www.kidney-international.org clinical investigation Clinical and genetic spectra of autosomal dominant tubulointerstitial kidney disease due to see commentary on page 549 mutations in UMOD and MUC1 OPEN Eric Olinger1,2,16,23, Patrick Hofmann1,3,23, Kendrah Kidd4,20,23, Inès Dufour1,9, Hendrica Belge5, Céline Schaeffer6, Anne Kipp1, Olivier Bonny7, Constantinos Deltas8, Nathalie Demoulin9,10, Thomas Fehr1,11, Daniel G. Fuster2, Daniel P. Gale12, Eric Goffin9,10, Katerina Hodan ová20, Uyen Huynh-Do , Andreas Kistler , Johann Morelle , Gregory Papagregoriou , Yves Pirson9, 2 13 9,10 8 Richard Sandford14, John A. Sayer15,16, Roser Torra17, Christina Venzin18, Reto Venzin19, Bruno Vogt2,  Martina Zivná 20 , Anna Greka21,22, Karin Dahan5, Luca Rampoldi6, Stanislav Kmoch20, Anthony J. Bleyer Sr4,20,24 and Olivier Devuyst1,9,24 1 Institute of Physiology, University of Zurich, Zurich, Switzerland; 2Department of Nephrology and Hypertension, Inselspital Bern University Hospital, Bern, Switzerland; 3Department of Internal Medicine, Hospital Uster, Uster, Switzerland; 4Section on Nephrology, Wake Forest School of Medicine, Winston-Salem, North Carolina, USA; 5Center for Human Genetics, Institute of Pathology and Genetics, Gosselies, Belgium; 6Division of Genetics and Cell Biology, San Raffaele Scientific Institute, Milan, Italy; 7Service of Nephrology, Lausanne University Hospital, Lausanne, Switzerland; 8Molecular Medicine Research Center, Department of Biological Sciences, University of Cyprus, Nicosia, Cyprus; 9Division of Nephrology, Cliniques Universitaires Saint-Luc, Brussels, Belgium; 10Institut de Recherche Expérimentale et Clinique, Université catholique de Louvain, Brussels, Belgium; 11Department of Internal Medicine, Cantonal Hospital Graubuenden, Chur, Switzerland; 12Department of Nephrology, University College of London, London, UK; 13Department of Internal Medicine, Cantonal Hospital Frauenfeld, Frauenfeld, Switzerland; 14Department of Medical Genetics, Cambridge Biomedical Campus, Cambridge, UK; 15Renal Services, Newcastle upon Tyne Hospitals National Health Service Trust, Newcastle upon Tyne, UK; 16Translational and Clinical Research Institute, Faculty of Medical Sciences, Newcastle University, Newcastle upon Tyne, UK; 17Inherited Renal Disorders, Nephrology Department, Fundació Puigvert, Spanish Renal Research Network (REDinREN), Instituto de Investigaciones Biomédicas Sant Pau, Universitat Autònoma de Barcelona, Barcelona, Spain; 18Division of Nephrology, Department of Internal Medicine, Hospital Davos, Davos, Switzerland; 19Division of Nephrology, Department of Internal Medicine, Cantonal Hospital Graubuenden, Chur, Switzerland; 20 Research Unit for Rare Diseases, Department of Pediatrics and Adolescent Medicine, First Faculty of Medicine, Charles University, Prague, Czech Republic; 21Department of Medicine, Brigham and Women’s Hospital, Harvard Medical School, Boston, Massachusetts, USA; and 22Broad Institute of MIT and Harvard, Massachusetts Institute of Technology, Cambridge, Massachusetts, USA Autosomal dominant tubulointerstitial kidney disease with ADTKD-UMOD compared to ADTKD-MUC1 (30 vs. 67 (ADTKD) is an increasingly recognized cause of end-stage years, respectively). In contrast to patients with ADTKD- kidney disease, primarily due to mutations in UMOD and UMOD, patients with ADTKD-MUC1 had normal urinary MUC1. The lack of clinical recognition and the small size of excretion of uromodulin and distribution of uromodulin in cohorts have slowed the understanding of disease tubular cells. A diagnostic algorithm based on a simple score ontology and development of diagnostic algorithms. We coupled with urinary uromodulin measurements separated analyzed two registries from Europe and the United States patients with ADTKD-UMOD from those with ADTKD-MUC1 to define genetic and clinical characteristics of ADTKD- with a sensitivity of 94.1%, a specificity of 74.3% and a UMOD and ADTKD-MUC1 and develop a practical score to positive predictive value of 84.2% for a UMOD mutation. Thus, guide genetic testing. Our study encompassed 726 patients ADTKD-UMOD is more frequently diagnosed than ADTKD- from 585 families with a presumptive diagnosis of ADTKD MUC1, ADTKD subtypes present with distinct clinical features, along with clinical, biochemical, genetic and radiologic and a simple score coupled with urine uromodulin data. Collectively, 106 different UMOD mutations were measurements may help prioritizing genetic testing. detected in 216/562 (38.4%) of families with ADTKD (303 Kidney International (2020) 98, 717–731; https://doi.org/10.1016/ patients), and 4 different MUC1 mutations in 72/205 j.kint.2020.04.038 (35.1%) of the families that are UMOD-negative (83 KEYWORDS: diagnostic score; dominant kidney disease; gout; mucin-1; patients). The median kidney survival was significantly uromodulin shorter in patients with ADTKD-MUC1 compared to ADTKD- Copyright ª 2020, International Society of Nephrology. Published by UMOD (46 vs. 54 years, respectively), whereas the median Elsevier Inc. This is an open access article under the CC BY-NC-ND license gout-free survival was dramatically reduced in patients (http://creativecommons.org/licenses/by-nc-nd/4.0/). 23 Correspondence: Eric Olinger or Olivier Devuyst, University of Zurich, Win- EO, PH, and KK are co-first authors. terthurerstrasse 190, 8057 Zurich, Switzerland. E-mail: eric.olinger@ncl.ac.uk 24 AJB and OD are co-last authors. or olivier.devuyst@uzh;ch. or Anthony J. Bleyer, Sr., Section on Nephrology, Wake Forest School of Medicine, Medical Center Boulevard, Winston-Salem, Received 5 January 2020; revised 23 March 2020; accepted 2 April 2020; North Carolina 27157, USA; ableyer@wakehealth.edu published online 22 May 2020 Kidney International (2020) 98, 717–731 717 clinical investigation E Olinger et al.: ADTKD due to UMOD and MUC1 A utosomal dominant tubulointerstitial kidney disease Because of the nonspecific presentation and relative rarity, (ADTKD) is characterized by tubular damage and a clinical characterization of ADTKD subtypes and practical interstitial fibrosis of the kidney in the absence of tools to guide genetic testing for suspected ADTKD are glomerular lesions. Affected individuals present with progres- missing. Here, we compared the phenotype of the ADTKD- sive chronic kidney disease (CKD), normal-to-mild protein- UMOD and ADTKD-MUC1 subgroups in 2 large cohorts uria, and normal-sized kidneys, often with a positive family from Europe (Belgo-Swiss ADTKD registry) and the United history.1,2 The disease invariably progresses to end-stage kidney States (US ADTKD registry), representing the largest multi- disease (ESKD). Dominant mutations in UMOD were first center ADTKD cohort (726 patients from 585 families) to associated with ADTKD.3,4 UMOD encodes uromodulin, a date. We observed distinct features among these ADTKD kidney-specific protein that is abundant in normal urine and subtypes and established a simple score to orient diagnosis plays multiple roles in the kidney.4 Mutations in MUC1 were and prioritize genetic testing in ADTKD. subsequently identified as a cause for ADTKD.5 MUC1 encodes the glycoprotein mucin-1, which is important in epithelial bar- RESULTS rier function and intracellular signaling.6–8 Rare forms of Clinical and genetic characteristics of patients with ADTKD ADTKD have also been associated with mutations in HNF1B, The International ADTKD Cohort included 726 patients from which encodes the transcription factor hepatocyte nuclear fac- 585 families: 451 patients from 429 families from the US tor 1b9,10; REN, which encodes preprorenin, the precursor of ADTKD registry and 275 patients from 156 families from the renin11; and SEC61A1, which encodes the a1 subunit of the Belgo-Swiss ADTKD registry (Figure 1).2 In the international SEC61 complex that forms the core of the endoplasmic retic- cohort, 84% of patients presented with CKD and 43% had ulum (ER) translocon.12 reached ESKD. Gout had an overall prevalence of 66% and a Due to the nonspecific nature of the clinical, biological, family history of either CKD and/or gout was reported in and pathological findings, ADTKD is underdiagnosed. In a 92% of all cases (Table 1). The main differences between the recent study of whole exome sequencing in w3000 patients Belgo-Swiss and US registries included age at presentation, with CKD, UMOD mutations were detected in 3% of patients which was older, and prevalence of ESKD, which was higher with a monogenic cause of CKD, making it the sixth most in the US registry, possibly due to a higher rate of patient self- common genetic diagnosis in CKD.13 A single tertiary center referral when the disease became symptomatic. survey in England estimated that up to 2% of patients with Most patients (703 of 726), from 562 of 585 families, ESKD had ADTKD-UMOD, that is, the most common underwent mutational screening in the UMOD gene as a first monogenic kidney disease after autosomal dominant poly- diagnostic test. UMOD mutations were detected in 216 of 562 cystic kidney disease.14 The prevalence of ADTKD-MUC1 tested families (38.4%), corresponding to 303 of 703 tested remains unclear, as mutations in MUC1 are not detected by patients (43.1%) (Figure 1). The UMOD mutation detection next-generation sequencing and require specialized genetic rate was 40.0% in the US registry and 34.6% in the Belgo- testing.5,13 However, previous studies have identified Swiss registry (Table 1). Next, mutations in MUC1 were ADTKD-MUC1 and ADTKD-UMOD as the most common screened in 218 patients who were UMOD-negative, from 205 subtypes of ADTKD.8,15 The pathophysiology of ADTKD- families that were UMOD-negative, mostly from the US UMOD involves retention of mutant UMOD in the ER with registry. Of these, 83 patients from 72 families screened ensuing ER stress (“gain of toxic function”) and a cascade positive for MUC1 mutations, yielding a proportion of 35.1% leading to inflammatory cell infiltrate, tubular dysfunction, (72 of 205) of families with ADTKD-MUC1 among families and interstitial fibrosis.16–18 ADTKD-MUC1 is caused by with UMOD-negative ADTKD. Of note, a subset of 23 pa- mutations in the variable number of tandem repeat (VNTR) tients from 23 families with ADTKD (most of them previ- region of MUC1, leading to the formation of a frameshift, ously linked to chromosome 1q22) were first screened for truncated protein (MUC1fs) that accumulates in intracellular MUC1, with a mutation in MUC1 detected in 21 patients in vesicles and causes tubulointerstitial damage.19 this group (Figure 1). At the end of the screening process, 135 To date, the largest clinical analysis of ADTKD-UMOD patients from 133 families were negative for mutations in was performed in a cohort of French and Belgian patients both UMOD and MUC1 (Figure 1). Based on these genetic with ADTKD-UMOD (n ¼ 70 from 38 families), showing a results, the prevalence for ADTKD-UMOD is 37.1% median renal survival of 54 years and a 66% prevalence of ½ð216 positiveÞ = ð585  2Þ tested families  and for ADTKD- gout.20 The phenotype of ADTKD-MUC1 was reported in a MUC1 is 21.0% ½ð93 positiveÞ = ð585  141Þ tested families  cohort of 95 patients from 24 families, with an age of onset of among ADTKD families in this real-life cohort. ESKD ranging from 16 to 80 years and a 24% prevalence of gout.8 A Spanish cohort of 90 patients with ADTKD-MUC1 Spectrum of UMOD and MUC1 mutations (16 families) showed a trend toward earlier age at ESKD and a A total of 106 different UMOD mutations were detected in the lower prevalence of gout compared with that of patients with 216 families with ADTKD-UMOD (Figure 2a; Supplementary ADTKD-UMOD (n ¼ 41 from 9 families). The small size of Table S1). Variant calling was based on in silico prediction these cohorts prevented the detection of significant differ- tools, previous reports, and/or family segregation analysis for ences between ADTKD subtypes.15 undescribed variants. Missense mutations were by far the most 718 Kidney International (2020) 98, 717–731 E Olinger et al.: ADTKD due to UMOD and MUC1 clinical investigation Inclusion criteria for ADTKD: - Family history compa ble with autosomal dominant inheritance of CKD fulfilling the clinical characteris cs of ADTKD - In absence of a posi ve family history of CKD: • Demonstra on of tubulointers al damage on kidney biopsy or • History of early-onset hyperuricemia and/or gout Exclusion criteria: - Different gene c diagnosis (non-ADTKD) - Enlarged cys c kidneys - Proteinuria (> 1 g/24 h) and/or consistent hematuria - Longstanding/uncontrolled diabetes mellitus/arterial hypertension N = 429 families (n = 451 pa ents) from US registry N = 156 families (n = 275 pa ents) from Belgo-Swiss registry Interna onal ADTKD Cohort (N = 585; n = 726) First screening: UMOD muta ons First screening: MUC1 muta ons N = 562; n = 703 N = 23; n = 23 + ADTKD-UMOD N = 216/562 (38.4%) – n = 303/703 (43.1%) UMOD-nega ve N = 346/562 (61.6%) n = 400/703 (56.9%) UMOD-nega ve – MUC1-nega ve N = 141; n = 182 N = 2; n = 2 Second screening: MUC1 muta ons N = 205; n = 218 + ADTKD-MUC1 in UMOD-nega ve N = 72/205 (35.1%) n = 83/218 (38.1%) + ADTKD-MUC1 total: N = 93; n = 104 – UMOD- and MUC1-nega ve N = 133; n = 135 Figure 1 | Design and flowchart of mutation detection in the International ADTKD Cohort. Clinical characteristics of autosomal dominant tubulointerstitial kidney disease (ADTKD) are based on the Kidney Disease: Improving Global Outcomes consensus report2; see the Methods for more details. CKD, chronic kidney disease; n, number of patients; N, number of families. common type of UMOD mutations (101 of 106, 95.3%). Four We detected 2 families with genetically proven de novo different deletions (H177-R185del, E188-L221del, K246- UMOD mutations c.855C>A (p.A285E) and c.707C>T S252del, Y272del) and 1 indel (V93-G97del4ins) mutations (p.P236L) and 1 family with clinically suspected neo- were found. Of 106 mutations, 95 (89.6%) were clustered in mutation c.707C>T (p.P236L). We did not detect UMOD exon 3 of the UMOD gene. Of the 101 missense mutations, 57 mutations in the homozygous state. (56.4%) involved cysteine bonds, either by substituting a Four different types of MUC1 mutations (27dupC, 28dupA, cysteine residue by another amino acid or by inserting a new 26_27insG, 23delinsAT) in the VNTR domain of MUC1 were cysteine (Figure 2b). Among the 17 mutations not described detected in this cohort (nomenclature based on the mutation before (Supplementary Table S1), 6 involve a previously re- position inside the canonical 60 nucleotide-long wild-type ported amino acid (N85S, C92G, C120R, C135W, V273L, VNTR repeat as identified by MUC1 VNTR sequencing7). C300S); 2 (Y272del, G201D) were validated in segregation Their localization inside the MUC1 VNTR as well as their effect analyses; and 1 (L284P) was clearly associated with ER reten- on the MUC1 structure are shown in Figure 2c. All these tion in functional studies, similar to paradigm mutation C150S mutations are predicted to lead to the same frameshift and (Supplementary Figure S1), along with family history (3 gen- premature stop codon.7 Among the 93 families with ADTKD- erations with CKD and gout, bland urine sediment) and the MUC1, 87 presented with a cytosine duplication (27dupC, absence of this substitution in the Genome Aggregation Data- 93.5%), 3 with an adenine duplication (28dupA, 3.2%), 2 with base. Using in silico prediction tools, the remaining 8 mutations a guanine insertion (26_27insG, 2.2%), and 1 with a small were predicted to be disease-causing (Supplementary Table S2). indel (23delinsAT, 1.1%) (Figure 2d). Kidney International (2020) 98, 717–731 719 clinical investigation E Olinger et al.: ADTKD due to UMOD and MUC1 Table 1 | Clinical and genetic characteristics of patients with ADTKD International ADTKD Belgo-Swiss ADTKD US ADTKD Characteristic Cohort (N [ 726) registry (n [ 275) registry (n [ 451) n (BE-CH/US) Number of families 585 156 429 Sex, female 332/726 (46) 115/275 (42) 217/451 (48) Age at presentation (yr) 45 (31, 58) 34 (22, 49) 49 (37, 62) 174/377 Positive family history, gout and/or CKD 625/679 (92) 191/227 (84) 434/451 (96) eGFR at diagnosis (ml/min) 44.3  30.0 45.1  20.9 43.8  34.3 137/229 CKD 492/586 (84) 205/258 (80) 287/328 (88) ESKD 216/503 (43) 70/258 (27) 146/245 (60) Age at ESKD (yr) 44 (32, 55) 44 (33, 56) 44 (32, 55) 245/146 Serum uric acid (mmol/l) 472  141 479  145 455  128 173/74 Female 452  149 457  158 443  129 67/33 Male 485  134 494  135 464  129 106/41 Gout 305/461 (66) 130/218 (60) 175/243 (72) Female 98/256 (38) 40/91 (44) 58/165 (35) Male 207/305 (68) 90/127 (71) 117/178 (66) Age at gout onset (yr) 30 (20, 45) 31 (20, 47) 30 (21, 40) 235/160 Female 35 (22, 50) 40 (23, 56) 35 (22, 50) 98/55 Male 28 (20, 40) 30 (20, 41) 28 (20, 40) 135/105 UMOD mutations 216/562 (38.4) 54/156 (34.6) 162/406 (40.0) ADTKD, autosomal dominant tubulointerstitial kidney disease; BE-CH, Belgo-Swiss; CKD, chronic kidney disease; eGFR, estimated glomerular filtration rate; ESKD, end-stage kidney disease. Quantitative parameters are presented as medians (interquartile ranges) or means  SD. Qualitative parameters are presented as fractions with percentages. n (BE-CH/US) denotes the number of patients from the Belgo-Swiss and US registries analyzed for the respective parameter. Clinical characteristics of ADTKD-UMOD and ADTKD-MUC1 95% CI: 27.3–32.7 in ADTKD-UMOD vs. 67 years, 95% CI: The size of the International ADTKD Cohort allowed us to 57.9–76.1 in ADTKD-MUC1, log rank test: P < 0.001) analyze the clinical characteristics of ADTKD-UMOD and (Figure 4b). ADTKD-MUC1 subtypes (Figure 3). Age at presentation (first Among patients with ADTKD-UMOD, carriers of patient contact) was earlier (median: 42 years [interquartile missense mutations involving cysteines (either by substituting range (IQR): 27, 53] vs. 47 years [IQR: 37, 57], P ¼ 0.005) a cysteine residue by another amino acid or by inserting a new and a positive family history of CKD and/or gout was more cysteine) did not experience a worse prognosis in terms of frequent (95% vs. 86%, P ¼ 0.007) in patients with ADTKD- onset of ESKD or age of gout onset when compared with UMOD than in patients with ADTKD-MUC1. While the patients with non-cysteine-involving ADTKD-UMOD overall prevalence of CKD was significantly higher in patients (Supplementary Figure S2). with ADTKD-UMOD, ESKD was significantly more prevalent Comparing ADTKD-UMOD with ADTKD–NOS (not (44% vs. 58%, P ¼ 0.04) and of earlier onset (median: 46 otherwise specified, i.e., no mutation detected) in the US years [IQR: 39, 57] vs. 36 years [IQR: 30, 46], P < 0.001) in ADTKD registry, we found that CKD (94.0% vs. 82.7%, P < patients with ADTKD-MUC1 (Figure 3b, upper panel). 0.001) and ESKD (46.5% vs. 26.2%, P < 0.001) were more Conversely, the prevalence of gout was significantly higher prevalent and the estimated glomerular filtration rate (eGFR) (79% vs. 26%, P < 0.001) and gout onset was significantly at diagnosis lower (34.7 ml/min vs. 48.1 ml/min, P < 0.001) earlier (median: 27 years [IQR: 19, 37] vs. 45 years [IQR: 29, in ADTKD-UMOD versus ADTKD–NOS, respectively. 51], P ¼ 0.001) in patients with ADTKD-UMOD (Figure 3b, Similarly, CKD and ESKD were more prevalent in ADTKD- lower panel). These findings were generally consistent in both MUC1 than in ADTKD–NOS (86.4% vs. 82.7%, P < 0.001 sexes. In patients with ADTKD-UMOD, gout onset was and 54.8% vs. 26.2%, P < 0.001, respectively) significantly earlier in men than in women (median: 26 years (Supplementary Table S3). These findings suggest a more [IQR: 18, 34] vs. 30 years [IQR: 21, 43], P ¼ 0.013) severe kidney phenotype in ADTKD-UMOD and ADTKD- (Figure 3a). MUC1 than in ADTKD cases without genetic diagnosis—a The key differences in terms of renal function and uric acid finding confirmed in the Belgo-Swiss registry. handling were substantiated by survival curves depicting freedom from ESKD and gout (Figure 4). Renal survival was UMOD biology in ADTKD-UMOD and ADTKD-MUC1 significantly shorter in ADTKD-MUC1 than in ADTKD- Given the colocalization of MUC1 with UMOD in the kidney UMOD (median: 54 years, 95% confidence interval [CI]: tubule6 and the fact that MUC1fs accumulates in several tissues 51.5–56.5 in ADTKD-UMOD vs. 46 years, 95% CI: 39.3–52.7 without causing extrarenal manifestations,7 we tested the hy- in ADTKD-MUC1, log rank test: P ¼ 0.013) (Figure 4a). pothesis that MUC1fs might interact with UMOD processing Conversely, gout-free survival was dramatically shorter in in the thick ascending limb (TAL) in ADTKD-MUC1. We used ADTKD-UMOD than in ADTKD-MUC1 (median: 30 years, a validated enzyme-linked immunosorbent assay21 to assess the 720 Kidney International (2020) 98, 717–731 E Olinger et al.: ADTKD due to UMOD and MUC1 clinical investigation a C32Y, C32W, C41Y, C52S, C52Y, C63S, C150S, C170Y, W202C, C217G, C217R, C297W b Indel C69R, N76K/C77G, C77R,C77Y, C83R, C92G, C92R, C92Y, C174R, W184C, R185C, C195Y C223Y, S237C, C248W, G253C, W258C, C267F, C297Y C300G 4.7% C94W, G103C, C106F, G269C, G270C, C282R, C300S C106G, C106Y, C112R, C282S, Y286C, C287Y C315R C120R, C126R, C135F, C315Y C135S, C135W, C135Y, G153G, D160H, G201D, W202S, Y203D, C317Y C148R, C148S, C148Y D172H, P173L, R204G, R204P, G210S, R178P, L180P, R222P, T225K, T225M, E34K, A39T, G55S, L180V, R185G, M229R, W230R, P236L, D59A, E68K, N85K, R185H, R185S, P236R, P236S, H250L, N85S, N128S D196N, D196Y L257P, V273L, Y274H, A461E T469M, G488R L284P, A285E Q316P I II III D8C D8C IV ZP_N ZP_N ZP N ZP_C ZP ZP_C C Non-Cys Cys K246-S252del 41.5% 53.8% H177-R185del V93-G97del4ins Y272del E188-L221del UMOD (chr 16p12.3) 1 2 3 4 5 6 7 8 9 10 11 Missense 1 kb 95.3% c Signal d 26_27insG Cytoplasm. sequence VNTR 2.2% tail 28dupA 23delinsAT Mucin-1 N-term. SEA TM C-term. 3.2% 1.1% domain MUC1 ch1q22 23delinsAT / 26_27insG / 27dupC / 28dupA Frameshi mucin-1 N-term. C-term. 27dupC VNTR Frameshi VNTR 93.5% Signal Premature sequence stop codon Figure 2 | Spectrum of mutations in UMOD and MUC1. (a) UMOD gene and protein domain structure with the 106 UMOD mutations reported in the international cohort depicted relative to domain localization. Mutations involving cysteine residues are indicated in italics, on top of each box. (b) The prevalence of different UMOD mutations: missense mutations (101 of 106; 95.3%), affecting cysteine ([Cys]; 57 of 106; 53.8%) or noncysteine (44 of 106; 41.5%) amino acids and indels (5 of 106; 4.7%). (c) MUC1 gene exon-intron structure (middle panel) and normal protein structure (above) with the 4 detected mutations (in red) in the variable number tandem repeat (VNTR) domain and the consequence on protein structure (below). (d) Prevalence of identified MUC1 mutations in reported families with autosomal dominant tubulointerstitial kidney disease (ADTKD)–MUC1. SEA, self-cleavage module; term, terminal; TM, transmembrane domain. levels of urinary UMOD in a population-based cohort 14.7 mg/g creatinine, P ¼ 0.99) (Figure 5a, left panel). (Cohorte Lausannoise), confirming the positive correlation Normalizing urinary UMOD levels to eGFR [(mg/g creati- between urinary UMOD (mg/g creatinine) and eGFR between nine)/eGFR] confirmed strongly reduced levels in patients with 15 and 90 ml/min per 1.73 m2 (test for linear trend: P ¼ 0.001) ADTKD-UMOD versus in controls (n ¼ 2717) with eGFR (Supplementary Figure S3A), as previously described.22 spanning 15 to 90 ml/min per 1.73 m2 {[(0.05 vs. 0.23 mg/g Normalizing urinary UMOD for eGFR (by dividing UMOD creatinine)/eGFR], P < 0.0001, respectively}, in contrast with concentrations by urinary creatinine and by eGFR) mitigated unchanged levels in patients with ADTKD-MUC1 versus in the linear dependency (test for linear trend: P ¼ 0.54) controls {[(0.29 vs. 0.23 mg/g creatinine)/eGFR], P ¼ 0.29, (Supplementary Figure S3B), allowing a more robust com- respectively} (Figure 5a, right panel). parison of urinary UMOD levels between patients and con- Next, we performed immunofluorescence staining for trols. We next measured urinary UMOD levels in patients with UMOD on kidney biopsies from healthy individuals (normal ADTKD-MUC1 and ADTKD-UMOD compared with levels in human kidney), from 2 patients with ADTKD-UMOD, and controls (n ¼ 180) from the population-based cohort strictly from 2 patients with ADTKD-MUC1. While we were able to matched for eGFR (45–60 ml/min per 1.73 m2). In contrast to see the characteristic intracellular UMOD deposits in the pa- patients with ADTKD-UMOD, who showed strongly reduced tients with ADTKD-UMOD, UMOD staining was largely urinary UMOD levels (median: 2.8 vs. 14.7 mg/g creatinine, confined to the apical membrane in patients with ADTKD- P < 0.0001), patients with ADTKD-MUC1 showed urinary MUC1, similar to the pattern observed in normal kidney levels of UMOD similar to those of controls (median: 15.7 vs. (Figure 5b). The accumulation of mutant UMOD in the TAL Kidney International (2020) 98, 717–731 721 clinical investigation E Olinger et al.: ADTKD due to UMOD and MUC1 a ADTKD-UMOD ADTKD-MUC1 n (UMOD/MUC1) P value b 100 (n = 303) (n = 104) **** Number of families 216 93 Sex (%) 257/80 1.0 80 - Female 130 (51) 40 (50) Age at ESKD (yr) - Male 127 (49) 40 (50) 60 Age at presentaon (yr) 42 (27, 53) 47 (37, 57) 218/78 0.005 Posive family history, gout and/or CKD (%) 243/257 (95) 69/80 (86) 0.007 eGFR at presentaon (ml/min) 39.2 ± 20.3 50 ± 51.9 136/52 0.157 40 CKD (%) 231/257 (90) 53/80 (66) < 0.001 ESKD (%) 112/257 (44) 46/80 (58) 0.04 20 - Age at ESKD (yr) 46 (39, 57) 36 (30, 46) 224/80 < 0.0001 - Female 44 (40, 55) 34 (28, 46) 117/40 0.002 - Male 50 (39, 58) 39 (32, 47) 107/40 0.007 0 #0.349 $0.46 ADTKD-UMOD Serum uric acid (μmol/l ) 497.9 ± 136.6 443.6 ± 121.7 110/14 0.159 ADTKD-MUC1 - Female 478.7 ± 133.2 418.7 ± 136.1 53/5 0.341 100 - Male 515.7 ± 138.5 457.4 ± 119.2 57/9 0.237 *** #0.158 $0.590 80 Age at gout onset (yr) Gout (%) 202/257 (79) 21/80 (26) < 0.001 - Female 96/130 (74) 4/40 (10) < 0.001 - Male 106/127 (83) 17/40 (43) < 0.001 60 #0.069 $0.001 40 Age at gout onset (yr) 27 (19, 37) 45 (29, 51) 199/18 0.001 - Female 30 (21, 43) 28 (21, 41) 93/4 0.828 - Male 26 (18, 34) 45 (33, 54) 106/14 < 0.001 20 #0.013 $0.10 0 Figure 3 | Clinical characteristics of autosomal dominant tubulointerstitial kidney disease (ADTKD)–UMOD and ADTKD-MUC1. (a) Quantitative parameters are presented as medians and interquartile ranges or means  SD. Qualitative parameters are presented as fractions with percentages. c2 test for categorial variables and Mann-Whitney U test and unpaired t test for quantitative parameters were used. #,$ Sex comparison within ADTKD-UMOD and ADTKD-MUC1, respectively. The n (UMOD/MUC1) column denotes the number of patients with ADTKD-UMOD and ADTKD-MUC1 analyzed for the respective parameter. (b) Scatter plots for age at end-stage kidney disease (ESKD) and onset of gout for patients with ADTKD-UMOD and ADTKD-MUC1. Bars indicate means  SD. ***P < 0.001, ****P < 0.0001. CKD, chronic kidney disease; eGFR, estimated glomerular filtration rate. cells from patients with ADTKD-UMOD induced ER stress, as  153.4 mmol/l, P ¼ 0.017); and an earlier onset of gout shown by colocalization with the unfolded protein response (median: 24 years vs. 33 years, P ¼ 0.001). Of note, the regulator glucose-regulated protein 78 ([GRP78], also known prevalence of renal cysts, as detected by sonography and/or as binding Ig protein). Conversely, GRP78 could not be computed tomography or magnetic resonance imaging, was detected in the TALs of patients with ADTKD-MUC1 lower in patients with ADTKD-UMOD compared with in (Figure 5b; Supplementary Figure S4). patients who were UMOD-negative (36% vs. 57%, P ¼ 0.001) (Supplementary Figure S6). Establishment of a clinical UMOD-score in the Belgo-Swiss The weighted UMOD-score was developed on 8 items ADTKD registry using these discriminative clinical, biochemical, histological, Based on the Belgo-Swiss ADTKD registry with detailed and imaging characteristics of ADTKD-UMOD (Figure 6a). phenotyping, including 54 families that are UMOD-positive The maximal item value of þ3 points was attributed to gout (n ¼ 132 patients) and 102 families that are UMOD-negative before 30 years and uricemia >500 mmol/l, which are the (n ¼ 143 patients) (Figure 1; Supplementary Figure S5), we most specific discriminants (Supplementary Figure S6). designed a clinical score to estimate the probability of Because the prevalence of CKD and autosomal dominant ADTKD-UMOD. Clinical characteristics in patients with inheritance was higher in ADTKD-UMOD, these criteria were ADTKD with or without UMOD mutations guided the weighted with þ2 points. Clinical findings suggesting an scoring system (Supplementary Figure S6). Compared with alternative diagnosis (e.g., proteinuria, uncontrolled hyper- patients who are UMOD-negative, patients with a UMOD tension) were attributed negative points. Values for each mutation had a more frequent family history of CKD and/or available item are added to obtain a final additive score for gout (90% vs. 76%, P < 0.001); a higher prevalence of CKD each patient. The clinical UMOD-score was applied on pa- (83% vs. 75%, P ¼ 0.03) and ESKD (33% vs. 20%, P ¼ 0.02), tients with ADTKD from the Belgo-Swiss registry, for which with earlier onset of CKD (median: 32 years vs. 42 years, P ¼ information for at least 5 of the 8 items were present (n ¼ 211 0.002) and ESKD (median: 42 years vs. 48 years, P ¼ 0.007); a patients: 106 UMOD-positive and 105 UMOD-negative). The higher level of serum uric acid (mean: 507.0  131 vs. 454.5 receiver-operating characteristics curve, with UMOD 722 Kidney International (2020) 98, 717–731 E Olinger et al.: ADTKD due to UMOD and MUC1 clinical investigation ADTKD-UMOD (n = 257) ADTKD-UMOD censored ADTKD-MUC1 (n = 80) ADTKD-MUC1 censored a b P = 0.013 P < 0.001 Freedom from ESKD Freedom from gout Time to ESKD (yr) Time to gout (yr) Figure 4 | Freedom from end-stage kidney disease (ESKD) and gout in autosomal dominant tubulointerstitial kidney disease (ADTKD)–UMOD and ADTKD-MUC1. (a) Kaplan-Meier curve of renal survival in patients with ADTKD-UMOD and ADTKD-MUC1. Median renal survival was 54 years (95% confidence interval [CI]: 51.5–56.5) in ADTKD-UMOD and 46 years (95% CI: 39.3–52.7) in ADTKD-MUC1. (b) Kaplan- Meier gout-free survival curve in patients with ADTKD-UMOD and ADTKD-MUC1. Median gout-free survival was 30 years (95% CI: 27.3–32.7) in ADTKD-UMOD and 67 years (95% CI: 57.9–76.1) in ADTKD-MUC1. Log rank test was used. Censored: event of interest has not occurred during the follow-up time. mutation status as the dependent variable yielded an area were available. The clinical UMOD-score alone separated the under the curve (AUC) of 0.72 (95% CI: 0.66–0.79, P < 2 entities with an AUC of 0.69 (95% CI: 0.62–0.77, P ¼ 0.037) 0.001) (Figure 6b). The UMOD-score cut-off of $5 was (Figure 7a, left panel). However, the specificity for UMOD selected, yielding a sensitivity of 98.1% and specificity of increased considerably with higher UMOD-score values (for 41.4% for positive UMOD mutation testing, corresponding to instance, a score $8 had a sensitivity of 48.8%, a specificity of a negative predictive value (NPV) of 94.3% and a positive 83.7%, an NPV of 50.8% and a PPV of 81.3% for UMOD predictive value (PPV) of 59.1% (Figure 6c; Supplementary mutation) (Supplementary Table S5). Only a few patients, Table S4). This cut-off also proved to be optimal for group mostly those with ADTKD-MUC1, had score results of <5 discrimination corresponding to a Youden index (Figure 7a, right panel). (sensitivity þ specificity  1) of 0.395 (Supplementary We next investigated whether addition of urinary UMOD Table S4). levels to the clinical score improved its ability to discriminate ADTKD-UMOD from ADTKD-MUC1. Based on the UMOD-score and urine UMOD levels to guide genetic testing normalized urinary UMOD values in the reference popula- in ADTKD tion [(mg/g creatinine)/eGFR] (Figure 5a, right panel), we The score was validated in patients that were UMOD-positive assigned, respectively, þ1 and þ3 points for urinary UMOD (n ¼ 124) and UMOD-negative (n ¼ 183) from the US values between the median and 25th percentile [(0.14–0.23 ADTKD registry, yielding similarly high sensitivity and low mg/g creatinine)/eGFR] and below the 25th percentile. specificity for UMOD mutations using a cut-off of $5 Similarly, we assigned, respectively, 1 and 3 points for (sensitivity: 97.6%, specificity: 16.4%, NPV: 91.0%, PPV: urinary UMOD values between the median and 75th 44.2%, data not shown), altogether making ADTKD-UMOD percentile [(0.23–0.35 mg/g creatinine)/eGFR] and above the very unlikely for score results <5. We tested how the clinical 75th percentile. Applied to a cohort of 51 patients with score separated the 2 most common etiologies of ADTKD in a ADTKD-UMOD and 35 patients with ADTKD-MUC1 for subset of patients with ADTKD-UMOD (n ¼ 125) and which urinary UMOD data were available, this combined ADTKD-MUC1 (n ¼ 80) from the US registry for which at clinical and biochemical score separated ADTKD-UMOD least 5 of the 8 clinical items and/or urinary UMOD levels from ADTKD-MUC1 with an improved AUC of 0.89 (95% Kidney International (2020) 98, 717–731 723 clinical investigation E Olinger et al.: ADTKD due to UMOD and MUC1 a *** b 50 0.8 NS *** Urinary uromodulin (mg/g creat) normalized to eGFR *** 0.7 40 NS *** 0.6 Urinary uromodulin (mg/g creat) 0.5 30 0.4 0.35 20 0.3 0.23 0.2 10 0.14 0.1 0 0.0 Urinary uromodulin Urinary uromodulin /creanine /creanine and eGFR Controls (n = 180) Controls (n = 2717) eGFR: 55.5 (51.7, 58.0) eGFR: 78.0 (70.3, 84.1) uUMOD: 14.7 (8.6, 22.6) uUMOD: 0.23 (0.14, 0.35) ADTKD-MUC1 (n = 35) ADTKD-MUC1 (n = 35) eGFR: 55.1 (45.0, 68.3) eGFR: 55.1 (45.0, 68.3) uUMOD: 15.7 (9.7, 22.0) uUMOD: 0.29 (0.22, 0.36) ADTKD-UMOD (n = 51) ADTKD-UMOD (n = 53) eGFR: 51.6 (37.0, 69.2) eGFR: 53.5 (37.0, 73.6) uUMOD: 2.8 (1.1, 5.9) uUMOD: 0.052 (0.029, 0.10) Figure 5 | UMOD processing in autosomal dominant tubulointerstitial kidney disease (ADTKD)–UMOD and ADTKD-MUC1. (a) Urinary UMOD excretion normalized to urinary creatinine (creat) (left panel) and normalized to urinary creatinine and estimated glomerular filtration rate (eGFR) (right panel) in patients with ADTKD-MUC1and ADTKD-UMOD and a reference population (controls). Median, 25th percentile, and 75th percentile values in the reference population are indicated (right panel). Numerical values (medians and interquartile ranges) for urinary UMOD (uUMOD), eGFR, and sample size are below the graph. Outlier removed with GraphPad (ROUT Q ¼ 1%), 1-way analysis of variance P < 0.0001 for both graphs, and Tukey’s multiple comparison test was applied with not significant (NS) and ***P < 0.0001. (b) Immunofluorescence staining for UMOD (green) and glucose-regulated protein 78 (GRP78; red) in ADTKD-MUC1, ADTKD-UMOD, and normal human kidney (NHK) biopsy. Bars ¼ 50 mm. DAPI, 40 ,6-diamidino-2-phenylindole. To optimize viewing of this image, please see the online version of this article at www.kidney-international.org. CI: 0.82–0.96, P < 0.001). The cut-off value of $5 still ap- frequent subtype of ADTKD with an estimated prevalence pears as the optimal cut-off value to discriminate ADTKD- of 37.1%, followed by ADTKD-MUC1 in 35.1% of fam- UMOD from ADTKD-MUC1 (Youden index: 0.684) with a ilies that are UMOD-negative, and an estimated overall sensitivity of 94.1%, a specificity of 74.3%, an NPV of 89.7%, prevalence of 21.0%. Of note, a systematic effort to screen and a PPV of 84.2% for a UMOD mutation (Figure 7b; for mutations in HNF1B, REN, DNAJB11, and SEC61A1 is Supplementary Table S5). Based on the clinical and ongoing in the 133 families that are UMOD- negative and biochemical UMOD-score, we suggest a diagnostic algorithm MUC1-negative and for mutations in MUC1 in the 141 to guide genetic testing in ADTKD (Figure 8).1,23,24 families that are UMOD-negative in the registry. Based on the large sample size, we observed distinct fea- DISCUSSION tures in the clinical presentation of ADTKD-UMOD and This international cohort study represents the largest ADTKD-MUC1, with relevance for clinical practice and pa- dataset of patients with ADTKD-UMOD and ADTKD- tient counselling. Kidney disease appears more severe in pa- MUC1 reported to date, providing new insights into the tients with ADTKD-MUC1, with a higher prevalence of phenotype and disease progression of the main subtypes ESKD (58% vs. 44% in ADTKD-UMOD, P ¼ 0.04), an earlier of ADTKD. Because of the autosomal dominant inheri- onset of ESKD (36 years vs. 46 years in ADTKD-UMOD, P < tance and regional familial clustering, considerable differ- 0.001), and a shorter median renal survival (46 years vs. 54 ences in the prevalence of ADTKD subgroups are years in ADTKD-UMOD, P ¼ 0.013). Previous studies re- mentioned in national cohorts.2,15,20 In the International ported an older age at ESKD (mean: 44.9 years) in patients ADTKD Cohort, ADTKD-UMOD represents the most with ADTKD-MUC1,8 which could be explained by inclusion 724 Kidney International (2020) 98, 717–731 E Olinger et al.: ADTKD due to UMOD and MUC1 clinical investigation a Clinical UMOD-score Characteriscs Item Value Family history of CKD or early gout (<40 yr) compable with autosomal +2 dominant inheritance CKD of unknown origina +2 <30 yr +3 Age at gout onset >30 yr +1 >500 μmol/l (>8.41 mg/dl) +3 Serum uric acid <500 μmol/l (<8.41 mg/dl) +1 Histological findings compable with ADTKDb +2 Proteinuria/hematuriac –1 Diabetes/uncontrolled hypertensiond –1 Renal cysts/enlarged kidneyse –1 b c UMOD-posive UMOD-negave AUC = 0.72 (95% CI: 0.66–0.79) UMOD-score Sensivity 1–specificity Count Count Figure 6 | Clinical UMOD-score and performance in the Belgo-Swiss ADTKD registry. (a) Clinical UMOD-score based on clinical, biochemical, histological, and imaging data. Attributed points for specific characteristics are shown on the right. aAfter routine work-up including urinary sediment and urinalysis and kidney imaging. bInterstitial fibrosis, tubular atrophy, thickening and lamellation of tubular basement membranes, tubular dilatation (microcysts), negative immunofluorescence for complement, and Igs. cProteinuria >300 mg/dl, persistent hematuria (both eumorphic and dysmorphic) in repeated urinalysis. dHemoglobin A1c >10% or repeated blood pressure measurements > 160/100 mm Hg and/or corresponding clinical findings of hypertensive cardiopathy and/or nephropathy. eAt least 1 cyst at any location diagnosed by ultrasonography, computed tomography scan, or magnetic resonance imaging. Example: 35-year-old patient, gout onset at 32 years (þ1); serum uric acid 550 mmol/l (þ3); estimated glomerular filtration rate 55 ml/min per 1.73 m2, bland urine analysis and sediment, kidneys without cysts and normal size on magnetic resonance imaging, no diabetes or hypertension (þ2 for chronic kidney disease [CKD] of unknown origin); and family history of CKD documented on 3 generations (þ2) yields a total clinical UMOD-score of 8 points. (b) Receiver-operating characteristics curve of the clinical UMOD-score in the Belgo-Swiss registry (n ¼ 211 patients with autosomal dominant tubulointerstitial kidney disease [ADTKD] with available data) are as follows: area under the curve (AUC): 0.72; 95% confidence interval (CI): 0.66–0.79; P < 0.001; the cut-off value of $5 has a sensitivity of 98.1% and specificity of 41.4% for UMOD mutation; negative predictive value: 94.3%; positive predictive value: 59.1%. (c) Histogram of clinical UMOD-score results in patient who are UMOD-positive (n ¼ 106) and UMOD- negative (n ¼ 105). The red horizontal line indicates the cut-off value of 5. of historically affected patients (clinically affected relatives of described in patients with ADTKD-UMOD, most likely genetically diagnosed patients), whereas we only included because of impaired activity of TAL-based Naþ-Kþ-2Cl- individuals with an established genetic diagnosis. The het- cotransporter.15,17 Plasma volume contraction and compen- erogeneity of ADTKD-MUC1 in terms of CKD and/or renal satory higher reabsorption activity of the proximal tubule disease progression is intriguing and suggests considerable including upregulation of Naþ-coupled urate transporters modifier effects. most likely explain the hyperuricemia phenotype in Gout has been classically described in patients with ADTKD-UMOD.25,26 A similar mechanism was shown in UMOD mutations. Indeed, our data suggest that gout is aged Umod knockout mice that displayed reduced activity strikingly more prevalent and of significantly earlier onset in of the Naþ-Kþ-2Cl-cotransporter.26 Even though ADTKD- ADTKD-UMOD than in ADTKD-MUC1. Defective urinary MUC1 presumably originates from the distal tubule, gout was concentration resulting in polydipsia and polyuria has been considerably less prevalent in this disorder. Kidney International (2020) 98, 717–731 725 clinical investigation E Olinger et al.: ADTKD due to UMOD and MUC1 Figure 7 | UMOD-score comparing autosomal dominant tubulointerstitial kidney disease (ADTKD)–UMOD versus ADTKD-MUC1 in the US ADTKD registry. (a, left panel) Receiver-operating characteristics curve of the clinical UMOD-score in the US registry (n ¼ 205 patients with ADTKD-UMOD and ADTKD-MUC1 with available data) are as follows: area under the curve (AUC): 0.69; 95% confidence interval (CI): 0.62–0.77; P < 0.037. A cut-off value of $8 has a sensitivity of 48.8% and specificity of 83.7% for UMOD mutations, while a cut-off value of $5 has a sensitivity of 97.6% and specificity of 15.0% for UMOD mutations. (a, right panel) Histogram of clinical UMOD-score results in patients with ADTKD-UMOD (n ¼ 125) and ADTKD-MUC1 (n ¼ 80). (b, left panel) Receiver-operating characteristics curve of the clinical UMOD-score including urine UMOD levels in the US registry (n ¼ 86 patients with ADTKD-UMOD and ADTKD-MUC1 with available urinary UMOD data) are as follows: AUC: 0.89; 95% CI: 0.82–0.96; P < 0.001. The cut-off value of $5 has the highest Youden index for discrimination (0.684) and has a sensitivity of 94.1% and specificity of 74.3% for UMOD mutation; negative predictive value: 89.7%; positive predictive value: 84.2%. (b, right panel) Histogram of clinical þ urinary UMOD-score results in patients with ADTKD-UMOD (n ¼ 51) and ADTKD-MUC1 (n ¼ 35). The red horizontal line indicates the cut-off value of 5. Q, quartile. We investigated 2 cardinal biological features described in kidney biopsies revealed a normal distribution of UMOD in ADTKD-UMOD with likely pathophysiological relevance: TAL cells, without evidence for ER stress (GRP78 expression), aberration in UMOD export mechanisms and induction of which is a hallmark of ADTKD-UMOD. These novel findings ER stress. Based on the observation that MUC1 is expressed suggest that the processing of UMOD is not altered in in the distal kidney tubule including the TAL where it ADTKD-MUC1 and that ER stress is not a main finding in colocalizes with UMOD6 and on the observation that ADTKD-MUC1. Along the same line, a recent study found MUC1fs is accumulating in other MUC1-expressing tissues entrapment of MUC1fs in vesicles of the early secretory (skin, breast, lung, colon) without causing extrarenal mani- pathway in models of ADTKD-MUC1.19 festations,7 one could hypothesize that MUC1fs might Previous reports described intracellular accumulation of interact with UMOD in TAL. Yet, in contrast to ADTKD- UMOD in kidney biopsies from patients with ADTKD- UMOD, we found no difference in the urinary level of UMOD.1,2 However, such staining is not available in a large UMOD between patients with ADTKD-MUC1 and the number of patients, preventing us from speculating on its normal population. Furthermore, analysis of MUC1-mutant value in clinical decision making. In our experience, the 726 Kidney International (2020) 98, 717–731 E Olinger et al.: ADTKD due to UMOD and MUC1 clinical investigation Criteria for suspecng a diagnosis of ADTKD – Family history compable with autosomal dominant inheritance of CKD fulfilling the clinical characteriscs of ADTKDa – In absence of a posive family history of CKD: • Demonstraon of tubulointersal damage on kidney biopsy or • History of early-onset hyperuricemia and/or gout Clinical UMOD-score ≥8 5–7 <5 Urine uromodulin Clinical UMOD-score + not available urinary uromodulinb ≥5 <5 UMOD gene analysis Posive Negave Test for MUC1 or other ADTKD genes or consider alternave diagnosisc Figure 8 | Diagnostic algorithm for suspected autosomal dominant tubulointerstitial kidney disease (ADTKD) based on clinical UMOD-score and urinary UMOD levels. aProgressive loss of renal function, bland urinary sediment, normal-to-mild albuminuria and/or proteinuria, normal-sized kidneys on ultrasound, and no consumption of drugs linked to tubulointerstitial nephritis. bAssessed by validated enzyme-linked immunosorbent assay and normalized to urinary creatinine and estimated glomerular filtration rate. Obtained values should be interpreted against family members who are UMOD-negative or reference populations.23,24 See Results and Discussion sections for more details. cFor diagnostic algorithm including other ADTKD genes, refer to Devuyst et al.1 Alternative diagnoses include nephronophthisis (autosomal recessive), autosomal dominant polycystic kidney disease (large cystic kidneys), autosomal dominant glomerulopathies (proteinuria and/or hematuria), other causes of tubulointerstitial kidney disease (autoimmune, tubulointerstitial nephritis, and uveitis syndrome) including drugs and toxins (nonsteriodal anti-inflammatory drugs, aristolochic acid, calcineurin inhibitors, lithium). CKD, chronic kidney disease. UMOD staining is operator-dependent, requiring rigorous validated diagnostic or genetic algorithm due to unappreci- positive and negative controls, and it might depend on the ated clinical differences between ADTKD subtypes, and (iii) underlying UMOD mutation. Furthermore, the availability of missing disease biomarkers due to small and scattered disease kidney biopsies is restricted. The assessment of urinary cohorts. For everyday practice and cost-effectiveness, practical UMOD levels in patients at time of diagnosis and during tools such as scoring systems are very useful to guide genetic disease progression might offer a noninvasive diagnostic tool testing.1 The Belgo-Swiss registry was instrumental in delin- and biomarker in ADTKD-UMOD. Because urinary UMOD eating a clinical UMOD-score because it revealed key levels show a positive correlation with eGFR (for eGFR <90 discriminatory clinical features, including positive family ml/min per 1.73 m2) and tubular mass,23,24 they need to be history of CKD and/or gout, age at presentation, prevalence of normalized for residual eGFR and interpreted against kidney disease and progression to ESKD, and history of gout. matched controls. Based on data from a large control cohort, Of interest, renal cysts are less common in patients with we show here that urinary UMOD (in mg/g creatinine to ADTKD-UMOD, which is in line with previous studies.8,15,20 account for urine concentration) normalized for eGFR can be The delineated clinical UMOD-score showed an excellent applied in the clinical setting of ADTKD. NPV for UMOD mutations (cut-off $5) in the Belgo-Swiss A recent study based on exome sequencing reported mu- (NPV: 94.3%) and US (NPV: 91.0%) registries. As ADTKD- tations in UMOD accounting for w3% of all patients with a UMOD and ADTKD-MUC1 present considerable clinical genetic finding in this cohort.13 However, considerable hur- overlap, we were not surprised that the clinical UMOD-score dles in the diagnostic approach of ADTKD subtypes persist. separated modestly between these 2 entities (AUC: 0.69). Yet, These include but are not limited to (i) limited availability of higher UMOD-score values showed a solid specificity for MUC1 testing due to technical challenges, (ii) lack of UMOD mutations (e.g., cut-off $8: specificity of 83.7% and Kidney International (2020) 98, 717–731 727 clinical investigation E Olinger et al.: ADTKD due to UMOD and MUC1 PPV of 81.3% for an UMOD mutation). Adding urinary of the 2 most common ADTKD subtypes are hyperuricemia UMOD measurements, a pathophysiological biomarker for and early gout in ADTKD-UMOD and a heterogeneous, but ADTKD-UMOD, considerably increased the discriminating generally more severe kidney disease in ADTKD-MUC1. The power of the score (AUC: 0.89) with a PPV of 84.2% for an clinical UMOD-score is a sensitive and, coupled to urinary UMOD mutation (cut-off $5 points). Because the progres- UMOD levels, potentially specific tool to select patients for sion of kidney disease and the prevalence and onset of gout genetic UMOD testing. These results should help clinicians to seem dependent on the underlying genetic diagnosis, a ge- improve diagnostic rates, clinical management, and patient netic diagnosis is recommended as it might impact on the counselling in ADTKD. management of patients with ADTKD (e.g., follow-up, scheduling of renal transplantation, and gout-preventive METHODS strategies). Furthermore, targeted therapies might be in International ADTKD Cohort reach at least for ADTKD-MUC1. The International ADTKD Cohort consists of patients from the The limits of this study include the retrospective “real-life” Belgo-Swiss ADTKD registry and the US ADTKD registry. The in- cohort design of consecutively recruited patients, with clusion criteria were those defined by the Kidney Disease: Improving Global Outcomes consensus2 and included the following in any inherent difficulties such as limited access to full clinical in- combination: a family history compatible with autosomal dominant formation, missing DNA samples for further genetic testing, inheritance of CKD with features of ADTKD, including progressive and lack of strict inclusion and exclusion criteria. We loss of kidney function, bland urinary sediment, absent-to-mild included all genetically resolved cases of a given family, albuminuria and/or proteinuria, normal-sized or small-sized kid- potentially introducing the risk for selection bias. However, neys on ultrasound; and/or (in absence of a positive family history of we estimate that this represents a negligible risk as in general CKD) a history of early-onset hyperuricemia and/or gout and/or the only 1 to 2 patients were included per family and considerable presence of interstitial fibrosis and/or tubular atrophy on kidney intrafamilial clinical variability exists in ADTKD.8,20 Because biopsy. Exclusion criteria included the following: a different genetic kidney biopsies are rarely performed in these diseases and diagnosis (non-ADTKD), the presence of enlarged cystic kidneys, yield nonspecific findings (e.g., interstitial fibrosis, tubular proteinuria (>1 g/24 h) and/or consistent hematuria, long-standing atrophy), we did not include histopathology information in or uncontrolled diabetes mellitus or arterial hypertension, and the consumption of drugs linked to tubulointerstitial nephritis. Only the analysis. A survey of histopathology results from the patients screened for mutations of UMOD and/or MUC1 were Belgo-Swiss registry showed that interstitial fibrosis with included in the cohort. Anonymized demographics and clinical and tubular atrophy (in w60% of available pathology reports) genetic information were recorded in a database. This study was and interstitial nephritis (in w40% of available pathology approved by the institutional review board of Wake Forest School of reports) were the preponderant histological findings in pa- Medicine), the Université catholique de Louvain (UCL) Medical tients with ADTKD-UMOD and those who were UMOD- School, and the European Community’s Seventh Framework Pro- negative. A more detailed histological description of biopsies gramme “European Consortium for High-Throughput Research in performed in ADTKD-UMOD and ADTKD-MUC1 warrants Rare Kidney Diseases (EURenOmics). a dedicated analysis. Belgo-Swiss ADTKD registry. The Belgo-Swiss ADTKD registry It should be pointed out that systematic screening for includes patients referred to UCLouvain and University of Zurich UMOD mutations in all 10 coding exons has only been per- (UZH) by clinical partners mostly from Europe (Supplementary formed in a subset of patients with ADTKD. Based on pre- Appendix S1). In 2019, the registry included 275 patients who had been enrolled since 2003. The clinical data included a family pedi- vious screens and whole exome sequencing, we estimate that gree, onset and evolution of kidney function decline, onset of hy- very few UMOD mutations outside exons 3 and 4 might have peruricemia and/or gout (age of gout onset was defined as the been missed in ADTKD-UMOD.13,15 Furthermore, large de- patient’s age at the first episode of gouty arthritis) and fractional letions or insertions in UMOD are not detected by direct excretion of uric acid, imaging and histopathology data (where sequencing methods. With the availability of gene panel available), and information on potential extrarenal manifestations testing and next-generation sequencing approaches, the utility (e.g., pancreatic enzymes, liver function tests). ESKD was defined as of a clinical score in directing targeted gene testing will eGFR<10 ml/min or initiation of renal replacement therapy (dialysis probably decrease. However, at the current stage, MUC1 or kidney transplantation). mutations are missed by next-generation sequencing and US ADTKD registry. The US ADTKD registry includes families availability of specialized testing is limited. To the best of our with tubulointerstitial kidney disease referred to Wake Forest School knowledge, clinical-grade genetic testing for MUC1 is only of Medicine since 1999 (Supplementary Appendix S1). Information performed by the Broad Institute. For these reasons, we es- collected included demographics, pedigree, age of ESKD, laboratory values, and ultrasound results. timate that simple clinical and biochemical tools to estimate pretest probability impacts on diagnostic work-up and Genetic testing potentially reduces the costs associated with unjustified Informed written consent was obtained from all patients. Genomic genotyping. DNA was isolated from peripheral blood leukocytes using standard In conclusion, this large international retrospective cohort procedures and DNA was stored at 4  C. study provides a detailed phenotype analysis of patients with Direct sequencing of UMOD exons was initially performed by ADTKD-UMOD and ADTKD-MUC1. The clinical hallmarks Sanger sequencing, as previously described.27 More recently, the 728 Kidney International (2020) 98, 717–731 E Olinger et al.: ADTKD due to UMOD and MUC1 clinical investigation UMOD gene is analyzed by massive parallel sequencing using a Fisher Scientific) following the manufacturer’s protocol and analyzed tubulopathy gene panel designed by the work package tubulopathies 24 hours after transfection. of the European Consortium EURenOmics.28,29 Mutational analysis was carried out in exons 3 and 4 for all enrolled patients and in all 10 Western blot coding exons for a subset of patients. Cells were lysed in octylglucoside lysis buffer (50 mmol/l Tris-HCl, MUC1 genotyping was performed using a MUC1 VNTR pH 7.4, 150 mmol/l NaCl, 60 mmol/l octyl b-D-glucopyranoside, sequencing approach coupled with a spectrometry-based probe 10 mmol/l NaF, 0.5 mmol/l sodium orthovanadate, 1 mmol/l glyc- extension assay as previously described.7,30 MUC1 testing was pro- erophosphate and protease inhibitor cocktail [Sigma-Aldrich, St. vided by the Broad Institute of MIT and Harvard 30 and the First Louis, MO]) for 1 hour at 4  C followed by 10 minutes of centri- Faculty of Medicine, Charles University.7 Nucleotide numbering fugation at 17,000g. Soluble fractions were quantified by the Bio-Rad reflects cDNA numbering with þ1 corresponding to the A of the Protein Assay (Bio-Rad Laboratories, Hercules, CA). Western blot ATG translation initiation codon in the reference sequence experiments were performed as described in Schaeffer et al.32 An- (NM_003361.3). Alamut Visual software (Interactive Biosoftware, tibodies used were mouse purified anti-HA.11 Epitope Tag antibody Rouen, France; www.interactivebiosoftware.com) was used to assist (dilution 1:1000; 901502; BioLegend, San Diego, CA) and mouse in determining variant pathogenicity. Identified variants were suc- monoclonal anti-b-actin (dilution 1:20,000; A2228; Sigma-Aldrich). cessively checked against relevant databases, such as Clinvar (Na- tional Center for Biotechnology Information, Bethesda, MD; https:// Immunofluorescence www.ncbi.nlm.nih.gov/clinvar/), Human Gene Mutation Database Kidney biopsies. Immunodetection of UMOD and GRP78 was (Institute of Medical Genetics in Cardiff, Cardiff, UK; http://www. performed on 5-mm-thick kidney sections obtained from nephrec- hgmd.cf.ac.uk/ac/index.php), VarSome (Saphetor, Lausanne, tomy samples of patients with ADTKD-UMOD (female, 41 years Switzerland; https://varsome.com/), and local databases to assess for old, ESKD; male, 42 years old, ESKD) and ADTKD-MUC1 (female, previous publication. 60 years old, ESKD; male, 47 years old, ESKD). Slides were depar- Variants were considered disease-causing based on previous re- affinized in xylene and rehydrated in a graded ethanol series. Antigen ports, family segregation analysis, or prediction algorithms (Sorting retrieval was carried out for 10 minutes with citrate buffer (pH 6.0) Intolerant from Tolerant [SIFT], Align GVD, mutation taster, and at 98  C. After 20 minutes in blocking solution, slides were incu- Polymorphism Phenotyping v2 [PolyPhen-2]) for pathogenicity. bated overnight with GRP78 primary antibody (1:300; ab21685; The variants were classified according to the guidelines published Abcam, Cambridge, UK), followed by incubation with Alexa- by the American College of Medical Genetics in 2015.31 Variants of Fluor555-conjugated goat anti-rabbit antibody for 45 minutes interest were verified by Sanger sequencing. (1:200; Invitrogen, Thermo Fisher Scientific). The slides were probed with sheep anti- UMOD primary antibody (1:800; K90071C; Me- Measurements of urinary levels of UMOD ridian Life Science Inc., Memphis, TN), followed by AlexaFluor488- A validated enzyme-linked immunosorbent assay method was used conjugated donkey anti-sheep (1:200; Invitrogen). Coverslips were to measure urinary UMOD levels (second morning urine sample) mounted with Prolong gold antifade reagent with 40 ,6-diamidino-2- from 86 patients with ADTKD.21 Urinary creatinine was measured phenylindole (Invitrogen) and analyzed under a Zeiss LSM 510 Meta using a Synchron DXC800 analyzer (Beckman Coulter, Fullerton, Confocal microscope (Carl Zeiss, Jena, Germany) with high nu- CA). The reference samples (n ¼ 2717) were obtained from the merical aperture lenses (Plan-Neofluar 20/0.5). The use of these Cohorte Lausannoise, a population-based study including 6000 samples has been approved by the Université catholique de Louvain people 35 to 75 years of age from the city of Lausanne, Ethical Review Board.33 Switzerland.22 eGFR was calculated using the Chronic Kidney HEK293 cells. Cells grown on coverslip were fixed in 4% Disease Epidemiology Collaboration equation. Informed consent paraformaldehyde for 15 minutes, permeabilized 10 minutes with was obtained from all participating individuals. 0.5% Triton, and blocked 30 minutes with 10% donkey serum. Cells were labelled for 1 hour, 30 minutes at room temperature with a UMOD expression constructs mouse purified anti-HA.11 Epitope Tag antibody (dilution 1:500; cDNA of human wild-type UMOD was cloned in pcDNA 3.1(þ) 901502; BioLegend) and a rabbit polyclonal anti-calreticulin (dilu- (Thermo Fisher Scientific, Waltham, MA) and a hemagglutinin tag tion 1:500; C4606; Sigma-Aldrich) followed by incubation for 1 hour was inserted after the leader peptide in between T26 and S27 in the with the appropriate AlexaFluor conjugated secondary antibodies protein sequence.32 The C150S and L284P mutant isoforms were (dilution 1:500; Thermo Fisher Scientific). Cells were stained with obtained by mutagenesis using the QuikChange Lightning muta- 40 ,6-diamidino-2-phenylindole and mounted using fluorescence genesis kit (Agilent, Santa Clara, CA) following the manufacturer’s mounting medium (Dako; Agilent). All pictures were taken with an instructions. Primers were designed using the software QuikChange UltraVIEW ERS spinning disk confocal microscope (UltraVIEW Primer Design Program (Agilent). Primers used for mutation C150S: ERS-Imaging Suite Software; Zeiss 63X/1.4; PerkinElmer Life and forward (50 /30 ) gatggcactgtgagtcctccccgggctcctg, reverse (50 /30 ) Analytical Sciences, Boston, MA). All images were imported in caggagcccggggaggactcacagtgccac and for mutation L248P: forward Photoshop CS (Adobe Systems, Mountain View, CA) and adjusted (50 /30 ) cccgagtgtcacccggcgtactgcaca, reverse (50 /30 ) for brightness and contrast. tgtgcagtacgccgggtgacactcggg. Generation and validation of the ADTKD UMOD-score Cell culture conditions The weighted UMOD-score was based on ADTKD criteria, specific HEK293 cells were grown in Dulbecco’s modified Eagle’s medium clinical characteristics of ADTKD-UMOD (i.e., early gout onset and supplemented with 10% fetal bovine serum, 200 U/ml penicillin, 200 hyperuricemia), and parameters that are negatively associated with mg/ml streptomycin, and 2 mmol/l glutamine at 37  C, 5% CO2. ADTKD (i.e., providing alternative explanation for CKD: proteinuria HEK293 cells were transfected using Lipofectamine 2000 (Thermo and/or hematuria, diabetes and/or uncontrolled hypertension, renal Kidney International (2020) 98, 717–731 729 clinical investigation E Olinger et al.: ADTKD due to UMOD and MUC1 cysts and/or enlarged kidneys).2,15,20 For weighting the items of the 189044). OD and OB were supported by the Gebert-Rüf Foundation score, we used integer values between 1 and þ3. A score of þ2 was for research on ADTKD-UMOD. JAS is supported by Kidney Research given for the general ADTKD criteria,2 þ1 or þ3 for the UMOD- UK and the Northern Counties Kidney Research Fund. RT is funded by specific clinical and laboratory findings, and 1 for each negatively Instituto de Salud Carlos III: Redes Temáticas de Investigación Cooperativa Red de Investigación Renal (grant RD16/0009) and Fondo associated item. The score was first tested in the Belgo-Swiss ADTKD de Investigación Sanitarias Fondo Europeo de Desarollo Regional registry and validated in the US ADTKD registry. To discriminate (grant PI15/01824, PI18/00362). JM is supported by the Fonds de la ADTKD-UMOD from ADTKD-MUC1, we defined a normal range of Recherche Scientifique–Communauté Française de Belgique. DGF urinary UMOD [(mg/g creatinine)/eGFR] using 2717 urine samples was supported by the Swiss National Centre of Competence in from the general population. Based on the pathophysiology of Research TransCure, the Swiss National Centre of Competence in ADTKD-UMOD, on previous reports,34 as well as on our findings Research Kidney Control of Homeostasis program, and the Swiss (Figure 5a), we assigned, respectively, þ1 and þ3 points for urinary National Science Foundation (grants 31003A_152829 and UMOD values between the median and 25th percentile and below the 33IC30_166785/1). Genetic testing for MUC1 is supported by the Slim 25th percentile of normal urinary UMOD levels. Similarly, we assigned, Initiative for Genomic Medicine in the Americas, a collaboration of the respectively, 1 and 3 points for urinary UMOD values between the Broad Institute with the Carlos Slim Foundation. We thank all participating patients and families. The Cohorte median and 75th percentile and above the 75th percentile of normal Lausannoise is acknowledged for providing reference urine samples urinary UMOD levels. Conceptualization of the score was based on the and eGFR information. We are grateful to Maegan Harden and her previously published hepatocyte nuclear factor 1b score.35 team on the Broad Genomics Platform for expert assistance with genetic testing for MUC1. Statistical analysis Parts of these data were presented as a poster during the 2017 Quantitative parameters are presented as median and IQR (25th, 75th American Society of Nephrology Kidney Week (October 31– percentiles) (for scale variables) or means  SD (for continuous var- November 5, 2017, New Orleans, Louisiana). iables), and qualitative parameters are presented as fractions with percentages. Categorical variables were compared using the c2 test. SUPPLEMENTARY MATERIAL Continuous variables were compared using the Mann–Whitney U test Supplementary File (PDF) or unpaired t test. Analysis of variance testing with Tukey’s multiple Appendix S1. Referring Physicians. comparison test was used to compare urinary UMOD levels. Kaplan- Figure S1. The L284P uromodulin shows trafficking defect. Meier curves were generated to display ESKD-free and gout-free sur- Figure S2. Freedom from ESKD and gout in ADTKD-UMOD according vival. Patients who had not reached ESKD or developed gout at the end to noncysteine versus cysteine mutations. of the study (outcome of interest not occurred during follow-up time) Figure S3. Association between urinary uromodulin and glomerular were considered censored individuals. Censoring time was defined as filtration in the general population. age at last follow-up. A log-rank test was used for comparison of Figure S4. Uromodulin processing in ADTKD-UMOD and ADTKD- survival curves. The performance of the UMOD-score was assessed MUC1. by calculating the AUC of the receiver-operating characteristic curve. Figure S5. Design and flowchart of the Belgo-Swiss ADTKD registry. Figure S6. Clinical characteristics of UMOD-positive and UMOD- The Youden index was used to define the optimal discriminatory negative patients in the Belgo-Swiss ADTKD registry. cut-off point for the UMOD-score. Statistical analysis was performed Table S1. List of the 106 UMOD mutations in the Belgo-Swiss and US using SPSS Statistics (IBM Corp., Armonk, NY). P < 0.05 was ADTKD registries. considered statistically significant, 2-sided tests were used. Table S2. Allele frequency and pathogenicity scores for novel UMOD variants. DISCLOSURE All the authors declared no competing interests. Table S3. Clinical characteristics of ADTKD patients in the US ADTKD registry according to genetic diagnosis. Table S4. Coordinates of the receiver-operating characteristics (ROC) ACKNOWLEDGMENTS curve of the clinical UMOD-score in the Belgo-Swiss ADTKD registry EO is supported by the Fonds National de la Recherche Luxembourg (UMOD-positive and UMOD-negative patients) (n ¼ 211 patients with (grant 6903109), the University Research Priority Program “Integrative available data). Human Physiology, ZIHP” of the University of Zurich, and an Early Table S5. Coordinates of the receiver-operating characteristics (ROC) Postdoc Mobility-Stipendium of the Swiss National Science curve of the UMOD-score in the US ADTKD registry (patients with Foundation (P2ZHP3_195181). LR is supported by the Italian Society ADTKD-UMOD and ADTKD-MUC1) without and with urinary uromo- of Nephrology (SIN) under the “Adotta un progetto di ricerca” dulin (n ¼ 205 and n ¼ 86 with urinary uromodulin). program, Telethon-Italy (grant GGP14263) and the Italian Ministry of Health (grant RF-2010-2319394). KK and AJB are supported by National Institutes of Health–National Institute of Diabetes and REFERENCES Digestive and Kidney Diseases (grant R21 DK106584). MZ,  KH, and SK 1. Devuyst O, Olinger E, Weber S, et al. Autosomal dominant were supported by the Ministry of Health of the Czech Republic tubulointerstitial kidney disease. Nat Rev Dis Primers. 2019;5:60. (grant NV17-29786A), the Ministry of Education of the Czech Republic 2. Eckardt KU, Alper SL, Antignac C, et al. Autosomal dominant (grant LTAUSA19068), and by Charles University in Prague tubulointerstitial kidney disease: diagnosis, classification, and (institutional programs UNCE/MED/007 and PROGRES-Q26/LF1). They management—a KDIGO consensus report. Kidney Int. 2015;88:676–683. thank the National Center for Medical Genomics (grant LM2015091) 3. Hart TC, Gorry MC, Hart PS, et al. Mutations of the UMOD gene are responsible for medullary cystic kidney disease 2 and familial juvenile for help with UMOD and MUC1 sequencing. OD is supported by the hyperuricaemic nephropathy. J Med Genet. 2002;39:882–892. European Community’s Seventh Framework Programme (grant 4. Devuyst O, Olinger E, Rampoldi L. Uromodulin: from physiology to rare 305608), the European Reference Network for Rare Kidney Diseases and complex kidney disorders. Nat Rev Nephrol. 2017;13:525–544. (project  739532), the Swiss National Science Foundation’s National 5. Kirby A, Gnirke A, Jaffe DB, et al. Mutations causing medullary cystic Center of Competence in Research Kidney Control of Homeostasis kidney disease type 1 lie in a large VNTR in MUC1 missed by massively program, and the Swiss National Science Foundation (grant 310030- parallel sequencing. Nat Genet. 2013;45:299–303. 730 Kidney International (2020) 98, 717–731 E Olinger et al.: ADTKD due to UMOD and MUC1 clinical investigation 6. Knaup KX, Hackenbeck T, Popp B, et al. Biallelic expression of mucin-1 in 21. Youhanna S, Weber J, Beaujean V, et al. Determination of uromodulin in autosomal dominant tubulointerstitial kidney disease: implications for human urine: influence of storage and processing. Nephrol Dial nongenetic disease recognition. J Am Soc Nephrol. 2018;29:2298–2309. Transplant. 2014;29:136–145. 7. Zivna M, Kidd K, Pristoupilova A, et al. Noninvasive 22. Pruijm M, Ponte B, Ackermann D, et al. Associations of urinary immunohistochemical diagnosis and novel MUC1 mutations causing uromodulin with clinical characteristics and markers of tubular function autosomal dominant tubulointerstitial kidney disease. J Am Soc Nephrol. in the general population. Clin J Am Soc Nephrol. 2016;11:70–80. 2018;29:2418–2431. 23. Troyanov S, Delmas-Frenette C, Bollée G, et al. Clinical, genetic, and 8. Bleyer AJ, Kmoch S, Antignac C, et al. Variable clinical presentation of an urinary factors associated with uromodulin excretion. Clin J Am Soc MUC1 mutation causing medullary cystic kidney disease type 1. Clin J Am Nephrol. 2016;11:62–69. Soc Nephrol. 2014;9:527–535. 24. Olden M, Corre T, Hayward C, et al. Common variants in UMOD associate 9. Bingham C, Ellard S, van’t Hoff WG, et al. Atypical familial juvenile with urinary uromodulin levels: a meta-analysis. J Am Soc Nephrol. hyperuricemic nephropathy associated with a hepatocyte nuclear factor- 2014;25:1869–1882. 1beta gene mutation. Kidney Int. 2003;63:1645–1651. 25. Scolari F, Caridi G, Rampoldi L, et al. Uromodulin storage diseases: clinical 10. Faguer S, Decramer S, Chassaing N, et al. Diagnosis, management, and aspects and mechanisms. Am J Kidney Dis. 2004;44:987–999. prognosis of HNF1B nephropathy in adulthood. Kidney Int. 2011;80:768–776. 26. Liu Y, Goldfarb DS, El-Achkar TM, et al. Tamm-Horsfall protein/ 11. Zivna M, Hulkova H, Matignon M, et al. Dominant renin gene mutations uromodulin deficiency elicits tubular compensatory responses leading to associated with early-onset hyperuricemia, anemia, and chronic kidney hypertension and hyperuricemia. Am J Physiol Renal Physiol. 2018;314: failure. Am J Hum Genet. 2009;85:204–213. F1062–F1076. 12. Bolar NA, Golzio C, Zivna M, et al. Heterozygous loss-of-function SEC61A1 27. Dahan K. A cluster of mutations in the UMOD gene causes familial mutations cause autosomal-dominant tubulo-interstitial and juvenile hyperuricemic nephropathy with abnormal expression of glomerulocystic kidney disease with anemia. Am J Hum Genet. 2016;99: uromodulin. J Am Soc Nephrol. 2003;14:2883–2893. 174–187. 28. Ashton EJ, Legrand A, Benoit V, et al. Simultaneous sequencing of 37 13. Groopman EE, Marasa M, Cameron-Christie S, et al. Diagnostic utility of genes identified causative mutations in the majority of children with exome sequencing for kidney disease. N Engl J Med. 2019;380:142–151. renal tubulopathies. Kidney Int. 2018;93:961–967. 14. Gast C, Marinaki A, Arenas-Hernandez M, et al. Autosomal dominant 29. Hureaux M, Ashton E, Dahan K, et al. High-throughput sequencing tubulointerstitial kidney disease-UMOD is the most frequent non contributes to the diagnosis of tubulopathies and familial hypercalcemia polycystic genetic kidney disease. BMC Nephrol. 2018;19:301. hypocalciuria in adults. Kidney Int. 2019;96:1408–1416. 15. Ayasreh N, Bullich G, Miquel R, et al. Autosomal dominant 30. Blumenstiel B, DeFelice M, Birsoy O, et al. Development and validation of tubulointerstitial kidney disease: clinical presentation of patients with a mass spectrometry-based assay for the molecular diagnosis of mucin-1 ADTKD-UMOD and ADTKD-MUC1. Am J Kidney Dis. 2018;72:411–418. kidney disease. J Mol Diagn. 2016;18:566–571. 16. Trudu M, Schaeffer C, Riba M, et al. Early involvement of cellular stress 31. Richards S, Aziz N, Bale S, et al. Standards and guidelines for the and inflammatory signals in the pathogenesis of tubulointerstitial kidney interpretation of sequence variants: a joint consensus recommendation disease due to UMOD mutations. Sci Rep. 2017;7:7383. of the American College of Medical Genetics and Genomics and the 17. Bernascone I, Janas S, Ikehata M, et al. A transgenic mouse model for Association for Molecular Pathology. Genet Med. 2015;17:405–424. uromodulin-associated kidney diseases shows specific tubulo-interstitial 32. Schaeffer C, Santambrogio S, Perucca S, et al. Analysis of uromodulin damage, urinary concentrating defect and renal failure. Hum Mol Genet. polymerization provides new insights into the mechanisms regulating 2010;19:2998–3010. ZP domain-mediated protein assembly. Mol Biol Cell. 2009;20:589–599. 18. Johnson BG, Dang LT, Marsh G, et al. Uromodulin p.Cys147Trp mutation 33. Dahan K, Devuyst O, Smaers M, et al. A cluster of mutations in the UMOD drives kidney disease by activating ER stress and apoptosis. J Clin Invest. gene causes familial juvenile hyperuricemic nephropathy with abnormal 2017;127:3954–3969. expression of uromodulin. J Am Soc Nephrol. 2003;14:2883–2893. 19. Dvela-Levitt M, Kost-Alimova M, Emani M, et al. Small molecule targets 34. Bleyer AJ, Hart TC, Shihabi Z, et al. Mutations in the uromodulin gene TMED9 and promotes lysosomal degradation to reverse proteinopathy. decrease urinary excretion of Tamm-Horsfall protein. Kidney Int. 2004;66: Cell. 2019;178:521–535.e523. 974–977. 20. Bollée G, Dahan K, Flamant M, et al. Phenotype and outcome in 35. Faguer S, Chassaing N, Bandin F, et al. The HNF1B score is a simple tool hereditary tubulointerstitial nephritis secondary to UMOD mutations. to select patients for HNF1B gene analysis. Kidney Int. 2014;86:1007– Clin J Am Soc Nephrol. 2011;6:2429–2438. 1015. Kidney International (2020) 98, 717–731 731