Hepatology, VOL. 72, NO. 1, 2020 Autoimmune, Cholestatic and Biliary Disease A Molecular Mechanism Underlying Genotype-Specific Intrahepatic Cholestasis Resulting From MYO5B Mutations Arend W. Overeem,1 Qinghong Li,1 Yi-Ling Qiu,2,3 Fernando Cartón-García,4 Changsen Leng,1 Karin Klappe,1 Just Dronkers,1 Nai-Hua Hsiao,1 Jian-She Wang,2,3 Diego Arango,4 and Sven C.D. van Ijzendoorn1 BACKGROUND AND AIMS: Progressive familial intrahe- with active rab11a and occurred at the trans-Golgi Network/ patic cholestasis (PFIC) 6 has been associated with missense recycling endosome interface. but not biallelic nonsense or frameshift mutations in MYO5B, CONCLUSIONS: Our results reveal a mechanism through ­encoding the motor protein myosin Vb (myoVb). This genotype- which MYO5B motor domain mutations can cause the mislo- phenotype correlation and the mechanism through which calization of canalicular proteins in hepatocytes which, unex- MYO5B mutations give rise to PFIC are not understood. pectedly, does not involve myoVb loss-of-function but, as we The aim of this study was to determine whether the loss of propose, a rab11a-mediated gain-of-toxic function. The results myoVb or expression of patient-specific myoVb mutants can explain why biallelic MYO5B mutations that affect the motor be causally related to defects in canalicular protein localization domain but not those that eliminate myoVb expression are and, if so, through which mechanism. associated with PFIC6. (Hepatology 2020;72:213-229). APPROACH AND RESULTS: We demonstrate that the H cholestasis-associated substitution of the proline at amino acid position 600 in the myoVb protein to a leucine (P660L) epatocytes are polarized epithelial cells with caused the intracellular accumulation of bile canalicular pro- basolateral/sinusoidal plasma membrane teins in vesicular compartments. Remarkably, the knockout of domains that is orientated to the blood cir- MYO5B in vitro and in vivo produced no canalicular locali- culation and apical/canalicular plasma membranes that zation defects. In contrast, the expression of myoVb mutants form the bile canaliculi (BC) through which bile is consisting of only the tail domain phenocopied the effects safely moved out of the liver. Tight junctions separate of the Myo5b-P660L mutation. Using additional myoVb and rab11a mutants, we demonstrate that motor domain-deficient the sinusoidal and canalicular domains and prevent the myoVb inhibited the formation of specialized apical recycling mixing of bile and blood. Defects in the polarized dis- endosomes and that its disrupting effect on the localiza- tribution or function of cell surface proteins can cause tion of canalicular proteins was dependent on its interaction severe liver diseases.(1) Of these, progressive familial Abbreviations: ANO, anoctamin; ATP8B1, adenosine triphosphatase phospholipid transporting 8b1; BC, bile canaliculi; CRISPR, clustered regularly interspaced short palindromic repeat; EGFP, enhanced green fluorescent protein; HEK, human embryonic kidney; hiHep, human-induced hepatocyte; KO, knockout; Mrp, multidrug resistance-associated protein; MVID, microvillus inclusion disease; Myc, myelocytomatosis; myoVb, myosin Vb; PFIC, progressive familial intrahepatic cholestasis; SDS, sodium dodecyl sulfate; TGN, trans-Golgi Network; TPN, total parenteral nutrition. Received April 15, 2019; accepted October 17, 2019. Additional Supporting Information may be found at onlinelibrary.wiley.com/doi/10.1002/hep.31002/suppinfo. Supported by grants from the Nederlandse vereniging voor Gastroenterologie (to S. I. J.) and the Natural Science Foundation of China, Nos. 81873543 and 81570468 (to J. S. W.). © 2019 The Authors. Hepatology published by Wiley Periodicals, Inc., on behalf of American Association for the Study of Liver Diseases. This is an open access article under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs License, which permits use and distribution in any medium, provided the original work is properly cited, the use is non-commercial and no modif ications or adaptations are made. View this article online at wileyonlinelibrary.com. DOI 10.1002/hep.31002 Potential conflict of interest: Nothing to report. 213 OVEREEM ET AL. Hepatology, July 2020 intrahepatic cholestasis (PFIC) is characterized by the microvillus inclusion disease (MVID),(5-8) a congen- inability of hepatocytes to secrete bile into the cana- ital enteropathy characterized by intractable diarrhea liculi, resulting in the buildup of bile components and and malabsorption and, at the cellular level, the mis- liver failure. PFIC can be caused by mutations in differ- localization of apical brush border proteins. Notably, ent genes,(2) including adenosine triphosphatase phos- many—but not all—patients with MVID also develop pholipid transporting 8B1 (ATP8B1); PFIC1), ATP cholestasis, leading to liver failure.(9) Binding Cassette Subfamily B Member 11 (ABCB11) How MYO5B mutations may lead to PFIC is not (PFIC2), ATP Binding Cassette Subfamily B Member known. Given the effect of MYO5B mutations on the 4 (ABCB4) (PFIC3), tight junction protein 2 (TJP2) apical localization of brush border proteins in enterocytes (PFIC4), and nuclear receptor subfamily 1, group H, in MVID, it is possible that myoVb is similarly needed member 4 (NR1H4; PFIC5). ATP8B1, ABCB11, and for the correct localization of BC proteins in hepato- ABCB4 encode canalicular membrane transporters. cytes and can cause cholestasis when mutated. In vitro Mutations in these proteins affect their expression, studies in the hepatic WIF-B9 cell line, in which the canalicular localization, or function and consequently ectopic expression of a rat myoVb tail fragment impaired impair bile salt secretion (ABCB11/bile salt export canalicular protein trafficking,(10) may support this pump [BSEP]) or phospholipid dynamics in the can- hypothesis. In situ studies, however, showing no immu- alicular membrane (ATP8B1, multidrug resistance nohistochemical abnormalities of canalicular transporters protein 3). NR1H4 encodes the farnesoid X receptor, in liver biopsies of some patients with MYO5B muta- a transcription factor that regulates the expression of tions presenting severe cholestasis,(3,11) challenge this ABCB11/BSEP. TJP2 encodes the tight junction pro- hypothesis. Furthermore, although missense, nonsense, tein zona occludens-2, and mutations in these presum- and frameshift MYO5B mutations all have been associ- ably lead to the leaking of bile out of the canaliculi. ated with MVID (reviewed in van der Velde et al.(7)), Recently, mutations in the MYO5B gene were biallelic nonsense and frameshift mutations predicted reported in a group of patients with PFIC who pre- to eliminate myoVb expression are noticeably absent in sented elevated bilirubin and bile acid levels with patients with non-MVID cholestasis.(3,12) Thus, not all normal gamma-glutamyl transpeptidase (GGT) lev- pathogenic MYO5B mutations may lead to PFIC and/or els and did not have mutations in any of the other canalicular protein localization defects. PFIC genes.(3,4) Unique MYO5B mutations were Notably, causality between patient MYO5B muta- associated with each affected family. MYO5B encodes tions and the mislocalization of BC proteins in hepato- the actin-filament–based motor protein myosin Vb cytes has not been experimentally addressed. The need (myoVb). MyoVb binds selected small guanosine to decisively determine whether a causal relationship triphosphatase (GTPase) rab proteins, including the exists between patient-specific MYO5B mutations and trans-Golgi Network (TGN)-associated and/or recy- canalicular protein localization defects is particularly cling endosome-associated rab8 and rab11a, and has relevant for PFIC presenting in patients with MVID. been implicated in apical plasma membrane protein Indeed, because patients with MVID receive lifelong trafficking. Mutations in MYO5B can also cause total parenteral nutrition (TPN), which itself may ARTICLE INFORMATION: From the 1 Department of Biomedical Sciences of Cells and Systems, Section Molecular Cell Biology, University of Groningen, University Medical Center Groningen, Groningen, the Netherlands; 2 The Center for Pediatric Liver Diseases, Children’s Hospital of Fudan University, Shanghai, China; 3 Department of Pediatrics, Jinshan Hospital of Fudan University, Shanghai, China; 4 Group of Biomedical Research in Digestive Tract Tumors, CIBBIM-Nanomedicine, Vall d’Hebron Research Institute (VHIR), Universitat Autònoma de Barcelona (UAB), Barcelona, 08035, Spain. ADDRESS CORRESPONDENCE AND REPRINT REQUESTS TO: Sven C.D. van Ijzendoorn, Ph.D. E-mail: s.c.d.van.ijzendoorn@umcg.nl UMCG, HPC FB34, Antonius Deusiglaan 1, 9713 AV Tel.: +31503616209 Groningen, the Netherlands 214 Hepatology, Vol. 72, No. 1, 2020 OVEREEM ET AL. induce cholestasis and liver failure,(13,14) it is difficult CLUSTERED REGULARLY to determine whether liver symptoms in these patients INTERSPACED SHORT are MYO5B mutation or TPN induced. PALINDROMIC REPEAT The aim of this study was to address the causal rela- KNOCKOUT tionship between patient MYO5B mutations and cana- licular protein mislocalization and to clarify the PFIC A lentiviral clustered regularly interspaced short pal- disease mechanism in these patients. We demonstrate indromic repeat (CRISPR) construct targeting Exon3 that myoVb is dispensable for the correct localization of of MYO5B was generated using the plentiCRISPR-V2 BC proteins yet can cause cholestasis-associated defects vector (Addgene #52961) following provided protocols in their localization when mutated through an unex- (guide RNA target sequence: tcttacggaatccagatatc). pected mechanism involving the small GTPase rab11a. Cells were transduced and selected with puromycin as described. Cells were plated on poly-L-lysine coat- ing at 18 cells/cm2 with untreated cells/cm2 as feeder Materials and Methods layer. After 4 days, cells were selected with puromycin (2.5 μg/mL) to kill feeder cells, and remaining colonies CELL CULTURE were isolated as separate lines. To deplete MyoVb in HUES9 cells, the cells were incubated with MYO5B- HepG2 cells (American Type Culture Collection targeting lentiCRISPR viral supernatant for 5 hours HB8065) were maintained in high-glucose Dulbecco’s (in E8 medium supplemented with 8 μg/mL poly- modified Eagle’s medium with 10% heat-inactivated brene). After 48 hours, cells were selected with puro- fetal bovine serum, 2 mM l-glutamine, 100 IU/mL mycin (1 μg/mL). Selected cells were then plated at penicillin, and 100 μg/mL streptomycin in a humid- 28 cells/cm2, and the resulting colonies were mechan- ified atmosphere. For experiments, cells were plated ically passaged after 3 weeks. Clones were checked for on poly-L-lysine–coated coverslips and used 3 days myoVb knockout (KO) by means of a western blot. later. Human embryonic stem cell line 9 (HUES9) cells were maintained on vitronectin in E8 (Thermo PLASMIDS Fisher). Cells were passaged every 4-5 days with 1% RevitaCell Supplement added to the cells overnight Full-length human myoVb-coding sequence was on day of passage. Differentiation of HUES9 cells to amplified from HepG2 complementary DNA (cDNA) hepatocytes was as described.(15) through PCR, including a myelocytomatosis (myc)- encoding ‘5 overhang in the forward primer sequence. Amplified myc-myoVb was inserted into pENTR1a VIRAL TRANSDUCTION vectors. All described myoVb mutants were generated by Lentiviral particles were produced using a sec- modification of this construct using the Q5 Site-Directed ond-generation system based on pCMVdR8.1 and Mutagenesis Kit (New England BioLabs) with primers pVSV-G. Human embryonic kidney (HEK) 293T cells designed in the NEBaseChanger tool. MyoVb and thereof in the amount of 1 × 106 were transferred to poly-L- derived mutant constructs were transferred to lentiviral lysine–coated 9 cm2 plates in 1.3 mL culture medium. vectors for mammalian expression through Gateway clon- Lentiviral vector in the amount of 1,200 ng, 1,000 ng ing using LR Clonase II (Thermo Scientific) as per man- pCMVdR8.1, and 400 ng pVSV-G were mixed with ufacturer’s instruction. Full-length myc-myoVb constructs 7.8 μL FuGENE HD in 200 μL Opti-MEM and were transferred to pLenti-cytomegalovirus (CMV)- added to suspension HEK293T. After overnight incu- Blast-DEST (706-1; Addgene #17451), and myc-myoVb bation, medium was refreshed, and after 48 hours, viral tail domain constructs to pLenti-CMV-Puro-DEST particles were harvested and filtered (0.45 μm polyvi- (w118-1; Addgene #17452). Enhanced green fluores- nylidene fluoride [PVDF] membrane filter). One day cent protein (EGFP)-tagged wild type (WT) rab11a after plating, cells were incubated with viral particles (rab11aWT) and the EGFP-tagged dominant negative for 16 hours (supplemented with 8 μg/mL polybrene). mutant of rab11a in which the serine at position 25 is Antibiotics (2.5 μg/mL puromycin, 4 μg/mL blastici- subsitituted with an asparagine (rab11aS25N)(16) were din) were added 24 hours after viral incubation. gifts from R.E. Pagano (Mayo Clinic). 215 OVEREEM ET AL. Hepatology, July 2020 WESTERN BLOTTING expression levels were measured by real-time quanti- tative RT-PCR using ABsolute aPCR SYBR Green Cells were resuspended in radio immunoprecipita- Master Mix (Westburg) in a Step-One Plus Real- tion assay buffer (150 mM NaCl, 1% Nonidet P40, Time PCR machine (Applied Biosystems), and the 0.5% sodium deoxycholate, 0.1% sodium dodecyl sul- resulting data were analyzed using the LinRegPCR fate (SDS), 50 mM Tris pH 8.0) containing prote- method. The primers used to mutate MYO5B cDNA ase inhibitors. Lysates were mixed with sample buffer were as follows: (2% SDS, 5% β-mercaptoethanol, 0.125M Tris–HCl, Forward -ACCAGCTGCCGTTCTTACGGA-. pH 6.8, 40% glycerol, 0.01% bromophenol blue) and Reverse -TGCGTTGTACATCAATTGGG-. incubated at 70°C for 10 minutes. Samples were resolved with SDS-polyacrylamide gel electrophore- sis and electro-transferred onto PVDF membranes. STATISTICS Membranes were blocked with Odyssey-blocking buf- For all phenotype quantifications, statistical signif- fer and incubated overnight at 4°C with primary anti- icance of differences between triplicate experiments bodies (Supporting Table S1). After incubation with was determined using Student t test (two-tailed, secondary antibodies, immunoblots were scanned with unpaired, equal variance). Replicates represent quanti- the Odyssey (LI-COR Biosciences). Relative quanti- fications of >200 cells. P values: *P < 0.05, **P < 0.01, fication was performed using the Odyssey software. ***P < 0.001. MICROSCOPY Immunolabeling and fluorescence microscopy were Results performed essentially as described.(3,8) Antibodies used are listed in Supporting Table S1. Fluorescent mul- MyoVb DEFICIENCY DOES NOT tiplex immunohistochemistry of paraffin-embedded DISRUPT CANALICULAR PROTEIN liver tissue of a reported patient with PFIC6(3) and LOCALIZATION an anonymous donor with cholangitis as control was performed with standard procedure of Tyramine Signal Displacement of BC transporters to the cyto- Amplification. Fluorescent images were analyzed using plasm of hepatocytes has been shown in liver biopsies a combination of ImageJ and Adobe Photoshop. For of patients with MVID presenting with cholestasis electron microscopy, cells were fixed by adding drop- and homozygous missense mutations (c.1979C>T/p. wise an equal volume fixative (2% glutaraldehyde and P660L)(17) and a patient with non-MVID PFIC 2% paraformaldehyde in 0.1 M sodium cacodylate with homozygous missense mutations (c.796T>C/p. buffer). After 10 minutes, this mixture was replaced by C266R)(3) in the MYO5B gene. Here, we demonstrate pure fixative at room temperature for 30 minutes. After the mislocalization of BC transporters to intracellular fixation in 1% osmium tetroxide/1.5% potassium ferro- compartments in hepatocytes of an additional patient cyanide (4°C; 30 minutes), cells were dehydrated using with non-MVID PFIC6 carrying a missense MYO5B ethanol and embedded in EPON epoxy resin. Then, mutation (c.437C>T/p.S158F(3); Supporting Fig. S1), 60-nm sections were cut and contrasted using 2% ura- thereby expanding the number of patients with nyl acetate followed by Reynolds lead citrate. Images PFIC in which missense MYO5B mutations correlate were captured with a Zeiss Supra 55 in scanning and with a cytoplasmic displacement of BC transport- transmission electron microscopy mode at 26 KV. ers. Intriguingly, in patients with cholestatic MVID with nonsense MYO5B mutations, a normal local- ization of BC transporters was reported,(11) suggest- REAL-TIME QUANTITATIVE PCR ing that loss of myoVb expression is not sufficient to RNA was harvested using trizol reagent (Sigma). induce BC transporter mislocalization. To address the RNA was reverse transcribed in the presence of oli- requirement of MYO5B expression for the localization go(dT)12-18 (Invitrogen) and deoxyribonucleotide of BC transporters in hepatocytes, we examined the triphosphate (Invitrogen) with Moloney murine leu- in vivo distribution of the ATP-binding ­ cassette kemia virus reverse transcriptase (Invitrogen). Gene sub-family C member 2 (ABCC2)/multidrug 216 Hepatology, Vol. 72, No. 1, 2020 OVEREEM ET AL. resistance-associated protein (Mrp) 2 and the structural livers (Fig. 1A,B). Human HepG2 cells (HepG2Par) BC protein radixin in the liver of whole-body Myo5b develop apical-basolateral polarity and BC lumens KO mice.(18) We observed their exclusive localization between adjacent cells.(19) In agreement with the obser- at BC, indistinguishable from wild-type control mouse vations in Myo5b KO mouse hepatocytes, HepG2 cells $ % :LOGW\SH0RXVH 0\RE.20RXVH :LOGW\SH0RXVH 0\RE.20RXVH '$3,+1)Į5DGL[LQ '$3,+1)Į$%&& 5DGL[LQ $%&& & ' +HS*3$5 +HS*.2 5 3$ .2   '$3,$%&&$FWLQ H S* HS* + + 0\R9E $FWLQ ( ) +8(63$5KL+HSV +8(6.2KL+HSV 5 1XFOHL$%&& 3$ 2  . ( 6 (6  8 8 + + 0\R9E $FWLQ FIG. 1. MyoVb deficiency does not disrupt canalicular protein localization. (A,B) Immunofluorescent staining of ABCC2 and radixin reveals their canalicular localization in both wild-type and Myo5b KO mouse liver sections. HNF4α costaining marks hepatocytes. (C) KO of MYO5B in HepG2KO cells (treated with MYO5B-targeting pLentiCRISPR V2) was confirmed by western blot (compared with parental line, HepG2PAR). (D) In HepG2 cells, localization of ABCC2 and F-actin is unaffected by MYO5B KO (HepG2KO) compared with HepG2PAR control. Yellow arrowheads indicate BCs. (E) Western blot for myoVb in HUES9KO cells confirmed MYO5B KO (compared with parental line, HUES9Par). (F) HiHeps generated from HUES9KO cells exhibit BC formation comparable with HUES9Par-derived hiHeps, with exclusive canalicular labeling of ABCC2. Scale bars: 10 μm. 217 OVEREEM ET AL. Hepatology, July 2020 in which endogenous myoVb had been knocked out by expression of myoVb-P660L in HepG2KO cells caused CRISPR/CRISPR-associated protein 9 (Cas9; Fig. 1C; the intracellular accumulation of the BC proteins Supporting Fig. S2A; HepG2KO cells) showed no defect ABCC2/MRP2 and ANO6, when compared with in the canalicular localization of ABCC2/MRP2, which HepG2KO cells expressing the wild-type MYO5B gene was indistinguishable from that in HepG2Par cells (Fig. (Fig. 2A-C). This was accompanied by a reduction in 1D). Similar results were obtained with another cana- the amount of BC (Supporting Fig. S2D). Notably, licular protein, anoctamin (ANO)-6 (Supporting Fig. HepG2Par cells that expressed myoVb-P660L showed S2B,C). We also generated a myoVb-deficient HUES9 a less severe phenotype (more BCs with subapical human pluripotent stem cell line through CRISPR/ localization of the mutant protein and less intracellu- Cas9-mediated gene KO (HUES9KO; Fig. 1E) lar accumulation of the mutant protein and canalicu- and differentiated these to polarized hepatocyte-like lar proteins) when compared with HepG2KO cells that cells (human-induced hepatocyte [hiHep]). These expressed myoVb-P660L (Supporting Fig. S2E-H, cf. hiHeps form in vivo-like multicellular BC (Fig. 1F).(15) Fig. 2). These data demonstrate that in the absence Similar to the results in HepG2KO cells, hiHeps derived of wild-type myoVb, mutant myoVb-P660L caused from HUES9KO cells formed multicellular BC to the intracellular accumulation of BC-resident proteins which ABCC2/MRP2 exclusively localized, similar to and provide evidence that this mutation is causally HUES9Par-derived hiHeps (Fig. 1F). linked to the hepatic canalicular defects as observed These data show that missense myoVb mutations in liver biopsies of the patients. Moreover, given the can correlate with a cytoplasmic displacement of BC absence of a localization defect in myoVb-depleted transporters, whereas myoVb as such is dispensable cells, the results also indicate that the disruptive effect for the correct localization of BC transporters at the of myoVb-P660L on the localization of canalicular canalicular membrane. proteins in hepatocytes cannot be explained by the mere loss of myoVb function. MVID-ASSOCIATED myoVb- P660L MUTATION CAUSES TAIL DOMAIN OF myoVb INTRACELLULAR ACCUMULATION IS SUFFICIENT TO CAUSE OF CANALICULAR PROTEINS INTRACELLULAR ACCUMULATION OF VESICLES AND BC PROTEINS Causality between patient MYO5B mutations and the mislocalization of BC proteins in hepatocytes has Because the mutated motor domain but not the not been experimentally addressed. Investigation of absence of the myoVb protein produced a disease such causality is particularly relevant for PFIC pre- phenotype, we hypothesized that regions that were senting in patients with MVID, as their long-term distal to the motor domain (IQ domains, coiled-coil parenteral nutrition obscures the etiology of hepatic domains, and/or the globular tail domain) may have dysfunction. We therefore focused on the founding been instrumental to the disruptive effects on the homozygous c.1979C>T mutation in the MYO5B localization of canalicular proteins. Therefore, we gene of Navajo patients with MVID.(6) These patients generated a human myoVb mutant that lacked the display liver disease, and liver biopsies from these motor domain, IQ domains, and part of the coiled- patients have been shown to display cytoplasmic dis- coil domain (Fig. 3A), which is similar to conven- placement of canalicular bile acid transporters and tionally used dominant-negative myoVb tail domain signs of perturbed polarity.(17) constructs (hereafter referred to as myoVb/Δ1-1195). To determine whether this MYO5B mutation, Similar to myoVb-P660L, the expression of myoVb/ leading to a P660L substitution in the myoVb pro- Δ1-1195 in HepG2KO cells resulted in the intracel- tein, could be causally linked to canalicular protein lular accumulation of ABCC2/MRP2 and ANO6 localization defects, a full-length human myc-tagged and a reduction in the number of BCs (Supporting MYO5B gene with the c.1979C>T mutation was con- Fig. S3A-E). Notably, the effect of myoVb/Δ1-1195 structed through site-directed mutagenesis, and either was more severe when compared with myoVb-P660L the myc-tagged wild-type myoVb or myc-myoVb- and was also observed when expressed in HepG2Par P660L protein was expressed in HepG2KO cells. The cells (Fig. 3B-E, Supporting Fig. S4A). Also, the 218 Hepatology, Vol. 72, No. 1, 2020 OVEREEM ET AL. A P\FP\R9E3/LQ+HS*.2 :7P\FP\R9ELQ +HS*.2 6XEDSLFDO 0\F$%&&&OXVWHUV 1XFOHL0\F$%&& B :7P\FP\R9ELQ P\FP\R9E3/LQ+HS*.2 +HS*.2 6XEDSLFDO 0\F$12&OXVWHUV 1XFOHL0\F$12 C D   $120\FFOXVWHUV RI0\FFHOOV  6XEDSLFDO0\F  RI0\F&HOOV        E / 9E / R9  \R 3 \ P 3 P E \F 9E \F 9 \R P \R 7 P P 7  P : \ F : \F P P FIG. 2. The MVID-associated myoVb-P660L mutation causes the intracellular accumulation of canalicular proteins. (A,B) Immunofluorescent microscopy images of myc-tagged myoVb proteins, ABCC2 and ANO6, in HepG2KO expressing myc-myoVb and myc-myoVb-P660L. HepG2KO cells expressing myoVb-P660L show intracellular colocalization of myc and ABCC2 (white arrows). Yellow arrowheads indicate BCs. Scale bars: 10 μm. (C) Quantification of the percentage of myc-positive cells that show intracellular clusters/accumulations of myc localized with ANO6. (D) Quantification of the percentage of myc-positive cells that show subapical localization of myc-tagged myoVb proteins. 219 OVEREEM ET AL. Hepatology, July 2020 ([RQ' QRWSUHVHQW A   &RLOHGFRLO   5DE%LQGLQJ 5DE%LQGLQJ      3/  0\F 0RWRUGRPDLQ  ,4GRPDLQV  *OREXODUWDLO    P\FP\R9E¨ 0\F B +HS*3$5 P\FP\R9E¨ C  $%&&DFFXPXODWLRQV  1XFOHL0\F$12  &HOOVZLWK   QV  \ R   O SW XU UR  9E HP WL3 QW  \R &R HQ ¨ FP S/ \ P D E +HS*3$5 P\FP\R9E¨ +HS*3$5 P\FP\R9E¨ 1XFOHL$%&&$12 1XFOHL0\F$%&& F FIG. 3. The tail domain of myoVb is sufficient to cause the intracellular accumulation of vesicles and BC proteins. (A) Schematic depiction of myoVb constructs. (B) Labeling of ANO6 and myc in HepG2Par cells expressing myc-myoVb/Δ1-1195 (white arrows indicate intracellular colocalization of both markers). (C) Quantification of the percentage of HepG2Par cells showing accumulation of ABCC2 (as shown in Fig. 4C) on expression of myc-myoVb/Δ1-1195 compared with untreated cells and cells transduced with an empty pLenti-Puro construct (control). (D,E) Labeling of ABCC2 and F-actin or ANO6 in HepG2Par cells expressing myc-myoVb/Δ1-1195 compared with untreated control. White arrows indicate intracellular accumulation of ABCC2 (and ANO6 in Fig. D). Scale bars: 10 μm unless labeled otherwise. Yellow arrowheads indicate BC. (F) Electron microscopy images of HepG2Par cells expressing myc-myoVb/Δ1- 1195. Cells displayed large collections of vesicles (enlarged areas) that were not observed in control cells. 220 Hepatology, Vol. 72, No. 1, 2020 OVEREEM ET AL. canalicular protein dipeptidyl peptidase IV accumu- However, the subcellular distribution of rab11a and lated inside the cells (Supporting Fig. S4B,C). The rip11 in HepG2KO cells and HepG2Par cells was indis- myoVb/Δ1-1195 mutant itself colocalized with the tinguishable, supporting the idea that myoVb expres- intracellular clusters (Fig. 3B). Electron microscopy of sion is dispensable for canalicular polarity (Supporting HepG2 cells expressing the myoVb mutant revealed Fig. S5B,C). Also, the recycling endosome-associated the presence of large clusters of vesicles, which were rab8, which in control HepG2 cells showed a rela- not observed in control HepG2 cells (Fig. 3F). Finally, tively dispersed cytoplasmic staining pattern, colocal- the expression of myoVb/Δ1-1195 in pluripotent ized with the clusters in cells expressing the myoVb HUESPar stem cell–derived hepatocytes also caused mutants (Fig. 4D). Lysosomal-associated membrane the intracellular accumulation of ABCC2/MRP2 and protein 1, a marker of late endosomes/lysosomes, did ANO6 (Fig. S4D), which indicated that the effects not colocalize with the canalicular protein–containing caused by this mutant are not specific for the HepG2 clusters, and its subcellular distribution pattern was cell line. Together, these results indicate that, in con- not visibly altered (Supporting Fig. S5D). In addition trast to the loss of myoVb, the expression of the tail to BC proteins, the sinusoidal transferrin receptor domain of myoVb mimicked the myoVb-P660L– and its ligand transferrin, which upon its endocyto- induced intracellular accumulation of BC proteins. sis is recycled to the sinusoidal surface through recy- cling endosomes, was found to colocalize with the BC MOTORLESS myoVb INDUCES protein–containing clusters (Fig. 4E, Supporting Fig. ACCUMULATION OF APICAL AND S5E). Moreover, when fluorescently labeled transfer- BASOLATERAL PROTEINS IN rin was allowed to be endocytosed in control HepG2 cells or HepG2 cells expressing mutant myoVb, its CLUSTERED COMPARTMENTS subsequent recycling to the cell surface was inhibited WITH MIXED RECYCLING in cells expressing the myoVb mutant, as evidenced by ENDOSOME AND TGN IDENTITY its persistent accumulation in the ANO6- and trans- The intracellular clusters of BC proteins and the ferrin receptor-containing clusters (Fig. 4E). appearance of clusters of vesicles in myoVb mutant- Although the cis-Golgi protein giantin did not expressing cells suggested that these clusters rep- colocalize with the BC protein–containing clusters resented intracellular organelles. To determine the (Fig. 5A), we found that three markers of the TGN identity of the mutant myoVb-induced ABCC2/ partly colocalized with the BC protein–containing MRP2- and ANO6-containing intracellular clusters, clusters (Fig. 5B-D). These included TGN46 and we performed immunofluorescence microscopy in golgin-97. With the exception of AP1y, which, in cells colabeled with markers for different organelles. addition to its typical TGN-like distribution pat- Proteins that make up BC microvilli, such as F-actin, tern, was also observed in the subapical region of the ABCC2/MRP2- and F-actin–binding pro- control HepG2 cells, TGN46 and golgin-97 did not tein radixin, or other phosphorylated proteins of the show a subapical localization in control HepG2 cells ezrin-radixin-moesi (ERM) family, did not colocalize (Fig. 5B-D). Together, these results indicate that the with the BC protein–containing intracellular cluster in BC protein–containing clusters in cells expressing the cells expressing myoVb/Δ1-1195 (Fig. 4A, Supporting myoVb mutant represented trafficking-incompetent Fig. S5A), indicating that these clusters did not repre- compartments with a mixed apical recycling endo- sent microvillus inclusions, which represent a hallmark some and TGN identity. of enterocytes in patients with MVID.(20) By contrast, intracellular clusters containing BC DISRUPTING Effect OF proteins colocalized with the apical recycling endo- MOTORLESS myoVb ON some markers rab11a and its interacting protein CANALICULAR PROTEIN rab11a-family of interacting proteins number 5/rab- LOCALIZATION REQUIRES interacting protein (rip11; Fig. 4B,C). This subcellular ACTIVE rab11a distribution of rab11a and its rip11 was markedly distinct from their exclusive subapical distribution in We hypothesized that the myoVb tail domain HepG2 cells that did not express the mutant protein. induced canalicular defects through rab8 or rab11a 221 OVEREEM ET AL. Hepatology, July 2020 A &RQWURO P\FP\R9E¨ B &RQWURO P\FP\R9E¨ 1XFOHL0\FS(50 1XFOHL5DE$12 C D &RQWURO P\FP\R9E¨ &RQWURO P\FP\R9E¨ 1XFOHL$%&&5,3 $125DE1XFOHL E &RQWURO P\FP\R9E¨ K K K K 0\F7I1XFOHL 0\F7I1XFOHL FIG. 4. Motorless myoVb induces the accumulation of apical and basolateral proteins in clustered compartments that display recycling endosome identity. (A) Phospho-proteins of the ezrin-radixin-moesi (ERM) family are not present in myc-myoVb/Δ1-1195 clusters (white arrows). Yellow arrowheads indicate BC. (B-D) Labeling of rip11, rab11a, and rab8 with ANO6 or ABCC2 in HepG2 expressing myc-myoVb/Δ1-1195 (white arrows) compared with control. White arrows indicate colocalization of endosomal proteins with BC- resident protein. The yellow arrowhead indicates juxta-nuclear staining of rip11 in nonpolarized control cells. (E) Labeling of myc in control and myc-myoVb/Δ1-1195 expressing HepG2, fixed after 30 minutes incubation (t = 0 hours) with fluorescently labeled transferrin (388Tf ) and after a 2-hour chase period. 488-Transferrin localized with myc-myoVb/Δ1-1195 clusters (white arrows) at t = 0 hours and at t = 2 hours. Scale bars: 10 μm. 222 Hepatology, Vol. 72, No. 1, 2020 OVEREEM ET AL. A &RQWURO P\FP\R9E¨ *LDQWLQ0\F1XFOHL B $12*ROJLQ1XFOHL C $127*11XFOHL D $12$31XFOHL FIG. 5. Motorless myoVb induces the accumulation of apical and basolateral proteins in clustered compartments that also display TGN identity. (A) Giantin labeling in HepG2 cells expressing myc-myoVb/Δ1-1195 compared with control. White arrows indicate lack of colocalization. (B,C) Golgin-97 and TGN46 showed colocalization with intracellular cluster of ANO6 in HepG2 expressing myc- myoVb/Δ1-1195 (white arrows). (D) AP1y localized with ANO6 in intracellular clusters in HepG2 expressing myc-myoVb/Δ1-1195 (white arrows). Scale bars: 10 μm. 223 OVEREEM ET AL. Hepatology, July 2020 function rather than competition with endogenous Thus, the intracellular clustering of BC proteins in cells myoVb. To test whether the observed defects are medi- expressing myoVb-P660L or the myoVb tail domain is ated through rab8 or rab11a, we generated a myoVb not phenocopied by loss of rab11a function. Together, mutant, which comprised only the globular tail domain we conclude that the interaction of the myoVb-P660L (the last 383 amino acids) and did not contain the or myoVb/Δ1-1195 mutant with active rab11a is binding site for rab8 in ExonC/Exon30 (referred to required for the myoVb-P660L- or myoVb/Δ1-1195– as myoVb/Δ1-1460; Fig. 6A). Like myoVb/Δ1-1195, induced intracellular accumulation of BC proteins, but myoVb/Δ1-1460 mutant led to the intracellular accu- not inhibition of polarity development, and that loss of mulation of BC proteins and a reduction in the num- rab11a function inhibited polarity development inde- ber of BCs, albeit to a lesser extent than the myoVb/ pendent of myoVb. Δ1-1195 mutant, suggesting that rab8 binding may contribute but is not essential to induce the effect (Fig. 6B,C, Supporting Fig. S5A). Indeed, substitu- MVID-ASSOCIATED NONSENSE tion of glycine at position 1300 in myoVb/Δ1-1195 to MYO5B MUTATIONS PRODUCING a leucine, a mutation known to abolish the interaction TRUNCATED myoVb MUTANTS between myoVb and rab8,(21) partially ameliorated its DO NOT DISRUPT HEPATOCYTE disrupting effects to the levels seen with the myoVb/ POLARITY AND CANALICULAR Δ1-1460 mutant (Fig. 6B,D). By contrast, when tyro- PROTEIN LOCALIZATION sine at position 1714 in myoVb/Δ1-1460 was mutated to glutamic acid (Y1714E; Fig. 6E-G), a mutation We reasoned that if the disrupting effect of that abolishes myoVb binding to rab11a,(21) the intra- motor-deficient myoVb mutants on the localization cellular accumulation of the canalicular proteins was of canalicular proteins required their interaction with completely abolished. Similarly, the introduction of rab11a through the distal C-terminal binding Y1714 this Y1714E mutation in the patient myoVb-P660L residue, nonsense MYO5B mutations that cause a pre- mutant reduced the intracellular accumulation of the mature translation termination codon and the resul- canalicular proteins (Fig. 7A-C). Notably, the intro- tant synthesis of truncated myoVb proteins should duction of Y1714E in myoVb/Δ1-1460 or myoVb- not lead to polarity defects. We therefore generated P660L did not lead to an increase in the number different MYO5B nonsense mutations previously of BC. reported in patients with MVID and listed in the Moreover, the myoVb/Δ1-1195 mutant, as well MVID registry (www.mvid-centr​ al.org), myoVb- as the patient myoVb-P660L mutant, failed to cause R363X (c.1087C>T), myoVb-R1016X (c.5382C>T), the intracellular clustering of ABCC2/MRP2 when and myoVb-R1795X (c.5383C>T; Fig. 8A), and expressed in HepG2 cells that also expressed the expressed these in HepG2KO cells. Note that in con- EGFP-tagged mutant rab11aS25N (Fig. 7D), which is trast to the myoVb-R363X and myoVb-R1016X expected to shift the equilibrium of rab11a toward the mutants the myoVb-R1795X mutant contains the guanosine diphosphate/nucleotide-free state and exert rab11a-binding site. Western blot analyses confirmed dominant-negative effects on endogenous rab11a by that these mutants led to the expression of truncated occupying the endogenous guanine nucleotide exchange myoVb proteins at their predicted molecular weights factors (GEFs). Consistent with reports in other cells(22) (Fig. 8B). Fluorescence microscopy showed that the and the previously reported location of two rab11 mutants failed to cause the intracellular accumulation GEFS, rab11-interacting protein-1, and Crag at the of ABCC2/MRP2 (Fig. 8C). These results demon- TGN, EGFP-rab11aS25N colocalized with the TGN strate that nonsense MVID–associated MYO5B muta- in HepG2 cells (Fig. 7E). Although the expression of tions and the expression of resultant truncated myoVb EGFP-tagged mutant rab11a-S25N in HepG2 cells, as mutants that lack the globular tail domain do not such, inhibited polarity development, it did not cause cause defects in BC formation and canalicular protein the intracellular clustering of BC proteins (Fig. 7F-H). localization, and they support our observations that Cells expressing wild-type EGFP-rab11a showed nor- the C-terminal region and a conserved interaction mal BC formation and a subapical distribution of the with rab11a is required for myoVb mutants to disrupt EGFP-rab11a, similar to wild-type cells (Fig. 7F-G). the localization of canalicular proteins. 224 Hepatology, Vol. 72, No. 1, 2020 OVEREEM ET AL. A B    $%&&DFFXPXODWLRQV  P\FP\R9E¨  0\F &HOOVZLWK 4/   4/  P\FP\R9E¨ 0\F    P\FP\R9E¨ 0\F   <(  <(    O  WUR  P\FP\R9E¨     RQ  ¨ ¨ & 0\F /¨   C 4 &RQWURO P\FP\R9E¨ 1XFOHL$%&&$FWLQ 1XFOHL0\F 1XFOHL$%&&$FWLQ 1XFOHL0\F 4/P\FP\R9E¨ D 1XFOHL$%&&$12 1XFOHL$%&&$FWLQ 1XFOHL0\F$FWLQ E <(P\FP\R9E¨ F 1XFOHL$%&&$FWLQ 1XFOHL0\F  0'5*)3DFFXPXODWLRQV   &HOOVZLWK   QV    ( O UR   ¨  QW  &R  ¨ < G &RQWURO <(P\R9E¨ P\R9E¨ FIG. 6. The role of rab8 and rab11a binding sites in the disrupting effect of motorless myoVb on canalicular protein localization. (A) Schematic depiction of the amino acid sequences of myoVb mutants. (B) Quantification of the percentage of HepG2 cells showing intracellular accumulation of ABCC2 on expression of myoVb tail domain mutants. (C) HepG2 cells expressing myc-myoVb/Δ1- 1460 showed intracellular ABCC2 accumulation (white arrows). Myc labeling showed myc-myoVb/Δ1-1460 localized diffusely in the cytoplasm. (D) Labeling of ABCC2, F-actin, and myc in HepG2 expressing myc-myoVb/Δ1-1195-Q1300L and untreated control. White arrows indicate intracellular ABCC2 accumulation. (E) In HepG2 cells expressing myc-myoVb/Δ1-1460-Y1714E ABCC2 localized at the BC with F-actin (yellow arrowheads). Labeling for myc confirmed expression of the construct. (F) Quantification of the percentage of cells with intracellular multidrug resistance protein (MDR) 1-GFP accumulations (depicted in Fig. 8G), on expression of myc-myoVb/ Δ1-1460 or its Y1714E mutant variant. (G) HepG2 cells expressing myc-myoVb/Δ1-1460 showed intracellular accumulation of the coexpressed BC marker MDR1-GFP (white arrows) but not when the Y1714E mutation was introduced in myc-myoVb/Δ1-1460. 225 OVEREEM ET AL. Hepatology, July 2020 $ % & +HS*.2   'LIIXVH0\F RI0\F&HOOV P\FP\R9E3/ P\FP\R9E3/<( $120\FFOXVWHUV   1XFOHL0\F$12 RI0\F&HOOV            9E 9E ( 9E 9E ( \R / \R  \R / \R  P  P  P  P  \F  \F < \F  \F < P 3 P / P 3 P / 3 3 ' +HS*3$5 +HS*.2 P\FP\R9E¨ P\FP\R9E3/ P\FP\R9E3/ (*)3UDE61 1XFOHL0\F ( ) * + 1XFOHL*ROJLQ 1XFOHL$%&& 1XFOHL$%&& (*)3UDE61 (*)3UDE:7 (*)3UDE61   $%&&DFFXPXODWLRQV  %&¶VSHUFHOOV   &HOOVZLWK     QV   7 1 7 :  : 1 E 6  6  E  UD E UD E )3 UD )3 UD (* )3 (* )3 (* (* FIG. 7. The disrupting effect of motorless myoVb on canalicular protein localization requires active rab11a. (A) ANO6 and myc labeling in HepG2KO expressing myc-myoVb-P660L or myc-myoVb-P660L-Y1714E. Myc-myoVb-P660L frequently accumulated intracellularly with ANO6 (white arrows), whereas myc-myoVb-P660L-Y1714E appeared diffuse in the cytoplasm or subapical (yellow arrowheads). (B) Quantification of the percentage of myc-positive cells that show intracellular clusters/accumulations of myc localized with ANO6 in HepG2KO cells expressing myc-myoVb-P660L or myc-myoVb-P660L-Y1714E. (C) Quantification of the percentage of myc- positive cells that show subapical localization of myc in HepG2KO cells expressing myc-myoVb-P660L or myc-myoVb-P660L/Y1714E. (D) HepG2 coexpressing EGFP-rab11aS25N and myc-myoVb/Δ1-1195 in HepG2Par cells (left), EGFP-rab11aS25N and myc-myoVb- P660L in HepG2Par cells (middle), and EGFP-rab11aS25N and myc-myoVb-P660L in HepG2KO HepG2 (right). In all three conditions, the presence of EGFP-rab11aS25N prevented the clustering of the respective myoVb mutants. (E) EGFP-rab11aS25N colocalized with golgin-97 in HepG2 cells. (F) ABCC2 labeling in HepG2 overexpressing wild-type EGFP-rab11a or EGFP-rab11aS25N. In EGFP- rab11aS25N transduced cells, BC formation was only seen in cells with no or very low expression of the construct (right side, box). (G) Quantification of BC formation (expressed as BC/100 cells) in HepG2 cells expressing wild-type EGFP-rab11a or EGFP- rab11aS25N. (H) Quantification of the percentage of HepG2 cells showing accumulation of ABCC2 on expression of wild-type EGFP- rab11a or EGFP-rab11aS25N. 226 Hepatology, Vol. 72, No. 1, 2020 OVEREEM ET AL.       S  S  S  % % % % <2 <2 <2 <2 O 0 0 0 0 WUR 0:/DGGHU F F F F Q P\ P\ P\ P\ % &R 5DE%LQGLQJ 5DE%LQGLQJ $ &RLOHGFRLO          0\F 0RWRUGRPDLQ  ,4GRPDLQV    S$UJ P\F0<2%S[  0\F *OREXODUWDLO  S$UJ   P\F0<2%S[ 0\F  S$UJ  0\F P\F0<2%S[  $QWL0<& & 0\R9E.2+HSJ 0\R9E.2+HSJ 0\R9E.2+HSJ 0\R9E.2+HSJ P\F0<2%S P\F0<2%S P\F0<2%S 1XFOHL0530\F FIG. 8. MVID-associated nonsense MYO5B mutations producing truncated myoVb mutants do not disrupt hepatocyte polarity and canalicular protein localization. (A) Schematic depiction of the amino acid sequences of nonsense myoVb mutants. (B) Western blot showing the truncated myoVb mutant proteins expressed in HEK293 cells. (C) Immunofluorescence microscopy images showing the subcellular distribution of the truncated myoVb mutant proteins and the canalicular protein ABCC2. Scale bars: 10 μm. Discussion mutation and therefore show that the liver symptoms and hepatocyte defects observed in Navajo patients Determination of causality between patient MYO5B with MVID(17) are likely a direct consequence of their mutations and mislocalization of BC proteins in MYO5B mutation rather than a sole consequence of patients with cholestasis is essential to understand the intestinal failure–induced or TPN-induced liver dam- etiology of the disease. In this study, we demonstrated age. The causality between myoVb-P660L and the that the founding Navajo myoVb-P660L mutant(6) mislocalization of canalicular transporters suggest when expressed in hepatic HepG2 cells caused the similar mechanisms for PFIC6 in patients carrying aberrant localization of canalicular proteins as well as other missense MYO5B mutations. Although differ- the sinusoidal transferrin receptor to intracellular clus- ent missense mutations may affect the myoVb protein ters. These data are in agreement with observations differently,(7,12) the clear mislocalization of canalicular in hepatocytes in liver biopsies of patients with this proteins to intracellular compartments as shown in 227 OVEREEM ET AL. Hepatology, July 2020 this study for another PFIC6 patient with a different PFIC in patients without MVID has been associated missense MYO5B mutation supports this. with only biallelic missense mutations and, in contrast Insight into the mechanism through which to the enteropathy in MVID, has not been associated (mutant) myoVb (de)regulates hepatocyte function with biallelic MYO5B mutations that are predicted to is necessary to understand the pathogenesis of the result in the loss of myoVb protein expression, such as disease. We demonstrated that the loss of myoVb in nonsense or frameshift mutations.(3,12) In agreement human or mouse hepatocytes, as well as the expression with these clinical findings, we found that the expres- of patients’ nonsense MYO5B mutations, did not cause sion of truncated myoVb resulting from MVID- the aberrant localization of canalicular proteins, indi- associated nonsense MYO5B mutations did not cause cating that myoVb function as such is not required a canalicular protein localization defect. Together with for the correct localization of BC proteins. Instead, the findings that myoVb as such is not required for the hepatocyte polarity phenotype as observed in the correct localization of canalicular proteins in vitro myoVb-P660L–expressing cells was faithfully phe- and in vivo, and that myoVb mutants required active nocopied by the expression of myoVb mutants that rab11a for their disruptive effect on canalicular pro- lacked the entire motor domain and consisted of only tein localization, this study thus provides a direct and the tail domains of the myoVb protein. simple explanation for this genotype-phenotype cor- These results indicated that the effects of myoVb- relation in patients with non-MVID PFIC6. It may P660L on the localization of canalicular proteins also lead us to speculate that intrahepatic cholestasis could not be explained by a mere loss of myoVb motor in patients with MVID(9,14) is less likely to be caused function. Indeed, additional mutagenesis experiments by their MYO5B mutations when these involve non- showed that the disrupting effect of myoVb motor sense mutations than when these involve missense domain mutants on the localization of canalicular mutations. In support of this, a patient with MVID proteins was critically dependent on their ability to was reported with only nonsense MYO5B mutations interact with active rab11a. Furthermore, the absence and presented with cholestasis with normal GGT of intracellular clusters of BC proteins on inhibition levels for 9 months, but liver biopsies showed normal of rab11a activation indicated that the mechanism canalicular protein localization. Cholestasis in this through which myoVb mutants exerted their effects patient later spontaneously resolved.(11) on the distribution of canalicular proteins involved The results of this study are relevant for explor- active rather than inhibited rab11a function. ing new treatment strategies, for example, for those A recent study demonstrated that the globu- patients with PFIC6 who are nonresponsive to rou- lar tail domain of myoVb induced the clustering of tine treatment.(3,9) Our results suggest that the specific rab11a-decorated lipid vesicles (liposomes) in a chemi- inhibition of the interaction between mutant myoVb cally defined in vitro reconstitution system by stimulat- and rab11a in the patients’ hepatocytes may amelio- ing homotypic rab11-rab11 interactions.(23) Although rate the harmful effects of the myoVb mutant on can- this effect has thus far not been demonstrated in living alicular protein localization and thereby the PFIC in cells, it would fit with the myoVb-Y1714–dependent patients. This study thus paves the way for the discov- and rab11a-dependent clustering of rab11a and asso- ery of small molecule inhibitors of this interaction and ciated cargo and the appearance of clusters of vesicles the exploration of their potential beneficial effects. that we observed in cells expressing myoVb-P660L Finally, the ectopic expression of the globular tail or only the myoVb tail domain. Conceivably, the domain of myoVb has been widely used to implicate C-terminal tail domain of mutant myoVb, on its dis- the involvement of myoVb in intracellular trafficking placement from its normal subapical location, in this of a variety of proteins in a variety of cell types.(10,24-27) way induced the ectopic clustering of TGN-derived The results from our study, demonstrating that the and/or recycling endosome–derived transport vesicles effects of the myoVb tail domain are not necessar- through rab11a and thereby perturbed the correct dis- ily mimicked by the loss of myoVb expression or loss tribution of BC proteins. of rab11a activity, yet depend on their interaction The results from this study are relevant for under- with active rab11a, suggest that the need to recheck standing the unexplained genotype-genotype cor- the interpretation of some of the studies using this relations that have been reported for PFIC6. Indeed, myoVb mutant is warranted. 228 Hepatology, Vol. 72, No. 1, 2020 OVEREEM ET AL. Acknowledgment: We thank R. Prekeris for his kind gift 13) Mitra A, Ahn J. Liver disease in patients on total parenteral nutri- of anti-rip11 antibodies. tion. Clin Liver Dis 2017;21:687-695. 14) Anez-Bustillos L, Dao DT, Potemkin AK, Perez-Atayde AR, Author Contributions: Conceptualization, A.W.O., Raphael BP, Carey AN, et al. An intravenous fish oil-based lipid emulsion successfully treats intractable pruritus and cholestasis Q.L., D.A., and S.C.D.IJ.; Methodology, A.W.O., Q.L., in a patient with microvillous inclusion disease. Hepatology F.C., C.L., K.K., N.H., J.W., D.A., and S.C.D.IJ.; 2019;69:1353-1356. Investigation, A.W.O., Q.L., Y.Q, F.C., C.L., K.K., 15) Overeem AW, Klappe K, Parisi S, Klöters-Planchy P, Mataković L, du Teil Espina M, et al. Pluripotent stem cell-derived bile cana- J.D., and N.H.; Writing – Original Draft, A.W.O. ad liculi-forming hepatocytes to study genetic liver diseases involving S.C.D.IJ.; Writing – Review & Editing, A.W.O., Q.L., hepatocyte polarity. J Hepatol 2019;71:344-356. Y.Q., F.C., C.L., K.K., J.D., N.H., J.W., D.A., and 16) Choudhury A, Dominguez M, Puri V, Sharma DK, Narita K, S.C.D.IJ.; Funding Acquisition, S.C.D.IJ. and J.W.; Wheatley CL, et al. Rab proteins mediate Golgi transport of ­caveola-internalized glycosphingolipids and correct lipid traffick- Resources, A.W.O., F.C., D.A., Y.Q.; Supervision, ing in Niemann-Pick C cells. J Clin Invest 2002;109:1541-1550. S.C.D.IJ., D.A., and J.W. 17) Schlegel C, Weis VG, Knowles BC, Lapierre LA, Martin MG, Dickman P, et al. Apical membrane alterations in non- intestinal organs in microvillus inclusion disease. Dig Dis Sci REFERENCES 2018;63:356-365. 18) Cartón-García F, Overeem AW, Nieto R, Bazzocco S, Dopeso H, 1) Gissen P, Arias IM. Structural and functional hepatocyte polarity Macaya I, et al. Myo5b knockout mice as a model of microvillus and liver disease. J Hepatol 2015;63:1023-1037. inclusion disease. Sci Rep 2015;5:12312. 2) Bull LN, Thompson RJ. Progressive familial intrahepatic cholesta- 19) Ohgaki R, Matsushita M, Kanazawa H, Ogihara S, Hoekstra D, sis. Clin Liver Dis 2018;22:657-669. van Ijzendoorn SC. The Na+/H+ exchanger NHE6 in the endo- 3) Qiu YL, Gong JY, Feng JY, Wang RX, Han J, Liu T, et al. Defects somal recycling system is involved in the development of apical in myosin VB are associated with a spectrum of previously un- bile canalicular surface domains in HepG2 cells. Mol Biol Cell diagnosed low γ-glutamyltransferase cholestasis. Hepatology 2010;21:1293-1304. 2017;65:1655-1669. 20) Davidson GP, Cutz E, Hamilton JR, Gall DG. Familial enteropa- 4) Gonzales E, Taylor SA, Davit-Spraul A, Thébaut A, Thomassin thy: a syndrome of protracted diarrhea from birth, failure to thrive, N, Guettier C, et al. MYO5B mutations cause cholestasis with and hypoplastic villus atrophy. Gastroenterology 1978;75:783-790. normal serum gamma-glutamyl transferase activity in chil- 21) Roland JT, Bryant DM, Datta A, Itzen A, Mostov KE, dren without microvillous inclusion disease. Hepatology Goldenring JR. Rab GTPase-Myo5B complexes control mem- 2017;65:164-173. brane recycling and epithelial polarization. Proc Natl Acad Sci 5) Müller T, Hess MW, Schiefermeier N, Pfaller K, Ebner HL, USA 2011;108:2789-2794. Heinz-Erian P, et al. MYO5B mutations cause microvillus in- 22) Chen W, Feng Y, Chen D, Wandinger-Ness A. Rab11 is required clusion disease and disrupt epithelial cell polarity. Nat Genet for trans-Golgi network-to-plasma membrane transport and a 2008;40:1163-1165. preferential target for GDP dissociation inhibitor. Mol Biol Cell 6) Erickson RP, Larson-Thomé K, Valenzuela RK, Whitaker SE, 1998;9:3241-3257. Shub MD. Navajo microvillous inclusion disease is due to a muta- 23) Inoshita M, Mima J. Human Rab small GTPase- and class V tion in MYO5B. Am J Med Genet A 2008;146A:3117-3119. myosin-mediated membrane tethering in a chemically defined ­ 7) van der Velde KJ, Dhekne HS, Swertz MA, Sirigu S, Ropars V, ­reconstitution system. J Biol Chem 2017;292:18500-18517. Vinke PC, et al. An overview and online registry of microvillus 24) Gupta A, Schell MJ, Bhattacharjee A, Lutsenko S, Hubbard AL. inclusion disease patients and their MYO5B mutations. Hum Myosin Vb mediates Cu+ export in polarized hepatocytes. J Cell Mutat 2013;34:1597-1605. Sci 2016;129:1179-1189. 8) Dhekne HS, Hsiao NH, Roelofs P, Kumari M, Slim CL, Rings 25) Brock SC, Goldenring JR, Crowe JE. Apical recycling sys- EH, et al. Myosin Vb and Rab11a regulate phosphorylation of tems regulate directional budding of respiratory syncytial ezrin in enterocytes. J Cell Sci 2014;127:1007-1017. virus from polarized epithelial cells. Proc Natl Acad Sci USA 9) Girard M, Lacaille F, Verkarre V, Mategot R, Feldmann G, 2003;100:15143-15148. Grodet A, et al. MYO5B and bile salt export pump contribute to 26) Fan GH, Lapierre LA, Goldenring JR, Sai J, Richmond A. cholestatic liver disorder in microvillous inclusion disease. Hepatol Rab11-family interacting protein 2 and myosin Vb are required Baltim Md 2014;60:301-310. for CXCR2 recycling and receptor-mediated chemotaxis. Mol 10) Wakabayashi Y, Dutt P, Lippincott-Schwartz J, Arias IM. Rab11a Biol Cell 2004;15:2456-2469. and myosin Vb are required for bile canalicular formation in 27) Swiatecka-Urban A, Talebian L, Kanno E, Moreau-Marquis S, WIF-B9 cells. Proc Natl Acad Sci USA 2005;102:15087-15092. Coutermarsh B, Hansen K, et al. Myosin Vb is required for traf- 11) Fernández Caamaño B, Quiles Blanco MJ, Fernández Tomé L, ficking of the cystic fibrosis transmembrane conductance regulator Burgos Lizáldez E, Sarría Osés J, Molina Arias M, et al. Intestinal in Rab11a-specific apical recycling endosomes in polarized human failure and transplantation in microvillous inclusion disease. [in airway epithelial cells. J Biol Chem 2007;282:23725-23736. Spanish] An Pediatr (Barc) 2015;83:160-165. 12) Dhekne HS, Pylypenko O, Overeem AW, Zibouche M, Ferreira Supporting Information RJ, van der Velde KJ, et al. MYO5B, STX3, and STXBP2 mu- tations reveal a common disease mechanism that unifies a subset of congenital diarrheal disorders: a mutation update. Hum Mutat 2018;39:333-344. Additional Supporting Information may be found at onlinelibrary.wiley.com/doi/10.1002/hep.31002/suppinfo. 229