ORIGINAL RESEARCH published: 19 February 2020 doi: 10.3389/fphys.2020.00115 A Transcriptome Analysis: Various Reasons of Adverse Pregnancy Outcomes Caused by Acute Edited by: Toxoplasma gondii Infection Elke Winterhager, University of Duisburg-Essen, Xue Zhou 1,2,3†‡ , Xiu-Xiang Zhang 4* †‡ , Yasser S. Mahmmod 5,6,7† , Jorge A. Hernandez 8 , Germany Gui-Feng Li 1,2,3 , Wan-Yi Huang 1,2,3 , Ya-Pei Wang 1,2,3 , Yu-Xiang Zheng 1,2,3 , Xiu-Ming Li 9* and Zi-Guo Yuan 1,2,3* Reviewed by: Xing-Quan Zhu, 1 College of Veterinary Medicine, South China Agricultural University, Guangzhou, China, 2 Key Laboratory of Zoonosis Lanzhou Veterinary Research Institute Prevention and Control of Guangdong Province, Guangzhou, China, 3 Key Laboratory of Zoonosis of Ministry of Agriculture (CAAS), China and Rural Affairs, South China Agricultural University, Guangzhou, China, 4 College of Agriculture, South China Agricultural José Roberto Mineo, University, Guangzhou, China, 5 IRTA, Centre de Recerca en Sanitat Animal, Barcelona, Spain, 6 Universitat Autónoma Federal University of Uberlândia, Brazil de Barcelona, Barcelona, Spain, 7 Infectious Diseases, Department of Animal Medicine, Faculty of Veterinary Medicine, Dong-Hui Zhou, Zagazig University, Zagazig, Egypt, 8 College of Veterinary Medicine, University of Florida, Gainesville, FL, United States, Fujian Agriculture and Forestry 9 College of Animal Science and Technology, Heilongjiang Bayi Agricultural University, Daqing, China University, China *Correspondence: Xiu-Xiang Zhang Background: Toxoplasma gondii (T. gondii) is an obligate intracellular parasite, which xiuxiangzh@scau.edu.cn can affect the pregnancy outcomes in infected females by damaging the uterus, and Xiu-Ming Li lxm_nj@qq.com the intrauterine environment as well as and the hypothalamus resulting in hormonal Zi-Guo Yuan imbalance. However, the molecular mechanisms underlying the parasite-induced poor ziguoyuan@scau.edu.cn pregnancy outcomes and the key genes regulating these mechanisms remain unclear. † These authors have contributed Therefore, this study aimed to analyze the gene expression in the mouse’s uterus equally to this work ‡ These following experimentally-induced acute infection with T. gondii RH strain. Three groups authors share first authorship of female mice were intraperitoneally injected with tachyzoites as follow; 3 days Specialty section: before pregnancy (FBD6), after pregnancy (FAD6), and after implantation (FID8) as This article was submitted to the experimental groups. Another corresponding three groups served as control, were Reproduction, a section of the journal injected with normal saline at the same time. Transcriptome analysis of the total RNA Frontiers in Physiology extracted from both infected and non-infected mouse uterus samples was performed Received: 22 September 2019 using RNA sequencing (RNA-Seq). Accepted: 31 January 2020 Published: 19 February 2020 Results: The three experimental groups (FBD6, FAD6, and FID8) had a total of 4,561, Citation: 2,345, and 2,997 differentially expressed genes (DEGs) compared to the controls. The Zhou X, Zhang X-X, Mahmmod YS, Hernandez JA, Li G-F, significantly upregulated and downregulated DEGs were 2,571 and 1,990 genes in Huang W-Y, Wang Y-P, Zheng Y-X, FBD6, 1,042 and 1,303 genes in FAD6 and 1,162 and 1,835 genes in FID8 group, Li X-M and Yuan Z-G (2020) A respectively. The analysis of GO annotation, and KEGG pathway showed that DEGs Transcriptome Analysis: Various Reasons of Adverse Pregnancy were mainly involved in anatomical structure development, transport, cell differentiation, Outcomes Caused by Acute embryo development, hormone biosynthetic process, signal transduction, immune Toxoplasma gondii Infection. Front. Physiol. 11:115. system process, phagosome, pathways in cancer, and cytokine-cytokine receptor doi: 10.3389/fphys.2020.00115 interaction pathways. Frontiers in Physiology | www.frontiersin.org 1 February 2020 | Volume 11 | Article 115 Zhou et al. Adverse Pregnancy and T. gondii Infection Conclusion: T. gondii infection can induce global transcriptomic changes in the uterus that may cause pregnancy hypertension, destruct the intrauterine environment, and hinder the normal development of placenta and embryo. Our results may help to understand the molecular mechanisms of the acute T. gondii infection, which could promote the development of new therapeutics or prophylactics for toxoplasmosis in pregnancy. Keywords: T. gondii, RNA-Seq, acute infection, abnormal pregnancy, DEGs INTRODUCTION 6% (Dunn et al., 1999). However, an acute infection in early Toxoplasmosis is a widespread zoonotic disease caused by pregnancy can lead to serious clinical symptoms in 61% of the the obligate intracellular protozoan parasite, Toxoplasma gondii infected cases (Montoya and Remington, 2008). The offspring (T. gondii). More than 30% of the human population has of mice infected with T. gondii in early pregnancy had a 40% been exposed to T. gondii infections (Hill and Dubey, 2002). survival rate and more stillbirths (Freeman et al., 2005; Rorman The main routes of T. gondii transmission are the oral et al., 2006). Mice with acute infection (72 h after intraperitoneal and transplacental transmission However, T. gondii can be injection) revealed tachyzoites in almost all nucleated cells with transmitted via blood transfusions and organ transplantation. abnormal cell morphology in the uterus and placenta (Chen T. gondii infections are usually asymptomatic but may cause et al., 2003). In experimental acute vaginal infection set-up with serious complications, such as severe fever in infants, and T. gondii RH strain, tachyzoites and DNA of T. gondii were fatal encephalitis in immunocompromised individuals such as detected through biopsy and PCR assays, respectively in the AIDS patients (Luft et al., 1983). Moreover, immunosuppressed uterine mucosa, and myometrium as well as the placental chorion T. gondii-infected women during pregnancy are susceptible to of mice (Bayat et al., 2013). Several studies have investigated the abortion or stillbirth. Even if the fetus survives, there is a high effect of acute T. gondii infection during pregnancy, however, probability of vertical transmission with subsequently expected it focused principally on the immune responses associated serious sequelaein the congenitally infected fetuses such as with T. gondii infection (Nishimura et al., 2017; Xu et al., hydrocephaly, retinochoroiditis, mental retardation, and seizures 2017). To best of our knowledge, research on the evidence of (Saadatnia and Golkar, 2012). T. gondii-associated key genes, which are involved in the adverse Females infected with T. gondii during pregnancy are three pregnancy and disturbance of the pregnancy, is very limited times more likely to experience a problematic pregnancy (Xiao and seldom. et al., 2010). Stahl et al. (1985) reported a reproductive Transcriptome analysis has been a valuable approach for failure, caused by the hypothalamus dysfunction, in T. gondii- investigating the global biological changes, gene expressions, infected mice. As well as, these mice showed atrophy of the and the transcription regulations in different body tissues uterus and ovary, low mature oocytes number and oocyte of mice infected with T. gondii. For instance, Tanaka et al. chromosome aneuploidy, which increase the incidence of used RNA-Seq approach to study the transcriptomic gene infertility (Stahl et al., 1985). At present, the hypothesis expressions in the brain of T. gondii-infected mice (Tanaka about the mechanism of infertility in T. gondii-infected et al., 2013). Earlier to that, Knight et al. (2005) utilized women includes endometritis, and expulsion of the fetus. the transcriptomics to reveal the role of inflammation in This hypothesis suggests that, during the placental formation, T. gondii-associated retinochoroiditis. More recently, He et al. T. gondii cysts can be formed in the endometrium inducing (2016b) analyzed the transcriptomic changes in the spleen non-suppurative inflammation (Remington et al., 1958). While of infected mice to elucidate the immune responses against this protozoan is being released, it irritates the placenta T. gondii infection. Later, they evaluated the transcriptomic gene and causes miscarriages (Remington et al., 1961). Another expressions in the liver of infected mice during the early stages hypothesis suggests that persistent infection of T. gondii in the of T. gondii infection (He et al., 2016a). However, data on hypothalamus results in infertility with follicle damage, and the global transcriptomic changes in uterine tissues of mouse uterine atrophy (Aral et al., 2011). Barbosa et al. (2012) has with acute T. gondii infection are highly deficient, despite of its shown that enoxacin, which is used for endometritis treatment crucial importance. in animals, has also a role in inhibiting the proliferation To elucidate the underlying molecular mechanisms of of T. gondii. the adverse pregnancy outcomes associated with the acute Previous research has shown that the incidence of uterine T. gondii infection, we utilized transcriptome sequencing toxoplasmosis in the early stage of pregnancy is less than technology (RNA-Seq) coupled with Bioinformatics approaches to analyze the transcriptomic gene expressions in the uterus Abbreviations: CD6A, mice injected with normal saline (NS) 3 days after of experimentally-infected mice with T. gondii RH strain pregnancy; CD6B, mice injected with NS 3 days before pregnancy; CD8, mice during the acute stage of infection. Full understanding of injected with NS in the fifth day of pregnancy; DEGs, differentially expressed genes; these mechanisms will promote the development of effective FAD6, mice infected with T. gondii 3 days after pregnancy; FBD6, mice infected with T. gondii 3 days before pregnancy; FID8, mice infected with T. gondii on the therapeutics and/or vaccines to control and minimize the fifth day of pregnancy. T. gondii infections. Frontiers in Physiology | www.frontiersin.org 2 February 2020 | Volume 11 | Article 115 Zhou et al. Adverse Pregnancy and T. gondii Infection MATERIALS AND METHODS kit (Illumina, San Diego, CA, United States). The average interposer dimension for the paired-end libraries was 300 bp Animals, Parasite Challenge and Sample (±50 bp). Finally, the paired-end sequencing was performed by the Illumina Hiseq2000/2500 (LC Sciences, United States) Collection according to the manufacturer’s recommendations. Specific-Pathogen Free (SPF) Kunming mice, purchased from Guangdong Medical Laboratory Animal Center (Guangdong, China), were subjected to carry out this study. Eight-week-old Processing of RNA-Seq Data non-pregnant female Kunming mice were randomly divided into After the transcriptome sequencing using the Illumina paired- six equal groups (20 mice per group). Three groups of female end RNA-Seq methodology, the quality and integrity of the raw mice were infected with tachyzoite, as follow; 3 days before reads data were analyzed. The adaptors in the sequenced reads, pregnancy (FBD6; 3 days before cohabiting with male mice at a which have a ratio of base N > 5% and nucleotide with Q ratio of 2:1), 3 days after pregnancy (FAD6), and the last group, on quality score < 20 were removed. Eventually, clean sequence the fifth day of pregnancy (FID8; 3 days after implantation). The reads were mapped to the mouse reference genome using vaginal plug, the indicator of pregnancy success, was carefully TopHat2 aligner and gene transfer format (gtf) annotations data inspected to determine the start of pregnancy. Each mouse (Mus_musculus.GRCm38.69). A statistical analysis of the three in the infected groups was intraperitoneally infected with 80 aspects of TopHat2 including the reads statistics, the outline of tachyzoites of T. gondii RH strain (Genotype I). Another three regional distribution, and the chromosome distribution density corresponding female mice groups, works as control groups, were was performed. For normalization of transcription profiles, injected with the normal saline at the same times as the former genetic variance analysis was conducted based on the mapping groups. All experiments were carried out in three replicates. results using the “cuffdiff ” command in the cufflinks (Trapnell All mice were humanely euthanized by CO2 asphyxiation on et al., 2010). The FPKM (Fragments Per Kilobase of exon model the sixth or eighth day of pregnancy for the groups of 3-days per Million mapped reads) value was used to calculate the before and 3-days after pregnancy infected mice. Whereas, the abundance of gene expression. third group, 3 days after implantation, were euthanized on the eighth day of pregnancy. Uterine tissues were quickly harvested. Identification and Bioinformatic Analysis Each uterine sample was divided into three portions for the of Differentially Expressed Genes subsequent examinations including transcriptome sequencing, Differentially expressed genes (DEGs) were identified by the qPCR, and follow-up experiments, respectively. Afterward, the EBSeq package and DESeq package of R software (Anders uterine samples were rapidly stored at −80◦ C until subsequent and Huber, 2010). The P-values were calculated using the use. Animal experiments were applied in accordance to the Benjamini and Hochberg method (Ferreira, 2007). Significant standard feeding procedures and experimental procedures of DEGs were identified as those with | log 2 FC (fold-change) South China Agricultural University. Figure 1 summarizes | ≥ 1 and an adjusted P-value of < 0.05. To understand the the time of infection and harvesting of uterine samples in biological functions of these genes, firstly; UniProt database was all mice groups. used to expand the biological functions of DEGs. Afterward, we mapped all DEGs to the Gene Ontology (GO) database1 mRNA Library Preparation and and classified these genes into three categories; biological Sequencing process, molecular function, and cellular component. The Kyoto Encyclopedia of Genes and Genomes (KEGG)2 was Experimental methods of the library preparation and RNA- used to predict molecular function, biological processes and Seq were conducted according to the standard procedures of significant DEGs pathways. Finally, the database for Annotation, Illumina. The total RNA was extracted from the preserved Visualization, and Integrated Discovery (DAVID) online tool3 uterine samples using RNAiso Plus Total RNA extraction reagent was used to systematically judge the affected pathways of DEGs. following the manufacturer’s protocol (Takara, Dalian, China). The RNA quality was initially evaluated with 1.0% agarose gel electrophoresis and ultraviolet spectrophotometer (Biotek Validation of RNA-Seq Results by EPOCH, United States). Following that, the integrity of RNA Quantitative Real-Time PCR (qRT-PCR) samples was confirmed by Agilent Bioanalyzer 2100 and RNA Analysis 6000 Nano Lab Chip Kit (Agilent Technologies, Santa Clara, Gene expression data were verified by qRT-PCR. The total CA, United States). RNA integrity number (RIN) over 7.0 was RNA was extracted from the remaining uterine specimen considered as the purity standard. Approximately, 10 µg of using the RNAiso Plus (Takara, Dalian, China) following the total RNA was utilized to isolate Poly (A) mRNA using poly- manufacturer’s protocols. The obtained RNA was resuspended T oligo-attached magnetic beads (Invitrogen, United States). in RNase-free water. The purity and concentration of total RNA The product was purified, and the mRNA was segmented were determined using ultramicrospectrophotometer (Biotek into small fragments utilizing divalent cations at elevated temperature. After that, the sliced RNA fragments were reverse- 1 http://www.geneontology.org/ transcribed to establish the final cDNA library according to 2 http://www.kegg.jp/kegg/ the recommendations of the mRNA-Seq sample preparation 3 http://david.abcc.ncifcrf.gov/ Frontiers in Physiology | www.frontiersin.org 3 February 2020 | Volume 11 | Article 115 Zhou et al. Adverse Pregnancy and T. gondii Infection FIGURE 1 | Uterine samples were collected from three mouse models of gestation: (A) The female mice infected with Toxoplasma gondii tachyzoites 3 days after pregnancy. (B) The female mice infected with tachyzoite 3 days before pregnancy. (C) The female mice infected with tachyzoite on the fifth day of pregnancy. Mice injected with normal saline (control group) at the same time as every experimental group. EPOCH, United States). Ten DEGs were selected to verify Interferon-induced transmembrane protein 1 (Ifitm1). Firstly, the gene expression data by qRT-PCR. Gene-specific qRT-PCR the pre-processed protein samples were run on a 5% stock gel at primers were designed, based on reference UniGene sequences, 80 V with 30 min, separated on a 12% SDS-PAGE in 60 min at with Premier 5.0 software (Premier Biosoft International, Palo 120 V, and then transferred into a nitrocellulose filter membrane Alto, CA, United States). The genes and primers used in qRT- (Millipore, Darmstadt, Germany) for 90 min at 150 mA. The PCR are shown in Table 1. The first strand cDNA was synthesized membrane was blocked in 0.1% Tween 20-PBS containing 5% by reverse transcription of RNA using RevertAid First Strand skimmed milk powder for 2 h and then incubated with β-actin cDNA Synthesis Kit (Thermo Fisher Scientific, United States). mouse monoclonal antibodies (1:500 dilution, Neobioscience, Quantitative PCR was performed on a Rotor-Gene Q (Qiagen, Shenzhen, China), specific mouse anti-Hsd11b2 (1:500, Abcam, Hilden, Germany) using AceQ qPCR SYBR Green Master R Cambridge, MA, United States), and anti-Ifitm1 (1:500, Abcam, Mix (Vazyme, Nanjing, China) according to the manufacturer’s Cambridge, MA, United States) antibodies overnight. The instructions. The thermal cycling program included 95◦ C for membranes were washed three times and probed with goat 5 min, 40 cycles of 95◦ C for 10 min, and 30 s of 60◦ C, anti-mouse IgG conjugated with horseradish peroxidase (HRP) followed 95◦ C for 15 s, 60◦ C for 1 min, and 95◦ C for 15 s as (Tiangen Biotech, Beijing, China) at 1:2500 dilution. Finally, a final step. Each sample was examined in triplicate. Relative the membranes were visualized with BeyoECL Plus (Beyotime, quantification of specific mRNA levels was performed using the Shanghai, China) and the image was taken and analyzed cycle threshold (Ct) 2−11Ct method (Livak and Schmittgen, by the Tanon5200 western blotting detection system (Tanon, 2001). For normalization of gene expression, β-actin was used as Shanghai, China). an internal standard of mRNA expression, and the blank control was used as a reference sample, which was set to a value 1. RESULTS Validations of RNA-Seq Results by Identification of Expressed Transcripts in Western Blotting the Mouse Uterus Transcriptome Western Blot was used to validate RNA-Seq results at the We established six different groups of mice, three experimental molecular level, by targeting the protein of two DEGs, and three control groups, including mice infected with T. gondii Corticosteroid 11-beta-dehydrogenase isozyme 2 (Hsd11b2) and 3 days after groups day of pregnancy (FAD6), mice infected Frontiers in Physiology | www.frontiersin.org 4 February 2020 | Volume 11 | Article 115 Zhou et al. Adverse Pregnancy and T. gondii Infection TABLE 1 | Primer design table for qRT-PCR analysis. Gene Description Forward primer (50 –30 ) Reverse primer (50 –30 ) 1 Hsd11b2 ENSMUSG00000031891 ATAGCCCTGGTGCCCTAGAA TCCAGAACACGGCTGATGTC 2 Slc39a4 ENSMUSG00000063354 CTCTGGATCGCCTGGAACTG CTGTGGCTTGTCAGGTTTGC 3 Ifitm1 ENSMUSG00000025491 ATGGTGGGTGATACGACTGG GGCACAGACAACGATGACGA 4 Krt8 ENSMUSG00000049382 TATGGGGGACTCACTAGCCC CAGCTTCCCATCTCGGGTTT 5 Cd24a ENSMUSG00000047139 CCCACGCAGATTTACTGCAAC CTGGTGGTAGCGTTACTTGG 6 Cndp2 ENSMUSG00000024644 GTGCCAGACATGATACCGGA CCCGCCTGGTAATGAGGATG 7 Hsd17b7 ENSMUSG00000026675 GCGTGTAGGAACCTGAGCAA GCTTGACTTCCTCTGCACCC 8 A2m ENSMUSG00000030111 AATATCGGTCTTCCGGCCAC TGTGAGCAGTACGCTTTGGT 9 Stc1 ENSMUSG00000014813 ATAGGAGGCGCACAAATGAG GGGAGGTGCGTTTGATGTGT 10 Hmgn5 ENSMUSG00000031245 CGACTGTCTGCTATGCCTGT TGGCTTGGTTTCAGGAATTGG 11 Actb ENSMUSG00000029580 AAAGAGAAGCTGTGCTATGTTGCT GCCTCAGGGCATCGGAAC with T. gondii 3 days before pregnancy (FBD6), mice infected to the control group, the upregulated genes in the FAD6 with T. gondii on the fifth day of pregnancy (FID8), mice were annotated in 1,047 GO terms, which were mainly injected with normal saline (NS) 3 days after pregnancy (CD6A), related to biological processes (such as anatomical structure mice injected with NS 3 days before pregnancy (CD6B), and development, transport, cell differentiation, response to stress), lastly, mice injected with NS on the fifth day of pregnancy cellular components (such as cellular, intracellular, organelle (CD8). Each group was tested in triplicates. The total RNA and cytoplasmic component), and molecular functions (such harvested from the uterus of all mice groups was subjected to as protein binding, ion binding, transmembrane transporter high-throughput sequencing on Illumina Hiseq2000/2500. The activity, and cytoskeletal protein binding). The number of GO number of the obtained raw reads was ranged from 56,804,874 terms of downregulated genes were 1,622. The most common (CD6B1 group) to 66,241,238 (FAD63 group). After filtration, the identified biological process were lipid, small molecule, and average number of clean reads of each mouse group was over cellular nitrogen compound metabolic processes, anatomical 48,000,000, where 82.32–98.90% could be aligned to the reference structure development, transport and response to amphetamine. mouse genome (Table 2). The sequence data of each group had The downregulated GO terms categorized under cellular more than 6G and Q20 > 99%. Therefore, the requirements of component were similar to the functional classification of the subsequent analysis were fulfilled. A filter criteria set at | log2 upregulated genes. As for the molecular function, most of the fold change| > 1 and P-value ≤ 0.05 to determine whether downregulated genes were related to protein and enzyme activity the difference was significant or not (shown in Supplementary besides binding to protein and ions. In general, there were Data Sheets 1, 2). Our findings showed that the FBD6 group 21 significant DEGs involved in embryonic development and produced a total of 4,561 DEGs compared to the control group one gene associated with embryo implantation in the FAD6 B (CD6B). Out of them, 2,571 and 1,990 genes were identified group (Figure 4A). as upregulated and downregulated, respectively. A total of 2,345 Comparing FBD6 group to the control group, the upregulated genes showed significant expression differences between the genes involved 1,311 GO terms, whereas the downregulated genes FAD6 group and its corresponding NS-treated group (CD6A). were related to 1,744 GO terms. As for the biological process GO Out of this number, 1,042 and 1,303 genes were identified as terms, the upregulated genes were mainly involved in glucose, upregulated and downregulated genes, respectively. As f for the immune system process, and signal transduction. Meanwhile, the third and last groupFID8 and its corresponding control group downregulated genes were mostly related to anatomical structure (CD8); 2,997 genes showed significantly different expression, development, transport, and cell differentiation. In the term of where 1,162 and 1,835 of them were identified as upregulated and cellular component, the traits of FBD6 vs. CD6B groups were downregulated, respectively. The details of the top 10 DEGs in almost similar to those of FAD6 vs. CD6A groups. In respect T. gondii-infected mouse uterine samples are shown in Table 3. to the molecular function, the DEGs showed mainly functions Volcanic maps showed the distribution of gene expression related to protein, ion and ATP binding (Figure 4B). differences between the experimental and control groups. The To explore whether the key genes related to embryo maps highlight the genes with an absolute fold change of ≥1 and implantation and development are affected by inducing the an adjusted p-value of <0.05 after infection (Figure 2). Figure 3 experimental infection in the pregnant mice with T. gondii after shows a hierarchical clustering analysis of genes expressed in the implantation or not, we performed GO function classification mouse uterus infected with T. gondii in the various groups. of the DEGs in FID8 group using the scatter plot (Figure 5). As for the cellular component, DEGs were mostly associated GO Enrichment of Differentially with the plasma membrane, the integral component of the Expressed Genes membrane, and extracellular region. Most DEGs were involved in The top 10 enriched GO terms under each category in FAD6 peptide hormone binding, transmembrane transporter activity, and FBD6 groups are shown in Figure 4. In comparison and serine-type endopeptidase activity molecular functions. Frontiers in Physiology | www.frontiersin.org 5 February 2020 | Volume 11 | Article 115 Zhou et al. Adverse Pregnancy and T. gondii Infection TABLE 2 | Summary of clean reads mapped to the reference genome of mouse. Sample Raw date read Base Valid date read Base Valid% read Q20% Q30% GC% CD6A-1 58748442 8.81G 48364460 7.25G 82.32 99.20 96.44 49.00 CD6A-2 59452796 8.92G 48959376 7.34G 82.35 99.52 97.21 51.00 CD6A-3 58563520 8.79G 48696972 7.30G 83.15 99.13 95.98 49.00 FBD6-1 59970362 9.00G 57652548 8.64G 96.14 99.39 97.09 50.00 FBD6-2 57907066 8.69G 56827140 8.52G 98.14 99.57 95.75 50.00 FBD6-3 56905122 8.54G 54152732 8.12G 95.16 99.22 96.17 49.00 FAD6-1 65608270 9.84G 57597380 8.64G 87.79 99.55 96.49 50.00 FAD6-2 64061528 9.65G 55865012 8.38G 87.21 99.15 95.86 51.00 FAD6-3 66241238 9.94G 58153066 8.72G 87.79 99.63 97.94 50.00 CD6B-1 56804874 8.52G 49590640 7.44G 87.30 99.66 97.93 49.00 CD6B-2 57290458 8.59G 50295274 7.54G 87.79 99.38 96.92 49.00 CD6B-3 57516602 9.63G 50243946 7.54G 87.36 99.62 97.31 50.00 CD8-1 51722480 7.76G 51153928 7.67G 98.90 99.68 96.19 50.00 CD8-2 54269660 8.14G 53547754 8.03G 98.67 99.69 97.05 49.50 CD8-3 48768472 7.32G 48078448 7.21G 98.59 99.69 96.90 49.00 FID8-1 44641116 6.70G 43937778 6.59G 98.42 99.69 96.97 50.00 FID8-2 53513324 8.03G 52647430 7.90G 98.38 99.65 96.94 50.00 FID8-3 49853240 7.48G 48944858 7.34G 98.18 99.75 97.42 49.50 TABLE 3 | Partial list of differentially expressed genes in T. gondii-infected mice uterus. Gene symbol Description Log2 (fold-change) Differential Expression FAD6/ CD6A FBD6/ CD6B FID8/ CD8 1 Hsd11b2 Hydroxysteroid 11-Beta Dehydrogenase 2 2.40061 3.47496 2.71847 Up 2 Slc39a4 Solute Carrier Family 39 (Zinc Transporter), Member 4 2.72085 4.63169 1.28504 Up 3 Ifitm1 Interferon-induced transmembrane protein 1 1.75738 3.59516 -0.23735 Up (Down in FID8/CD8) 4 Krt8 Keratin, type II cytoskeletal 8 1.01272 3.09309 3.46933 Up 5 Cd24a Signal transducer CD24 1.29161 1.19154 3.07802 Up 6 Cndp2 Cytosolic non-specific dipeptidase 1.33972 3.14075 2.66401 Up 7 Hsd17b7 3-keto-steroid reductase −5.40267 −6.46531 −4.46804 Down 8 A2m Alpha-2-macroglobulin-P −3.80101 −5.8787 −5.92206 Down 9 Stc1 Stanniocalcin-1 −2.66361 −3.95738 −2.45878 Down 10 Hmgn5 High mobility group nucleosome-binding domain-containing protein 5 −1.26749 −3.44105 −2.30626 Down Moreover, DEGs were related to the central biological processes upregulated and downregulated DEGs, respectively. The such as hormone biosynthetic process and immune response. major five enriched upregulated pathways were phagosome, systemic lupus erythematosus, cell adhesion molecules, KEGG Enrichment Analysis cytokine-cytokine receptor interaction. The major five Enrichment analysis of the DEGs in the uteri of the infected enriched downregulated pathways involved neuroactive versus the control groups’ pairs was performed by using the ligand-receptor interaction, pathways in cancer, PPAR KEGG database, where the pathways that play an important signaling pathway, MAPK signaling pathway, and steroid role in the infection process can be furtherly explored. Of biosynthesis (Figure 6B). the 166 identified enriched pathways in the group FAD6 vs. In the FID8 vs. CD8 group, 169 pathways were enriched, CD6A, upregulated DEGs enriched in 107 pathways, and 136 including 134 upregulated DEGs enrichment pathways pathways were enriched by downregulated DEGs. The top five and 145 downregulated DEGs enrichment pathways. The enriched upregulated pathways were cell adhesion molecules top five enriched upregulated pathways were involving (CAMs), pathways in cancer, phagosome, endocytosis, and pathways related to cancer, focal adhesion, cell adhesion tight junction. The top five identified enriched downregulated molecules (CAMs), vascular smooth muscle contraction, pathways were PPAR signaling pathway, TGF-beta signaling and ECM-receptor interactions. However, the top five pathway, cytokine-cytokine receptor interaction, focal adhesion, enriched downregulated pathways were pathways related and steroid biosynthesis (Figure 6A). to cancer, neuroactive ligand-receptor interaction, TGF- Of the 175 identified enriched pathways in the FBD6 beta signaling pathway, axon guidance, and Wnt signaling vs. CD6B group, 128 and 149 pathways were enriched with pathway (Figure 6C). Frontiers in Physiology | www.frontiersin.org 6 February 2020 | Volume 11 | Article 115 Zhou et al. Adverse Pregnancy and T. gondii Infection FIGURE 2 | Volcano maps of differentially expressed genes in the uterus of three infected mice groups compared to control groups. Significantly upregulated and downregulated genes are shown as a red and green dot, respectively. The blue dot represents genes without a significant difference in the expression level. Frontiers in Physiology | www.frontiersin.org 7 February 2020 | Volume 11 | Article 115 Zhou et al. Adverse Pregnancy and T. gondii Infection (UniprotKB: Q9D103) were selected as the research targets to explore their role in T. gondii infection. Therefore, we verified the expression changes of its protein level by western blot (Figure 8). The results were consistent with the sequencing results of the transcriptome, where these two proteins were overexpressed. DISCUSSION In this study, all the three experimental groups showed pregnancy failure confirming the adverse effect of T. gondii infection on pregnancy. Thus, we investigated the causes of T. gondii-induced pregnancy failure by analyzing the transcriptomic changes in the uterus of mice with acute T. gondii infection. A total of 4,561, 2,345, and 2,997 DEGs were identified in FBD6, FAD6, and FID8 groups compared to the corresponding control groups. Validation of our RNA-Seq results by qRT-PCR and Western blotting confirmed the differential expression, indicating that the RNA-seq results were reliable and subsequent further experiments and analyses can be conducted. The mechanism of poor pregnancy outcome, associated with T. gondii infection, can be discussed from two aspects, the DEGs, and the enrichment pathways. In respect to DEGs, Hsd11b2 gene was overexpressed in infected groups compared to controls. The Hsd11b2 gene is a marker for pregnancy hypertension (Bicho et al., 2012; Majchrzak-Celinska et al., 2017). When the Hsd11b2 gene is overexpressed, it can cause placental dysfunction, especially in early-onset preeclampsia. On top of that, it might affect the embryonic development, and cause even placental abruption (Majchrzak-Celinska et al., 2017). Therefore, pregnant women who are infected with T. gondii might have pregnancy hypertension and experience pregnancy failure. A gene named Ifitm1 was also upregulated in the uterus of infected mice. This gene is associated with endometrial tumor when it is overexpressed, thus it is a marker for endometrial tumor. Rojas et al. (2012) demonstrated that FIGURE 3 | Heat maps representing hierarchical clustering analysis of endometrial tumor can cause pregnancy failure. Kuang et al. differentially expressed genes in the uterus of mice infected with T. gondii tachyzoites 3 days before pregnancy (FBD6) and 3 days after pregnancy (2009) concluded that after embryo implantation, the chemokine (FAD6). Each row refers to the expression level of each gene in the various (C-X-C motif) ligand 14 (CXCL14) gene can promote the growth groups, and each column refers to the expression level of all DEGs in each and development of trophoblast. However, CXCL14 gene was group. significantly downregulated in our transcriptome analysis, which may explain the adverse pregnancy outcome associated with T. gondii infection, but perhaps require further experimental Validation of Ten Differentially Expressed confirmation on protein level. The mostly enriched DEGs and pathways in the uterus Genes by qRT-PCR of the three experimental groups were identified and the In order to verify the reliability of RNA-Seq results, we selected signal pathways of pre-implantation and post-implantation were 10 DEGs with different expression trends for qRT-PCR. Six separately analyzed. Our results revealed that the number of genes, Hsd11b2, Slc39a4, Ifitm1, Krt8, Cd24a, and Cndp2 were DEGs in the cancer pathways was ranked in the top position upregulated, whereas Hsd17b7, A2m, Stc1, and Hmgn5 were of all the enrichment pathways. The cancer pathways included downregulated. These results were consistent with the results of five DEGs (Wnt, Frizzled, CBL, JNK, and PPFP), which were RNA-Seq (Figure 7). shared by the three experimental groups and involved in the three related pathways, which are the wingless-type MMTV integration Verification of Hsd11b2 and Ifitm1 site family (Wnt) signaling pathway, the phosphatidylinositol Expression Levels by Western Blotting 3-kinase-protein Kinase B (PI3K-Akt) signaling pathway, and After analyzing the preliminary data and searching relevant the peroxisome proliferator-activated receptor (PPAR) signaling literature, Hsd11b2 (UniprotKB: P51661) and Ifitm1 pathway. Among them, the DEGs related to the Wnt signaling Frontiers in Physiology | www.frontiersin.org 8 February 2020 | Volume 11 | Article 115 Zhou et al. Adverse Pregnancy and T. gondii Infection FIGURE 4 | Gene Ontology (GO) distribution of differentially expressed genes of the uterus transcriptome. The top 10 enriched GO terms under biological process, cellular component and molecular function in (A) mice infected with Toxoplasma gondii 3 days after pregnancy (FAD6) and (B) mice infected with T. gondii 3 days before pregnancy (FBD6). pathway were the most abundant. The proteins expressed by it can be expressed in human trophoblast cells and the the Wnt family genes are secreting morphogens, which play uterus of pregnant mice to regulate blastocyst implantation an important role in the growth and development of embryos. (Tranguch et al., 2005). Knocking out Wnt4 leads to embryo Such proteins and its products participate in the tissues and implantation and decidual abnormalities (Franco et al., 2011). organs morphogenesis and the embryonic development and Wnt4 expression in endometrial cancer is lower than that in cell division (Moon et al., 2004). The Wnt signaling pathway normal tissues (Bui et al., 1997). In our study, Wnt4 was includes three major transduction pathways (Figure 9), which downregulated in the experimental groups with acute T. gondii regulate the growth and development of embryos. These three infection. We hypothesize that acute T. gondii infection can major transduction pathways are the Wnt/β-catenin classical affect the decidualization reaction and destroy the endometrium pathway, the c-Jun NH2-terminal kinases (JNK) gene-mediated environment. Thus, it will hinder the implantation of embryos and participating planar cell polarity (PCP) pathway, and the through reducing the expression of Wnt4. Wnt7a plays many Ca-mediated Wnt/Ca2+ pathways (Xing et al., 2003). In mice, roles, for instance, it stimulates embryo-implantation-associated the Wnt/β-catenin signaling pathway is essential for hormone- responses, upregulates β-catenin in the nucleus of uterine mediated uterine growth and implantation (Hou et al., 2004; epithelial cells, and activates the Wnt/β-catenin signaling Mohamed et al., 2005). This is agreement with previous research pathway as well as improves embryo implantation success rates (Chen et al., 2009), which confirmed the important role of (Zhang et al., 2009). Wnt7a is also a tumor suppressor gene Wnt/β-catenin pathway in embryonic development, pre/post- that inhibits cell proliferation and promotes apoptosis (Li et al., implantation, and decidualization of the uterus. 2013; Bikkavilli et al., 2015). The mutation of Wnt7b can cause Our results showed that Wnt gene expression was altered placental dysplasia and fetal death in mice (Biechele et al., 2011). during embryonic development in female mice infected with In this study, the Wnt7a and Wnt7b gene were upregulated in T. gondii. Wnt gene is not only related to the estrous cycle all experimental groups compared to uninfected pregnant mice. and steroid hormone levels, but also closely related to the Therefore, we hypothesize that the proliferation effect induced by morphological changes regulated by intrauterine epithelium T. gondii looks like the effect of cancer cells. In other words, acute (Park et al., 2011). The Wnt1 gene plays an important role in T. gondii infection increases the expression of Wnt7a, which in the development of the embryonic brain and central nervous turn, hinders the embryonic cell multiplication, and stimulates system (Liu et al., 2005). In our study, the expression of the apoptosis process. We think this fact beside other factors Wnt1 genes in FBD6 and FID8 were inhibited. We believe could explain the underlying mechanism of adverse pregnancy that inhibition of the Wnt1 gene expression in early pregnancy outcomes associated with acute T. gondii infection. by T. gondii infection had an adverse effect on embryonic Frizzleds (seven-transmembrane proteins) act as receptors development resulting in pregnancy failure. Wnt4 is important for the Wnt proteins and are involved in many functions such for the development of the female reproductive system, and as regulation of embryonic development, cell differentiation, Frontiers in Physiology | www.frontiersin.org 9 February 2020 | Volume 11 | Article 115 Zhou et al. Adverse Pregnancy and T. gondii Infection FIGURE 5 | Gene Ontology enrichment scatter plot for differentially expressed genes in the uterus of mice infected with T. gondii on the fifth day of pregnancy (FID8). proliferation, apoptosis, and inflammation. The Frizzled in the inflammatory process (Neumann et al., 2010). We gene family “Fzd9, Fzd6, and Fzd1genes,” were differentially hypothesize that the Wnt genes expression is strongly expressed in the uterus of our experimental groups (FBD6, influenced by T. gondii acute infection, which result in FAD6, and FID8). The former studies have shown that Fzd1 activation of the classical and non-canonical pathways and Wnt7a combine to activate the Wnt classical pathway of Wnt signaling pathway, and eventually altering the and play a key role in embryonic lung development. Fzd6 early embryonic development, the endometrial formation, is expressed in endometrial epithelium and stromal cells, and decidualization. but it cannot be regulated directly by ovarian steroid On the other hand, the analysis of the signaling pathways hormones. Thus, the expression of Fzd6 is constant during in mice infected with T. gondii after embryo implantation the secretory and proliferative phases (Tulac et al., 2003). (FID8 group) showed that the infection had a marked influence Therefore, we suggest that the differential expression of on the vascular endothelial growth factor (VEGF) signaling Frizzled genes in our study is caused by the acute infection and Wnt signaling pathways. In normal pregnancy, David of T. gondii. This finding was also consistent with the (2017) demonstrated that placenta angiogenesis, and vascular claim that the Wnt/Frizzled signaling pathway is involved expansion are enhanced by placental growth factor (PIGF), Frontiers in Physiology | www.frontiersin.org 10 February 2020 | Volume 11 | Article 115 Zhou et al. Adverse Pregnancy and T. gondii Infection FIGURE 6 | Significantly enriched pathways in the uterus of T. gondii-infected mice. [A (Upper), B (Medium), and C (Lower)] represent KEGG pathway analysis of DEGs for FAD6 vs. CD6A, FBD6 vs. CD6B and FID8 vs. CD8 group, respectively. Frontiers in Physiology | www.frontiersin.org 11 February 2020 | Volume 11 | Article 115 Zhou et al. Adverse Pregnancy and T. gondii Infection FIGURE 7 | Validation of the relative abundance of 10 DEGs by q-PCR. The x-axis represents different DEGs in the uterus from different infected mouse groups and the y-axis represents the fold change in mRNA expression. the embryo implantation. In this regard, we think T. gondii infection can damage the placental tissues and impair the normal development of the embryo. Concerning the time before the embryo implantation, we found that DEGs were mostly related to cytokines pathway. Transforming growth factor beta (TGF-β) is highly expressed in the normal endometrium epithelium and trophoblastic layer. It plays an important role several process such as endometrial inflammation, maternal support for embryonic development, immune-regulating maternal-fetal interface, and maintaining normal pregnancy. In this study, TGF gene family and the cytokines pathway were downregulated in the infected groups compared to the control. This is consistent FIGURE 8 | Validation of expression level of Hsd11b2 and Ifitm1 in all three with previous studies, which reported that downregulation experimental groups by Western blot analysis. of TGF could cause abortion or fetal death (Pazmany and Tomasi, 2006; Norris et al., 2011). Therefore, we conclude that infection with T. gondii affects the development and VEGF and insulin growth factor (IGF). However, VEGF was implantation of the embryo. downregulated in our T. gondii-infected groups, indicating that KEGG pathway analysis of DEGs showed upregulation it is responsible for the blockage of angiogenesis in placenta of pathways related to diseases in infected mice such as and even, miscarriage. As for the Wnt signaling pathway, we systemic lupus erythematosus, leishmaniasis, viral myocarditis, noticed that infection with T. gondii decreased the expression and autoimmune thyroid disease. This finding indicates that of glycogen synthase kinase beta (GSK-β), and β-catenin, which the abortion caused by T. gondii infection during pregnancy is in turn, affect the neural development of the embryo. Wang complicated, and may not be exclusively caused by Toxoplasma et al. (2017) treated a group of mice with celecoxib and infection, where other diseases may be involved as a secondary they found that the expression of GSK-β was changed, and sequelae of T. gondii infections. Previous research showed a close β-catenin was decreased, which resulted in dysplasia of the relationship between T. gondii infection and the occurrence of fetus’ nerve cells. We propose that the reasons for pregnancy systemic lupus erythematosus in 1990 (Wilcox et al., 1990) and failure can be argued by many factors, which take place after rheumatoid arthritis (Fischer et al., 2013). Frontiers in Physiology | www.frontiersin.org 12 February 2020 | Volume 11 | Article 115 Zhou et al. Adverse Pregnancy and T. gondii Infection FIGURE 9 | Wnt signaling pathway. Red and green color for genes indicate the upregulation and downregulation, respectively. CONCLUSION T. gondii infection and associated mechanisms in the pregnancy failure which could promote the development of a new treatment The adverse pregnancy caused by acute toxoplasmosis can for toxoplasmosis in pregnancy. be attributed to three factors: (i) direct injury to tissues and cells due to T. gondii proliferation, (ii) disruption of the early maternal uterine environment, which impair the normal DATA AVAILABILITY STATEMENT embryo implantation, and (iii) poor development of embryos before and after the implantation. Our finding indicates that The sequencing data generated in this study has been deposited acute T. gondii infection altered the Wnt genes expression and into BioProject (accession no. PRJNA593831, https://www.ncbi. signaling pathway, leading to the failure of early embryonic nlm.nih.gov/bioproject/PRJNA593831). development, endometrial formation, and decidualization. Acute T. gondii infection is disturbing the normal implantation of the embryo. Acute infection of T. gondii is associated with ETHICS STATEMENT gestational hypertension, systemic lupus erythematosus, and possibly endometrial tumor resulting in adverse effects on the Experimental animals were handled according to the Animal pregnancy outcome. Our findings uncover the role of the acute Ethics Procedures and Guidelines of the People’s Republic Frontiers in Physiology | www.frontiersin.org 13 February 2020 | Volume 11 | Article 115 Zhou et al. Adverse Pregnancy and T. gondii Infection of China. All animal experimental procedures were reviewed of China (31972707), the Key Research and Development and approved by the Experimental Animal Welfare Ethics Programme of Guangdong Province (2019B020218004), Committee, the Laboratory Animal Center of Guangdong the Natural Science Foundation of Guangdong Province Province (Reference No. 2016-10). (2019A1515011534), and Major Scientific Research Projects (Characteristic Innovation) of Guangdong Province (2017KTSCX018). AUTHOR CONTRIBUTIONS X-ML and Z-GY conceived and designed the experiments. XZ performed the experiments, analyzed the data, and wrote the ACKNOWLEDGMENTS manuscript. X-XZ, JH, and YM revised the manuscript. XZ, Thank for Zhanhong Zheng’s experimental technical support. G-FL, W-YH, Y-PW, and Y-XZ contributed to data collection We also thanks for the student Junjie Wang to submit the data and laboratory work. All authors read and approved the to SRA database. final manuscript. FUNDING SUPPLEMENTARY MATERIAL This work was supported, in part, by grants from the The Supplementary Material for this article can be found National Key Research and Development Programme of China online at: https://www.frontiersin.org/articles/10.3389/fphys. (2018YFD0501200), National Natural Science Foundation 2020.00115/full#supplementary-material REFERENCES Fischer, S., Agmon-Levin, N., Shapira, Y., Bat-Sheva, P. K., Eduard, G., Ricard, C., et al. (2013). Toxoplasma gondii: bystander or cofactor in rheumatoid arthritis. Anders, S., and Huber, W. (2010). Differential expression analysis for sequence Immunol. Res. 56, 287–292. doi: 10.1007/s12026-013-8402-2 count data. Genome Biol. 11:R106. doi: 10.1186/gb-2010-11-10-r106 Franco, H. L., Dai, D., Lee, K. Y., Cory, A. R., Dennis, R., Derek, B., et al. Aral, A. G., Elhan, H. A., and Akarsu, C. (2011). Retrospective evaluation of (2011). WNT4 is a key regulator of normal postnatal uterine development and Toxoplasma gondii seropositivity in fertile and infertile women. Mikrobiyol. progesterone signaling during embryo implantation and decidualization in the Bull. 45, 174–180. mouse. FASEB J. 25, 1176–1187. doi: 10.1096/fj.10-175349 Barbosa, B. F., Gomes, A. O., Ferro, E. A., Napolitano, D. R., Mineo, J. R., and Freeman, K., Oakley, L., Pollak, A., Semprini, A. E., Salt, A., and Gilbert, R. Silva, N. M. (2012). Enrofloxacin is able to control Toxoplasma gondii infection (2005). Association between congenital toxoplasmosis and preterm birth, low in both in vitro and in vivo experimental models. Vet. Parasitol. 187, 44–52. birthweight and small for gestational age birth. BJOG 112, 31–37. doi: 10.1016/j.vetpar.2011.12.039 He, J. J., Ma, J., Elsheikha, H. M., Song, H. Q., Huang, S. Y., and Zhu, X. Q. Bayat, P. D., Eslamirad, Z., and Shojaee, S. (2013). Toxoplasmosis: experimental (2016a). Transcriptomic analysis of mouse liver reveals a potential hepato- vaginal infection in NMRI mice and its effect on uterine, placenta and fetus enteric pathogenic mechanism in acute Toxoplasma gondii infection. Parasit. tissues. Iran Red Crescent. Med. J. 15, 595–599. doi: 10.5812/ircmj.11427 Vectors 9:427. doi: 10.1186/s13071-016-1716-x Bicho, M. D., Matos, A., Silva, A. P., Macedo, C., Afonso, C., Areias, M. J., He, J. J., Ma, J., Song, H. Q., Zhou, D. H., Wang, J. L., Huang, S. Y., et al. et al. (2012). PP159. In women with previous pregnancy hypertension, (2016b). Transcriptomic analysis of global changes in cytokine expression in cardiovascular risk biomarkers may be modulated by haptoglobin genotype. mouse spleens following acute Toxoplasma gondii infection. Parasitol. Res. 115, Preg. Hypertens. 2:325. doi: 10.1016/j.preghy.2012.04.270 703–712. doi: 10.1007/s00436-015-4792-5 Biechele, S., Cox, B. J., and Rossant, J. (2011). Porcupine homolog is required for Hill, D., and Dubey, J. P. (2002). Toxoplasma gondii: transmission, diagnosis and canonical Wnt signaling and gastrulation in mouse embryos. Dev. Biol. 355, prevention. Clin. Microbiol. Infect. 8, 634–640. 275–285. doi: 10.1016/j.ydbio.2011.04.029 Hou, X., Tan, Y., Li, M., Dey, S. K., and Das, S. K. (2004). Canonical Wnt signaling Bikkavilli, R. K., Avasarala, S., Van Scoyk, M., Arcaroli, J., Brzezinski, C., Zhang, is critical to estrogen-mediated uterine growth. Mol. Endocrinol. 18, 035–3049. W., et al. (2015). Wnt7a is a novel inducer of beta-catenin-independent tumor- Knight, B., Brunton, C., Modi, N., Wallace, G., and Stanford, M. (2005). The effect suppressive cellular senescence in lung cancer. Oncogene 34:5406. of Toxoplasma gondii infection on expression of chemokines by rat retinal Bui, T. D., Zhang, L., Rees, M. C., Bicknell, R., and Harris, A. L. (1997). vascular endothelial cells. J. Neuroimmunol. 160, 41–47. Expression and hormone regulation of Wnt2, 3, 4, 5a, 7a, 7b and 10b in Kuang, H., Chen, Q., Fan, X., Zhang, Y., Zhang, L., Peng, H., et al. (2009). CXCL14 normal human endometrium and endometrial carcinoma. Br. J. Cancer. 75, inhibits trophoblast outgrowth via a paracrine/autocrine manner during early 1131–1136. pregnancy in mice. J. Cell Physiol. 221, 448–457. doi: 10.1002/jcp.21877 Chen, B., Wang, H., Wang, L., Lu, Q., Zhou, L., Cheng, B., et al. (2003). Studies Li, J., Xu, X., Kook-Joo, N., and Chan, C. (2013). “The role of Wnt7a gene in on the Effect of IFN-γ on Toxoplasma gondii-infected pregnancy mice in the proliferation, invasion and metastasis of non-small cell lung cancer,” in ultramicrostructure of uterus and placenta. Jiang. Pharm. Clin. Res. 11, 3–6. Proceedings of the Thirteenth National Lung Cancer Conference, Changchun. Chen, Q., Zhang, Y., Lu, J., Wang, Q., Wang, S., Cao, Y., et al. (2009). Embryo- Liu, Y., Shi, J., Lu, C. C., Zheng-Bei, W., Anna, I. L., Xue-Jun, S., et al. (2005). Ryk- uterine cross-talk during implantation: the role of Wnt signaling. Mol. Hum. mediated Wnt repulsion regulates posterior-directed growth of corticospinal Reprod. 15, 215–221. doi: 10.1093/molehr/gap009 tract. Nat. Neurosci. 8, 1151–1159. David, A. L. (2017). Maternal uterine artery VEGF gene therapy for treatment of Livak, K. J., and Schmittgen, T. D. (2001). Analysis of relative gene expression intrauterine growth restriction. Placenta 59(Suppl. 1), S44–S50. doi: 10.1016/j. data using real-time quantitative PCR and the 2-11CT method. Methods 25, placenta.2017.09.011 402–408. Dunn, D., Wallon, M., Peyron, F., Petersen, E., Peckham, C., and Gilbert, R. (1999). Luft, B. J., Conley, F., Remington, J. S., Laverdiere, M., Wagner, K. F., Levine, Mother-to-child transmission of toxoplasmosis: risk estimates for clinical J. F., et al. (1983). Outbreak of central-nervous-system toxoplasmosis in western counselling. Lancet 353, 1829–1833. Europe and North America. Lancet 1, 781–784. Ferreira, J. A. (2007). The benjamini-hochberg method in the case of discrete test Majchrzak-Celinska, A., Kosicka, K., Paczkowska, J., Główka, F. K., Brêborowicz, statistics. Int. J. Biostat. 3:11. doi: 10.2202/1557-4679.1065 G. H., Krzyścin, M., et al. (2017). HSD11B2, RUNX3, and LINE-1 methylation Frontiers in Physiology | www.frontiersin.org 14 February 2020 | Volume 11 | Article 115 Zhou et al. Adverse Pregnancy and T. gondii Infection in placental DNA of hypertensive disorders of pregnancy patients. Reprod. Sci. Stahl, W., Dias, J. A., and Turek, G. (1985). Hypothalamic-adenohypophyseal 24, 1520–1531. doi: 10.1177/1933719117692043 origin of reproductive failure in mice following chronic infection with Mohamed, O. A., Jonnaert, M., Labelle-Dumais, C., Kazuki, K., Hugh, Toxoplasma gondii. Proc. Soc. Exp. Biol. Med. 178, 246–249. J. C., and Daniel, D. (2005). Uterine Wnt/beta-catenin signaling Tanaka, S., Nishimura, M., Ihara, F., Yamagishi, J., Suzuki, Y., and Nishikawa, is required for implantation. Proc. Natl. Acad. Sci. U.S.A. 102, Y. (2013). Transcriptome analysis of mouse brain infected with Toxoplasma 8579–8584. gondii. Infect. Immun. 81, 3609–3619. doi: 10.1128/IAI.00439-13 Montoya, J. G., and Remington, J. S. (2008). Management of Toxoplasma gondii Tranguch, S., Daikoku, T., Guo, Y., Wang, H., and Dey, S. K. (2005). Molecular infection during pregnancy. Clin. Infect. Dis. 47, 554–566. complexity in establishing uterine receptivity and implantation. Cell Mol. Life Moon, R. T., Kohn, A. D., De Ferrari, G. V., and Kaykas, A. (2004). WNT Sci. 62, 1964–1973. and beta-catenin signalling: diseases and therapies. Nat. Rev. Genet. 5, Trapnell, C., Williams, B. A., Pertea, G., Mortazavi, A., Kwan, G., van Baren, 691–701. M. J., et al. (2010). Transcript assembly and quantification by RNA-Seq reveals Neumann, J., Schaale, K., Farhat, K., Tobias, E., Artur, J. U., Stefan, E., et al. (2010). unannotated transcripts and isoform switching during cell differentiation. Nat. Frizzled1 is a marker of inflammatory macrophages, and its ligand Wnt3a is Biotechnol. 28, 511–515. doi: 10.1038/nbt.1621 involved in reprogramming Mycobacterium tuberculosis-infected macrophages. Tulac, S., Nayak, N. R., Kao, L. C., Van Waes, M., Huang, J., Lobo, S., et al. (2003). FASEB J. 24, 4599–4612. doi: 10.1096/fj.10-160994 Identification, characterization, and regulation of the canonical Wnt signaling Nishimura, M., Umeda, K., Suwa, M., Furuoka, H., and Nishikawa, Y. (2017). pathway in human endometrium. J. Clin. Endocrinol. Metab. 88, 3860–3866. CCR5 is involved in interruption of pregnancy in mice infected with toxoplasma Wang, R., Tian, S., Yang, X., Liu, J., Wang, Y., and Sun, K. (2017). Celecoxib- gondii during early pregnancy. Infect. Immun. 85:e00257-17. doi: 10.1128/IAI. induced inhibition of neurogenesis in fetal frontal cortex is attenuated by 00257-17 curcumin via Wnt/beta-catenin pathway. Life Sci. 185, 95–102. doi: 10.1016/j. Norris, W., Nevers, T., Sharma, S., and Kalkunte, S. (2011). Review: hCG, lfs.2017.07.028 preeclampsia and regulatory T cells. Placenta 32(Suppl. 2), S182–S185. doi: Wilcox, M. H., Powell, R. J., Pugh, S. F., and Balfour, A. H. (1990). Toxoplasmosis 10.1016/j.placenta.2011.01.009 and systemic lupus erythematosus. Ann. Rheum. Dis. 49, 254–257. Park, H. J., Kuk, I. S., Kim, J. H., Kim, J. H., Song, S. J., Choi, B. C., et al. Xiao, Y., Yin, J., Jiang, N., Mei, X., Lili, H., Huijun, L., et al. (2010). (2011). Characterisation of mouse interferon-induced transmembrane protein- Seroepidemiology of human Toxoplasma gondii infection in China. BMC Infect. 1 gene expression in the mouse uterus during the oestrous cycle and pregnancy. Dis. 10:4. doi: 10.1186/1471-2334-10-4 Reprod. Fertil. Dev. 23, 798–808. doi: 10.1071/RD10086 Xing, Y., Clements, W. K., Kimelman, D., and Xu, W. (2003). Crystal structure Pazmany, T., and Tomasi, T. B. (2006). The major histocompatibility complex of a beta-catenin/axin complex suggests a mechanism for the beta-catenin class II transactivator is differentially regulated by interferon-gamma and destruction complex. Genes Dev. 17, 2753–2764. transforming growth factor-beta in microglial cells. J. Neuroimmunol. 172, Xu, X., Zhang, J., Zhan, S., Li, Z., Liu, X., Zhang, H., et al. (2017). TGF- 18–26. β1 improving abnormal pregnancy outcomes induced by Toxoplasma gondii Remington, J. S., Jacobs, L., and Kaufman, H. E. (1958). Studies on chronic infection: regulating NKG2D/DAP10 and killer subset of decidual NK cells. Cell toxoplasmosis; the relation of infective dose to residual infection and Immunol. 317, 9–17. to the possibility of congenital transmission. Am. J. Ophthalmol. 46, Zhang, Y., Peng, S., Kuang, H., Chen, Q., Liu, S., Zhang, L., et al. (2009). Expression 261–268. and regulation of Dickkopf2 during periimplantation in mice. J. Reprod. Dev. Remington, J. S., Jacobs, L., and Melton, M. L. (1961). Congenital transmission of 55, 17–22. toxoplasmosis from mother animals with acute and chronic infections. J. Infect. Dis. 108, 163–173. Conflict of Interest: The authors declare that the research was conducted in the Rojas, D. B., de Andrade, R. B., Gemelli, T., Oliveira, L. S., Campos, A. G., Dutra- absence of any commercial or financial relationships that could be construed as a Filho, C. S., et al. (2012). Effect of histidine administration to female rats during potential conflict of interest. pregnancy and lactation on enzymes activity of phosphoryltransfer network in cerebral cortex and hippocampus of the offspring. Metab. Brain Dis. 27, Copyright © 2020 Zhou, Zhang, Mahmmod, Hernandez, Li, Huang, Wang, Zheng, Li 595–603. doi: 10.1007/s11011-012-9319-5 and Yuan. This is an open-access article distributed under the terms of the Creative Rorman, E., Zamir, C. S., Rilkis, I., and Ben-David, H. (2006). Congenital Commons Attribution License (CC BY). The use, distribution or reproduction in toxoplasmosis–prenatal aspects of Toxoplasma gondii infection. Reprod. other forums is permitted, provided the original author(s) and the copyright owner(s) Toxicol. 21, 458–472. are credited and that the original publication in this journal is cited, in accordance Saadatnia, G., and Golkar, M. (2012). A review on human toxoplasmosis. Scand. J. with accepted academic practice. No use, distribution or reproduction is permitted Infect. Dis. 44, 805–814. doi: 10.3109/00365548.2012.693197 which does not comply with these terms. Frontiers in Physiology | www.frontiersin.org 15 February 2020 | Volume 11 | Article 115