelman, A. (1954). The relationship of pathogenicity of Pseudomonas solanacearum 195, 133–140. to colony appearance in tetrazolium medium. Phytopathology 44, 693–695. Boucher, C. A., Barberis, P. A., Trigalet, A. P., and Demery, D. A. (1985). Kim, Y. H., Lee, Y., Kim, S., Yeom, J., Yeom, S., Seok, K. B., et al. (2006). The role of Transposon mutagenesis of Pseudomonas solanacearum: Isolation of Tn5- periplasmic antioxidant enzymes (superoxide dismutase and thiol peroxidase) induced avirulent mutants. J. Gen. Microbiol. 131, 2449–2457. doi: 10.1099/ of the Shiga toxin-producing Escherichia coli O157:H7 in the formation of 00221287-131-9-2449 biofilms. Proteomics 6, 6181–6193. doi: 10.1002/pmic.200600320 Brown, D. G., and Allen, C. (2004). Ralstonia solanacearum genes induced during Lamb, C., and Dixon, R. A. (1997). The oxidative burst in plant disease resistance. growth in tomato: an inside view of bacterial wilt. Mol. Microbiol. 53 (6), 1641– Annu. Rev. Plant Physiol. Plant Mol. Biol. 48, 251–275. doi: 10.1146/ 1660. doi: 10.1111/j.1365-2958.2004.04237.x annurev.arplant.48.1.251 Chen, W. P., and Kuo, T. T. (1993). A simple and rapid method for the Lee, B., Haagensen, J. A., Ciofu, O., Andersen, J. B., Hoiby, N., and Molin, S. preparation of gram-negative genomic DNA. Nucleic Acids Res. 21, 2260. (2005). Heterogeneity of biofilms formed by nonmucoid Pseudomonas doi: 10.1093/nar/21.9.2260 aeruginosa isolates from patients with cystic fibrosis. J. Clin. Microbiol. 43, Chung, C.-H., Fen, S., Yu, S.-C., and Wong, H. (2016). Influence of oxyR on 5247–5255. doi: 10.1128/JCM.43.10.5247-5255.2005 growth, biofilm formation, and mobility of Vibrio parahaemolyticus. Appl. Loewen, P. C. (1997). “Bacterial catalases,” in Oxidative Stress and the Molecular Environ. Microbiol. 82, 788–796. doi: 10.1128/AEM.02818-15 Biology of Antioxidant Defenses. Ed. J. G. Scandalios (New York: Cold Spring Demple, B. (1991). Regulation of bacterial oxidative stress genes. Annu. Rev. Harbor Laboratory Press), 273–308. Genet. 25, 315–337. doi: 10.1146/annurev.ge.25.120191.001531 Mandal, S., Das, R. K., and Mishra, S. (2011). Differential occurrence of oxidative Denny, T. P. (2006). “Plant pathogenic Ralstonia species,” in Plant-Associated burst and antioxidative mechanism in compatible and incompatible Bacteria. Ed. S. S. Gnanamanickam (Dordrecht, The Netherlands: Springer), interactions of Solanum lycopersicum and Ralstonia solanacearum. Plant 573–644. Physiol. Biochem. 49 (2), 117–123. doi: 10.1016/j.plaphy.2010.10.006 Frontiers in Plant Science | www.frontiersin.org 11 July 2020 | Volume 11 | Article 1156 Tondo et al. Ralstonia solanacearum KatE Catalase Marx, C. J., and Lidstrom, M. E. (2002). Broad-host-range cre-lox system for Sedmak, J. J., and Grossberg, S. E. (1977). A rapid, sensitive, and versatile assay for antibiotic marker recycling in Gram-negative bacteria. Biotechniques 33 (5), protein using Coomassie brilliant blue G250. Anal. Biochem. 79, 544–552. 1062–1067. doi: 10.2144/02335rr01 doi: 10.1016/0003-2697(77)90428-6 Mikkelsen, H., Duck, Z., Lilley, K. S., and Welch, M. (2007). Interrelationships Shanks, R. M., Stella, N. A., Kalivoda, E. J., Doe, M. R., O’Dee, D. M., Lathrop, between colonies, biofilms, and planktonic cells of Pseudomonas aeruginosa. K. L., et al. (2007). A Serratia marcescens OxyR homolog mediates surface J. Bacteriol. 189, 2411–2416. doi: 10.1128/JB.01687-06 attachment and biofilm formation. J. Bacteriol. 189, 7262–7272. doi: 10.1128/ Mishra, S., and Imlay, J. (2012). Why do bacteria use so many enzymes to scavenge JB.00859-07 hydrogen peroxide? Arch. Biochem. Biophys. 525 (2), 145–160. doi: 10.1016/ Simmons, W. L., and Dybvig, K. (2015). Catalase enhances growth and biofilm j.abb.2012.04.014 production of Mycoplasma pneumoniae. Curr. Microbiol. 71 (2), 190–194. Monteiro, F., Genin, S., van Dijk, I., and Valls, M. (2012a). A luminescent reporter doi: 10.1007/s00284-015-0822-x evidences active expression of Ralstonia solanacearum type III secretion system Smith, S. G., Wilson, T. J., Dow, J. M., and Daniels, M. J. (1996). A gene for genes throughout plant infection. Microbiology 158, 2107–2116. doi: 10.1099/ superoxide dismutase from Xanthomonas campestris pv. campestris and its mic.0.058610-0 expression during bacterial-plant interactions. Mol. Plant-Microbe Interact. 9, Monteiro, F., Solé , M., van Dijk, I., and Valls, M. (2012b). A chromosomal 584–593. doi: 10.1094/mpmi-9-0584 insertion toolbox for promoter probing, mutant complementation, and Tamir-Ariel, D., Navon, N., and Burdman, S. (2007). Identification of genes in pathogenicity studies in Ralstonia solanacearum. Mol. Plant-Microbe Xanthomonas campestris pv. vesicatoria induced during its interaction with Interact. 25, 557–568. doi: 10.1094/MPMI-07-11-0201 tomato. J. Bacteriol. 189, 6359–6371. doi: 10.1128/JB.00320-07 Okinaka, Y., Yang, C.-H., Perna, N. T., and Keen, N. T. (2002). Microarray Tartaglia, L. A., Storz, G., Farr, S. B., and Ames, B. N. (1991). “The bacterial profiling of Erwinia chrysanthemi 3937 genes that are regulated during plant adaptation to hydrogen peroxide stress,” in Oxidative stress, oxidants and infection. Mol. Plant-Microbe Interact. 15, 619–629. doi: 10.1094/ antioxidant. Ed. H. Sies (New York: Academic Press), 155–169. MPMI.2002.15.7.619 Tondo, M. L., Petrocelli, S., Ottado, J., and Orellano, E. G. (2010). The Peeters, N., Guidot, A., Vailleau, F., and Valls, M. (2013). Ralstonia solanacearum, monofunctional catalase KatE of Xanthomonas axonopodis pv. citri is a widespread bacterial plant pathogen in the post-genomic era. Mol. Plant required for full virulence in citrus plants. PloS One 5 (5), e10803. Pathol. 14 (7), 651–662. doi: 10.1111/mpp.12038 doi: 10.1371/journal.pone.0010803 Peng, M., and Kuc, J. (1992). Peroxidase-generated hydrogen peroxide as a source Tondo, M. L., Delprato, M. L., Kraiselburd, I., Ferná ndez Zenoff, M. V., Farı́as, of antifungal activity in vitro and on tobacco leaf disks. Phytopathology 82, M. E., and Orellano, E. G. (2016). KatG, the bifunctional catalase of 696–699. doi: 10.1094/Phyto-82-696 Xanthomonas citri subsp. citri, responds to hydrogen peroxide and Plener, L., Manfredi, P., Valls, M., and Genin, S. (2010). PrhG, a transcriptional contributes to epiphytic survival on citrus leaves. PloS One 11 (3), e0151657. regulator responding to growth conditions, is involved in the control of the doi: 10.1371/journal.pone.0151657 type III secretion system regulon in Ralstonia solanacearum. J. Bacteriol. 192, Valls, M., Genin, S., and Boucher, C. (2006). Integrated regulation of the type III 1011–1019. doi: 10.1128/JB.01189-09 secretion system and other virulence determinants in Ralstonia solanacearum. Puigvert, M., Guarischi-Sousa, R., Zuluaga, P., Coll, N. S., Macho, A. P., Setubal, J. C., PloS Pathog. 2 (8), e82. doi: 10.1371/journal.ppat.0020082 et al. (2017). Transcriptomes of Ralstonia solanacearum during root Vattanaviboon, P., and Mongkolsuk, S. (2000). Expression analysis and colonization of Solanum commersonii. Front. Plant Sci. 8, 370. doi: 10.3389/ characterization of the mutant of a growth-phase- and starvation-regulated fpls.2017.00370 monofunctional catalase gene from Xanthomonas campestris pv. phaseoli. Ram, R. J., Verberkmoes, N. C., Thelen, M. P., Tyson, G. W., Baker, B. J., Blake, Gene 241, 259–265. doi: 10.1016/s0378-1119(99)00483-7 R. C., et al. (2005). Community proteomics of a natural microbial biofilm. Villa, F., Remelli, W., Forlani, F., Gambino, M., Landini, P., and Cappitelli, F. Science 308, 1915–1920. doi: 10.1126/science.1109070 (2012). Effects of chronic sub-lethal oxidative stress on biofilm formation by Resch, A., Rosenstein, R., Nerz, C., and Gotz, F. (2005). Differential gene Azotobacter vinelandii. Biofouling 28 (8), 823–833. doi: 10.1080/ expression profiling of Staphylococcus aureus cultivated under biofilm and 08927014.2012.715285 planktonic conditions. Appl. Environ. Microbiol. 71, 2663–2676. doi: 10.1128/ Wojtaszek, P. (1997). Oxidative burst: an early plant response to pathogen AEM.71.5.2663-2676.2005 infection. Biochem. J. 322 (3), 681–692. doi: 10.1042/bj3220681 Saenkham, P., Eiamphungporn, W., Farrand, S., Vattanaviboon, P., and Zá mocky, M., Gasselhuber, B., Furtmüller, P. G., and Obinger, C. (2012). Mongkolsuk, S. (2007). Multiple superoxide dismutases in Agrobacterium Molecular evolution of hydrogen peroxide degrading enzymes. Arch. tumefaciens: functional analysis, gene regulation, and influence on Biochem. Biophys. 525 (2), 131–144. doi: 10.1016/j.abb.2012.01.017 tumorigenesis. J. Bacteriol. 189, 8807–8817. doi: 10.1128/JB.00960-07 Salanoubat, M., Genin, S., Artiguenave, F., Gouzy, J., Mangenot, S., Arlat, M., et al. Conflict of Interest: The authors declare that the research was conducted in the (2002). Genome sequence of the plant pathogen Ralstonia solanacearum. absence of any commercial or financial relationships that could be construed as a Nature 415, 497–502. doi: 10.1038/415497a potential conflict of interest. Sambrook, J., and Russell, D. W. (2001). Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press). Copyright © 2020 Tondo, de Pedro-Jove ́, Vandecaveye, Piskulic, Orellano and Valls. Santos, R., Franza, T., Laporte, M. L., Sauvage, C., Touati, D., and Expert, D. This is an open-access article distributed under the terms of the Creative Commons (2001). Essential role of superoxide dismutase on the pathogenicity of Erwinia Attribution License (CC BY). The use, distribution or reproduction in other forums is chrysanthemi strain 3937. Mol. Plant-Microbe Interact. 14, 758–767. permitted, provided the original author(s) and the copyright owner(s) are credited and doi: 10.1094/MPMI.2001.14.6.758 that the original publication in this journal is cited, in accordance with accepted Scandalios, J. G. (1968). Genetic control of multiple molecular forms of catalase in academic practice. No use, distribution or reproduction is permitted which does not maize. Ann. N. Y. Acad. Sci. 151, 274–293. doi: 10.1111/j.1749-6632.1968.tb11896.x comply with these terms. Frontiers in Plant Science | www.frontiersin.org 12 July 2020 | Volume 11 | Article 1156