Alvarez-Palomo et al. Stem Cell Research & Therapy (2020) 11:213 https://doi.org/10.1186/s13287-020-01726-3 RESEARCH Open Access Induced pluripotent stem cell-derived lung alveolar epithelial type II cells reduce damage in bleomycin-induced lung fibrosis Belén Alvarez-Palomo1, Luis Ignacio Sanchez-Lopez2, Yuben Moodley3, Michael J. Edel3,4,5*† and Anna Serrano-Mollar2,6*† Abstract Background: Idiopathic pulmonary fibrosis is a chronic, progressive, and severe disease with a limited response to currently available therapies. Epithelial cell injury and failure of appropriate healing or regeneration are central to the pathogenesis of idiopathic pulmonary fibrosis. The purpose of this study is to investigate whether intratracheal transplantation of alveolar type II-like cells differentiated from induced pluripotent stem cells can stop and reverse the fibrotic process in an experimental model of bleomycin-induced lung fibrosis in rats. Methods: Human induced pluripotent stem cells were differentiated to alveolar type II-like cells and characterized. Lung fibrosis was induced in rats by a single intratracheal instillation of bleomycin. Animals were transplanted with human induced pluripotent stem cells differentiated to alveolar type II-like cells at a dose of 3 × 106 cells/animal 15 days after endotracheal bleomycin instillation when the animal lungs were already fibrotic. Animals were sacrificed 21 days after the induction of lung fibrosis. Lung fibrosis was assessed by hydroxiprolin content, histologic studies, and the expression of transforming growth factor-β and α-smooth muscle actin. Results: Cell transplantation of alveolar type II-like cells differentiated from induced pluripotent stem cells can significantly reduce pulmonary fibrosis and improve lung alveolar structure, once fibrosis has already formed. This is associated with the inhibition of transforming growth factor-β and α-smooth muscle actin in the damaged rat lung tissue. Conclusion: To our knowledge, this is the first data to demonstrate that at the fibrotic stage of the disease, intratracheal transplantation of human induced pluripotent differentiated to alveolar type II-like cells halts and reverses fibrosis. Keywords: Induced pluripotent stem cells, Alveolar type II cells, Cell differentiation, Idiopathic pulmonary fibrosis, Cell therapy One sentence summary Transplantation of human iPSC-derived AEC2 reduces * Correspondence: edel.michael@gmail.com; anna.serranomollar@iibb.csic.es lung fibrosis, associated with reduced expression of α- Michael J. Edel and Anna Serrano-Mollar are equal corresponding authors. 3 Harry Perkins Research Institute, Centre for Cell Therapy and Regenerative SMA and TGF-β in the experimental bleomycin model Medicine (CCTRM), University of Western Australia, Perth, WA, Australia 2 in rats. Department of Experimental Pathology, Institut d’Investigacions Biomèdiques de Barcelona, Consejo Superior de Investigaciones Científicas (IIBB-CSIC), Institut d’Investigacions Biomédiques August Pi i Sunyer (IDIBAPS), Barcelona, Spain Full list of author information is available at the end of the article © The Author(s). 2020 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data. Alvarez-Palomo et al. Stem Cell Research & Therapy (2020) 11:213 Page 2 of 12 Introduction are bone marrow mesenchymal stromal cells [13], but Idiopathic pulmonary fibrosis (IPF) is a chronic, progres- also other cell types such as cord blood mesenchymal sive, and severe disease of unknown cause with a limited stem cells, human amnion epithelial cells (hAEC) [14], response to currently available therapies [1–3]. The me- and AEC2 in both animal and human clinical studies dian survival time is 3 to 5 years from the time of diag- [15–17]. AEC2 are responsible for repairing the dam- nosis [1]. Most patients show a progressive decline in aged alveolar epithelium in the event of lung damage pulmonary function leading to respiratory failure and and consequently proposed as an optimal cell type for death. The poor prognosis, combined with the scarcity the treatment of IPF. In preclinical studies, the adminis- of treatment options, provides a strong rationale for de- tration of AEC2 during the inflammatory phase or dur- velopment of novel therapeutic alternatives for this dis- ing the fibrotic phase resulted in significant reduction of ease [1]. fibrosis and the restoration of surfactant levels [15, 16]. Alveolar epithelial cell injury and failure of appropriate Moreover, in a clinical study performed with IPF pa- healing or regeneration are central to the pathogenesis tients, the intratracheal administration of heterologous of IPF. Epithelial cell damage and death result in breaks AEC2 was safe, well tolerated, with no relevant side ef- in epithelial basement membranes of alveoli. Subsequent fects, stabilized disease progression, and improved migration of fibroblasts and myofibroblasts into the al- health-related quality of life throughout a 1-year clinical veolar space through these gaps leads to intra-alveolar fi- follow-up [17]. Therefore, results of transplanting AEC2 brosis with an exaggerated accumulation of extracellular have been promising in halting pulmonary fibrosis pro- matrix (ECM) components. The resulting fibrosis dis- gression both in animals and in humans. Additionally, turbs the normal lung architecture leading to lung dys- other minor lung cell populations have also been de- function and respiratory failure [4–6]. scribed as potential stem cells or distal epithelium that Within the structure of the alveolar epithelium are the are activated in particular situations such as acute injury alveolar type II (AEC2) and type I (AEC1). One of the and are yet to be tested [18–20]. main important functions of AEC2 is the production, se- Induced pluripotent stem cells (iPSC) have been pro- cretion, and recycling of pulmonary surfactant proteins posed as an alternative source of cells for cell therapy to that decrease the surface tension of the alveoli providing treat lung disease with the possibility of increased cell efficient ventilation and alveolar stability as well as act- production for clinical applications [21]. Differentiation ing as a protective barrier against possible infections [7, of mouse or human iPSC to definitive endoderm and 8]. Under normal conditions, AEC2 have the ability of then into distal AEC2 and proximal lung cells has been self-renewal and are the progenitor cell type for AEC1, well described before [22–25]. the cells responsible for gas exchange in the alveoli [9, The aim of our study was to test in a rat model of 10]. However, during the course of IPF, AEC2 undergo bleomycin (BLM)-induced lung fibrosis if transplant- cell death and are replaced by myofibroblasts that show ation of iPSC-like AEC2 could improve the fibrotic a great proliferative activity. In this regard, the death of phenotype and reconstruction of alveolar structure. Dif- the AEC2 and activation of fibroblasts or myofibroblasts ferentiation of iPSC resulted in high efficiency of surfac- are central in the development of the pulmonary fibrosis tant protein C (SP-C)-positive lung cells of [11]. approximately 90–95%. The results demonstrate that The loss of AEC2 prevents renewal and repairing of iPSC-AEC2 intratracheal transplantation after 15 days of the alveolar wall and induces the secretion of fibrogenic BLM instillation, when fibrosis had been fully developed, mediators such as transforming growth factor beta led to decreased collagen deposition and a significant de- (TGF-β). TGF-β acts as a major pro-fibrotic cytokine, crease in both TGF-β expression and α-SMA expression. potently increasing fibroblast recruitment, proliferation, In summary, our results show a reduction in the severity differentiation into myofibroblasts, and production of of pulmonary fibrosis with iPSC-like AEC2 intratracheal ECM [12]. Myofibroblasts compose the majority of cells transplantation at the fibrotic stage of development of in the fibroblastic foci and are characterized by the pres- the disease. ence of α-smooth muscle actin (α-SMA). They play an important role in the pathogenesis of pulmonary fibrosis Materials and methods by contributing to increased ECM deposition and re- iPSC preparation and its differentiation to AEC2 duced contractibility of lung tissue during IPF. Myofi- Culture of induced pluripotent stem cells broblasts also secrete TGF-β that in turn induces AEC2 Human iPSC were purchased from ThermoFisher and apoptosis reducing the capability of wound healing and cultured on vitronectin (ThermoFisher)-coated 6 well increasing lung architecture damage [11]. plates in Essential 8™ Flex Medium (Gibco). Cells were Cell transplantation therapy to treat lung disease has adapted to single cell passaging for 4–5 passages before been proposed before; the most widely tested cell types starting the differentiation protocol. Alvarez-Palomo et al. Stem Cell Research & Therapy (2020) 11:213 Page 3 of 12 Differentiation from iPSC to AEC2 C-Kit, Sox17, MEF2C (mesoderm specific was used as a The differentiation protocol from iPSC to AEC2 was negative control), and GAPDH. The real-time PCR reac- adapted from previously published protocols by the Kot- tion was performed with the 7500 Real Time PCR Sys- ton group [24]. Single cell passaging-adapted iPSC were tem (10 min at 95 °C, 40 cycles 10 s at 95 °C, and finally plated on vitronectin (ThermoFisher)-coated plates at 40 cycles 34 s at 60 °C). RT-PCR experiments were run 400,000 cells/well in 12 MW in Essential 8™ Flex at Genetic Forensics Laboratory (Hospital Clinic, UB). Medium with Rock inhibitor. Twenty-four hours later (day 0), definitive endoderm was induced using STEM- diff definitive endoderm kit (StemCells Technologies) Fluorescence activated cell-sorting (FACS) for 72 h (day 3). For the induction of anterior foregut For flow cytometry, the samples were centrifuged 5 min endoderm, the cells were replated on human placenta at 200g, and then resuspended in PBS 5% Donkey collagen IV (Sigma)-coated 6 MW at about 200,000 serum-0.5% Triton X-100 and incubated 15 min at room cells/cm2 in basal differentiation media (BDM) (DMEM: temperature. After that, the samples were centrifuged F12 (3:1), 1 x B27, 0.5 x N2 (all from ThermoFisher), as- again and resuspended in PBS 5% Donkey serum-0.1% corbic acid 25 μg/ml (Sigma)) plus SB431542 10 μM Triton X-100 with the primary antibody in the (Merk) and Dorsomorphin 2 μM (Sigma) from day 3 to correspondent sample. We left the samples for 30 min at day 6. Rock inhibitor was added at day 3 and removed at room temperature. Next, secondary antibody (1:500) was day 4. For lung progenitor induction, the cells were added and left for 30 min at room temperature. Samples transferred to BDM plus fibroblast growth factor-10 were washed two times with PBS and analyzed by flow (FGF10) 10 ng/ml, keratinocyte growth factor (KGF) 10 cytometry. ng/ml, bone morphogenetic protein-4 (BMP4) 10 ng/ml (all from Peprotech), retinoic acid 50 μM (Sigma), and CHIR99021 3 μM (Merk) from day 6 to day 15. At day Immunofluorescence 8, the cells were split 1:5. For the last step of AEC2 in- For immunofluorescence, iPSC, iPSC-AEC2 (day 22), duction, the cells were transferred to BDM plus KGF 10 and endogenous human AEC2 were previously plated in ng/ml and CHIR99021 3 μM from day 15 to day 22. coverslips. Cells were fixed with 4% paraformaldehyde for 20 min. For immunofluorescence staining, cells were RNA extraction and cDNA synthesis for in vitro work washed with PBS and blocked and permeabilized with For RNA extraction, during the differentiation of iPSC PBS 6% Donkey serum, 1% BSA, and 0.5% Triton during to AEC2, in each stage, cells were washed with PBS and 30 min at room temperature. Primary antibody used was dissociated by adding trypsine solution or TrpLE™ select mouse monoclonal anti-NKX 2.1 (1:250), anti-SP-C (1: (ThermoFisher Scientific) to the plate. Cells were col- 50), anti-MUC (1:100), and anti- Oct4 (1:60). Samples lected in a 15-ml tube and diluted with more medium, were left over night at 4 °C rocking. The next day, cells and the suspension then was centrifuged 5 min at 800 were washed three times with PBS. Secondary antibodies rpm. The pellet obtained was used for RNA extraction. were both prepared at the same dilution 1:200 (anti- RNA from cells was extracted following the PureLinkR rabbit Alexa488 and anti-mouse Alexa568). Samples mini Kit (Ambion) protocol and was quantified measur- were left during 1 h at 4 °C in the dark. After 1 h, DAPI ing the absorbance at 260 nm at Nanodrop ND-100 was added for nucleus staining and incubated 10 min at Spectrophotometer (Thermo Scientific). A 1% agarose room temperature. Finally, the slides were mounted on gel was made to confirm that there was no degradation fluoromont and observed by confocal microscopy. of RNA. The synthesis of cDNA was done using a kit (Bioline) and XP Cycler. We synthesized 1 μg for sample iPSC, definitive endoderm, day 15 and day 22. However, Alkaline phosphatase for AEC2, we synthesized 360 μg. For the reaction of alkaline phosphatase, the kit alkaline phosphatase blue kit (Membrane Substrate Solution- Quantitative real-time PCR for in vitro work ThermoFisher Scientific) was used. Firstly, the cells were RT-PCR was performed with SYBR Green: 7.5 μl SYBR washed with PBS and 0.5 ml of paraformaldehyde 4% Green, 0.75 μl of each primer at 10 μM, 2 μl 10× PCR was added for 90 s. Then, cells were washed again with buffer, and 500 ng of RNA in 8 μl of water. Duplicates PBS and a mix of 250 μl of component A and 250 μl of for each sample were performed in 96-well plates and component B was added and incubated for 30 min at analyzed for all the markers (GAPDH, Oct4, NKX 2.1, room temperature. Slides were observed under a trans- FOXA2, FOXA1, FOXP2, Sox9, SP-C, surfactant protein mission microscope. AEC2 should be reactive for alka- A (SP-A), p63, GATA6, and Aquoporin5). For definitive line phosphatase activity and appear blue. endoderm, we analyzed the following markers: CXCR4, Alvarez-Palomo et al. Stem Cell Research & Therapy (2020) 11:213 Page 4 of 12 Animals fluorescent microscopy. Before cell transplantation, cells Sprague-Dawley rats, weighting 200–225 g at the begin- were labeled by the Vybrant™ DiO Cell-Labeling Solution ning of the experiment, were used, in accordance with (ThermoFisher) following the manufacturer’s protocol. the European Community (Directive 86/609/EEC) and At the end of the experiment, the lungs were collected, Spanish guidelines for experimental animals, and it was frozen, and embedded in OCT (Jung, Japan). The nuclei approved by the institutional committees of animal care were stained with DAPI. and research of University of Barcelona. Fibrosis measurement Bleomycin-induced lung fibrosis Hidroxyproline content Lung fibrosis was induced by intratracheal instillation of Lung hydroxyproline content was measured as an indi- a single dose of BLM (2.5 U/kg) (Sigma, USA) dissolved cator of collagen deposition, following the method out- in 400 μl of sterile saline under isofluorane anesthesia lined by Woessner [26]. Samples were homogenized and [15]. Control animals received the same volume of sa- then hydrolyzed in 6 M HCl, and the hydrolysate was line. The animal body weights were recorded every 2 then neutralized with 2.5 M NaOH. Hydroxyproline in days during the course of the experiment. the hydrolysate was assessed colorimetrically at 550 nm with p-dimethylaminobenzaldehyde. The results are iPSC-AEC2 transplantation expressed as micrograms of hydroxyproline per lung. At day 21 of differentiation, cells were labeled by incu- bating them for 20 min in F12 medium with Vybrant™ RNA extraction and cDNA synthesis for in vivo work DiO Cell-Labeling Solution (ThermoFisher). The next To preserve the native ratio between DNA and RNA, day, the cells were lifted with 0.05% trypsin and were Selfie-qPCR analysis was performed using sample lysate washed twice with saline solution and resuspended at without nucleic acid extraction as previously described 4.5 × 106 cells/ml in saline solution the final concentra- [27]. Briefly, tissue was homogenized in 100ST DNA/ tion for transplantation. After 15 days of intratracheal RNA/Protein Solubilization Reagent (#DCQ100ST, BLM, each animal received 3.0 × 106 cells (suspended in DireCtQuant) 5 μl/mg. The homogenized tissue was in- 400 μl of sterile saline) by intratracheal administration cubated at 90 °C for 3 min with 750 rpm agitation, cen- under isofluorane anesthesia. Control animals received trifuged at 10,000×g for 10 min, and the supernatant was the same volume of saline solution. The animals were used directly to measure mtDNA, 7SDNA, nuclear sacrificed 21 days after the induction of lung fibrosis DNA, and mtRNA as described [27]. [15]. To avoid immunological rejection, all the trans- planted animals started, the same day of cell administra- Strand-specific transcription quantification by Selfie-qPCR tion, an immunosuppressive treatment with cyclosporine Strand-specific analysis of mtDNA transcription was (Novartis) (10 mg/kg, orally) daily until the day of the performed by Selfie-qPCR as previously described, sacrifice. adapting the method to qPCR [27]. This method enables separate analysis of transcriptional activity of each one Experimental groups of the DNA strands without using a reference gene. The The animals were randomly distributed into four Selfie-qPCR procedure includes three steps: (1) sample experimental groups (n = 6 in each group): (1) control— and mtRNA strand-specific primer pre-annealing in du- saline instillation; (2) control + iPSC-AEC2 transplant- plicate aliquots of the same sample, (2) reverse transcrip- ation (C + iPSC-AEC2)—saline instillation + iPSC-AEC2 tion with retro-transcriptase enzyme in one duplicate transplantation; (3) BLM—BLM instillation; and (4) and no enzyme in the other duplicate, and (3) qPCR BLM + iPSC-AEC2—BLM instillation + iPSC-AEC2 analysis. To anneal the primers to their complementary transplantation. transcripts, a reaction mixture containing the sample and 500 nM primer in 10 μl of double-distilled water iPSC-AEC2 engraftment was heated to 70 °C for 1 min, followed by a gradual de- Engrafted cells were assessed in whole lung single cell crease of temperature to 22 °C. Afterwards, we added preparations. Lung tissue samples were digested with 4 μl of reaction buffer 5× (EP0751, ThermoFisher), 2 μl trypsin (Sigma, USA), chopped into 1–2 mm2 cubes, 10 mM dNTPs (R0191, ThermoFisher), 0.5 μl Ribolock treated with 75 U/ml DNase (Sigma, USA) dissolved in RNase inhibitor (EO0381, ThermoFisher), and double- saline, and filtered through nylon meshes ranging from distilled water to a final volume of 19.5 μl to each dupli- 150 to 30 μm. The resulting cell suspension was centri- cate. After mixing both tubes well, we added 0.5 μl of fuged 10 min at 500g and then washed twice with PBS Maxima H Minus reverse transcriptase (EP0751, Ther- and analyzed by AMNIS Image StreamX flow cytometry. moFisher) to one of the duplicates and 0.5 μl of enzyme Moreover, cell engraftment was also evaluated by storage buffer to the second duplicate. Then, both tubes Alvarez-Palomo et al. Stem Cell Research & Therapy (2020) 11:213 Page 5 of 12 were incubated at 60 °C for 30 min to perform the retro- Histology transcription, followed by 90 °C incubation for 3 min, to The lungs used for histology were inflated and fixed with inactivate the reverse transcriptase. Next, 4 μl of each 10% neutral buffered formalin, immersed in the fixative duplicate was added to a qPCR reaction mixture con- solution for 24 h, and paraffin-embedded. Four- taining 100 nM of the corresponding primer, 1× Eva- micrometer sections were stained with hematoxylin- Green ddPCR Supermix, in a final volume of 20 μl. eosin and Masson’s trichrome to identify inflammatory qPCR was performed in a thermal cycler (C1000 Touch cells, connective tissue, and collagen deposition. Thermal Cycler, Bio-Rad) using the following thermal profile: 95 °C 5 min, (95 °C 30 s; 60 °C 1 min) 40 repeats, Statistical analysis 4 °C 5 min, and 90 °C 10 min. Non-template controls Data are expressed as mean ± SEM values with 95% con- containing all the reagents and the corresponding fidence intervals (CIs). Statistical analysis was carried amount of solubilization buffer without sample lysate out by analysis of variance (ANOVA) followed by appro- were included in all steps of the procedure. The number priate post hoc tests, including the Newman-Keuls test of mtRNA transcripts was calculated by subtracting the when differences were significant (GraphPad Software amount of amplicons measured in the reaction without Inc., USA). A p value of < 0.05 was considered reverse transcriptase (RT−) from the reaction with re- significant. verse transcriptase (RT+) and dividing by (RT−). The used primers for TGF-β were forward 5′GACTCTC- Results CACCTGCAAGACC3′ and reverse 5′GGACTGGC- Differentiation of human iPSC to AEC2 GAGCCTTAGTTT3′ and for α-SMA were forward and For the production of iPSC-derived AEC2, we used a reverse forward 5′CATCACCAACTGGGACGACA3′ commercially available human iPSC line (cord blood and reverse 5′TCCGTTAGCAAGGTCGGATG3′. cells reprogrammed with episomal vectors, Thermo- Fisher) and applied a previously published differentiation SDS-PAGE and Western blot protocol to AEC2 described by the Kotton group [24] Protein samples were extracted using Nonidet P-40 buf- (Fig. 1a). Cells were adapted to single cell passaging and fer. SDS-PAGE was performed on 5–13% acrylamide differentiated to definitive endoderm using a commercial gels. Proteins were electrotransferred to nitrocellulose kit (Stem Cell Technologies). After 3 days, the cells had membrane and probed with primary antibodies. The acquired the characteristic polygonal shape of definitive antibodies used included mouse anti-α-SMA (Acris endoderm and RT-PCR analysis showed enhanced ex- Antibodies, Germany), molecular weight 42 kDa, and pression of typical definitive endoderm markers: C-KIT, mouse anti-β-actin (Sigma, USA), molecular weight 42 CXCR4, and SOX17 (Fig. 1c). Definitive endoderm cells kDa, which served as a housekeeping reference. The were then replated and transferred sequentially to anter- membranes were incubated with the corresponding ior foregut endoderm induction medium, lung progeni- peroxidase-conjugated secondary antibodies, washed, tor induction medium, and finally AEC2 induction and then incubated with ECL reagents (GE Healthcare medium. At day 22, the end of the differentiation proto- Europe GmbH; Freigburg; GE) before exposure to high- col, the cells had changed significantly in morphology performance chemiluminescence films. Gels were cali- and looked clearly epithelial (Fig. 1b). To check that no brated using Bio-Rad standard proteins (Hercules, CA) undifferentiated iPSC were left at day 22, we assessed with markers covering a 7–240-kDa range. the expression of the pluripotency marker Oct3/4 and Films were scanned by using image-editing software found reduced gene expression (Fig. 1d) and protein NIH ImageJ software for densitometric analysis of im- levels in differentiated cells (Fig. 1e). munoreactive bands. Characterization of human iPSC-AEC2 Immunostaining studies To demonstrate that the differentiated cells had acquired For the immunofluorescence studies, the lungs were col- an AEC2 phenotype, we first stained for alkaline phos- lected, frozen, and embedded in OCT (Jung, Japan). phatase activity, a well-established general marker for Eight-micrometer tissue sections were obtained, and the AEC2, and observed clear foci of alkaline phosphatase- α-SMA protein was assessed using an antibody against positive cells (Fig. 2a). Next, we analyzed the capacity of α-SMA (Abcam, UK) and revealed with a secondary the cells to express typical AEC2 markers. At the protein antibody anti-mouse FITC (Acris, Germany). The α- level, we saw that iPSC-AEC2 at day 22 expressed SP-C SMA was observed in green color. The nuclei were in the cytosol and accumulated in granules, with resem- stained with DAPI. Tiling fluorescent microscopy was blance to the pattern observed in endogenous human used to assess more than 10% of each section and 2000 AEC2 from donor lung (Fig. 2b). We also stained for cells counted for each condition. MUC1, an epithelial marker that is mostly found in Alvarez-Palomo et al. Stem Cell Research & Therapy (2020) 11:213 Page 6 of 12 Fig. 1 a Schedule of the differentiation protocol from iPSC to AEC2. b Open field photographs of the iPSC during differentiation, at DE stage (day 3) and AEC2 stage (day 22). The arrows indicate typical epithelial shape cells. c RT-PCR data for DE markers of cells at day 3. d RT-PCR data for pluripotency marker OCT4 of cells at day 22. e Immunofluorescence staining for OCT4 (green) in iPSC at day 0 and iPSC-AEC2 at day 22. Nuclei were stained with DAPI (blue). DE, definitive endoderm; AFE, anterior foregut endoderm; iPSC, induced pluripotent stem cells; AEC2, alveolar type II cells Fig. 2 a Alkaline phosphatase staining (blue) of iPSC-AEC2 at day 22. The arrows indicate alkaline phosphatase-positive cells. b Immunofluorescence staining for SP-C (red) in ehAEC2 and in iPSC-AEC2 at day 22, and MUC1 (red) iPSC-AEC2 at day 22. Nuclei were stained with DAPI (blue). c RT-PCR data for AEC2 cell markers (NKX2.1, DNP63a, FOXA2, FOXA1, GATA6, FOXP2) and AEC1 cell markers (AQ5) of iPSC at day 0 and day 22 and of ehAEC2 cells. d RT-PCR data for AEC2 markers (SP-C, SP-A) of iPSC at day 0 and iPSC-AEC2 at day 22 and of ehAEC2 cells. iPSC-AEC2, induced pluripotent stem cells derived to alveolar type II cells; AEC2, alveolar type II cell; AEC1, alveolar type I cell; ehAEC2, endogenous human AEC2; SP-C, surfactant protein C; SP-A, surfactant protein A Alvarez-Palomo et al. Stem Cell Research & Therapy (2020) 11:213 Page 7 of 12 airway cells, and observed sporadic expression indicating f). Although multifocal parenchymal lesions and septal that the population was not totally pure alveolar (Fig. 2b). widening were still present in the lungs transplanted Next, we assessed gene expression levels of a battery of with iPSC-AEC2, the organized fibroblast foci were genes typically expressed in AEC2: NKX2.1, P63, smaller and considerably less frequent than were ob- FOXA2, FOXA1, GATA6, FOXP2, SP-C, SP-A, and served in the BLM lungs. The reduction in parenchymal AEC1 typical marker AQ5. All samples demonstrated in- lesions is clearly observed with large areas of undamaged creased gene expression (Fig. 2c). FOXA1 and FOXP2 tissue with normal alveolar architecture (Fig. 3e, f). gene expression levels were found to be comparable to Compared with the BLM group, BLM + iPSC-AEC2 those of endogenous human lung AEC2. Those marker transplanted animals showed less edema and less colla- indicating more mature alveolar cells, SP-C and SP-A, gen deposition. Assessment of cell engraftment of trans- were overexpressed to modest levels compared to en- planted human iPSC-AEC2 in single cell preparations of dogenous AEC2, indicating that iPSC-AEC2 were prob- the rat lung tissue by AMNIS Image StreamX flow cy- ably not fully mature. tometry and by fluorescent microscopy failed to detect any cell engraftment (Fig. 4), suggesting a paracrine Transplantation of human iPSC-AEC2 into the lungs of effect. bleomycin rat model BLM instillation of rat lungs initially causes a loss in Transplanted human iPSC-AEC2 reduce α-SMA-positive body weight that normally recovers, and we observed cell fibrosis that iPSC-AEC2 transplantation did not modify the body To confirm the decrease in fibrosis induced by iPSC- weight with time (Fig. 3a). However, the lung weight AEC2 transplantation, we studied the changes in gene showed a significant decrease in the iPSC-AEC2 trans- expression of fibrotic markers TGF-β and α-SMA. planted group compared with the BLM group, suggest- Quantitative real-time PCR analysis revealed a signifi- ing less fibrosis (Fig. 3b). Therefore, the amount of cant increase in the expression of both markers in the hydroxyproline, a modified amino acid specifically found BLM group, compared to the control group (Fig. 5a, b). in collagen, was assessed to determine how iPSC-AEC2 iPSC-AEC2 transplantation in fibrotic animals signifi- transplantation could alter the natural course of BLM- cantly decreased gene expression levels of TGF-β and α- induced lung injury. BLM lungs showed a significant in- SMA compared to control levels (Fig. 5a, b). High levels crease in the amount of lung hydroxyproline when com- of α-SMA in BLM animals indicate an increase in the pared with the control groups (Fig. 3c). In contrast, amount of myofibroblasts that are directly related to fi- levels of hydroxyproline were significantly reduced in brosis. In this regard, and in order to evaluate one of the the BLM + iPSC-AEC2 transplanted group which did mechanisms involved in the beneficial effect of iPSC- not significantly differ from levels observed in the con- AEC2 transplantation, we also evaluate the presence of trol groups (Fig. 3c). These results confirm that trans- myofibroblasts and the α-SMA protein release. Results plantation of iPSC-AEC2 induces a reduction in collagen showed that iPSC-AEC2 transplantation strikingly re- deposition and as a consequent of the fibrotic response. duced the number of α-SMA-positive cells and the levels To further examine the effect of iPSC-AEC2 transplant- of α-SMA release in the lung tissue of transplanted ani- ation in BLM-induced pulmonary fibrosis, serial lung mals compared with the fibrotic BLM animals (Fig. 5c, sections were stained with hematoxylin-eosin or Mas- d). The results indicate that one of the mechanisms in- son’s trichrome (Fig. 3d–f). To have a whole vision of volved of the positive effect of transplanted iPS-AEC2 is lung tissue, Masson’s trichrome-stained lung sections related with a significant reduction in α-SMA and TGF- were examined by stereomicroscopy that illustrates the β gene expression. heterogeneous topography of the fibrotic lesions (patchy areas of lung fibrosis) (Fig. 3d). BLM lungs showed ex- Discussion tensive areas of fibrosis compared with BLM + iPSC- In the last decade, different cell therapies using various AEC2 transplanted lung that had less fibrosis (Fig. 3d). types of cells have been proposed as prospective novel Moreover, fibrotic lesions were examined by light mi- IPF treatments. In this study, we evaluated the thera- croscopy, and lung tissue sections from control rats peutic effect of iPSC-AEC2 after 15 days of BLM admin- showed no evidence of inflammation or epithelial dam- istration in rats, when fibrosis had already developed in age. As expected, lung tissue sections from rats with the animal lungs. We demonstrate that intratracheal BLM-induced fibrosis showed marked peribronchiolar transplantation of AEC2 derived from iPSC is able to de- and interstitial infiltration with inflammatory cells, ex- creased lung fibrosis. The discovery and development of tensive cellular thickening of interalveolar septa, intersti- new technologies to treat lung disease that includes IPF tial edema, increased interstitial cells with a fibroblastic are essential because of a limited repertoire of currently appearance, and excessive collagen deposition (Fig. 3e, available therapies [1–3]. Alvarez-Palomo et al. Stem Cell Research & Therapy (2020) 11:213 Page 8 of 12 Fig. 3 (See legend on next page.) The timing for cell transplantation is a critical factor BLM instillation, an acute inflammatory response is trig- determining the effect of therapy. The development of gered; after 7 days, fibroblasts begin to proliferate; after the BLM-induced pulmonary fibrosis model has three 15 days, the disease is already fully developed [15]. This different well-recognized phases. In the first 3 days after last phase is characterized by the loss of lung Alvarez-Palomo et al. Stem Cell Research & Therapy (2020) 11:213 Page 9 of 12 (See figure on previous page.) Fig. 3 a Curves of animal body weight over time. On day 0, the animals received bleomycin (BLM). The arrowhead indicates the day of iPSC- AEC2 cell transplantation (day 14). Data are means ± SEM of 6 animals per group (*p < 0.05 vs control groups). b Lung weight at the end of the experiment (21 days). iPSC-AEC2 cell transplantation reduced significantly the lung weight compared to the BLM group. Data are means ± SEM of 6 animals per group (*p < 0.05 vs control groups, #p < 0.05 vs BLM group). c Lung hydroxyproline (HP) levels at the end of the experiment (21 days). iPSC-AEC2 cell transplantation reduced significantly the total lung content of hydroxyproline compared with the BLM group. Data are means ± SEM of 6 animals per group (*p < 0.05 vs control groups, #p < 0.05 vs BLM group). d Representative photographs of lung sections stained with Masson’s trichrome from all the experimental groups. Insets show changes in the multifocal parenchymal lesions in BLM non-transplanted lungs and BLM iPSC-AEC2 transplanted lungs. e Representative photomicrographs of lung sections stained with hematoxylin-eosin; iPSC-AEC2 transplantation in fibrotic animals was able to ameliorate the inflammatory and pulmonary lesions (inset). Magnification × 200. f Representative photomicrographs of lung sections stained with Masson’s trichrome; the presence of interstitial collagen (blue staining, inset) was also diminished in the BLM + iPSC-AEII group. Magnification × 200 architecture due to remodeling process, where there is slowdown of fibrogenesis. However, some stem cell ther- an increase in the deposition of ECM components to- apies demonstrated controversial results related to effi- gether with a large proliferation of fibroblasts and α- cacy when cells were administered during the fibrotic SMA-positive cells [15]. Over the last decade, a great phase and even shown some aberrant action [28, 29]. number of preclinical studies based in cell therapies have This could be explained because stem cells could differ- been conducted as prospective treatment for IPF. Vari- entiate into fibroblasts and therefore most likely increase ous types of cells have been used, including different the development of fibrosis [28, 29]. Nevertheless, the stem cells such as bone marrow-derived mesenchymal administration of AEC2 at 3, 7, and 15 days after BLM cells, hematopoietic stem cells, adipose stem cells, em- administration demonstrated a reduction in fibrosis even bryonic stem cells, iPSC, and lung stem cells [13, 28, 29]. in the fibrotic phase [15, 16]. The use of lung progenitor Additionally, AEC2 and lung mixed epithelial cells have cells or differentiated lung cells would explain why this also been investigated [13, 28, 29]. Usually, most cell re- cell type increases the effectiveness during the fibrotic placement therapy strategies have been assayed as a pre- phase. Consistent with these latest studies, our results treatment, after 24 h of BLM administration or during also demonstrated that iPSC-AEC2 transplantation is the early stages of fibrosis development 3 or 7 days after able to significantly reduce collagen deposition when fi- BLM [13, 28, 29]. In general, cell administration during brosis is already formed. Moreover, the transplanted these initial stages of the disease showed very promising iPSC-AEC2 inhibited the expression of TGF-β and α- results, because many of these cell types are able to in- SMA in the animal lung tissue. TGF-β is a powerful hibit the inflammatory response, leading to the pro-fibrotic factor, and its overexpression induces ECM Fig. 4 a Flow cytometry AMNIS Image StreamX analysis of whole lung single cell preparations. Histograms and photo of cells from flow cytometry by AMNIS Image StreamX analysis of whole lung single cell preparations to detect transplanted cells in rat lungs after 1 week transplantation. Control and control + iPSC-AEC2 groups where no labeled cells were BLM and BLM + iPSC2 groups demonstrating that no positive cells (zone R4) could be found 1 week after transplanting in the rat lung. MC_BF, Multi-Channel_Bright Field; MC_CFDA, Channel_Vybrant™ Cell Fluorescent Dye; MC, Multi-Channel. b Detection of iPSC-AEC2 engraftment after cell transplantation by fluorescence microscopy. For tracking cell purposes, iPSC-AEC2 cells were labeled with green with Vybrant™ DiO. Nuclei were stained in blue with DAPI. No green cells were observed in the transplanted groups over background/autofluorescence signal in the rat lungs (control + iPSC-AEC2 and BLM + iPSC-AEC2). Magnification × 400 Alvarez-Palomo et al. Stem Cell Research & Therapy (2020) 11:213 Page 10 of 12 Fig. 5 a, b Changes in the mRNA expression of markers for fibroblast activation (TGF-β and α-SMA) were evaluated by Selfie-qPCR. Data are means ± SEM of 6 animals per group (*p < 0.05 vs control groups, #p < 0.05 vs BLM). c Immunohistological staining with anti-α-SMA (green) shows the presence of α-SMA-positive fibroblast in BLM animals. iPSC-AEC2 cell transplantation reduces the number of α-SMA-positive cells. (magnification × 400). d Graph of integrated optical density (area × density) of each band using Image-Pro plus software for α-SMA analyzed by immunoblot and normalized to β-actin (n = 2 for control, control + iPSC-AEC2, and BLM; n = 3 for iPSC-AEC2). Data are means + SEM (n = 2 for control, control + iPSC-AEC2, and BLM; n = 3 for iPSC-AEC2) protein synthesis and regulates the differentiation from inflammation and fibrosis [30–32]. Although these fibroblasts to myofibroblasts. At the same time, myofi- works agree with our results, it is important to take into broblast activation requires the presence of ECM pro- account that they were not performed during the fibrotic teins and TGF-β. The decreased expression of TGF-β phase of the disease development. and α-SMA observed after iPSC-AEC2 transplantation We exhaustively searched for evidence of transplanted can in turn diminish fibrosis by decreasing the expres- iPSC-AEC2 at the time of sacrifice of the animals by sin- sion of collagen, myofibroblast differentiation, and pro- gle cell flow cytometry and by fluorescent microscopy of liferation. This is associated with a decrease in fibrotic dissected lung tissue. The absence of the implanted cells lesions and lung alveolar architecture improvement. As 1 week after the transplantation suggests that the cells we stated above, most cell therapies have been con- failed to engraft as a true cell replacement therapy, des- ducted during the early stages of fibrosis development, pite immune suppression treatment of animals. These and therefore, it is difficult to compare our work with results do not correspond as reported by other research previous studies. To date, few of the reported studies conducted with iPSC-AEC2 or ACE2 where cell engraft- have been performed with IPSC derived into lung ment was observed; however, the percentage of lineage cells [30–32]. In those studies, iPSC-AEC2 were engrafted cells in those studies was not stated [15, 16, administered during the first 24 h or 3 days after BLM 30–32]. Booh and colleagues reported only 1% of cells administration and both studies reported a decrease in engraft after transplantation [31]. In our work, although Alvarez-Palomo et al. Stem Cell Research & Therapy (2020) 11:213 Page 11 of 12 engrafted cells were not found in the lungs after 1 week cell transplantation. In addition, the derivation of iPSC of transplantation, beneficial effects were observed that bypasses the ethical concern associated with the use of could be due to several aspects: (i) loss of cell dye, (ii) human embryonic stem cells and provides an alternative iPSC-AEC2 were replaced by endogenous progenitor source of cells that can be used as donor cells for cell cells, or (iii) the cells were not engrafted and the positive therapy. Alternatively, iPSC banks from HLA homolo- effects were due to a paracrine effect. In agreement with gous donors could provide HLA-matched lung cells that the latter scenario, it has been reported that the adminis- would involve minimal immune rejection of the grafted tration of conditioned medium from iPSC was able to cells. reduce the levels of inflammatory cytokines, chemokines, In conclusion, this a first study to transplant iPSC- and collagen deposition [33]. This warrants further in- AEC2 15 days after BLM instillation during the fibrotic vestigation in our model whether there is a real engraft- stage of the disease. We confirm that human iPSC- ment of the cells or if there is a paracrine effect of the derived AEC2 can acquire the AEC2 phenotype in vitro. transplanted cells. Intratracheal transplantation of iPSC-AEC2 is able to re- Another key challenge in the field of cell replacement duce pulmonary fibrosis when fibrosis has already devel- therapy strategy that must be addressed is the possibility oped, decreasing the amount of collagen by the of chromosomal mutations that would lead to the for- inhibition of both TGF-β and α-SMA expression. mation of tumors post-cell transplantation into the lung Abbreviations [34]. In our study, we did not observe any tumors in the IPF: Idiopathic pulmonary fibrosis; ECM: Extracellular matrix; AEC2: Alveolar transplanted lungs, albeit at a short time point after cell type II cells; AEC1: Alveolar type I cells; TGF-β: Transforming growth factor transplantation. Accordingly, other studies have also not beta; α-SMA: α-Smooth muscle actin; hAEC: Human amnion epithelial cells; Krt5: Keratin 5; BLM: Bleomycin; iPSC: Induced pluripotent stem cells; SP- found evidence of tumors in the lung, even after 12 C: Surfactant protein C; SP-A: Surfactant protein A; MW: Multi-well cell culture months of iPSC-AEC2 transplantation [31]. plate; BDM: Basal differentiation media; FGF10: Fibroblast growth factor-10; Although our protocol for cell differentiation from KGF: Keratinocyte growth factor; BMP4: Bone morphogenetic protein-4; MC_BF: Multi-Channel_Bright Field; MC_CFDA: Channel_Vybrant™ Cell iPSC into AEC2 has been effective with high efficiency, Fluorescent Dye; MC: Multi-Channel it is important to develop further a protocol where the differentiation will be fully efficient. Our iPSC differenti- Acknowledgements RT-PCR experiments for iPSC-AEC2 differentiation were run at Genetic Foren- ated into AEC2 did not fully resemble endogenous lung sics Laboratory (Hospital Clinic, UB) by Dr. Carme Barrot. We thank the Unit- AEC2 by expression of some specific gene markers, in Cytomics Platform of the Institut d’Investigacions Biomèdiques August Pi I particularly SP-C expression levels. Further development Sunyer (IDIBAPS) for the technical help. of the protocol and niche mimicking, which might only Authors’ contributions be achieved inside the lung architecture, is warranted. Conception and design: BAP, ASM, and MJE. Analysis and interpretation: BAP, Reaching the full mature phenotype is hard to achieve LISL, MJE, and ASM. Drafting the manuscript for important intellectual because it may demand using lung niche mimicking content: BAP, YM, MJE, and ASM. Funding: YM, MJE, and ASM. The authors read and approved the final manuscript. strategies such as (i) architecture, (ii) a dynamic fluid flow, or (iii) transplantation in vivo. Possible modifica- Funding tions of the protocol to improve the maturation could This work was supported by a grant (076/2016) from SEPAR (Spanish Respiratory Society). MJE supported in part by the Program Ramon y Cajal potentially use 3D gels or exposing the AEC2 to an air- (RYC-2010-06512), University of Barcelona Talent Retention program, MINECO liquid interphase in the final part of the differentiation project grant BFU2011-26596, BFU2014-54467-P, TV3 Marato project protocol. For example, the group of Kotton has designed FBG309768. YM funding FBG project 307900. 3D alveolospheres that are found to outperform 2D cul- Availability of data and materials tures in AEC2 differentiation and functionality [24]. All the data supporting the findings will be made public and can be shared However, we considered that for the purpose of trans- by contacting the corresponding authors ASM and MJE. plantation, single cells would be better to reach the thin Ethics approval and consent to participate passages of alveoli. This warrants future work to define Animal ethics has been approved and for endogenous human lung cells and using 3D lung structures in future studies to develop (ASM group). All authors approved the final version of the article. advanced iPSC-AEC2 stem cell replacement therapy to Consent for publication treat lung disease. All authors consent for the publication of this manuscript. The manuscript There are multiple therapeutic applications of this does not contain any individual person’s data in any form (including any work. Our results indicate that iPSC-AEC2 is a promis- individual details, images, or videos). ing new advanced cell therapy because the isolation of Competing interests lung stem/progenitor AEC2 from the lung is a compli- The authors declare no competing interests. cated process with limited availability. The use of iPSC Author details differentiated to AEC2 is an easy and efficient approach 1 Banc de Sang i Teixits, Edifici Dr. Frederic Duran i Jordà, Passeig Taulat 116, for the lung cell-based therapy that allows for autologous 08005 Barcelona, Spain. 2Department of Experimental Pathology, Institut Alvarez-Palomo et al. Stem Cell Research & Therapy (2020) 11:213 Page 12 of 12 d’Investigacions Biomèdiques de Barcelona, Consejo Superior de 20. Zuo W, Zhang T, Wu DZ, Guan SP, Liew AA, Yamamoto Y, Wang X, Lim SJ, Investigaciones Científicas (IIBB-CSIC), Institut d’Investigacions Biomédiques Vincent M, Lessard M, Crum CP, Xian W, McKeon F. p63(+)Krt5(+) distal August Pi i Sunyer (IDIBAPS), Barcelona, Spain. 3Harry Perkins Research airway stem cells are essential for lung regeneration. Nature. 2015;517:616– Institute, Centre for Cell Therapy and Regenerative Medicine (CCTRM), 20. University of Western Australia, Perth, WA, Australia. 4Centro de Oftalmología 21. Huang SX, Islam MN, O'Neill J, Hu Z, Yang YG, Chen YW, Mumau M, Green Barraquer, Institut Universitari Barraquer, Universitat Autònoma de Barcelona, MD, Vunjak-Novakovic G, Bhattacharya J, Snoeck HW. Efficient generation of Barcelona, Spain. 5Victor Chang Cardiac Research Institute, Sydney, NSW, lung and airway epithelial cells from human pluripotent stem cells. Nat Australia. 6Centro de Investigaciones Biomédicas en Red de Enfermedades Biotechnol. 2014;32:84–91. Respiratorias (CIBERES), Madrid, Spain. 22. Wong AP, Chin S, Xia S, Garner J, Bear CE, Rossant J. Efficient generation of functional CFTR-expressing airway epithelial cells from human pluripotent Received: 5 February 2020 Revised: 20 April 2020 stem cells. Nat Protoc. 2015;10:363–81. Accepted: 11 May 2020 23. Ghaedi M, Mendez JJ, Bove PF, Sivarapatna A, Raredon MS, Niklason LE. Alveolar epithelial differentiation of human induced pluripotent stem cells in a rotating bioreactor. Biomaterials. 2014;35:699–710. References 24. Jacob A, Morley M, Hawkins F, Guttentag SH, Beers MF, Kotton DN. 1. Raghu G, Collard HR, Egan JJ, et al. ATS/ERS/JRS/ALAT Committee on Differentitation of human pluripotent stem cells into functional lung Idiopathic Pulmonary Fibrosis.An official ATS/ERS/JRS/ALAT statement: alveolar epithelial cells. Cell Stem Cell. 2017;21:472–88. idiopathic pulmonary fibrosis: evidence-based guidelines for diagnosis and 25. Banerjee ER, Laflamme MA, Papayannopoulou T, Kahn M, Murry CE, management. Am J Respir Crit Care Med 2011;183:788–824. Henderson WR Jr. Human embryonic stem cells differentiated to lung 2. Noble PW, Albera C, Bradford WZ, et al. Pirfenidone in patients with lineage-specific cells ameliorate pulmonary fibrosis in a xenograft transplant idiopathic pulmonary fibrosis (CAPACITY): two randomised trials. Lancet. mouse model. PLoS One. 2012;7:e33165. 2011;377:1760–9. 26. Woessner JFJR. The determination of hydroxyproline in tissue and protein 3. Richeldi L, Costabel U, Selman M, et al. Efficacy of a tyrosine kinase inhibitor samples containing small proportions of this imino acid. Arch Biochem in idiopathic pulmonary fibrosis. N Engl J Med. 2011;365:1079–87. Biophys. 1961;93:440–7. 4. Sisson TH, Mendez M, Choi K, et al. Targeted injury of type II alveolar 27. Podlesniy P, Trullas R. Absolute measurement of gene transcripts with epithelial cells induces pulmonary fibrosis. Am J Respir Crit Care Med. 2010; Selfie-digital PCR. Sci Rep. 2017;7:8328. 181:254–63. 28. Ghadiri M, Young PM, Traini D. Cell-based therapies for the treatment of 5. Korfei M, Ruppert C, Mahavadi P, et al. Epithelial endoplasmic reticulum idiopathic pulmonary fibrosis (IPF) disease. Expert Opin Biol Ther. 2016;16: stress and apoptosis in sporadic idiopathic pulmonary fibrosis. Am J Respir 375–87. Crit Care Med. 2008;178:838–46. 29. Serrano-Mollar A. Cell therapy in idiopathic pulmonary fibrosis(†). Med Sci 6. Thannickal VJ, Toews GB, White ES, et al. Mechanisms of pulmonary fibrosis. (Basel). 2018;13:2–18. Annu Rev Med. 2004;55:395–417. 30. Zhou Q, Ye X, Sun R, Matsumoto Y, Moriyama M, Asano Y, Ajioka Y, Saijo Y. 7. Crapo JD, Young SL, Fram EK, Pinkerton KE, Barry BE, Crapo RO. Differentiation of mouse induced pluripotent stem cells into alveolar Morphometric characteristics of cells in the alveolar region of mammalian epithelial cells in vitro for use in vivo. Stem Cells Transl Med. 2014;3:675–85. lungs. Am Rev Respir Dis. 1983;128:S42–6. 31. Jun D, Garat C, West J, Thorn N, Chow K, Cleaver T, Sullivan T, Torchia EC, 8. Chuquimia OD, Petursdottir DH, Periolo N, Fernández C. Alveolar epitelial Childs C, Shade T, et al. The pathology of bleomycin-induced fibrosis is cells are critical in protection of the respiratory tract by secretion of factors associated with loss of resident lung mesenchymal stem cells that regulate able to modulate the activity of pulmonary macrophages and directly effector T.-cell proliferation. Stem Cells. 2011;29:725–35. control bacterial growth. Infect Immun. 2013;81:381–9. 32. Soh BS, Zheng D, Yeo JSL, et al. CD166(pos) subpopulation from 9. Fehrenbach H. Alveolar epithelial type II cell: defender of the alveolus differentiated human ES and iPS cells support repair of acute lung injury. revisited. Respir Res. 2001;2:33–46. Mol Ther. 2012;20:2335–46. 10. Mason RJ. Biology of alveolar type II cells. Respirology. 2006;11:S12–5 33. How CK, Chien Y, Yang KY, Shih HC, Juan CC, Yang YP, Chiou GY, Huang PI, Review. Chang YL, Chen LK, et al. Induced pluripotent stem cells mediate the 11. King TE Jr, Pardo A, Selman M. Idiopathic pulmonary fibrosis. Lancet. 2011; release of interferon gamma-induced protein 10 and alleviate bleomycin- 378:1949–61. induced lung inflammation and fibrosis. Shock. 2013;39:261–70. 12. Sheppard D. Transforming growth factor beta: a central modulator of 34. Jeong JO, Han JW, Kim JM, et al. Malignant tumor formation after pulmonary and airway inflammation and fibrosis. Proc Am Thorac Soc. 2006; transplantation of short-term cultured bone marrow mesenchymal stem 3:413–7. cells in experimental myocardial infarction and diabetic neuropathy. Circ 13. Lu Q, El-Hashash AHK. Cell-based therapy for idiopathic pulmonary fibrosis. Res. 2011;108:1340–7. Stem Cell Investig. 2019;16(6):22. 14. Moodley Y, Ilancheran S, Samuel C, Vaghjiani V, Atienza D, Williams ED, Jenkin G, Wallace E, Trounson A, Manuelpillai U. Human amnion epithelial Publisher’s Note cell transplantation abrogates lung fibrosis and augments repair. Am J Springer Nature remains neutral with regard to jurisdictional claims in Respir Crit Care Med. 2010;182:643–51. published maps and institutional affiliations. 15. Serrano-Mollar A, Nacher M, Gay-Jordi G, Closa D, Xaubet A, Bulbena O. Intratracheal transplantation of alveolar type II cells reverses bleomycin- induced lung fibrosis. Am J Respir Crit Care Med. 2007;176:1261–8. 16. Guillamat-Prats R, Gay-Jordi G, Xaubet A, Peinado VI, Serrano-Mollar A. Alveolar type II cell transplantation restores pulmonary surfactant protein levels in lung fibrosis. J Heart Lung Transplant. 2014;33:758–65. 17. Serrano-Mollar A, Gay-Jordi G, Guillamat-Prats R, Closa D, Hernandez- Gonzalez F, Marin P, Burgos F, Martorell J, Sánchez M, Arguis P, et al. Safety and tolerability of alveolar type II cell transplantation in idiopathic pulmonary fibrosis. Chest. 2016;150:533–43. 18. Vaughan AE, Brumwell AN, Xi Y, Gotts JE, Brownfield DG, Treutlein B, Tan K, Tan V, Liu FC, Looney MR, Matthay MA, Rock JR, Chapman HA. Lineage- negative progenitors mobilize to regenerate lung epithelium after major injury. Nature. 2015;517:621–5. 19. Kumar PA, Hu Y, Yamamoto Y, Hoe NB, Wei TS, Mu D, Sun Y, Joo LS, Dagher R, Zielonka EM, Wang de Y, Lim B, Chow VT, Crum CP, Xian W, McKeon F. Distal airway stem cells yield alveoli in vitro and during lung regeneration following H1N1 influenza infection. Cell. 2011;147:525–38.