Stem Cell Research 42 (2020) 101663 Contents lists available at ScienceDirect Stem Cell Research journal homepage: www.elsevier.com/locate/scr Lab Resource: Multiple Cell Lines A collection of three integration-free iPSCs derived from old male and T female healthy subjects Eva Rodríguez-Travera,b,1, Eva Díaz-Guerraa,b,1, César Rodríguezc, Fabián Arenasb,d, ⁎ María Orerac, Jaime Kulisevskyb,d, Rosario Moratallaa,b, Carlos Vicarioa,b, a Instituto Cajal-Consejo Superior de Investigaciones Científicas (CSIC), Madrid, Spain b Centro de Investigación Biomédica en Red sobre Enfermedades Neurodegenerativas (CIBERNED), Madrid, Spain c Servicio de Bioquímica Clínica, Hospital General Universitario Gregorio Marañón, Madrid, Spain d Movement Disorders Unit, Neurology Dept., Hospital Sant Pau, Barcelona, Spain A B S T R A C T Here, we present the characterization of three iPSC lines derived from dermal fibroblasts of old healthy subjects. Fibroblasts were reprogrammed using Sendai viral vectors encoding OCT4, SOX2, KLF4 and c-MYC. The iPSCs expressed endogenous pluripotency markers, could generate the three germ layers (ectoderm, mesoderm and endoderm), maintained a stable karyotype, and were free from Sendai vectors and reprogramming factors. These integration-free iPSCs can serve for establishing control cell cultures in studies searching for phenotypes and mechanisms that could potentially be dysregulated in degenerative diseases. 1. Resource table Date archived/stock da- te ICCSICi013-A: 20/03/2018 ICCSICi014-A: 20/03/2018 Unique stem cell lines i- ICCSICi012-A Cell line repository/ba- IC-Ctrl1-F-iPS-4F-1 dentifier nk ICCSICi013-A IC-Ctrl2-F-iPS-4F-1 ICCSICi014-A IC-Ctrl3-F-iPS-4F-1 Alternative names of st- ICCSICi012-A: IC-Ctrl1-F-iPS-4F-1 Banco Nacional de Líneas Celulares (BNLC, Spanish Stem em cell lines Cell Bank): ICCSICi013-A: IC-Ctrl2-F-iPS-4F-1 http://www.isciii.es/ISCIII/es/contenidos/fd-el-instituto/ ICCSICi014-A: IC-Ctrl3-F-iPS-4F-1 fd-organizacion/fd-estructura-directiva/fd-subdireccion- Institution Instituto Cajal-CSIC and CIBERNED (Madrid, Spain) general-investigacion-terapia-celular-medicina-regenera- Contact information of Carlos Vicario, cvicario@cajal.csic.es tiva/fd-centros-unidades/fd-banco-nacional-lineas-celu- distributor lares/fd-lineas-celulares-disponibles/lineas-de-celulas- Type of cell lines iPSC iPS.shtml Origin Human Ethical approval The study was approved by the Commission of Guarantees Cell Source Dermal fibroblasts for the Donation and Utilization of Human Cells and Clonality Clonal Tissues, Instituto de Salud Carlos III (ISCIII; approval Method of reprogram- Non-integrative (Sendai viral vectors expressing OCT4, numbers 3,212,701 and 4,103,331). Informed consents ming KLF4, SOX2 and c-MYC) were obtained from the subjects. Multiline rationale Healthy subjects, non-isogenic cell lines Gene modification NO Type of modification N/A Associated disease N/A 2. Resource utility Gene/locus N/A Method of modification N/A Studying neurodegeneration has been difficult due to the scarcity of Name of transgene or r- N/A human cellular models. Our three iPSC lines are valuable tools for ob- esistance taining differentiated cells from healthy subjects. They can be used as Inducible/constitutive N/A system controls for other disease lines derived from geriatric patients. ICCSICi012-A: 23/08/2018 ⁎ Corresponding author at: Instituto Cajal-Consejo Superior de Investigaciones Científicas (CSIC), Madrid, Spain. E-mail address: cvicario@cajal.csic.es (C. Vicario). 1 E.R-T and E.D-G contributed equally to this study. https://doi.org/10.1016/j.scr.2019.101663 Received 22 October 2019; Received in revised form 8 November 2019; Accepted 19 November 2019 Available online 23 November 2019 1873-5061/ © 2019 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/). E. Rodríguez-Traver, et al. Stem Cell Research 42 (2020) 101663 Table 1 Summary of lines. iPSC line names Abbreviation in figures Gender Age Ethnicity Genotype of locus Disease ICCSICi012-A (IC-Ctrl1-F-iPS-4F-1) IC12-HS Male 85 Caucasian N/A N/A ICCSICi013-A (IC-Ctrl2-F-iPS-4F-1) IC13-HS Female 66 Caucasian N/A N/A ICCSICi014-A (IC-Ctrl3-F-iPS-4F-1) IC14-HS Male 72 Caucasian N/A N/A 3. Resource details 4. Materials and methods Human iPSC technology has brought new approaches for disease 4.1. Reprogramming of dermal fibroblasts modeling, drug discovery and cell therapy development. Advantages of using human iPSCs in disease modeling include their easy accessibility Fibroblasts were isolated from skin biopsies which were taken from and their ability to give rise to almost any desired cell type such as the ventral side of the forearm of healthy subjects. Firstly, fat was re- neurons and glia cells for neurodegeneration studies (Brennand et al., moved from the biopsy and the tissue was incubated with 0.25% Typsin 2015; Shi et al., 2017). In this work, we obtained and characterized (Labclinics) and 2.4 mM EDTA (Sigma-Aldrich) in Hanks’ Balanced Salt three iPSC lines derived from dermal fibroblasts of old healthy subjects Solution (Thermo Fisher) at 37 °C for 1–2 h. The dermis was isolated using a non-integrative reprogramming method (Sendai viral vectors and cut into small pieces that were incubated with 2.75 mg/mL encoding OCT4, SOX2, KLF4 and c-MYC transcription factors). Three Collagenase, 1.25 mg/mL Hyaluronidase (all Sigma-Aldrich), 0.1 mg/ weeks after reprogramming, primary colonies were picked and ex- mL DNAse I (Labclinics) in RPMI supplemented with 0.25 µg/mL panded, and the iPSC clones ICCSICi012-A, ICCSICi013-A and ICC- Amphotericin, 50 U/mL Penicillin and 50 µl/mL Streptomycin B (all SICi014-A were chosen for complete characterization (Tables 1 and 2). Thermo Fisher) at 37 °C for 2–3 h. Next, the tissue was mechanically The normal iPSC morphology (flat, round or polygonal with defined dissociated, centrifuged at 400x g, 10 min and the cells were counted borders) in these iPSCs was confirmed by light microscopy observations and plated onto 0.1% (w/v) gelatin-coated (Sigma-Aldrich) dishes at (Fig. 1A). These clonal lines expressed NANOG, TRA-1-60, TRA-1-81 10,000 cells/cm2 in fibroblast medium consisting of DMEM with and SSEA-3 human pluripotency markers (Table 3), as demonstrated by 110 mg/L pyruvate and high glucose (4,5 g/L) supplemented with immunofluorescence (Fig. 1B–E) and OCT4, SOX2 and NANOG by RT- 100 µM non-essential amino acids (NEAA), 100 U/mL Penicillin and qPCR (Fig. 1F), whereas fibroblasts showed no expression of these 100 µl/mL Streptomycin B and 10% (v/v) fetal bovine serum (all transcripts (Supplementary Fig. 1A). The iPSCs presented normal kar- Thermo Fisher). Finally, fibroblasts were expanded and two days before yotypes (46, XY and 46, XX) at passages 14–19 (Fig. 1G). To confirm the reprogramming, they were plated at 10,000 cells/cm2, transduced on pluripotency of these iPSCs, the clone lines were differentiated into the day 2 using the CytoTune™-iPS Sendai Reprogramming Kit (Thermo three germ layers (ectoderm, mesoderm or endoderm) using three Fisher) and incubated (37 °C, 5% CO2). Seven days later, transduced distinct protocols. Immunocytochemistry with specific antibodies human fibroblasts were seeded on mitotically inactivated mouse em- (Table 3), revealed the expression of PAX6 and ß-III-TUBULIN (ecto- bryonic fibroblasts (MEFs) in hiPSC medium (KnockOut™ DMEM/F12, derm), DESMIN (mesoderm) as well as AFP (endoderm; Fig. 1H). In 100 µM NEAA, 2 mM glutaMAX, 55 µM ß-mercaptoethanol, 100 U/mL addition, the iPSC lines were integration-free as confirmed by the ab- Penicillin, 100 µL/mL Streptomycin B, 20% KnockOut serum replace- sence of the SeV genome and transgenes (tested at passages 5–10 by RT- ment; Thermo Fisher) supplemented with 20 ng/mL FGF-2 (Peprotech), PCR; Fig. 1I and Supplementary Fig. 1B). Furthermore, the iPSC lines and incubated (37 °C, 5% CO2). Three-four weeks after, iPSC colonies were free from mycoplasma (Supplementary Fig. 1C). The analysis of were mechanically sliced into several fragments of cell clumps, seeded nine short tandem repeat (STR) loci plus the Amelogenin (AMEL) locus onto mitotically inactivated MEFs and expanded every week in hiPSC for gender determination, showed that the parental fibroblasts and the medium supplemented with 20 ng/mL FGF-2 and incubated as above. iPSC lines shared alleles with a 100% match (available with the au- Ten colonies per well of multiple well plate, size 6 wells, were passaged. thors). Table 2 Characterization and validation. Classification Test Result Data Morphology Photography Normal morphology Fig. 1A Phenotype Qualitative analysis Immunocytochemistry Positive for NANOG, TRA-1-60, TRA-1-81 and SSEA-3 pluripotency Fig. 1B–E markers Quantitative analysis RT-qPCR Positive for OCT4, SOX2 and NANOG transcription factors Fig. 1F and Supplementary Fig. 1A Genotype Karyotype (G-banding) and resolution 46, XY and 46, XX Resolution 450–500 bands Fig. 1G Identity Microsatellite PCR (mPCR) OR STR N/A N/A analysis 10 sites tested, identity verified (100% match) Available with the authors Mutation analysis (IF Sequencing N/A N/A APPLICABLE) Southern Blot OR WGS N/A N/A Microbiology and virology Mycoplasma Mycoplasma testing by PCR: Negative Supplementary Fig. 1C Differentiation potential Embryoid body formation followed by Proof of three germ-layers formation by positive immunostaining Fig. 1H directed differentiation for PAX6 and ß-III-TUBULIN (ectoderm), DESMIN (mesoderm) and AFP (endoderm) Donor screening (OPTIONAL) HIV 1 + 2 Hepatitis B, Hepatitis C N/A N/A Genotype additional info Blood group genotyping N/A N/A (OPTIONAL) HLA tissue typing N/A N/A 2 E. Rodríguez-Traver, et al. Stem Cell Research 42 (2020) 101663 Fig. 1. Characterization of iPSCs derived from old male and female healthy subjects. 4.2. Embryoid body (EB) formation and three-lineage differentiation 10 µM Rock inhibitor (Tocris) and without FGF-2. After 5 days, em- bryoid bodies were formed and plated onto 0.2% (w/v) gelatin-coated iPSC colonies were mechanically divided into cell clumps and plated thermanox coverslips (Thermo Fisher) in the same medium without onto low attachment dishes in hiPSCs medium supplemented with Rock inhibitor. Two-three days later, trilineage differentiation was 3 E. Rodríguez-Traver, et al. Stem Cell Research 42 (2020) 101663 Table 3 Reagents details. Antibodies used for immunocytochemistry/flow-cytometry Antibody Dilution Company Cat # and RRID Pluripotency Markers Rabbit anti-NANOG 1:250 Stemgent Cat#09-0020 RRID:AB_2298294 Rat anti-SSEA-3 1:100 Stemgent Cat#09–0014 RRID:AB_1512168 Mouse anti-TRA-1-60 1:200 Stemgent Cat#09-0010 RRID:AB_1512170 Mouse anti-TRA-1-81 1:200 Stemgent Cat#09-0011 RRID:AB_1512171 Differentiation Markers Mouse anti-AFP 1:100 R&D Systems Cat#MAB1368 RRID:AB_357658 Rabbit anti-DESMIN 1:250 Lab Vision Cat#RB-9014-P0 RRID:AB_149768 Rabbit anti-PAX6 1:300 Covance Cat#PRB-278P RRID:AB_291612 Mouse anti-β-III-TUBULIN 1:1000 Covance Cat#MMS-435P RRID:AB_2313773 Secondary antibodies Alexa Fluor 488 Goat 1:750 Thermo Fisher Scientific Anti-Rabbit IgG Cat# A-11008, RRID:AB_143165 Alexa Fluor 488 Donkey 1:750 Thermo Fisher Scientific Anti-Mouse IgG Cat# A-21202, RRID:AB_141607 Alexa Fluor488 1:500 Thermo Fisher Scientific Goat Anti-Rat IgM Cat# A-21212, RRID:AB_2535798 Alexa Fluor 594 Donkey 1:750 Thermo Fisher Scientific Anti-Mouse IgG Cat# A-21203, RRID:AB_2535789 Texas Red Goat 1:400 Jackson ImmunoResearch Labs Anti-Mouse IgM Cat# 115-076-075, RRID:AB_2338588 Primers Target Forward/Reverse primer (5′−3′) Sendai Viral Vectors (PCR) SeV, 181 bp GGATCACTAGGTGATATCGAGC/ ACCAGACAAGAGTTTAAGAGATATGTATC OCT4, 483 bp CCCGAAAGAGAAAGCGAACCAG/ AATGTATCGAAGGTGCTCAA KLF4, 410 bp TTCCTGCATGCCAGAGGAGCCC/ AATGTATCGAAGGTGCTCAA SOX2, 451 bp ATGCACCGCTACGACGTGAGCGC/ AATGTATCGAAGGTGCTCAA c-MYC, 532 bp TAACTGACTAGCAGGCTTGTCG/ TCCACATACAGTCCTGGATGATGATG Pluripotency Markers (qPCR) OCT4 CCCCTGTCTCTGTCACCACT/ TGAATGAAGAACTTAATCCCAAA SOX2 ACACTGCCCCTCTCACACAT/ TCCCATTTCCCTCGTTTTT NANOG TCTGCTGAGATGCCTCACACGG/ CACACAGCTGGGTGGAAGAGAAC House-Keeping Genes (qPCR) GADPH AACCATGAGAAGTATGACAACAGCC/ TGAGTCCTTCCACGATACCAAAGT started. Noggin (250 ng/mL; Peprotech) and A83 (5 µM; Miltenyi- converted to cDNA using SuperScript III (Thermo Fisher) and oligo(dT) Biotec) were used to induce ectodermal differentiation. On day 11, the primers according to the manufacturer's information. The PCR reactions hiPSC medium was changed to Neurobasal medium (Thermo Fisher) were performed using Taq DNA polymerase (Applied Biosystem) fol- with 2% B27 (Thermo Fisher), 2 mM Glutamax, 0.02 mM ascorbic acid lowing the manufacturer's protocol in a thermocycler (Techne, TC-312). (Sigma-Aldrich), 0.05 mM cAMP (Sigma-Aldrich), 20 ng/mL BDNF Different amplification conditions were applied for different primers: (Peprotech), 20 ng/mL GDNF (Peprotech) and 1 ng/mL TGFß-3 1 min 45 s at 95 °C, 45 s at 95 °C, 45 s at 55–60 °C, 1 min at 72 °C (35 (Peprotech). For mesodermal differentiation, the hiPSC was supple- cycles), 5 min at 72 °C (primers listed in Table 3). mented with 0.01 mM ascorbic acid. For endodermal differentiation, no growth factors or small molecules were added. All cultures were fixed 4.6. Karyotyping on days 16–17. Colcemid (10 μg/mL; Irvine-Scientific; 2 h at 37 °C) was used to stop 4.3. Immunocytochemistry iPSC mitosis at metaphase. Then, iPSCs were incubated with Trypsin- EDTA (Euroclone) 10 min at 37 °C. Hypotonic treatment was achieved Immunostaining was carried out following our standard procedures with 0.075 M KCl (30 min at 37 °C) and cells were fixed with methanol (Nieto-Estevez et al., 2016). The primary and secondary antibodies used / acetic acid (3:1). Cells were dropped on a microscope slide and me- are listed in Table 3. Images of the cells were taken on a Leica SP-5 taphases were G-banded with Wright stain. At least 10–20 metaphases confocal microscope. were counted and structurally evaluated (sensitivity of 450–500 bands per haploid number). 4.4. RT-qPCR 4.7. Mycoplasma detection Total RNA was extracted from the fibroblasts and iPSCs using RNeasy Mini Kit (Qiagen) to perform RT-qPCR following our standard The absence of mycoplasma in the culture medium was analyzed by protocols (Nieto-Estevez et al., 2016) using specific primers (Table 3). PCR using Mycoplasma Detection Kit (SoutherBiotech). The gene expression level analysis was conducted in triplicate and normalized versus GAPDH. 4.8. Short tandem repeat (STR) analysis 4.5. Sendai virus and transgene detection DNAs of the parental fibroblasts and iPSC lines were extracted using Puregene Core kit B (Qiagen) and analyzed at the Genomics Unit of To detect the SeV genome and transgenes, 500 ng of total RNA were CNIO-ISCIII (Spain). Nine STR loci plus the AMEL locus were PCR 4 E. Rodríguez-Traver, et al. Stem Cell Research 42 (2020) 101663 amplified (GenePrint 10 kit; Promega). Each DNA was subsequently Supplementary materials analyzed using an ABI Prism 3730xl Genetic Analyzer and the Osiris v2.6 software (NIH). Supplementary material associated with this article can be found, in the online version, at doi:10.1016/j.scr.2019.101663. Declaration of Competing Interest References The authors declare no conflict of interest. Brennand, K.J., Marchetto, M.C., Benvenisty, N., Brüstle, O., Ebert, A., Izpisua Belmonte, Acknowledgments J.C., Kaykas, A., Lancaster, M.A., Livesey, F.J., McConnell, M.J., McKay, R.D., Morrow, E.M., Muotri, A.R., Panchision, D.M., Rubin, L.L., Sawa, A., Soldner, F., Song, H., Studer, L., Temple, S., Vaccarino, F.M., Wu, J., Vanderhaeghen, P., Gage, We thank Mª José Román for technical assistance. This work was F.H., Jaenisch, R., 2015. Creating patient-specific neural cells for the in vitro study of funded by grants from the Spanish Ministerio de Economía y brain disorders. Stem Cell Rep. 5 (6), 933–945 Dec 8. Nieto-Estévez, V., Oueslati-Morales, C.O., Li, L., Pickel, J., Morales, A.V., Vicario-Abejón, Competitividad (MINECO: SAF2013-47596-R and CIBERNED: CB06/ C., 2016. Brain insulin-like growth factor-I directs the transition from stem cells to 05/0065) to C.V., from CIBERNED CB06/05/0055 to R.M, from mature neurons during postnatal/adult hippocampal neurogenesis. Stem Cells 34 (8), CIBERNED CB06/05/0041 to J.K., and from Fundación Ramón Areces 2194–2209 Aug. Shi, Y., Inoue, H., Wu, J.C., Yamanaka, S., 2017. Induced pluripotent stem cell tech- (CIVP18A3941) to C.V. and R.M. E.R.-T. was supported by a FPI nology: a decade of progress. Nat. Rev. Drug Discov. 16 (2), 115–130 Feb. Fellowship from the MINECO. 5