This is the accepted version of the journal article: Cuevas-Ferrando, E.; Guirado, Pedro; Miró, Elisenda; [et al.]. «Tetracycline resistance transmission in Campylobacter is promoted at temperatures resembling the avian reservoir». Veterinary Microbiology, Vol. 244 (May 2020), art. 108652. DOI 10.1016/j.vetmic.2020.108652 This version is available at https://ddd.uab.cat/record/285177 under the terms of the license 1 2 3 1 Tetracycline resistance transmission in Campylobacter is promoted at temperatures 4 5 6 2 resembling the avian reservoir. 7 8 3 Running title: Thermoregulation of plasmid conjugation in Campylobacter. 9 10 4 11 12 5 Cuevas-Ferrando, E.1*, Guirado, P.1*, Miró, E.2, Iglesias-Torrens, Y.2,3, Navarro, F.2,3, 13 14 6 Alioto, T. S.4,5, Gómez-Garrido, J.4, Madrid, C.1, Balsalobre, C.1 15 16 7 1Department of Genetics, Microbiology and Statistics. School of Biology. University of 17 18 8 Barcelona. Av. Diagonal, 643. 08028. Barcelona (Spain). 19 20 2Hospital 9 de la Santa Creu i Sant Pau and Institut d’Investigació Biomèdica Sant Pau (IIB 21 22 23 10 Sant Pau), Barcelona, Spain. 24 11 3Departament de Genètica i Microbiologia. Universitat Autònoma de Barcelona, Barcelona, 25 26 27 12 Spain. 28 13 4CNAG-CRG, Centre for Genomic Regulation (CRG), Barcelona Institute of Science and 29 30 31 14 Technology (BIST), Baldiri i Reixac 4, 08028 Barcelona, Spain 32 33 15 5Universitat Pompeu Fabra (UPF), Barcelona, Spain 34 35 16 *Both authors equally contributed. 36 37 17 Corresponding authors: 38 39 40 18 Dra. Cristina Madrid. Department of Genetics, Microbiology and Statistics. University of 41 42 19 Barcelona. Av. Diagonal 643, 08028 Barcelona, Spain. E-mail: cmadrid@ub.edu, tel: 43 44 20 +34934039382, fax: +34934034639. 45 46 21 Dr. Carlos Balsalobre. Department of Genetics, Microbiology and Statistics. University of 47 48 22 Barcelona. Av. Diagonal 643, 08028 Barcelona, Spain. E-mail: cbalsalobre@ub.edu, tel: 49 50 23 +34934034622, fax: +34934034639. 51 52 53 54 1 55 56 57 58 59 24 Abstract 60 61 62 25 Campylobacter is the causal agent of campylobacteriosis in humans, a self-limiting 63 64 26 gastroenteritis. Campylobacteriosis is a zoonosis, commonly transmitted from 65 66 27 contaminated chicken meat by either direct consumption or cross contamination during 67 68 28 food manipulation. Presence of plasmids encoding for resistance to antibiotics such as 69 70 29 tetracycline is common among Campylobacter isolates. In this report, we studied the effect 71 72 30 of the temperature in the conjugation frequency of several tet(O) carrying plasmids, 73 74 31 providing tetracycline resistance to the recipient cells. The conjugation frequency from 75 76 32 donor cells carrying three previously characterized plasmids (pCjA13, pCjA9 and pTet) and 77 78 79 33 from two clinical isolates was determined. Two temperatures, 37 and 42 ºC, mimicking the 80 81 34 conditions encountered by C. jejuni in the human and broiler chicken gastrointestinal tracts, 82 83 35 respectively, were assessed. Our results clearly indicate that the conjugation process is 84 85 36 promoted at high temperature. Accordingly, the transcriptional expression of some putative 86 87 37 conjugative apparatus genes is thermoregulated, being induced at 42 ºC. The two plasmids 88 89 38 present in the clinical isolates were sequenced and assembled. Both plasmids are highly 90 91 39 related among them and to the pTet plasmid. The high identity of the genes putatively 92 93 40 involved in the conjugation process among the plasmids is in agreement with the similar 94 95 96 41 behavior regarding the temperature dependency of the conjugative process. This report 97 98 42 suggest that conjugation of plasmids carrying antibiotic resistance genes occurs 99 100 43 preferentially at temperatures that resemble the gastrointestinal tract of birds, the main 101 102 44 reservoir of C. jejuni. 103 104 45 Keywords: Campylobacter; tetracycline resistance; plasmid conjugation; temperature 105 106 46 regulation 107 108 109 110 2 111 112 113 114 115 47 Introduction 116 117 118 48 Campylobacter is a motile Gram-negative epsilon proteobacteria. Thermophilic 119 120 49 Campylobacter species, particularly C. jejuni and C. coli, are the leading cause of bacterial 121 122 50 gastroenteritis in the European Union, United States and Australia (Havelaar et al., 2015). 123 124 51 They cause campylobacteriosis in humans, a self-limiting gastroenteritis characterized by 125 126 52 watery diarrhea, abdominal pain and fever. Severe cases are associated with 127 128 53 immunocompromised patients such as very young people and the elderly. Moreover, 129 130 54 infection by Campylobacter has been associated with complications such as reactive 131 132 55 arthritis and Guillian-Barré syndrome (Kaakoush et al., 2015). 133 134 135 56 Despite the fact that Campylobacter has been isolated from environmental samples, such as 136 137 57 water and soils, campylobacteriosis is recognized as a zoonosis. Campylobacter is quite 138 139 58 common among different animal species, although the major reservoir of C. jejuni is the 140 141 59 gastrointestinal tract of birds, including broiler chicken (Bronowski et al., 2014). The 142 143 60 consumption of contaminated chicken meat is the common source of human 144 145 61 campylobacteriosis (EFSA, 2017). 146 147 62 Genetically, Campylobacter is highly variable. Horizontal gene transfer and recombination 148 149 63 events mediate the rapid evolution detected among Campylobacter isolates, promoting 150 151 152 64 changes in the pathogenic potential, adaptability to different hosts and spread of antibiotic 153 154 65 resistance (Wilson et al., 2009; Woodcock et al., 2017). A widespread dissemination 155 156 66 mechanism of genetic information in bacteria is plasmid conjugation. The plasmid 157 158 67 occurrence in C. jejuni is variable, ranging from 20 to 90 % in different reports (Dasti et al., 159 160 68 2007). In C. jejuni, the presence of plasmids is directly related to the pathogenic potential, 161 162 69 in the case of the virulence plasmid pVir, or to the antimicrobial resistance profile of the 163 164 70 recipient cell, in the case of the tetracycline resistance-carrying plasmid pTet (Poly et al., 165 166 3 167 168 169 170 171 71 2005; Zeng et al., 2015). Genes coding for resistance to antibiotics such as tetracycline, 172 173 174 72 kanamycin, gentamycin and streptomycin have been found in plasmids from C. jejuni 175 176 73 (Gibreel et al., 2004; Dasti et al., 2007; Abril et al., 2010; Chen et al., 2013). Tetracycline 177 178 74 resistance is highly prevalent and, although several mechanisms have been elucidated, is 179 180 75 primarily mediated by the protein encoded in the tet(O) gene (Elhadidy et al., 2018). This 181 182 76 gene encodes for a ribosome-binding protein that promotes the release of tetracycline, 183 184 77 allowing protein synthesis in the presence of the antibiotic. The tet(O) gene can be located 185 186 78 in both, the chromosome and/or in extrachromosomal elements such as plasmids (Gibreel et 187 188 79 al., 2004; Pratt and Korolik, 2005). Consistently, tetracycline resistance can be spread by 189 190 191 80 plasmid conjugation (Pratt and Korolik, 2005; Dasti et al., 2007; Luangtongkum et al., 192 193 81 2009). 194 195 82 To know the optimal conditions for plasmid conjugation is pivotal to establish efficient 196 197 83 strategies for the control of antibiotic resistance spread. In this report, the conjugation 198 199 84 frequency of several tet(O) carrying plasmids has been assessed at two temperatures, 37 200 201 85 and 42 ºC, mimicking the conditions encountered by C. jejuni in the human and broiler 202 203 86 gastrointestinal tracts, respectively. The results indicate that the conjugation process is 204 205 87 promoted at high temperature. Consistent with the differential conjugation frequency 206 207 208 88 described, transcriptional expression of several putative conjugation-related genes is 209 210 89 thermoregulated, being induced at 42 ºC as compared to 37 ºC. Our data indicates that 211 212 90 conjugation of plasmids carrying antibiotic resistance genes occurs preferentially at 213 214 91 temperatures that resemble the gastrointestinal tract of birds, the main reservoir of C. jejuni. 215 216 217 218 219 220 221 222 4 223 224 225 226 227 92 Methods 228 229 230 93 Bacterial strains, plasmids and growth conditions. 231 232 94 The C. jejuni strains used in this work were isolated from human patients suffering from 233 234 95 campylobacteriosis. The following strains carrying tetracycline-resistant (TcR) plasmids 235 236 96 were used as donor cells during mating experiments. Strains A9 and A13 carry the TcR 237 238 97 plasmids pCjA9 and pCjA13, respectively (Schmidt-Ott et al., 2005). Strain 81-176 carries 239 240 98 the plasmids pVir and pTet. The pTet plasmid confers resistance to tetracycline (Poly et al., 241 242 99 2005). The H32 and H61 clinical isolates (Iglesias-Torrens et al., 2018) are characterized to 243 244 100 be TcR and carrying plasmids. In addition to tetracycline, H32 is resistant to ciprofloxacin 245 246 247 101 and ampicillin, and H61 is resistant to ciprofloxacin and nalidixic acid. 248 249 102 The A3 and A3S C. jejuni strains were used as recipient strains during mating experiments. 250 251 103 The A3 strain is nalidixic acid resistant, tetracycline-susceptible and does not carry any 252 253 104 plasmid (Schmidt-Ott et al., 2005). The A3S strain is a streptomycin-resistant derivative of 254 255 105 the A3 strain obtained after culturing in presence of increased concentrations of streptomycin. 256 257 106 A3S was only used as recipient strain in mating experiments with H32 and H61 strains. 258 259 107 The strain H40, previously isolated by our research group (Iglesias-Torrens et al., 2018), was 260 261 108 used as negative control for tet(O) gene presence during hybridization assays. H40 is 262 263 264 109 susceptible to all antibiotic tested and carries a plasmid. All C. jejuni strains were grown on 265 266 110 Columbia blood agar base (CBA, Oxoid) supplemented with 5% of defibrinated sheep blood 267 268 111 (Oxoid). When required, culture media was supplemented with nalidixic acid (Nal), 269 270 112 tetracycline (Tc) and streptomycin (Sm) at 50, 20 and 15 µg/ml, respectively. CBA plates 271 272 113 were incubated for 48 hours at either 37 or 42 ºC under microaerophilic conditions using 273 274 114 CampyGenTM atmosphere generation system (Oxoid). 275 276 115 Mating experiments 277 278 5 279 280 281 282 283 116 Mating experiments were performed essentially as earlier described (Schmidt-Ott et al., 284 285 286 117 2005). Donor and recipient strains were grown on selective CBA plates for 48 hours at either 287 288 118 37 or 42 ºC. Bacterial cells were collected in phosphate-buffered saline (PBS) supplemented 289 290 119 with MgCl2 (100 µM) and the OD550 of the cell suspension was normalized to 1.5. Equivalent 291 292 120 volumes (50 µl) of recipient and donor cells suspensions were mixed in the presence of 293 294 121 DNAse I (100 U/ml) (Roche), to avoid natural transformation events during the assay. 295 296 122 Aliquots of 15 µl were spotted on CBA plates supplemented with DNAse I (100 U/ml) and 297 298 123 incubated at either 37 or 42 ºC for the indicated times. Cells were recovered in PBS, serially 299 300 124 diluted and spread on CBA plates supplemented with the required antibiotics for the selection 301 302 303 125 of both donor and transconjugant cells. Control mating experiments with only donor or 304 305 126 recipient cells were included in all experiments. Plates were incubated for 48 h at 42 ºC and 306 307 127 the frequency of conjugation was calculated as the number of transconjugants per donor cell. 308 309 128 We show the results of at least three independent experiments in a scatter dot plot graphic 310 311 129 with the average. Plasmid isolation, restriction profile characterization and strain genotyping 312 313 130 by detection of the wlaN and flaA genes were used to confirm transconjugants selection. 314 315 131 DNA techniques 316 317 132 Genomic and plasmid DNA isolation was extracted by standard procedures using 318 319 320 133 InstaGeneTM Matrix (Bio-Rad) and E.Z.N.A.® Plasmid DNA kit (Omega Bio-tek), 321 322 134 respectively. Bacterial cultures were grown at 42 ºC for 48 h on CBA plates. BglII restriction 323 324 135 pattern was used to characterize the isolated plasmids. PCR amplification was performed 325 326 136 with PCR MasterMix (2x) (Thermo ScientificTM). All the primers used are described in Table 327 328 137 1. 329 330 138 RNA isolation and RT-PCR assays. 331 332 333 334 6 335 336 337 338 339 139 Total RNA was purified from C. jejuni cultures grown for 48 h on CBA plates at either 37 or 340 341 342 140 42 ºC. Bacterial cell suspensions in PBS with RNA Protect Bacteria Reagent (Qiagen) were 343 344 141 normalized to an OD550 of 1.5 and total RNA was isolated using the RNeasy Minikit (Qiagen) 345 346 142 following supplier indications. 347 348 143 Illustra Ready-to-Go RT-PCR beads (GE Healthcare) were used to perform one step RT- 349 350 144 PCR to monitor the expression of cmgB2, cmgB5, cmgB8 and cmgB11 genes. 16S rRNA 351 352 145 was used as the internal control. For each specific gene, the amount of template used during 353 354 146 PCR amplification was defined by performing saturation curves with increasing amounts of 355 356 147 total cDNA to determine the interval of lineal increase in the relative amount of RT-PCR 357 358 359 148 product and total RNA. The relative amount of amplified DNA was determined after 2 % 360 361 149 agarose gel electrophoresis using the Image Lab software (Bio-Rad). All the primers used 362 363 150 are described in Table 1. 364 365 151 DNA hybridization 366 367 152 DNA samples were subjected to separation by electrophoresis, DNA was transferred and UV 368 369 153 light cross-linked onto positively charged nylon membrane by standard methods (Sambrook 370 371 154 Fritsch, E.F., Maniatis, T., 1989). Specific digoxigenin-labeled probes for tet(O) gene were 372 373 155 obtained by PCR with the primer pair tet(O)F - tet(O)R and the PCR DIG Probe Synthesis 374 375 376 156 kit (Roche). Southern blot hybridization was carried out under high stringency conditions 377 378 157 according to the manufacturer’s instructions. 379 380 158 Genome sequencing, plasmid assembly and alignment 381 382 159 Whole genome sequencing of the C. jejuni isolates H32 and H61 was performed. The DNA 383 384 160 extraction was carried out with the Wizard DNA-Purification kit (Promega). Genomic 385 386 161 libraries and sequencing were performed in Life Sequencing 387 388 162 (http://www.lifesequencing.com/) using the Illumina NextSeq platform and Nextyera XT 389 390 7 391 392 393 394 395 163 150PE/TrueSeq DNA kit for library preparation. The pCjH32 and pCjH61 plasmids were 396 397 398 164 assembled from the trimmed reads with SPAdes (Bankevich et al., 2012) v3.13.0 with the 399 400 165 plasmid option in addition to default parameters. For pCjH32, a single contig of length 44,740 401 402 166 bp was assembled. For pCjH61, three contigs of lengths 31,173 bp, 13,377 bp and 112 bp 403 404 167 were assembled. As they were overlapping, we manually assembled them into one contig of 405 406 168 44,466 bp. The origin and orientation of both plasmid sequences were adjusted to coincide 407 408 169 with that of pTet (AY394561.1). 409 410 170 We annotated the assembled plasmids with Prokka (Seemann, 2014) v1.12. To compare the 411 412 171 assembled plasmids with the reference plasmid pTet, pairwise BLAST (Altschul et al., 413 414 415 172 1990) alignments were performed (blastn e-value cutoff of 10-5) and visualized with 416 417 173 EasyFig v2.2.2 (Sullivan et al., 2011). Additional pairwise comparisons were made with 418 419 174 Mummer v3.22 (Kurtz et al., 2004) in order to determine percent identity. To assign all the 420 421 175 genes to their corresponding ortholog in the other plasmids, we performed an all versus all 422 423 176 Blastp with all the protein sequences. Then, we selected the hits with more than 75% 424 425 177 identity and covering at least an 80% of the sequence length and produce table 2. The gene 426 427 178 names were inherited from the pTet reference transcript annotation. 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 8 447 448 449 450 451 179 Results 452 453 454 180 The conjugation of several tet(O) carrying plasmids is promoted at 42 ºC. 455 456 181 To study conjugation of plasmids carrying the tet(O) determinant, conferring resistance to 457 458 182 tetracycline, the C. jeuni A13 strain was initially used as donor strain. A13 carries the 41.9 459 460 183 Kb plasmid pCjA13, described as the prototype of the mob plasmids, a major subgroup of 461 462 184 tet(O)-carrying conjugative plasmids in C. jejuni (Schmidt-Ott et al., 2005). 463 464 185 The mating time required for optimal detection of transconjugants was determined for the 465 466 186 donor strain A13 (TcR, NalS), and the recipient strain A3 (TcS, NalR). Bacterial cultures and 467 468 187 mating assays were incubated at 42 ºC and the conjugation frequency of pCjA13 after 469 470 471 188 increasing mating times was determined (Fig. 1A). Transconjugants were detected after 2.5 472 473 189 hours of mating incubation and the conjugation frequency was constant after prolonged 474 475 190 incubation (between 2.5 and 5 hours). Colonies selected (TcR, NalR) were confirmed as 476 477 191 transconjugants by BglII digestion profile of the plasmid DNA and genotyping by PCR 478 479 192 detection of the chromosomal wlaN gene, since the A3 recipient strain, but not the A13 480 481 193 donor strain, carries the wlaN gene (Fig. 1B). Therefore, transconjugants clones are 482 483 194 characterized by being NalR, wlaN+ and carrying the pCjA3 plasmid (TcR). From these 484 485 195 results, an arbitrary mating incubation time of 4 hours was chosen for all conjugation 486 487 488 196 assays. In a previous report, similar plasmid transfer kinetics were described for the closely 489 490 197 related plasmid, pCC31 (Batchelor et al., 2004). 491 492 198 C. jejuni is commonly found colonizing the gastrointestinal tract of different birds, being 493 494 199 the consumption of contaminated poultry meat the most common infection transmission 495 496 200 route to humans. The temperature of the gastrointestinal tract of birds and humans is 497 498 201 different, being higher in birds (Card et al., 2017). To study the effect of temperature in the 499 500 202 conjugation of plasmids carrying the tet(O) determinant, the conjugation frequency of 501 502 9 503 504 505 506 507 203 pCjA13 was monitored at two temperatures, 42 and 37 ºC, resembling the broiler cecal and 508 509 510 204 the human gut temperatures. Remarkably, pCjA13 plasmid transfer occurs more efficiently 511 512 205 at 42 ºC. The conjugation frequency is over 13-fold higher at 42 ºC as compared to 37 ºC 513 514 206 (Fig. 1C), suggesting that pCjA13 conjugation can be promoted during broiler colonization. 515 516 207 With the same samples used to determine the conjugation frequency, experiments were 517 518 208 performed to monitor if the growth temperature (37 and 42 ºC) may affect growth kinetics 519 520 209 in such way that could justify the increase in the number of transconjugants detected at 521 522 210 42ºC. The concentration of recipient cells at time 0 (starting mating mixtures) and after 4h 523 524 211 mating incubation was calculated for mating mixtures incubated at both 37 and 42 ºC 525 526 527 212 (Table S1). The data obtained clearly demonstrate that the bacterial growth during the 4h 528 529 213 mating incubation is only slightly promoted (1.3-fold) at 42 ºC as compared at 37 ºC, 530 531 214 whereas conjugation frequency is promoted over 13-fold at the highest temperature. 532 533 215 Overall, these data rule out that the detection of higher conjugation frequency results from a 534 535 216 promoted growth at 42 ºC. 536 537 217 The temperature-dependent conjugation of two more previously characterized tet(O) 538 539 218 carrying plasmids, pCjA9 and pTet, was also determined. Plasmid pCjA9 (40.5 Kb) 540 541 219 belongs also to the mob plasmids subgroup, although remarkable differences with pCjA13 542 543 544 220 plasmid were reported at the nucleotide sequence level (Schmidt-Ott et al., 2005). The pTet 545 546 221 plasmid (45.2 Kb) present in the 81-176 C. jejuni strain has been extensively studied 547 548 222 (Batchelor et al., 2004; Poly et al., 2005). Conjugation of pCjA9 and pTet to the A3 strain 549 550 223 was efficiently detected using the same experimental layout as described above (Fig. 2A). It 551 552 224 should be pointed out that strain 81-176 carries two plasmids (pVir and pTet) (Poly et al., 553 554 225 2005), being the tet(O) carrying plasmid - pTet - the one selected during our conjugation 555 556 226 assay as determined by plasmid restriction analyses (Fig. 2A and (Bacon et al., 2000)). Our 557 558 10 559 560 561 562 563 227 results indicate that conjugation of both pCjA9 and pTet is also temperature dependent. 564 565 566 228 Again, temperatures mimicking broiler gut (42 ºC) promotes conjugation as compared with 567 568 229 human gut temperature (37 ºC). In this case, more than 8- and 6-fold stimulation was 569 570 230 detected for pCjA9 and pTet, respectively (Fig. 2B). 571 572 231 Two unrelated C. jejuni isolates from patients suffering gastroenteritis, H32 and H61 573 574 232 (Iglesias-Torrens et al., 2018), which are tetracycline resistant and carry plasmid DNA, 575 576 233 were tested. The plasmid content from both isolates showed a distinct BglII restriction 577 578 234 pattern (Fig. 2C). The presence of a tet(O) gene within pCjH32 and pCjH61 was confirmed 579 580 235 by Southern hybridization using a tet(O) specific probe (Fig. 2D). Mating experiments were 581 582 583 236 performed with H32 and H61 strains as donor strains and A3S, a SmR derivative of A3, as 584 585 237 recipient strain. Plasmid transfer was efficiently detected. In these experiments, since wlaN 586 587 238 did not allow discriminating between strain H32 and the transconjugants, detection of the 588 589 239 flaA gene was used for transconjugant genotyping (Fig. 2C). Our results let us conclude 590 591 240 that both tet(O) carrying plasmids, pCjH32 and pCjH61, are conjugative. The conjugation 592 593 241 frequency of these plasmids was monitored at 37 and 42 ºC and plasmid transfer was also 594 595 242 temperature dependent, being 3.5- and 14.5-fold induced at 42 ºC as compared to 37 ºC for 596 597 243 pCjH32 and pCjH61, respectively (Fig. 2E). 598 599 600 244 Transcriptional expression of plasmid transfer-related genes. 601 602 245 To further characterize the observed difference in conjugation frequency, the transcriptional 603 604 246 expression pattern of genes putatively involved in plasmid transfer at both assayed 605 606 247 temperatures was determined by semi quantitative RT-PCR. Several genes encoding 607 608 248 putative T4SS components, named cmg (Campylobacter mating genes), have been 609 610 249 identified in the pTet plasmid for its high homology with genes related with plasmid 611 612 250 conjugation from the pVT745 plasmid of Actinobacillus actinomycetemcomitans (Batchelor 613 614 11 615 616 617 618 619 251 et al., 2004; Poly et al., 2005). Using the pTet annotated sequence (AY394561.1), primers 620 621 622 252 were designed to PCR-amplify fragments of the ORF cmgB2, cmgB5, cmgB8 and cmgB11. 623 624 253 These ORFs presumably code for the major subunit of the conjugative pilus, the pilus-tip 625 626 254 adhesion protein, a protein of the inner membrane complex and an ATPase, respectively. It 627 628 255 has been described that the plasmids pCjA13, pCjA9 and pTet are somehow related since 629 630 256 they share homology among several cmg genes (Batchelor et al., 2004; Schmidt-Ott et al., 631 632 257 2005). Accordingly, the designed primers amplify DNA fragments of similar size in 633 634 258 genomic samples of strains carrying pTet, pCjA13 and pCjA9. Moreover, similar PCR 635 636 259 fragments were also detected in samples of strains carrying plasmids pCjH32 and pCjH61 637 638 639 260 (Fig. 3A), suggesting that this two uncharacterized plasmids are related with the other 640 641 261 tet(O) carrying plasmids used in this study and that their conjugative apparatus are 642 643 262 conserved to some extent (Batchelor et al., 2004; Friis et al., 2007). 644 645 263 Total RNA from A13 strain, carrying the pCjA13 plasmid, grown at either 37 or 42 ºC was 646 647 264 isolated. Same culture conditions as for conjugation assays were used. The mRNA levels of 648 649 265 the above-indicated genes were monitored using RT-PCR (Fig. 3B). Consistent with the 650 651 266 increased conjugation frequency detected at 42 ºC, an upregulation in the mRNA levels for 652 653 267 the four genes analyzed - cmgB2, cmgB5, cmgB8 and cmgB11 - was detected at high 654 655 656 268 temperature (approximately 3.6-, 4.8-, 9.6- and 7.5-fold, respectively). These results 657 658 269 strongly suggest the existence of regulatory pathways that adjust the expression of plasmid- 659 660 270 borne genes putatively involved in plasmid transfer in response to temperature changes. 661 662 271 This thermoregulation has apparently an impact in the conjugation frequency and may 663 664 272 promote plasmid transfer when bacteria are present in the broiler gastrointestinal tract. 665 666 273 Plasmids pCjH32 and pCjH61 are highly similar to the pTet plasmid. 667 668 669 670 12 671 672 673 674 675 274 The plasmids from the clinical isolates H32 and H61 were sequenced. pCjH32 and pCjH61 676 677 678 275 have a size of 44.7 and 44.4 Kb and a GC content of 29.62 and 28.34 %, respectively. The 679 680 276 annotation revealed 50 and 52 ORFs, being coding sequence approximately 92.3 and 91.8 681 682 277 % for pCjH32 and pCjH61, respectively. The tetracycline resistance transferred by these 683 684 278 plasmids is encoded in canonical tetO genes identical to the pTet plasmid tetO gene, with 685 686 279 only 1 and 8 nucleotides difference for pCjH32 and pCjH61, respectively. Alignment of the 687 688 280 genomes with Mummer shows that pCjH32 has an identity of 95.98% with 3.72% 689 690 281 unaligned with respect to pTet, while pCjH61 has an identity of 98.33% with 8.14% 691 692 282 unaligned with respect to pTet. A graphical overview based on BLAST alignments is 693 694 695 283 shown in Fig. 4. 696 697 284 Putative plasmid conjugation related genes were detected in both pCjH32 and pCjH61 698 699 285 plasmids using PCR amplification and primers designed according to the pTet described 700 701 286 sequence (Fig. 3). In the pTet plasmid and the closely related pCC31 plasmid, genes 702 703 287 putatively coding for T4SS and DNA transfer functions were identified by homology with 704 705 288 the T4SS of the pVT745 from Actinobacillus actinomycetemcomitans (Batchellor et al., 706 707 289 2004). CmgB2 (pilin) and CmgB5 (minor pilus component) were predicted to be involved 708 709 290 in pilus biogenesis. CmgB6 (protein with five transmembrane domains), CmgB7 and 710 711 712 291 Cpp44 (lipoproteins), CmgB9 (periplasmic protein), CmgB8 and CmgB10 (transmembrane 713 714 292 proteins) were predicted to form the trans-envelope pore complex. Moreover, three 715 716 293 ATPases associated with the T4SS (CmgB4, CmgB11 and CmgD4), a nickase (Cpp17), a 717 718 294 DNA primase (Cpp22), a DNA helicase (Cpp26) and a ssDNA binding protein (Cpp34) 719 720 295 were predicted to be encoded in these plasmids. All these genes are also found in the two 721 722 296 sequenced plasmids, pCjH32 and pCjH61, sharing a high degree of homology at the DNA 723 724 725 726 13 727 728 729 730 731 297 sequence level and the predicted encoded proteins (Table 2). The homology of all proteins 732 733 734 298 encoded in pCjH32 and pCjH61 among them and to pTet is detailed in Table S2. 735 736 299 Batchelor et al, (2004) anticipated the location of the oriT in the pTet plasmid between the 737 738 300 ORFs cpp18 and cpp19. The proposed sequence contains inverted DNA repeats 739 740 301 surrounding a conserved nic site motif ATCCTG as found in other oriT sites. Sequence 741 742 302 alignment of the equivalent plasmid locations reveals the presence of the nic site motif and 743 744 303 a high degree of conservation in the surrounding sequences in the plasmids pCjH32 and 745 746 304 pCjH61 when compared to the pTet and the closely related pCC31 plasmids (Table 3). 747 748 305 749 306 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 14 783 784 785 786 787 307 Discussion 788 789 790 308 Campylobacter is a highly ubiquitous bacteria, being part of the commensal microbiota of 791 792 309 numerous animal species and being isolated from distinct environmental niches (Thépault 793 794 310 et al., 2017). The most common transmission route of Campylobacter to humans is the 795 796 311 consumption of chicken meat. The use of antibiotics as prophylactic and growth promoters 797 798 312 for livestock is forbidden in the EU since 2006, however, in many countries these practices 799 800 313 are still in use (Maron et al., 2013). One of the antibiotics extensively used in food animal 801 802 314 production during the last decades is tetracycline (Fairchild et al., 2005). Accordingly, 803 804 315 resistance to tetracycline is one of the most common reported antibiotic resistance among 805 806 807 316 C. jejuni isolates (Wieczorek and Osek, 2013; Iglesias-Torrens et al., 2018). These data 808 809 317 suggest that the extensive use of this antimicrobial has importantly promoted the spread of 810 811 318 tet(O), the main tetracycline resistant genetic determinant, among circulating strains of C. 812 813 319 jejuni (Landers et al., 2012). The fact that in many countries the use of tetracyclines have 814 815 320 been restricted during food production for the last years, but tetracycline resistance is still 816 817 321 highly prevalent, suggest that the tet(O) gene remains highly stable in the Campylobacter 818 819 322 genome (Friis et al., 2007). 820 821 323 To know the specific environmental and physiological conditions that promote plasmid 822 823 824 324 transfer is relevant to develop strategies aiming to contain the spread of plasmid borne 825 826 325 functions such as antibiotic resistance. Moreover, it should be noted that several reports 827 828 326 suggest that the acquisition of plasmids carrying antibiotic resistance genes can be 829 830 327 associated with an increase in the virulence of the pathogenic bacteria (Schroeder et al., 831 832 328 2017). In this report we characterized the temperature dependency of the conjugation of 833 834 329 plasmids carrying the tet(O) gene in C. jejuni. We showed that the frequency of conjugation 835 836 330 is significantly stimulated at 42 ºC as compared to 37 ºC. In a previous report, it was 837 838 15 839 840 841 842 843 331 described that no significant differences were observed in the transfer of TcR plasmids of C. 844 845 846 332 jejuni at 42 and 37 ºC (Taylor et al., 1981). We cannot rule out that the TcR plasmid used in 847 848 333 these experiments has a differential response to the temperature as compared to the ones 849 850 334 used in our report. Nevertheless, it should be noted that in Taylor et al report, the mating 851 852 335 mixtures were incubated for 24-48 hours in contrast to the 4 hour incubation used in this 853 854 336 report. This difference in the experimental setup may also explain the discrepancies in the 855 856 337 results obtained. The stimulation of conjugation at 42 ºC was observed with several tet(O) 857 858 338 carrying plasmids: pCjA13, pCjA9 and pTet, previously reported to be related by carrying 859 860 339 homologous plasmid transfer genes (Batchelor et al., 2004; Schmidt-Ott et al., 2005); and 861 862 863 340 the previously uncharacterized pCjH32 and pCjH61 plasmids from clinical isolates. 864 865 341 Remarkably, PCR detection of putative plasmid transfer genes, using pTet specific primers, 866 867 342 indicates that all plasmids tested are related. Interestingly, a previous report described 868 869 343 unsuccessful transfer of the pTet plasmid by conjugation after several attempts (Bacon et 870 871 344 al., 2000). It should be point out that the mating assays were performed at 37 ºC, 872 873 345 temperature that is suboptimal for pTet conjugation, as shown in this report. Our data 874 875 346 suggest that plasmid transfer might be promoted within the avian reservoir rather that 876 877 347 during the transit through the human gastrointestinal tract. In vivo experiments previously 878 879 880 348 showed efficient conjugation of tet(O) carrying plasmids within chicken gastrointestinal 881 882 349 tract (Avrain et al., 2004). 883 884 350 Expression studies with four putative conjugation-related genes cmgB2, cmgB5, cmgB8 and 885 886 351 cmgB1, let us conclude that its expression is thermoregulated. Remarkably, the four genes 887 888 352 analyzed were higher expressed at high temperature providing a rational justification to the 889 890 353 temperature-dependent conjugation of these plasmids. 891 892 893 894 16 895 896 897 898 899 354 The temperature dependent regulation of plasmid conjugation through transcriptional 900 901 902 355 modulation of genes involved in the synthesis of the conjugative apparatus has been 903 904 356 previously reported for the IncHI1 plasmid R27 (Alonso et al., 2005; Forns et al., 2005). 905 906 357 The conjugation of plasmids IncHI1, associated with the spread of antibiotic resistances 907 908 358 among enterobacteria, is stringently thermoregulated (Taylor and Levine, 1980). IncHI1 909 910 359 plasmids conjugation is promoted at low temperature suggesting that plasmid transfer 911 912 360 occurs during the transit of the bacteria outside the mammal hosts (Maher and Taylor, 913 914 361 1993). Our data clearly indicate that the plasmids present in two TcR clinical isolates are 915 916 362 highly related among them and to the pTet plasmid. Accordingly, with the similar response 917 918 919 363 to temperature shown by the conjugation of the plasmid studied, the high identity is 920 921 364 extensive to all genes presumably involved in plasmid conjugation. The similarity is not 922 923 365 restricted to the ORFs; it is also high among the surrounding non-coding sequences, 924 925 366 indicating similar promoter sequences that control the expression of the conjugation related 926 927 367 genes in the different plasmids. In this report, we described that in C. jejuni the conjugation 928 929 368 of tet(O) carrying plasmids is stimulated at higher temperature indicating that antibiotic 930 931 369 spread occurs more efficiently within the avian reservoir. 932 933 370 934 935 936 937 938 939 940 941 942 943 944 945 946 947 948 949 950 17 951 952 953 954 955 371 Acknowledgment 956 957 958 372 Dr. Andreas Zautner from Universitätsmedizin Göttingen for kindly providing the A3, A9 959 960 373 and A13 strains. Dr. Patricia Guerry from the U.S. Naval Medical Research Center for 961 962 374 kindly providing the 81-176 strain. 963 964 375 Funding sources 965 966 376 This work was supported by the Spanish Ministry of Economy and Competitiveness [grant 967 968 377 AGL2013-45339R], Spanish Ministry of Science, Innovation and Universities [grant 969 970 378 PGC2018-096958-B-I00] and the Catalonian government [grant 2017SGR499]. PG was 971 972 379 recipient of an ADR fellowship of the University of Barcelona. 973 974 975 380 Competing of interest statement 976 977 381 Declaration of interest: none. 978 979 382 980 981 982 983 984 985 986 987 988 989 990 991 992 993 994 995 996 997 998 999 1000 1001 1002 1003 1004 1005 1006 18 1007 1008 1009 1010 1011 383 References 1012 384 Abril, C., Brodard, I., Perreten, V., 2010. Two novel antibiotic resistance genes, tet(44) and 1013 1014 1015 385 ant(6)-Ib, are located within a transferable pathogenicity island in Campylobacter 1016 1017 386 fetus subsp. fetus. Antimicrob. Agents Chemother. 54, 3052–3055. 1018 1019 387 doi:10.1128/AAC.00304-10 1020 1021 388 Alonso, G., Baptista, K., Ngo, T., Taylor, D.E., 2005. Transcriptional organization of the 1022 1023 389 temperature-sensitive transfer system from the IncHI1 plasmid R27. Microbiology 1024 1025 390 151, 3563–3573. 1026 1027 391 Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local 1028 1029 392 alignment search tool. J. Mol. Biol. 215, 403–410. doi:10.1016/S0022- 1030 1031 1032 393 2836(05)80360-2 1033 1034 394 Avrain, L., Vernozy-Rozand, C., Kempf, I., 2004. Evidence for natural horizontal transfer 1035 1036 395 of tetO gene between Campylobacter jejuni strains in chickens. J. Appl. Microbiol. 97, 1037 1038 396 134–140. doi:10.1111/j.1365-2672.2004.02306.x 1039 1040 397 Bacon, D.J., Alm, R.A., Burr, D.H., Hu, L., Kopecko, D.J., Ewing, C.P., Trust, T.J., 1041 1042 398 Guerry, P., 2000. Involvement of a plasmid in virulence of Campylobacter jejuni 81- 1043 1044 399 176. Infect. Immun. 68, 4384–4390. 1045 1046 400 Bankevich, A., Nurk, S., Antipov, D., Gurevich, A.A., Dvorkin, M., Kulikov, A.S., Lesin, 1047 1048 1049 401 V.M., Nikolenko, S.I., Pham, S., Prjibelski, A.D., Pyshkin, A. V., Sirotkin, A. V., 1050 1051 402 Vyahhi, N., Tesler, G., Alekseyev, M.A., Pevzner, P.A., 2012. SPAdes: A new 1052 1053 403 genome assembly algorithm and its applications to single-cell sequencing. J. Comput. 1054 1055 404 Biol. 19, 455–477. doi:10.1089/cmb.2012.0021 1056 1057 405 Batchelor, R.A., Pearson, B.M., Friis, L.M., Guerry, P., Wells, J.M., 2004. Nucleotide 1058 1059 406 sequences and comparison of two large conjugative plasmids from different 1060 1061 1062 19 1063 1064 1065 1066 1067 407 Campylobacter species. Microbiology 150, 3507–3517. doi:10.1099/mic.0.27112-0 1068 1069 1070 408 Bronowski, C., James, C.E., Winstanley, C., 2014. Role of environmental survival in 1071 1072 409 transmission of Campylobacter jejuni. FEMS Microbiol. Lett. 356, 8–19. 1073 1074 410 doi:10.1111/1574-6968.12488 1075 1076 411 Card, R.M., Cawthraw, S.A., Nunez-Garcia, J., Ellis, R.J., Kay, G., Pallen, M.J., 1077 1078 412 Woodward, M.J., Anjum, M.F., 2017. An In Vitro Chicken Gut Model Demonstrates 1079 1080 413 Transfer of a Multidrug Resistance Plasmid from Salmonella to Commensal 1081 1082 414 Escherichia coli. MBio 8, e00777-17. doi:10.1128/mBio.00777-17 1083 1084 415 Chen, Y., Mukherjee, S., Hoffmann, M., Kotewicz, M.L., Young, S., Abbott, J., Luo, Y., 1085 1086 1087 416 Davidson, M.K., Allard, M., McDermott, P., Zhao, S., 2013. Whole-genome 1088 1089 417 sequencing of gentamicin-resistant Campylobacter coli isolated from U.S. retail meats 1090 1091 418 reveals novel plasmid-mediated aminoglycoside resistance genes. Antimicrob. Agents 1092 1093 419 Chemother. 57, 5398–5405. doi:10.1128/AAC.00669-13 1094 1095 420 Dasti, J.I., Gross, U., Pohl, S., Lugert, R., Weig, M., Schmidt-Ott, R., 2007. Role of the 1096 1097 421 plasmid-encoded tet(O) gene in tetracycline-resistant clinical isolates of 1098 1099 422 Campylobacter jejuni and Campylobacter coli. J. Med. Microbiol. 56, 833–7. 1100 1101 423 doi:10.1099/jmm.0.47103-0 1102 1103 1104 424 Datta, S., Niwa, H., Itoh, K., 2003. Prevalence of 11 pathogenic genes of Campylobacter 1105 1106 425 jejuni by PCR in strains isolated from humans, poultry meat and broiler and bovine 1107 1108 426 faeces. J. Med. Microbiol. 52, 345–348. doi:10.1099/jmm.0.05056-0 1109 1110 427 Elhadidy, M., Miller, W.G., Arguello, H., Álvarez-Ordóñez, A., Duarte, A., Dierick, K., 1111 1112 428 Botteldoorn, N., 2018. Genetic Basis and Clonal Population Structure of Antibiotic 1113 1114 429 Resistance in Campylobacter jejuni Isolated From Broiler Carcasses in Belgium. 1115 1116 430 Front. Microbiol. 9, 1014. doi:10.3389/fmicb.2018.01014 1117 1118 20 1119 1120 1121 1122 1123 431 Fairchild, A.S., Smith, J.L., Idris, U., Lu, J., Sanchez, S., Purvis, L.B., Hofacre, C., Lee, 1124 1125 1126 432 M.D., 2005. Effects of orally administered tetracycline on the intestinal community 1127 1128 433 structure of chickens and on tet determinant carriage by commensal bacteria and 1129 1130 434 Campylobacter jejuni. Appl. Environ. Microbiol. 71, 5865–5872. 1131 1132 435 doi:10.1128/AEM.71.10.5865-5872.2005 1133 1134 436 Forns, N., Baños, R.C., Balsalobre, C., Juárez, A., Madrid, C., 2005. Temperature- 1135 1136 437 dependent conjugative transfer of R27: Role of chromosome- and plasmid-encoded 1137 1138 438 Hha and H-NS proteins. J. Bacteriol. 187, 3950-3959. doi:10.1128/JB.187.12.3950- 1139 1140 439 3959.2005 1141 1142 1143 440 Friis, L.M., Pin, C., Taylor, D.E., Pearson, B.M., Wells, J.M., 2007. A role for the tet(O) 1144 1145 441 plasmid in maintaining Campylobacter plasticity. Plasmid 57, 18–28. 1146 1147 442 doi:10.1016/j.plasmid.2006.06.005 1148 1149 443 Gibreel, A., Sköld, O., Taylor, D.E., 2004. Characterization of plasmid-mediated aphA-3 1150 1151 444 kanamycin resistance in Campylobacter jejuni. Microb. Drug Resist. 10, 98–105. 1152 1153 445 doi:10.1089/1076629041310127 1154 1155 446 Havelaar, A.H., Kirk, M.D., Torgerson, P.R., Gibb, H.J., Hald, T., Lake, R.J., Praet, N., 1156 1157 447 Bellinger, D.C., de Silva, N.R., Gargouri, N., Speybroeck, N., Cawthorne, A., 1158 1159 1160 448 Mathers, C., Stein, C., Angulo, F.J., Devleesschauwer, B., World Health Organization 1161 1162 449 Foodborne Disease Burden Epidemiology Reference Group, 2015. World Health 1163 1164 450 Organization Global Estimates and Regional Comparisons of the Burden of 1165 1166 451 Foodborne Disease in 2010. PLOS Med. 12, e1001923. 1167 1168 452 doi:10.1371/journal.pmed.1001923 1169 1170 453 Iglesias-Torrens, Y., Miró, E., Guirado, P., Llovet, T., Muñoz, C., Cerdà-Cuéllar, M., 1171 1172 454 Madrid, C., Balsalobre, C., Navarro, F., 2018. Population Structure, Antimicrobial 1173 1174 21 1175 1176 1177 1178 1179 455 Resistance, and Virulence-Associated Genes in Campylobacter jejuni Isolated From 1180 1181 1182 456 Three Ecological Niches: Gastroenteritis Patients, Broilers, and Wild Birds. Front. 1183 1184 457 Microbiol. 9, 1676. doi:10.3389/fmicb.2018.01676 1185 1186 458 Kaakoush, N.O., Castaño-Rodríguez, N., Mitchell, H.M., Man, S.M., 2015. Global 1187 1188 459 Epidemiology of Campylobacter Infection. Clin. Microbiol. Rev. 28, 687–720. 1189 1190 460 doi:10.1128/CMR.00006-15 1191 1192 461 Kurtz, S., Phillippy, A., Delcher, A.L., Smoot, M., Shumway, M., Antonescu, C., Salzberg, 1193 1194 462 S.L., 2004. Versatile and open software for comparing large genomes. Genome Biol. 1195 1196 463 5. doi:10.1186/gb-2004-5-2-r12 1197 1198 1199 464 Landers, T.F., Cohen, B., Wittum, T.E., Larson, E.L., 2012. A review of antibiotic use in 1200 1201 465 food animals: perspective, policy, and potential. Public Health Rep. 127, 4–22. 1202 1203 466 doi:10.1177/003335491212700103 1204 1205 467 Luangtongkum, T., Jeon, B., Han, J., Plummer, P., Logue, C.M., Zhang, Q., 2009. 1206 1207 468 Antibiotic resistance in Campylobacter: emergence, transmission and persistence. 1208 1209 469 Future Microbiol. 4, 189–200. doi:10.2217/17460913.4.2.189 1210 1211 470 Maher, D., Taylor, D.E., 1993. Host range and transfer efficiency of incompatibility group 1212 1213 471 HI plasmids. Can J Microbiol 39, 581–587. 1214 1215 1216 472 Maron, D.F., Smith, T.J.S., Nachman, K.E., 2013. Restrictions on antimicrobial use in food 1217 1218 473 animal production: an international regulatory and economic survey. Global. Health 9, 1219 1220 474 48. doi:10.1186/1744-8603-9-48 1221 1222 475 Poly, F., Threadgill, D., Stintzi, A., 2005. Genomic Diversity in Campylobacter jejuni: 1223 1224 476 Identification of C. jejuni 81-176-Specific Genes. J. Clin. Microbiol. 43, 2330–2338. 1225 1226 477 doi:10.1128/JCM.43.5.2330-2338.2005 1227 1228 478 Pratt, A., Korolik, V., 2005. Tetracycline resistance of Australian Campylobacter jejuni and 1229 1230 22 1231 1232 1233 1234 1235 479 Campylobacter coli isolates. J. Antimicrob. Chemother. 55, 452–60. 1236 1237 1238 480 doi:10.1093/jac/dki040 1239 1240 481 Sambrook Fritsch, E.F., Maniatis, T., J., 1989. Molecular cloning: a laboratory manual. Ed. 1241 1242 482 Cold Spring Harb. Lab. Press. Cold Spring Harbour, New York. 1243 1244 483 Schmidt-Ott, R., Pohl, S., Burghard, S., Weig, M., Gross, U., 2005. Identification and 1245 1246 484 characterization of a major subgroup of conjugative Campylobacter jejuni plasmids. J. 1247 1248 485 Infect. 50, 12–21. doi:10.1016/j.jinf.2004.02.013 1249 1250 486 Schroeder, M., Brooks, B.D., Brooks, A.E., 2017. The Complex Relationship between 1251 1252 487 Virulence and Antibiotic Resistance. Genes (Basel). 8. doi:10.3390/genes8010039 1253 1254 1255 488 Seemann, T., 2014. Prokka: Rapid prokaryotic genome annotation. Bioinformatics 30, 1256 1257 489 2068–2069. doi:10.1093/bioinformatics/btu153 1258 1259 490 Sullivan, M.J., Petty, N.K., Beatson, S.A., 2011. Easyfig: A genome comparison visualizer. 1260 1261 491 Bioinformatics 27, 1009–1010. doi:10.1093/bioinformatics/btr039 1262 1263 492 Taylor, D.E., De Grandis, S.A., Karmali, M.A., Fleming, P.C., 1981. Transmissible 1264 1265 493 Plasmids from Campylobacter jejuni, Antimicrob. Agents Chemother. 19, 831-835. 1266 1267 494 doi: 10.1128/aac.19.5.831 1268 1269 495 Taylor, D.E., Levine, J.G., 1980. Studies of temperature-sensitive transfer and maintenance 1270 1271 1272 496 of H incompatibility group plasmids. J Gen Microbiol 116, 475–484. 1273 1274 497 The European Union summary report on trends and sources of zoonoses, zoonotic agents 1275 1276 498 and food‐borne outbreaks in 2016, 2017. EFSA J. 15. doi:10.2903/j.efsa.2017.5077 1277 1278 499 Thépault, A., Méric, G., Rivoal, K., Pascoe, B., Mageiros, L., Touzain, F., Rose, V., Béven, 1279 1280 500 V., Chemaly, M., Sheppard, S.K., 2017. Genome-Wide Identification of Host- 1281 1282 501 Segregating Epidemiological Markers for Source Attribution in Campylobacter jejuni. 1283 1284 502 Appl. Environ. Microbiol. 83, e03085-16. doi:10.1128/AEM.03085-16 1285 1286 23 1287 1288 1289 1290 1291 503 Wieczorek, K., Osek, J., 2013. Antimicrobial Resistance Mechanisms among 1292 1293 1294 504 Campylobacter. Biomed Res. Int. 2013, 1–12. doi:10.1155/2013/340605 1295 1296 505 Wilson, D.J., Gabriel, E., Leatherbarrow, A.J.H., Cheesbrough, J., Gee, S., Bolton, E., Fox, 1297 1298 506 A., Hart, C.A., Diggle, P.J., Fearnhead, P., 2009. Rapid Evolution and the Importance 1299 1300 507 of Recombination to the Gastroenteric Pathogen Campylobacter jejuni. Mol. Biol. 1301 1302 508 Evol. 26, 385–397. doi:10.1093/molbev/msn264 1303 1304 509 Woodcock, D.J., Krusche, P., Strachan, N.J.C., Forbes, K.J., Cohan, F.M., Méric, G., 1305 1306 510 Sheppard, S.K., 2017. Genomic plasticity and rapid host switching can promote the 1307 1308 511 evolution of generalism: a case study in the zoonotic pathogen Campylobacter. Sci. 1309 1310 1311 512 Rep. 7, 9650. doi:10.1038/s41598-017-09483-9 1312 1313 513 Zeng, X., Ardeshna, D., Lin, J., 2015. Heat Shock-Enhanced Conjugation Efficiency in 1314 1315 514 Standard Campylobacter jejuni Strains. Appl. Environ. Microbiol. 81, 4546–4552. 1316 1317 515 doi:10.1128/AEM.00346-15 1318 1319 516 1320 1321 517 1322 1323 1324 1325 1326 1327 1328 1329 1330 1331 1332 1333 1334 1335 1336 1337 1338 1339 1340 1341 1342 24 1343 1344 1345 1346 1347 518 Table 1. Oligonucleotides used in this report. 1348 519 1349 1350 520 1351 Gene Source Forward (Fw) and Reverse (Rv) primers Reference 1352 cmgB2 pTet plasmid Fw 5’ GCTGGTGGTATTGATAAAGT 3’ This study 1353 (AY394561.1) Rv 5’ TGATCCAAAAATAACGCCAC 3’ 1354 cmgB5 pTet plasmid Fw 5’ AGCCATAGGGAAATCTCATC 3’ This study 1355 (AY394561.1) Rv 5’ GGAATACCAGCACTAAATGC 3’ 1356 cmgB8 pTet plasmid Fw 5’ GACAATACTACAGGAATGGT 3’ This study 1357 (AY394561.1) Rv 5’ TCTCTTGCATTATCACCTTC 3’ 1358 cmgB11 pTet plasmid Fw 5’ GAAATCTGCTATAACGGCGA 3’ This study 1359 (AY394561.1) Rv 5’ AGCGAGTTTTGCTTGGCTTT 3’ 1360 tet(O) pTet plasmid Fw 5’ GCGTTTTGTTTATGTGCG 3’ Bacon et 1361 (AY394561.1) Rv 5’ ATGGACAACCCGACAGAAG 3’ al., 2000 1362 1363 16S LMG 9217 Fw 5’ GGATGACACTTTTCGGAG 3’ This study 1364 (AF550626.1) Rv 5’ CCTCCACTCTAGACTATC 3’ 1365 wlaN NCTC 11168 Fw 5’ TGCTGGGTATACAAAGGTTGTG 3’ Koolman et 1366 (AL111168.1) Rv 5’ AGGTCCATTACCGCATACCA 3’ al., 2015 1367 flaA 81-176 Fw 5’ Datta et al., 1368 (AF345999.1) AATAAAAATGCTGATAAAACAGGTG 3’ 2003 1369 Rv 5’ TACCGAACCAATGTCTGCTCTGATT 1370 3’ 1371 521 1372 1373 1374 1375 1376 1377 1378 1379 1380 1381 1382 1383 1384 1385 1386 1387 1388 1389 1390 1391 1392 1393 1394 1395 1396 1397 1398 25 1399 1400 1401 1402 1403 1404 1405 522 Table 2. Predicted conjugation related coding regions on pCjH32 and pCjH61 plasmids and the closest relationships to the 1406 523 functional homologues in pTet. 1407 1408 1409 % identity DNA* - % identity (% similarity) 1410 proteins** Length (aa) 1411 Gene Predicted function pCjH32 pCjH61 pTet / pCjH32 / pCjH61 1412 1413 cpp17 Nickase 98.3 - 97.0 (99.4) 97.9 - 96.8 (99.4) 462 / 462 / 462 1414 cpp22 Primase 95.6 - 95.1 (98.8) 99.7 - 99.8 (100) 408 / 408 / 408 1415 1416 cpp26 DNA helicase 96.5 - 97.5 (99.7) 99.9 - 100 (100) 597 / 597 / 597 1417 cmgB2 (cpp30) Pilin 92.4 - 92.0 (97.7) 92.0 -92.0 (98.9) 87 / 87 / 87 1418 1419 cmgB3/4 (cpp31) ATPase 97.9 - 98.7 (99.8) 96.5 - 98.2 (99.8) 883 / 922 / 922 1420 cpp34 ssDNA binding protein 97.9 - 97.2 (99.3) 97.6 - 97.2 (99.3) 141 / 140 / 140 1421 1422 cmgB5 (cpp36) Pilus minor component 94.6 - 89.2 (97.5) 97.4 - 93.2 (98.1) 323 / 329 / 329 1423 cmgB6 (cpp37) Transmembrane protein (TEPC) 85.5 - 84.9 (96.4) 86.7 - 85.3 (96.4) 281 / 331 / 331 1424 1425 cmgB7 (cpp38) Lipoprotein (TEPC) 95.8 - 94.5 (98.2) 99.4 - 100 (100) 55 / 54 / 55 1426 1427 cmgB8 (cpp39) Transmembrane protein (TEPC) 84.9 - 86.2 (97.2) 99.5 - 100 (100) 220 / 219 / 220 1428 cmgB9 (cpp40) Periplasmic protein (TEPC) 89.8 - 89.2 (97.0) 97.7 - 98.0 (100) 295 / 296 / 295 1429 1430 cmgB10 (cpp41) Transmembrane protein (TEPC) 85.2 - 86.1 (94.9) 99.6 -99.5 (100) 398 / 392 / 391 1431 cmgB11 (cpp42) ATPase 91.4 - 96.0 (98.8) 99.9 - 100 (100) 348 / 335 / 330 1432 1433 cmgD4 (cpp43) ATPase 93.9 - 94.9 (98.8) 99.7 - 99.8 (100) 603 / 603 / 603 1434 cpp44 Lipoprotein (TEPC) 99.5 - 99.3 (100) 99.5 - 99.3 (100) 145 / 145 / 145 1435 1436 524 TEPC: Trans-envelope porus complex. * % of DNA identity determined by BLAST (NCBI, NIH). ** % of protein identity and 1437 525 similarity determined by LALIGN (EXPASI, SIB) 1438 1439 1440 26 1441 1442 1443 1444 1445 526 Table 3. Alignment of the putative oriT in plasmid pTet, pCjH32 and pCjH61. The nic 1446 1447 1448 527 site motif ATCCTG is indicated (grey shadow). 1449 1450 528 1451 Plasmid Sequence 1452 pCjH32 TTTGAGAAATAAAAGGCTATCCTGTAAT---C----ATTAAA 1453 pCjH61 TTTGAGAAATAAAAGGCTATCCTGCAAT---C----ATTAAA 1454 pTet TTTGAGAAATAAAAGGCTATCCTGCAATTATCAATTATTAAA 1455 pCC31 TTTGAGAAATAAAAGGCTATCCTGCAAT---C----ATTAAA 1456 529 1457 530 1458 1459 1460 1461 1462 1463 1464 1465 1466 1467 1468 1469 1470 1471 1472 1473 1474 1475 1476 1477 1478 1479 1480 1481 1482 1483 1484 1485 1486 1487 1488 1489 1490 1491 1492 1493 1494 1495 1496 27 1497 1498 1499 1500 1501 531 Figure captions 1502 1503 1504 532 Figure 1. Transfer of the conjugative tetracycline resistance plasmid pCjA13 in C. jejuni. 1505 1506 533 A. Conjugation frequency of plasmid pCjA13 to A3 recipient cells after different mating 1507 1508 534 incubation times. Cultures and mating mixtures were incubated at 42 ºC. B. Genotyping of 1509 1510 535 recipient (R), donor (D) and transconjugants (T): BglII restriction profile of plasmid DNA 1511 1512 536 (upper panel) and wlaN PCR amplification (lower panel). C. Conjugation frequency of 1513 1514 537 plasmid pCjA13 to A3 recipient cells at 37 and 42 ºC. Both cultures and mating mixtures 1515 1516 538 were incubated at the indicated temperatures. Significance was tested by an impaired two- 1517 1518 539 tailed t-test. Statistical significance is indicated by *** p<0.001. 1519 1520 1521 540 Figure 2. Temperature dependent transfer of conjugative tetracycline resistance plasmids. 1522 1523 541 A. Upper panels, BglII restriction profile of pCjA9 and pTet plasmids from recipient (R), 1524 1525 542 donor (D) and transconjugant (T) cells. R strain was A3, D strains were A9 and 81-176 for 1526 1527 543 pCjA9 and pTet, respectively. In lower panels, wlaN PCR amplification. Notice that the 81- 1528 1529 544 176 strain carries two plasmids, pVir and the TcR plasmid pTet, whereas in its derivative 1530 1531 545 transconjugant only the pTet plasmid was detected. B. Conjugation frequency of pCAj9 and 1532 1533 546 pTet plasmids at 37 and 42 ºC using donor and recipient cells as in A. C. Genotyping of R, 1534 1535 547 D and T cells. R strain was A3S, D strains were H32 and H61 for pCjH32 and pCjH61, 1536 1537 1538 548 respectively. BglII restriction profile of pCjH32 and pCjH61 plasmids (upper panels), wlaN 1539 1540 549 PCR amplification (middle panels) and flaA PCR amplification (lower panel). D. Southern 1541 1542 550 hybridization using a digoxygenin labeled tet(O) specific probe. Plasmid samples from the 1543 1544 551 clinical isolates H32 and H61 and the control strains A3(pTet) (positive control) and H40 1545 1546 552 (negative control) were analyzed. H40 is tetracycline susceptible (Iglesias-Torrens et al., 1547 1548 553 2018). Left panel, plasmid samples after ethidium bromide staining (EtBr). Right panel, 1549 1550 554 tet(O) detection in the plasmid samples. E. Conjugation frequency of pCjH32 and pCjH61 1551 1552 28 1553 1554 1555 1556 1557 555 plasmids at 37 and 42 ºC. Donor and recipient cells as in C. In B and E, both cultures and 1558 1559 1560 556 mating mixtures were incubated at the indicated temperatures. Significance was tested by 1561 1562 557 an impaired two-tailed t-test. Statistical significance is indicated by * p<0.05, ** p<0.01, 1563 1564 558 *** p<0.001. 1565 1566 559 Figure 3. Transcription analysis by semi-quantitative RT-PCR of the selected genes coding 1567 1568 560 for putative proteins of the conjugative apparatus. A. PCR- amplification using specific 1569 1570 561 primers for the cmgB2, cmgB5, cmgB8 and cmgB11 homologous genes using genomic 1571 1572 562 DNA from the strains 81-176, A13, A9 and A3, A3 (pTet), H32 and H61. B. 1573 1574 563 Transcriptional expression of the conjugation related genes was monitored by semi 1575 1576 1577 564 quantitative RT-PCR. The RNA was extracted from cultures of the A13 strain grown at 37 1578 1579 565 and 42 ºC. RNA16S amplification was included as a control to confirm that equivalent 1580 1581 566 amounts of template were used. RNA samples from three independent cultures were tested 1582 1583 567 by RT-PCR obtaining similar results. The images correspond to gels from a representative 1584 1585 568 experiment. 1586 1587 569 Figure 4. Sequence comparison plasmids pCjH32, pCjH61 and pTet (reference plasmid, 1588 1589 570 AY394561.1). Nucleotide BLAST percent identity is color-coded according to the legend. 1590 1591 571 Genes predicted with Prokka in pCjH32 and pCjH61 and named according to their 1592 1593 1594 572 correspondence to genes in pTet are shown on the top and bottom, respectively. Genes that 1595 1596 573 are not present in pTet but in the other two plasmids have been labeled with their putative 1597 1598 574 function when possible. 1599 1600 575 1601 1602 1603 1604 1605 1606 1607 1608 29 1609 1610 pCjA13 A B C *** 1E-03 R D T 1E-3 pCjA13 Kb 10 1E-04 Conjugation frequency Conjugation frequency 8 6 5 1E-4 1E-05 4 3 2.5 1E-06 2 1E-5 1E-07 1 0.8 wlaN n.d. n.d. 1E-6 0.6 0 1 2 3 4 5 37 ºC 42 ºC Time (hours) pCjA9 pTet A R D T B 1E-3 R D T Kb * ** Conjugation frequency 10 1E-4 8 6 5 4 1E-5 3 2.5 2 1E-6 1 0.8 1E-7 wlaN 0.6 37 ºC 42 ºC 37 ºC 42 ºC pCjA9 pTet C pCjH32 pCjH61 D 32 61 40 32 61 40 jH jH jH jH jH jH R D T R D T et et pC pC pC pT pC pC pC pT Kb 10 8 21.2 6 5 4 3.5 Kb 3 2.5 1.5 2 EtBr tet(O) probe 1.5 1E-4 E 1 *** * Conjugation frequency 1 1E-5 0.8 wlaN 0.6 1E-6 3 1.5 1 1E-7 0.8 flaA 1E-8 37 ºC 42 ºC 37 ºC 42 ºC pCjH32 pCjH61 A B 42 ºC/37 ºC 42 ºC 37 ºC t Te 76 /p -1 A13 A9 A3 H32 H61 C- A3 81 cmgB2 3.6 x cmgB2 cmgB5 4.8 x cmgB5 cmgB8 9.6 x cmgB8 cmgB11 cmgB11 7.5 x 16S RNA pCjH61 pCjH32 pTet tetO tetO cpp3 cpp3 cpp8 cpp9 cpp4 cpp10 cpp11 repA cpp12 cpp13 cpp7 cpp8 cpp9 cpp10 cpp11 cpp12 cpp13 cpp14 cpp14 cpp17 cpp18 cpp19 NYN cpp20 domain cpp21 cpp16 cpp22 cpp17 cpp23 cmgB6 partial cpp18 cpp19 cpp24 cpp20 cpp25 cpp22 cpp26 cpp23 cpp24 cpp25 vapD-like cpp26 repL cpp27 vapD cpp27 cpp29 vapD cmgB2 cpp29 cmgB2 cmgB3/4 cmgB3/4 cpp32 cpp32 cpp33 cpp33 ssb1 ssb1 cpp35 cmgB5 cmgB5 cmgB6 cmgB6 cmgB7 cmgB7 cmgB8 cmgB8 cmgB9 cmgB9 cmgB10 cmgB10 cmgB11 cmgB11 cmgD4 cmgD4 cpp44 cpp44 cpp45 cpp45 cpp46 cpp46 cpp47 cpp47 cpp49 cpp49 cpp50 cpp50 cpp51 cpp51 83% 100% Tetracycline resistance transmission in Campylobacter is promoted at temperatures resembling the avian reservoir. Cuevas, E., Guirado, P., Miró, E., Iglesias-Torrens, Y., Navarro, F., Alioto, T. S., Gómez- Garrido, J., Madrid, C., Balsalobre, C. Supplementary information Table S1. Conjugation frequency and bacterial growth at 37 versus 42 ºC……… 2 Table S2. Protein homology between pTet, pCjH32 and pCjH61……………… 3 1 Conjugation Recipient cell frequency av. growth T4/T0* 37ºC 3.00E-05 2.71±0.6 42ºC 4.04E-04 3.69±0.5 Ratio 42ºC/37ºC 13.3 1.36 Table S1. Conjugation frequency and bacterial growth at 37 versus 42 ºC. The average conjugation frequency of plasmid pCjA13 to A3 recipient cells at 37 and 42 ºC was calculated from six conjugation mixtures (detailed data shown in Fig. 1C). The ratio 42ºC/37ºC indicate that conjugation occurs >10-fold more efficiently at 42 ºC. Recipient cell growth T4/T0 indicate the fold duplication of the recipient cells during the 4 hours incubation of the mating mixtures at the indicated temperatures, the concentration of recipient cells at 4h was divided by the concentration at time 0. The ratio 42ºC/37ºC indicate that bacterial growth is only slightly promoted at 42ºC as compared at 37ºC (1.3 fold). Overall, these data rule out that the detection of higher conjugation frequency results from a promoted growth at 42 ºC. 2 Table S2. Protein homology between pTet, pCjH32 and pCjH61. The predicted ORFs from plasmid pTet, pCjH32 and pCjH61 plasmids and the percentage of identity among the ORFs for the indicated comparisons are given. To assign all the genes to their corresponding ortholog in the other plasmids, we performed an all versus all Blastp with all the protein sequences. Hits with more than 75% identity and covering at least an 80% of the sequence length were selected. The gene names were inherited from the pTet reference transcript annotation. % Identity Gene pTet ID pCjH32 ID pCjH61 ID pTet/pCjH32 pTet/pCjH61 pCjH32/pCjH61 tet(O) AAR29535.1 AOHAJODB_00001 EOHDCONB_00001 99.8 99.1 98.9 cpp2 AAR29536.1 cpp3 AAR29537.1 AOHAJODB_00002 EOHDCONB_00002 100.0 cpp4 AAR29538.1 AOHAJODB_00003 100.0 repA AAR29539.1 AOHAJODB_00004 100.0 cpp6 AAR29540.1 cpp7 AAR29541.1 AOHAJODB_00005 100.0 cpp8 AAR29542.1 AOHAJODB_00006 EOHDCONB_00003 100.0 100.0 100.0 cpp9 AAR29543.1 AOHAJODB_00007 EOHDCONB_00004 100.0 100.0 100.0 cpp10 AAR29544.1 AOHAJODB_00008 EOHDCONB_00005 100.0 100.0 100.0 cpp11 AAR29545.1 AOHAJODB_00009 EOHDCONB_00006 100.0 100.0 100.0 cpp12 AAR29546.1 AOHAJODB_00010 EOHDCONB_00007 100.0 100.0 100.0 cpp13 AAR29547.1 AOHAJODB_00011 EOHDCONB_00008 97.7 97.7 100.0 cpp14 AAR29548.1 AOHAJODB_00012 EOHDCONB_00009 99.4 99.5 99.8 cpp16 AAR29549.1 AOHAJODB_0013 AOHAJODB_0014 EOHDCONB_00010 cpp17 AAR29550.1 AOHAJODB_00015 EOHDCONB_00011 97.0 96.8 98.1 3 cpp18 AAR29551.1 AOHAJODB_00016 EOHDCONB_00012 100.0 95.6 95.6 cpp19 AAR29552.1 AOHAJODB_00017 EOHDCONB_00013 96.8 96.8 100.0 cpp20 AAR29553.1 AOHAJODB_00018 EOHDCONB_00014 94.0 100.0 94.0 cpp21 AAR29554.1 EOHDCONB_00015 98.2 cpp22 AAR29555.1 AOHAJODB_00019 EOHDCONB_00016 95.1 99.8 95.3 cpp23 AAR29556.1 AOHAJODB_00020 EOHDCONB_00017 85.9 88.2 95.7 * AAR29570.1 AOHAJODB_00036 EOHDCONB_00018 93.1 90.3 AOHAJODB_00021 EOHDCONB_00019 94.0 AOHAJODB_00022 EOHDCONB_00020 83.6 cpp24 AAR29557.1 AOHAJODB_00023 EOHDCONB_00021 97.2 100.0 97.2 cpp25 AAR29558.1 AOHAJODB_00024 EOHDCONB_00022 94.6 98.4 92.0 cpp26 AAR29559.1 AOHAJODB_00025 EOHDCONB_00023 97.5 100.0 97.5 EOHDCONB_00024 EOHDCONB_00025 EOHDCONB_00026 EOHDCONB_00027 cpp27 AAR29560.1 AOHAJODB_00026 EOHDCONB_00028 93.6 100.0 93.6 vapD AAR29561.1 AOHAJODB_00027 EOHDCONB_00029 83.7 91.0 85.0 cpp29 AAR29562.1 AOHAJODB_00028 EOHDCONB_00030 99.1 99.1 98.1 cmgB2 AAR29563.1 AOHAJODB_00029 EOHDCONB_00031 92.0 92.0 83.9 cmgB3/4 AAR29564.1 AOHAJODB_00030 EOHDCONB_00032 98.7 98.2 97.2 cpp32 AAR29565.1 AOHAJODB_00031 EOHDCONB_00033 81.5 86.8 84.0 cpp33 AAR29566.1 AOHAJODB_00032 EOHDCONB_00034 99.5 ssb1 AAR29567.1 AOHAJODB_00033 EOHDCONB_00035 97.2 97.2 100.0 cpp35 AAR29568.1 AOHAJODB_00034 EOHDCONB_00036 97.8 97.8 100.0 cmgB5 AAR29569.1 AOHAJODB_00035 EOHDCONB_00037 90.0 94.1 95.7 4 cmgB6 AAR29570.1 AOHAJODB_00036 EOHDCONB_00038 84.9 85.3 95.8 cmgB7 AAR29571.1 AOHAJODB_00037 EOHDCONB_00039 94.5 100.0 94.5 cmgB8 AAR29572.1 AOHAJODB_00038 EOHDCONB_00040 86.2 100.0 86.2 cmgB9 AAR29573.1 AOHAJODB_00039 EOHDCONB_00041 89.2 98.0 90.6 cmgB10 AAR29574.1 AOHAJODB_00040 EOHDCONB_00042 86.1 99.5 85.8 cmgB11 AAR29575.1 AOHAJODB_00041 EOHDCONB_00043 96.0 100.0 96.0 cmgD4 AAR29576.1 AOHAJODB_00042 EOHDCONB_00044 94.9 99.8 94.7 cpp44 AAR29577.1 AOHAJODB_00043 EOHDCONB_00045 99.3 99.3 100.0 cpp45 AAR29578.1 AOHAJODB_00044 EOHDCONB_00046 100.0 100.0 100.0 cpp46 AAR29579.1 AOHAJODB_00045 EOHDCONB_00047 100.0 100.0 100.0 AOHAJODB_00046 EOHDCONB_00048 100.0 cpp47 AAR29580.1 AOHAJODB_00047 EOHDCONB_00049 100.0 100.0 100.0 cpp49 AAR29581.1 AOHAJODB_00048 EOHDCONB_00050 91.5 99.2 91.2 cpp50 AAR29582.1 AOHAJODB_00049 EOHDCONB_00051 100.0 99.8 99.8 cpp51 AAR29583.1 AOHAJODB_00050 EOHDCONB_00052 100.0 100.0 100.0 *The EOHDCONB_00018 ORF shows a high percentage of identity with cmgB6 from both pTet and pCJH32. The length of the EOHDCONB_00018 ORF (93 bp) is shorter than cmgB6 (843 bp) indicating that is the result of a partial translocation. 5