Since January 2020 Elsevier has created a COVID-19 resource centre with free information in English and Mandarin on the novel coronavirus COVID- 19. The COVID-19 resource centre is hosted on Elsevier Connect, the company's public news and information website. Elsevier hereby grants permission to make all its COVID-19-related research that is available on the COVID-19 resource centre - including this research content - immediately available in PubMed Central and other publicly funded repositories, such as the WHO COVID database with rights for unrestricted research re-use and analyses in any form or by any means with acknowledgement of the original source. These permissions are granted for free by Elsevier for as long as the COVID-19 resource centre remains active. Veterinary Microbiology 246 (2020) 108744 Contents lists available at ScienceDirect Veterinary Microbiology journal homepage: www.elsevier.com/locate/vetmic Activation of pro- and anti-inflammatory responses in lung tissue injury T during the acute phase of PRRSV-1 infection with the virulent strain Lena J.M. Sánchez-Carvajala,*, I.M. Rodríguez-Gómeza, I. Ruedas-Torresa, F. Larenas-Muñoza, I. Díazb, C. Revillac, E. Mateub,d, J. Domínguezc, G. Martín-Vallsd, I. Barrancoa, F.J. Pallarése, L. Carrascoa, J. Gómez-Lagunaa a Department of Anatomy and Comparative Pathology, Faculty of Veterinary Medicine, University of Córdoba, 14014, Córdoba, Spain b Institut de Recerca i Tecnologia Agroalimentàries - Centre de Recerca en Sanitat Animal (IRTA-CReSA), Campus de la Universitat Autònoma de Barcelona, 08193 Cerdanyola del Vallès, Spain c Department of Biotechnology, National Institute for Agricultural and Food Research and Technology (INIA), 28040, Madrid, Spain d Department of Animal Health and Anatomy, Faculty of Veterinary Medicine, Autonomous University of Barcelona, 08193, Bellaterra, Spain e Department of Anatomy and Comparative Pathology, Faculty of Veterinary Medicine, University of Murcia, 30100, Murcia, Spain A R T I C LE I N FO A B S T R A C T Keywords: Porcine reproductive and respiratory syndrome virus (PRRSV) plays a key role in porcine respiratory disease PRRSV-1 complex modulating the host immune response and favouring secondary bacterial infections. Pulmonary al- Virulent strains veolar macrophages (PAMs) are the main cells supporting PRRSV replication, with CD163 as the essential re- Lung lesion ceptor for viral infection. Although interstitial pneumonia is by far the representative lung lesion, suppurative Inflammatory response bronchopneumonia is described for PRRSV virulent strains. This research explores the role of several immune markers potentially involved in the regulation of the inflammatory response and sensitisation of lung to sec- ondary bacterial infections by PRRSV-1 strains of different virulence. Conventional pigs were intranasally in- oculated with the virulent subtype 3 Lena strain or the low virulent subtype 1 3249 strain and euthanised at 1, 3, 6 and 8 dpi. Lena-infected pigs exhibited more severe clinical signs, macroscopic lung score and viraemia as- sociated with an increase of IL-6 and IFN-γ in sera compared to 3249-infected pigs. Extensive areas of lung consolidation corresponding with suppurative bronchopneumonia were observed in Lena-infected pigs. Lung viral load and PRRSV-N-protein+ cells were always higher in Lena-infected animals. PRRSV-N-protein+ cells were linked to a marked drop of CD163+ macrophages. The number of CD14+ and iNOS+ cells gradually increased along PRRSV-1 infection, being more evident in Lena-infected pigs. The frequency of CD200R1+ and FoxP3+ cells peaked late in both PRRSV-1 strains, with a strong correlation between CD200R1+ cells and lung injury in Lena-infected pigs. These results highlight the role of molecules involved in the earlier and higher extent of lung lesions in piglets infected with the virulent Lena strain, pointing out the activation of routes potentially involved in the restraint of the local inflammatory response. 1. Introduction with virulent PRRSV-1 strains (Canelli et al., 2017; Karniychuk et al., 2010; Morgan et al., 2013, 2016; Ogno et al., 2019; Sinn et al., 2016; Porcine reproductive and respiratory syndrome virus (PRRSV) en- Weesendorp et al., 2013). Several contradictory results about viraemia, compasses two species, Betaarterivirus suid 1 and Betaarterivirus suid 2 tissue viral load, early virus clearance, low frequencies of PRRSV-spe- (formerly, PRRSV-1 and PRRSV-2, respectively) (Gorbalenya et al., cific IFN-γ secreting cells or PRRSV neutralizing antibodies have been 2018), which present a wide inter- and intra-species viral diversity reported after infection with PRRSV-1 virulent strains. However, there (Balka et al., 2018; Shi et al., 2010; Stadejek et al., 2017). Since 2006, is consensus on the fact that some strains are more virulent than others different outbreaks characterised by high morbidity and mortality rates, (Canelli et al., 2017; Ferrari et al., 2018; Frydas et al., 2013; Geldhof fever, haemorrhages, severe lesions in lung and, eventually, in other et al., 2012; Morgan et al., 2013; Renson et al., 2017; Stadejek et al., organs such as thymus or lymph nodes, have been reported associated 2017; Weesendorp et al., 2013, 2014). ⁎ Corresponding author. E-mail address: v42sancj@uco.es (J.M. Sánchez-Carvajal). https://doi.org/10.1016/j.vetmic.2020.108744 Received 8 April 2020; Received in revised form 29 May 2020; Accepted 31 May 2020 0378-1135/ © 2020 Elsevier B.V. All rights reserved. J.M. Sánchez-Carvajal, et al. Veterinary Microbiology 246 (2020) 108744 PRRSV replicates predominantly in the lung, causing a mild to se- 2. Materials and methods vere interstitial pneumonia which may be complicated to suppurative bronchopneumonia due to the increased lung sensitisation to bacterial 2.1. Porcine reproductive and respiratory syndrome strains infections associated with the damage and impairment of the different pulmonary macrophage subpopulations (pulmonary alveolar macro- The low virulent 3249 strain (subtype 1 PRRSV-1) was isolated from phages, PAMs; pulmonary intravascular macrophage, PIMs; and inter- the serum of a piglet with pneumonia from a PRRSV-positive herd lo- stitial macrophages) (Brockmeier et al., 2017; Thanawongnuwech cated in Spain in 2005 (Gimeno et al., 2011). The virulent Lena strain et al., 2000). PAMs are the main cellular target of PRRSV, although (subtype 3 PRRSV-1) is considered as the prototype of PRRSV-1 virulent interstitial and intravascular macrophages can be infected too (Bordet strains. Lena strain isolation was performed from lung homogenates et al., 2018; Duan et al., 1997; Gómez-Laguna et al., 2010), with the obtained from weak born piglets from a PRRSV-positive herd from nucleocapsid protein N (PRRSV-N-protein) as the most abundant viral Belarus in 2007 with a high mortality rate, reproductive failure and protein during PRRSV infection (Rowland et al., 1999). PAMs express respiratory disorders (Karniychuk et al., 2010). Viral stocks were pro- high levels of CD163 scavenger receptor (Sánchez et al., 1999; Van duced from the 4th passage of each strain on PAMs, titrated by means of Gorp et al., 2008) which is essential to support PRRSV internalisation immunoperoxidase monolayer assay and expressed as tissue culture and disassembly interacting with GP2 and GP4 viral proteins (Burkard infectious doses 50 (TCID50)/mL (3249 strain: 105.79 TCID50/mL; Lena et al., 2017; Das et al., 2010; Whitworth et al., 2016). A soluble form of strain: 105.66 TCID50/mL). CD163 (sCD163), that may be released from tissue macrophages and monocytes, has been identified in plasma as potential biomarker for 2.2. Animals and experimental design macrophage activity and inflammation (Costa-Hurtado et al., 2013; Møller, 2012; Pasternak et al., 2019). The animals and samples used in this study were part of a project to PRRSV is known to modulate the host immune response by inducing investigate the pathogenesis of the infection with PRRSV-1 strains of changes in the frequencies of immune cell subsets in blood (Dwivedi different virulence (Rodríguez-Gómez et al., 2019). Briefly, fifty-two 4- et al., 2012; Ferrari et al., 2018; Morgan et al., 2013; Weesendorp et al., week-old male and female piglets (Landrace x Large White crossbred) 2013) and in tissues (Gómez-Laguna et al., 2010; Rodríguez-Gómez were obtained from a historically PRRSV-negative farm. All pigs were et al., 2013), leading to an enhanced susceptibility to secondary bac- negative for porcine circovirus type 2 (PCV2), PRRSV and Mycoplasma terial infections (Karniychuk et al., 2010; Renson et al., 2017; Sinn hyopneumoniae by ELISA and PCR assays (Mattsson et al., 1995; Sibila et al., 2016). An early decrease in the frequency of monocytes, NK cells et al., 2004). or cytotoxic T cells linked to a strong inflammatory response in target Piglets were blocked by weight and sex and randomly assigned to organs has been described upon experimental infection with PRRSV-1 three different groups and housed in separate pens: Lena group virulent strains (Ferrari et al., 2018; Morgan et al., 2013; Weesendorp (n = 20), 3249 group (n = 20) and control group (n = 12). After an et al., 2013; 2014). In addition, some studies indicate an early over- acclimation period of seven days, piglets were intranasally inoculated production of pro-inflammatory cytokines, such as IFN-γ, IL-1β or IL-8, with either the low virulent 3249 strain or the virulent Lena strain (both as the main source of pulmonary injury after infection with virulent used at 1 × 105 TCID50/mL, 1 mL/nostril, using the MAD Nasal™ PRRSV-1 strains (Amarilla et al., 2015; Morgan et al., 2013; Renson Intranasal Mucosal Atomization Device, Teleflex, Alcalá de Henares, et al., 2017; Weesendorp et al., 2014). Nevertheless, other potential Madrid, Spain). The control group was mock-inoculated with the PAM mechanisms, such as an imbalance among pro- and anti-inflammatory supernatant diluted with RPMI similarly to the inoculum. Three control responses, might predispose to secondary infections contributing to the pigs and five infected pigs from each group were euthanised on days 1, onset of the porcine respiratory disease complex (PRDC) (Gómez- 3, 6 and 8 post-inoculation (dpi). This experiment was conducted ac- Laguna et al., 2013; Van Gucht et al., 2004). cording to the guidelines of the European Union (Directive 2010/63/ In this context, overproduction of nitric oxide (NO), mainly trig- EU) and approved by the IRTA Ethics Committee and by the Catalan gered by inducible NO synthase (iNOS) (Akaike and Maeda, 2000), or Autonomous Government (Project 3647; FUE-2017-00533413). upregulation of CD14, as the primary lipopolysaccharide (LPS) receptor (Zanoni and Granucci, 2013), could contribute to lung inflammation 2.3. Clinical signs, gross pathology and histopathology of lung upon infection with PRRSV (Chen et al., 2014; Lee and Kleiboeker, 2005; Van Gucht et al., 2004, 2005; Yan et al., 2017). By contrast, the Commencing 1 day prior to inoculation, piglets were daily mon- transcription factor forkhead box protein 3 (FoxP3), is an essential itored to evaluate clinical signs (liveliness, respiratory symptoms and transcription factor for the development of regulatory T cells (Tregs) anorexia) and rectal temperature. Quantification of clinical signs was and hence, a useful marker to detect them. This subset could be in- performed by applying the following clinical score: liveliness (score 0, volved in supressing the activation of other T-cell populations (Käser no abnormalities; score 1, reduced liveliness but with response to ex- et al., 2008). CD200 receptor 1 (CD200R1), expressed on myeloid cells ternal stimuli; score 2, pig prostration; score 3, agonic pig); respiratory and B cell subsets (Poderoso et al., 2019), is an inhibitory surface re- symptoms (score 0, no abnormalities; score 1, mild dyspnoea; score 2, ceptor that might deliver inhibitory signals dampening the activation of evident dyspnoea; score 3, evident dyspnoea with tachypnoea; score 4, cells which express it (Vaine and Soberman, 2014). Thus, both immune evident dyspnoea, tachypnoea and cyanosis); and anorexia (score 0, markers might play an important role inhibiting the production of pro- eating without abnormality; score 1, sporadic frequency of eating; score inflammatory cytokines (Elmore et al., 2014; Nedumpun et al., 2018; 2, no eating). The sum of these scores represented the total clinical Singh et al., 2019; Vaine and Soberman, 2014; Wang et al., 2018), score per animal and per day. Rectal temperatures > 40.5 °C were lessening the exuberant lung injury observed with virulent PRRSV-1 considered hyperthermia. At necropsy, gross lung lesions were recorded strains. Whereas all these markers may play a key role in PRRSV and scored by the same pathologist (Halbur et al., 1996). Afterwards, virulence, there are scarce studies analysing their role in the context of samples from apical, medial and caudal lobes from the right lung were the lung lesion. Therefore, the systemic immune response and im- collected and fixed in 10 % neutral-buffered formalin (Fisher Scientific munopathology of lung are evaluated in this study with the goal of Ltd., Loughborough, UK) for histopathological and im- exploring the role of selected immune markers in the pro- and anti- munohistochemical studies. inflammatory priming of the lung to secondary bacteria after infection Four-micron tissue sections were stained with haematoxylin and with a virulent PRRSV-1 strain (subtype 3, Lena strain) in comparison eosin and blindly graded by two pathologists for the histopathological with a low virulent PRRSV-1 strain (subtype 1, 3249 strain). evaluation. The severity of histopathological lesions in the lung was scored as previously described by Halbur et al. (1996): 0, no 2 J.M. Sánchez-Carvajal, et al. Veterinary Microbiology 246 (2020) 108744 Table 1 Summary of immunohistochemical methodology. Specificity Type of antibodies Clone Source Blocking solution Dilution Antigen retrieval PRRSV-N- protein mAb SDOW17 Rural Technologies, Brookings, SD, USA BSA 2 % 1:500 Protease XIV CD163 mAb 2A10/11 In house, INIA NGS 10 % neat Citrate pH 6 CD200R1 mAb PCT3 In house, INIA BSA 2 % neat Protease XIV CD14 mAb MIL2 Biorad, Hercules, CA BSA 2 % 1:100 Protease XIV iNOS pAb NA Neomarers, Fremont, CA, USA BSA 2 % 1:750 Citrate pH 6* FoxP3 mAb FJK-16s eBioscience™, Bacelona, Spain NGS 10 %** 1:100 Citrate pH 6* PRRSV, Porcine reproductive and respiratory syndrome virus; CD200R1, CD200 Receptor 1; iNOS, inducible nitric oxide synthase; FoxP3, forkhead box protein 3; mAb, monoclonal antibody; pAb, polyclonal antibody; BSA, Bovine Serum Albumin; NGS, Normal Goat Serum; NA, not applicable; Citrate pH 6, microwave heat treatment at 420 W for 10 min; Protease XIV, enzymatic digestion with protease type XIV (Sigma-Aldrich) at 38 °C for 8 min; Citrate pH 6*, autoclave treatment at 121 °C for 10 min; NGS 10 %**: NGS diluted in phosphate buffer saline with 10 % tween 20. microscopic lesions; 1, mild interstitial pneumonia; 2, moderate mul- X3 ELISA test (IDEXX laboratories, Barcelona, Spain) following manu- tifocal interstitial pneumonia; 3, moderate diffuse interstitial pneu- facturer’s instructions. Levels of IFN-γ, IL-6 and IL-10 and the acute monia; and 4, severe interstitial pneumonia. In addition, a similar score phase protein lipopolysaccharide binding protein (LBP) as well as the was developed considering the diagnosis of suppurative bronchopneu- soluble form of swine CD163 (sCD163) were assessed in sera from all monia (Rodríguez-Gómez et al., 2019): 0, no microscopic lesions; 1, piglets. Different commercially available ELISA tests were used in ac- mild bronchopneumonia; 2, moderate multifocal bronchopneumonia; cordance with manufacturer’s guidelines (IFN-γ, IL-6, IL-10 [Invitrogen, 3, moderate diffuse bronchopneumonia; and 4, severe bronchopneu- Barcelona, Spain]; LBP, [Hycult Biotech, Uden, Netherlands]; sCD163 monia. Altogether, the final score included the total of both, the in- [Cusabio Biotech, Houston, USA]). Results were expressed in pg/mL for terstitial pneumonia score and the bronchopneumonia score, being 8 IFN-γ, IL-6 and IL-10, and ng/mL for LBP and sCD163. The minimum points the maximum possible score. detectable concentrations were 2 pg/mL for IFN-γ, 45 pg/mL for IL-6, 3 pg/mL for IL-10, 1.6 ng/mL for LBP and 23.4 ng/mL for sCD163. 2.4. Viral genome quantification 2.6. Immunohistochemistry in lung tissue RNA was isolated from sera using NucleoSpin® RNA virus (Macherey-Nagel, Düren, Germany) according to manufacturer’s in- Four-micron sections from lung were dewaxed in xylene and rehy- structions. For lung, RNA was purified from tissue homogenate using a drated in descending grades of alcohol until distilled water. Then, en- combined procedure with TRIzol™ (Thermo Fisher Scientific, dogenous peroxidase inhibition was performed in a 3 % H2O2 solution Barcelona, Spain) and NucleoSpin® RNA Virus columns (Macherey- in methanol for 30 min. Epitope demasking, primary antibodies dilu- Nagel) according to manufacturer’s instructions. Viral load for either tions and blocking of non-specific binding are detailed in Table 1. 3249 strain or Lena strain was quantified by RT-qPCR using VetMAX™ Monoclonal primary antibodies were incubated overnight at 4 °C in a PRRSV EU/NA 2.0 kit (Thermo Fisher Scientific, Barcelona, Spain). humid chamber. Polyclonal goat anti-mouse immunoglobulins (Agilent Amplifications were performed in duplicate from each animal in the Technologies, Madrid, Spain) or polyclonal goat anti-rabbit im- QuantStudio 5 Real-time PCR System (Thermo Fisher Scientific) for munoglobulins (Vector laboratories, USA) biotinylated secondary an- 5 min (min) at 50 °C, 10 min at 95 °C followed by 40 cycles of 3 s (s) at tibodies were accordingly incubated for 30 min at room temperature. 95 °C and 30 s at 60 °C. PRRSV RNA quantification was performed using After washing in PBS, Avidin–Biotin–Peroxidase complex technique specific primers of the target gene (Lena strain ORF7: forward primer (ABC Vector Elite, Vector laboratories, USA) was applied and the im- AGCGCCAATTCAGAAAGAAA, reverse primer TGGATCGATTGCAGAC munolabelling was revealed by application of NovaRED™ substrate kit AGAG; 3249 strain ORF7: forward primer GGCAAACGAGCTGTTAA (Vector Laboratories). Sections were counterstained with Harris’s hae- ACG, reverse primer AATTTCGGTCACATGGTTCC; Darwich et al., matoxylin, dehydrated and mounted. PBS (pH 7.4) and Tris buffered 2011). The ORF7 RT-PCR product from both 3249 and Lena strains was saline (pH 7.6) were used as wash and diluent buffers, respectively. firstly EtOH precipitated and purified using ExoSAP-ITTM (Thermo Antibody specificity was verified by exchanging the primary antibody Fisher Scientific, Barcelona, Spain). The purified products were quan- by isotype matched reagents of irrelevant specificity. One negative tified using BioDrop (BioDrop, UK). Serial 10-fold dilutions of 3249 or control which consisted of replacement of the primary antibody by BSA Lena ORF7 RT-PCR products with known quantities, ranging from 108 blocking solution was included in each immunohistochemical assay to to 102 genomic copies/mL were used as standards to generate a stan- rule out non-specific bindings. dard curve and, therefore, to determine the PRRSV genomic copies in sera and lung. The RT-qPCR efficiency (E) was estimated for each strain 2.7. Immunohistochemistry cell counting by a linear regression model. The E value was calculated from the slope of the standard curve according to equation: E = 10(−1/slope) -1. Also, a The number of immunolabelled cells was quantified in 25 non- set of eight serial 10-fold dilutions of know TCID50/mL (starting from overlapping selected high magnification fields of 0.2 mm2 (Olympus 106 TCID50/mL) was included in order to determine a relation between BX51, Olympus Iberia SAU, L’Hospitalet de Llobregat, Barcelona, Ct-values, genomic copies/mL and TCID50/mL. An inter-run calibrator Spain) and expressed as the mean of the score for each animal per mm2. sample with a known number of PRRSV copies was introduced in each Labelled cells were morphologically identified by differentiating among experiment to self-control inter-run variation. The area under the curve PAMs, PIMs and interstitial macrophages. (AUC) for viremia and lung viral load was calculated using the trape- zoidal approach (Greenbaum et al., 2001). Results of viral load in sera 2.8. Statistical analyses and lung are showed in equivalent TCID 50 (eq TCID50) per mL. Differences between groups were evaluated for approximate nor- 2.5. Antibody and serological assessments mality of distribution by the D’Agostino and Pearson omnibus nor- mality test followed by the Mann Whitney’s U non-parametric mean Specific antibodies against PRRSV were detected using IDEXX PRRS comparisons test. Correlation coefficients were assessed by the 3 J.M. Sánchez-Carvajal, et al. Veterinary Microbiology 246 (2020) 108744 Fig. 1. Clinical signs score, macroscopic and microscopic lung outcomes. Clinical signs and temperature were recorded from 1 day prior to infection until 8 dpi to evaluate clinical signs and hyperthermia (> 40.5 °C). Plots show the mean average of clinical signs score (A) and rectal temperature (B) for control group (gray circles), 3249-infected group (green triangle) and Lena-infected group (red diamonds). “a” indicates a significant difference between the Lena and 3249 and control groups, “b” a significant difference between the Lena and 3249 groups and “c” a significant difference between the 3249 and control groups. P value lower than 0.05 was considered statistically significant and represented as * P ≤ 0.05, ** P ≤ 0.01 and *** P ≤ 0.001. Days post-inoculation, dpi. (C) At necropsy, lungs were scored and processed for histological and immunohistochemical studies. Box plots display the macroscopic lung score for each group (control, gray circles; 3249, green triangles; Lena, red diamonds) for each time point. P value lower than 0.05 was considered statistically significant and represented as * P ≤ 0.05, ** P ≤ 0.01 and *** P ≤ 0.001. Days post-inoculation, dpi. (D) Lung appearance of piglets from the control, 3249 and Lena group at 8 dpi are shown in the pictures. (E) Box plots show the microscopic lung score for each group (control, gray circles; 3249, green triangles; Lena, red diamonds) for each time point. Each symbol represents individual data for each pig. P value lower than 0.05 was considered statistically significant and represented as * P ≤ 0.05, ** P ≤ 0.01 and *** P ≤ 0.001. Days post-inoculation, dpi. (F) Photomicrographs of the medial lung lobe illustrate characteristic interstitial pneumonia in a representative 3249-infected pig (left) and suppurative bronchopneumonia in a representative Lena-infected pig (right) at 8 dpi. Haematoxylin and eosin. Bar, 100 μm. Spearman and Pearson tests and were considered relevant with r > 0.6 3. Results and P < 0.05. Data analyses and figures were performed by using GraphPad Prism 7.0 software (GraphPad Prism software 7.0, Inc., San 3.1. Acute suppurative bronchopneumonia and the highest rectal Diego, CA, USA) and InkScape 0.92 software. A P value lower than 0.05 temperature and clinical signs score were observed in Lena-infected pigs was considered statistically significant and represented as * P ≤ 0.05, ** P ≤ 0.01 *** P ≤ 0.001 and **** P ≤ 0.0001. Clinical observations and gross pathology of lung were described thoroughly by Rodríguez-Gómez et al. (2019). In brief, piglets in- oculated with virulent Lena strain had a long period of hyperthermia (mean rectal temperature above 40.5 °C) with marked clinical signs score from 4 dpi onwards, both peaking at 6 dpi (Fig. 1A-B, clinical signs score and temperature). By contrast, an increase in rectal 4 J.M. Sánchez-Carvajal, et al. Veterinary Microbiology 246 (2020) 108744 Statistical correlations found in piglets infected with virulent Lena strain throughout the study. For all data, a P value lower than 0.05 was considered statistically significant and represented as * P ≤ 0.05, ** P ≤ 0.01, temperature below the hyperthermic threshold accompanied by mild 0.52* iNOS NS NS NS NS NS NS NS NS NS NS NS NS clinical signs was observed in piglets infected with 3249 strain (Fig. 1A- – B). At necropsy, tan-mottled areas, atelectasis, rubbery consistency, and 0.84*** consolidated areas were observed in the lungs from both PRRSV-1-in- 0.55* CD14 fected pigs whose macroscopic lung score gradually increased NS NS NS NS NS NS NS NS NS NS – throughout the study (Fig. 1C-D). In particular, a stronger and earlier onset of the lung lesion (from 6 dpi onwards) associated with the pre- 0.70** FoxP3 sence of extensive consolidated areas in apical and medial lobes as well NS NS NS NS NS NS NS NS NS NS – as more severe interstitial pneumonia were observed in Lena-infected pigs causing the highest macroscopic lung score compared to 3249-in- CD200R1 0.91**** −0.63** fected pigs (Fig. 1C-D). 0.73*** 0.63** 0.61** 0.63** 0.56* A mild to moderate interstitial pneumonia with thickening of the NS NS NS – alveolar septa by infiltrate of lymphocytes and macrophages was caused by both Lena and 3249 strains (Fig. 1E-F). Furthermore, a suppurative −0.78*** −0.71*** −0.62** bronchopneumonia characterised by neutrophils, cell debris and mucus CD163 filling the bronchial, bronchiolar and alveolar lumen was observed in NS NS NS NS NS NS – lung section from Lena-infected pigs at 6 and 8 dpi (Fig. 1E-F). A strong statistical correlation was found among temperature, clinical signs PRRSV-N-protein score, macroscopic and microscopic lung scores in Lena-infected pigs (Table 2). 0.78**** 0.78**** 0.85**** 0.74** 0.68** 0.62* 0.55* 3.2. Viraemia and lung viral load followed a similar kinetics in PRRSV-1- NS – infected pigs Microscopic lesion Viraemia and lung viral load were determined by RT-qPCR (effi- ciency of 99 %; slope = 3.34; detection limit: 1 copy/μl; slope-inter- 0.75**** cept = 39.5; and high linearity, r = 0.99). All animals were negative by 0.64** 0.62** 0.68** 0.8*** NS: not statistically significant or with r < 0.6. Correlation coefficients were considered relevant with r > 0.6 and P < 0.05. 0.62* RT-qPCR at day 0 and control pigs remained so all throughout the ex- NS periment. In sera, four out of five 3249-infected pigs and all Lena-in- – fected pigs were PRRSV positive as early as 1 dpi. Viraemia was always Gross lesion higher in Lena- than in 3249-infected pigs from 1 to 8 dpi (P < 0.01 at 0.72*** 0.62** 0.68** 1, 3, 6 dpi; P < 0.05 at 8 dpi), reaching the highest viral load at 6 dpi (1.9 × 107 eq TCID50/mL). The AUC for viremia (mean) in Lena and NS NS NS – 3249 group were 44.8 and 33.8 respectively (Fig. 2A). The viral load in the lung displayed a similar kinetics to that of serum for both infected IL-6 NS NS NS NS NS – groups, reaching the maximum lung viral loads at 6 dpi in Lena group (1.6 × 107 eq TCID50/mL), whereas 3249 group peaked at 8 dpi 0.72*** 0.71*** (1.9 × 106 eq TCID50/mL) (Fig. 2B). By contrast to sera, PRRSV-1 was 0.71** 0.67* IFN-γ just detected in lung in two out of five animals in both infected groups – at 1 dpi, being positive all infected piglets from 3 dpi onwards. The AUC for lung viral load (mean) in Lena group was 45 and 36.2 for 3249 Lung viral Load group (Fig. 2B). In Lena infected-group the statistical analysis revealed 0.76**** 0.72**** 0.77**** a positive correlation among viraemia, lung viral load, temperature, clinical signs score and the number of PRRSV-N-protein+ cells in the lungs (Table 2). A correlation among lung viral load and viraemia and – PRRSV-N-protein+ cells was also observed in 3249-infected pigs Viraemia 0.79**** 0.84**** (r = 0.71, P < 0.0001; and, r = 0.60, P < 0.005, respectively). – 3.3. A significant increase in the serum concentration of IFN-γ was observed Clinical score in Lena-infected pigs when compared with 3249-infected pigs 0.92**** PRRSV-specific antibodies were first detected at 8 dpi in sera from both PRRSV-1-infected groups (non-significant differences in S/P ra- – tios) (data not shown). A significant increase in IFN-γ serum levels was *** P ≤ 0.001 and ****P ≤ 0.0001. Temperature detected after Lena infection at 6 and 8 dpi (maximum mean level of 234 ± 100 pg/mL at 6 dpi) compared to control (P < 0.05) and 3249 (P < 0.01) groups (Fig. 2C). Maximum IL-6 levels in serum of 3249 group were observed at 6 dpi (mean of 350 ± 220 pg/mL), whereas – pigs belonging to Lena group reached the highest IL-6 levels at 8 dpi Clinical signs score Microscopic lesion (mean of 480 ± 50 pg/mL) (Fig. 2D). IL-10, LBP or sCD163 were not PRRSV-N-protein Lung viral load detected in serum samples from both control and infected groups Temperature Gross lesion throughout the study. Both viraemia and lung viral load displayed a CD200R1 Viraemia positive statistical correlation with IFN-γ levels, which in turn were also Table 2 CD163 FoxP3 CD14 IFN-γ iNOS IL-6 correlated with temperature and the clinical signs score in Lena in- fected-pigs (Table 2). 5 J.M. Sánchez-Carvajal, et al. Veterinary Microbiology 246 (2020) 108744 Fig. 2. PRRSV viraemia, lung viral load, IFN-γ and IL-6 level in sera. PRRSV viral load was quantified in sera (A) and lung (B) by RT-qPCR. The concentration of IFN-γ (C) and IL-6 (D) were assessed in sera by using ELISA. Diagrams (A) and (B) display the viral load (eq TCID50/mL) and (C) and (D) the concentration of the cytokines IFN-γ (pg/mL) and IL-6 (pg/mL), respectively, for each group (control, gray circles; 3249, green triangles; Lena, red diamonds) and time point. All data are reported as the mean with range of results obtained for each group and time point. P value lower than 0.05 was considered statistically significant and represented as * P ≤ 0.05 and ** P ≤ 0.01. “a” indicates a significant difference between the Lena and 3249 and control groups and “b” a significant difference between the 3249 and control groups. Days post-inoculation, dpi. 3.4. The increase in the number of PRRSV-N-protein+ cells was associated 3.5. A strong influx of CD14+ macrophages and monocytes infiltrating the with a decrease of CD163+ macrophages in the lung of PRRSV-infected pigs interstitium was detected in Lena-infected pigs The labelling of PRRSV-N-protein was mainly observed in PAMs and The labelling against CD14 was mainly observed in the cell mem- in a lesser extent in interstitial and intravascular macrophages (Fig. 3A- brane and cytoplasm of monocytes, interstitial and intravascular mac- B). In Lena-infected pigs, clusters of PRRSV-N-protein+ macrophages rophages and, occasionally, in PAMs (Fig. 4A-B, insets). Whereas no were observed within foci of bronchopneumonia at 6 and 8 dpi (Fig. 3B changes were observed in the number of CD14+ cells in the control inset). A progressive increase in the number of PRRSV-N-protein+ cells group along the study, a gradual increase with maximum expression at was detected throughout the study in both PRRSV-1-infected groups, 8 dpi was detected in both infected groups (Fig. 4E). Lena-infected pigs reaching a peak at 6 and 8 dpi in Lena and 3249-infected piglets, re- showed the highest frequency of CD14+ cells when compared to con- spectively. This increase was significantly higher in Lena than in 3249 trol animals (P < 0.01) in association with the presence of suppurative group (P < 0.05 at 3, 6 and 8 dpi) (Fig. 3E, primary axis). No positive bronchopneumonia (Fig. 4B). CD14+ interstitial and intravascular cells were detected in control pigs. macrophages were observed infiltrating extensive areas of the inter- CD163 immunolabelling was detected in the cell membrane and stitium, whereas almost no CD14+ cells were present in the bronchial cytoplasm of PAMs, interstitial macrophages and, occasionally, in- wall and alveolar lumen. Interestingly, the number of CD14+ cells in travascular macrophages (Fig. 3C-D, insets). A drop in the number of Lena-infected piglets displayed a strong positive correlation with the CD163+ cells was observed from 3 to 8 dpi in both PRRSV-1-infected concentration of IL-6 in sera (Table 2). groups. This decrease was more intense in Lena-infected animals when compared to 3249 (P < 0.05 at 3 dpi) and control groups (P < 0.05 at 3 and 8 dpi) (Fig. 3E, secondary axis). By contrast, the frequency of 3.6. Lena virulent strain induced a strong increase of iNOS+ cells associated CD163+ cells remained constant in control pigs during the whole study. with a higher microscopic lung lesion Of note, PAMs were the subset of pulmonary macrophages which un- derwent the strongest reduction in the number of CD163+ cells. Fur- The granular intracytoplasmic immunostaining of iNOS was pri- thermore, the frequency of CD163+ cells showed a strong negative marily observed in PAMs and interstitial macrophages in foci of inter- correlation with lung viral load and the number of PRRSV-N-protein+ stitial pneumonia and bronchopneumonia (Fig. 4C-D). The number of cells in Lena infected-pigs (Fig. 3E) (Table 2). iNOS+ cells followed a similar kinetics in both PRRSV-1-infected groups, with a progressive increase from 6 dpi onwards, reaching a significant increase by the end of the study (8 dpi) in Lena-infected pigs compared to 3249 (P < 0.01) and control groups (P < 0.05) (Fig. 4F). 6 J.M. Sánchez-Carvajal, et al. Veterinary Microbiology 246 (2020) 108744 Fig. 3. Immunohistochemical expression of PRRSV-N-protein and CD163 in lung tissue. Lung tissue sections were immunolabelled for both antigens. Photomicrographs of the medial lung lobe illustrate the expression of PRRSV-N- protein in a 3249-infected (A) and Lena-in- fected (B) pig, which was mainly observed in PAMs (3A-3B, insets). IHC. Bar, 100 μm. Photomicrographs of the medial lung lobe il- lustrate the expression of CD163 in a re- presentative control (C) and Lena-infected (D) pig. Immunolabelling of CD163 scavenger re- ceptor was mainly observed in the cytoplasm and cell surface of PAMs found in the pul- monary alveolus and in a lesser extent in in- terstitial and intravascular macrophages (3C- 3D, insets). IHC. Bar, 50 μm. (E) The diagram displays the number of PRRSV-N-protein+ (primary axis) and CD163+ (secondary axis) cells/mm2. Scatter dot plot shows the number of CD163+ macrophages (secondary axis) for each animal (control, gray circles; 3249, green triangles; Lena, red diamonds) and coloured lines the average for each group and time point. Control baseline displays the mean of the number of positive cells along the study in control group. P value lower than 0.05 was considered statistically significant and re- presented as * P ≤ 0.05 and ** P ≤ 0.01. The grey bars display the average of total number of PRRSV-N-protein+ macrophages (primary axis) for each group and time point. “a” in- dicates a significant difference between the Lena and 3249 groups. Days post-inoculation, dpi. 3.7. The increase of CD200R1+ cells along the study was highly correlated animals (P < 0.05). with the course of lung injury 4. Discussion CD200R1 labelling was detected in the cytoplasm of intravascular and interstitial macrophages located inside or surrounding bronch- PRRSV plays a pivotal role in PRDC, modulating the host immune opneumonia foci, with occasional expression in PAMs and monocytes response and favouring secondary bacterial infections (Gómez-Laguna (Fig. 5A-B, insets). Whereas the number of CD200R1+ cells sig- et al., 2013; Van Gucht et al., 2004). Virulent PRRSV-1 strains cause nificantly increased in Lena-infected pigs at 6–8 dpi (P < 0.05 at 6 dpi more severe clinical signs, higher mortality rates as well as marked lung with respect to 3249 group; and P < 0.01 at 6 dpi and P < 0.05 at 8 injury with a higher incidence of bronchopneumonia as opposed to low dpi with respect to control group), this increase was just detected at 8 virulent strains (Amarilla et al., 2015; Canelli et al., 2017; Frydas et al., dpi in 3249-infected pigs (P < 0.05 with respect to control group) 2013; Gómez-Laguna et al., 2010; Morgan et al., 2013; Renson et al., (Fig. 5E, primary axis). Control animals presented a scarce number of 2017; Rodríguez-Gómez et al., 2019; Stadejek et al., 2017; Weesendorp CD200R1+ cells along the study. For Lena infected-pigs a strong posi- et al., 2013). Accordingly, we hypothesise that severe pulmonary le- tive correlation was observed among the frequency of CD200R1+ cells sions observed along infection with virulent PRRSV-1 strains might be and the microscopic lung lesions (Fig. 5E) (Table 2). associated with a higher decrease in the amount of PAMs as well as an imbalance between anti- and pro-inflammatory responses with different 3.8. Both PRRSV-1 strains induced an increase of FoxP3+ cells at 6–8 dpi molecules potentially involved in this process. As previously described (Renson et al., 2017; Weesendorp et al., FoxP3 yielded a nuclear immunolabelling in lymphocytes mainly 2013), severe systemic and respiratory symptoms as well as hy- located in areas of atelectasis and interstitial pneumonia (Fig. 5C-D, perthermia were observed in animals infected with virulent Lena strain, insets). Although two Lena-infected pigs exhibited a higher number of whereas low virulent 3249 strain only caused mild clinical signs and a FoxP3+ cells at 1 dpi, the kinetics of positive cells for this immune slightly increase of rectal temperature. Furthermore, virulent Lena markers showed a gradual increase along the study in both Lena- and strain caused an earlier and stronger onset of lung lesions due to ex- 3249-infected animals, reaching the maximum at 6 dpi (Fig. 5F). There tensive consolidated areas in the apical and medial lobes which were were no significant differences in the number of FoxpP3+ cells among microscopically linked to suppurative bronchopneumonia as well as infected groups. However, a significant increase of FoxP3+ cells was severe characteristic interstitial pneumonia. On the other hand, PRRSV detected at 6 and 8 dpi in Lena-infected pigs compared to control virulence has been associated with higher virus titre and antibody 7 J.M. Sánchez-Carvajal, et al. Veterinary Microbiology 246 (2020) 108744 Fig. 4. Immunohistochemical expression of CD14 and iNOS in lung tissue. Lung tissue sections were immunolabelled for both anti- gens. Photomicrographs of the medial lung lobe illustrate the expression of CD14 in a 3249-infected (A) and Lena-infected pig (B), which was mainly expressed on the cell mem- brane and cytoplasm of monocytes, interstitial and intravascular macrophages (4A-4B, insets). IHC. Bar, 100 μm. Photomicrographs of the medial lung lobe illustrate the expression of iNOS in a representative control (C) and Lena- infected (D) pig. iNOS was observed primarily in the cytoplasm of PAMs and interstitial macrophages detected in foci of interstitial pneumonia and bronchopneumonia (4C-4D, insets). IHC. Bar, 100 μm. (E) Box plots shows the number of CD14+ cells/mm2 for each group (control, gray circles; 3249, green tri- angles; Lena, red diamonds) and time point. (F) Box plots display the number of iNOS+ cells for each group (Control, gray circles; 3249, green triangles; Lena, red diamonds) and time point. Control baseline displays the mean of the number of positive cells along the study in control group. P value lower than 0.05 was considered statistically significant and re- presented as * P ≤ 0.05 and ** P ≤ 0.01. Days post-inoculation, dpi. response in vivo (Brockmeier et al., 2012; Lu et al., 2014) Although Lena attempt of the host innate immune response in controlling virus re- virulent strain elicited a quite higher viraemia than the low virulent plication. The enhanced serum concentration of IL-6 could mirror the strain, no differences were observed in the antibody response in the stronger systemic inflammatory response induced by Lena during the early phase of infection. Similar results have been previously reported acute phase response contributing to the fever and more severe clinical by others when comparing Lena with low virulent strains (Renson et al., signs as well as lung lesion that specifically arise in virulent PRRSV-1 2017; Weesendorp et al., 2013), and confirm that PRRSV-1 virulence strains (Amarilla et al., 2015; Renson et al., 2017). and specific non-neutralizing antibodies are not associated in the acute In order to evaluate the kinetics of PRRSV-1 in the lung, we ana- phase of infection. lysed the expression of PRRSV-N-protein and lung viral load. PRRSV infection with virulent strains usually induces a strong in- Interestingly, both the number of PRRSV-N-protein+ cells and lung flammatory immune response when compared with low virulent strains viral load showed a solid negative correlation with the frequency of (Amarilla et al., 2015; Liu et al., 2010; Morgan et al., 2013; Renson CD163+ cells, the essential host receptor for PRRSV infection (Burkard et al., 2017; Weesendorp et al., 2013). In our study, higher levels of IL-6 et al., 2017; Van Gorp et al., 2008; Whitworth et al., 2016). The dra- at 8 dpi and IFN-γ at 6–8 dpi were detected in the sera of Lena-infected matical depletion in the frequency of pulmonary CD163+ cells in Lena- pigs. Increased concentration of IL-6 in plasma is associated with both infected animals has been already reported in live PAMs from the BALF systemic and respiratory symptoms (Van Reeth and Nauwynck, 2000) of Lena-infected piglets (Renson et al., 2017; Rodríguez-Gómez et al., and could play a dual role during virus infection: (i) protecting the host 2019) as well as from lung tissue sections of piglets infected with from infection and (ii) inducing inflammation and tissue damage when virulent SU1-bel strain (Sánchez-Carvajal et al., 2019). This finding it is overexpressed (Liu et al., 2010). It is known that IFN-γ is, mostly could be due to the direct cytopathic effect of the virus in its target cell produced by activated NK cells, NKT cells, γ/δ T cells, cytotoxic T cells but also to an indirect induction of regulated cell death in infected and and memory T cells (Gerner et al., 2015; Mair et al., 2014), and par- non-infected cells, which has been broadly described in the lung and ticipates in regulating the immune and inflammatory responses (Van lymphoid organs of pigs infected with virulent PRRSV-1 strains Reeth and Nauwynck, 2000). In fact, an early increase of NKT cells has (Morgan et al., 2013; Ruedas-Torres et al., 2020; Sánchez-Carvajal been associated with viraemia peak in piglets infected with PR40 et al., 2019). Another possibility would be the shedding of sCD163 due virulent strain (Ferrari et al., 2018). In our study, virulent Lena strain to macrophages activation either by a direct effect of the virus or sec- elicited a marked increase in the serum level of IFN-γ which was sig- ondary to viral infection (Møller, 2012). However, it seems unlikely, nificantly correlated with viremia and lung viral load, suggesting an since no changes were detected in sCD163 sera concentration in our 8 J.M. Sánchez-Carvajal, et al. Veterinary Microbiology 246 (2020) 108744 Fig. 5. Immunohistochemical expression of CD200R1 and FoxP3 in lung tissue. Lung tissue sections were immunolabelled for both antigens. Photomicrographs of the medial lung lobe illustrate the expression of CD200R1 in a 3249-infected (A) and Lena-infected (B) pig, which was mainly detected in the cytoplasm of intravascular and interstitial macrophages lo- cated inside or surrounding bronchopneu- monia foci (5A-5B, insets). IHC. Bar, 50 μm. Photomicrographs of the medial lung lobe il- lustrate the expression of FoxP3 in a re- presentative control (C) and Lena-infected (D) pig. FoxP3 yielded a nuclear immunolabelling in lymphocytes mainly located in areas of at- electasis and interstitial pneumonia (5C-5D, insets). IHC. Bar, 100 μm. (E) The diagram displays the number of CD200R1+ cells/mm2 versus the microscopic lung score. Scatter dot plot shows the number of CD200R1+ cells (primary axis) for each animal (control, gray circles; 3249, green triangles; Lena, red dia- monds) and coloured lines the average for each group and day point. The gray bar displays the microscopic lung score (secondary axis) for each group (control, gray circles; 3249, green triangles; Lena, red diamonds) at each time point. (F) Box plots shows the number of FoxP3+ cells for each group (control, gray circles; 3249, green triangles; Lena, red dia- monds) and time point. Control baseline dis- plays the mean of the number of positive cells along the study in control group. P value lower than 0.05 was considered statistically sig- nificant and represented as * P ≤ 0.05 and ** P ≤ 0.01. Days post-inoculation, dpi. study after infection with a virulent PRRSV-1 strain. In contrast, function. On the other hand, the increase of CD14+ cells implies a Glaesserella parasuis virulent strains have been reported to increase higher availability of the LPS-LBP complex receptor, which is likely to serum levels of sCD163 linked to a reduction in CD163 surface ex- sensitise the lung to future secondary bacterial infections making the pression in PAMs (Costa-Hurtado et al., 2013). In our study, the de- onset of PRDC easier (Van Gucht et al., 2005). In the case of iNOS, a crease of CD163+ macrophages, an important cell subset to tackle significant increase in the number of iNOS+ cells was observed in areas bacterial infections (Fabriek et al., 2009), points out to a mechanism of interstitial pneumonia as well as bronchopneumonia in Lena-infected involved in the impairment of the local pulmonary immune response. pigs. The induction of iNOS has been associated with both a direct ef- This fact may potentially favour the co-infection with secondary com- fect of the viral replication or viral components and an indirect effect mensal microorganisms leading to bronchopneumonia. mediated by cytokines, such as IFN-γ, or by LPS (Akaike and Maeda, CD14 and iNOS are involved in lung inflammation after infection 2000; Chen et al., 2014; Lee and Kleiboeker, 2005). Of note, the peak of with PRRSV (Chen et al., 2014; Lee and Kleiboeker, 2005; Van Gucht iNOS in Lena-infected animals appeared in our study just after the peak et al., 2004, 2005; Yan et al., 2017) Upregulation of CD14, as lipopo- of PRRSV replication in the lung as well as after the peak of serum IFN- lysaccharides (LPS) co-receptor, after infection with PRRSV sensitises γ, being associated with the maximum lung injury and bronchopneu- the lungs for the production of proinflammatory cytokines and re- monia lesion. These factors may play a role in the regulation of iNOS spiratory signs upon exposure to bacterial LPS (Van Gucht et al., 2005). expression along PRRSV infection and its role in lung injury develop- For its part, iNOS is mainly expressed in response to different stimuli, ment (Chen et al., 2014; Lee and Kleiboeker, 2005; Yan et al., 2017). such as cytokines and LPS, playing a role in tissue injury upon pro- After a cascade of proinflammatory events, the host is able to trigger duction of NO (Chen et al., 2014; Cho and Chae, 2002; Vlahos et al., off the release of anti-inflammatory or regulatory mediators to restrain 2011; Yan et al., 2017). In this study, an increase in the number of the extent of the injury. Thus, the role of CD200R1 and FoxP3 was CD14+ cells after PRRSV-1 infection was observed in association with evaluated in the present study. A strong positive correlation was de- suppurative bronchopneumonia, which was more evident in Lena-in- tected among the frequency of CD200R1+ cells and the microscopic fected piglets at 6–8 dpi. This increase was mainly due to CD14+ score which was mainly associated with a higher severity of typical monocytes, interstitial and intravascular macrophages infiltrating ex- interstitial pneumonia and suppurative bronchopneumonia in Lena-in- tensive areas of the interstitium. The influx of CD14+ monocytes and fected pigs. Likewise, an increase in the frequency of FoxP3+ cells immature macrophages may be explained by an attempt to replenish between 6 and 8 dpi was triggered by both PRRSV-1 strains when the the loss of CD163+ macrophages contributing to clearance of cellular lung injury was higher. CD200R1 has been involved in reducing the debris and resolution of inflammation, restoring the normal lung expression of pro-inflammatory cytokines in a wide range of 9 J.M. Sánchez-Carvajal, et al. Veterinary Microbiology 246 (2020) 108744 inflammatory diseases (Vaine and Soberman, 2014), nevertheless to the J.M., Morgan, S.B., Graham, S.P., Frossard, J.P., Drew, T.W., Salguero, F.J., 2015. A best of the authors’ knowledge, the role of CD200R1 in viral diseases of comparative study of the local cytokine response in the lungs of pigs experimentally infected with different PRRSV-1 strains: upregulation of IL-1α in highly pathogenic swine is largely unknown. Previous studies in a murine model reported strain induced lesions. Vet. Immunol. Immunopathol. 164 (3–4), 137–147. https:// that influenza virus infection induced the upregulation of CD200R1 in doi.org/10.1016/j.vetimm.2015.02.003. macrophages, decreasing their responsiveness and increasing the sen- Arpaia, N., Green, J.A., Moltedo, B., Arvey, A., Hemmers, S., Yuan, S., Treuting, P.M., Rudensky, A.Y., 2015. A distinct function of regulatory t cells in tissue protection. sitivity to bacterial infection and finally severe lung injury (Snelgrove Cell 162 (5), 1078–1089. https://doi.org/10.1016/j.cell.2015.08.021. et al., 2008; Vaine and Soberman, 2014). In contrast, CD200/CD200R1 Balka, G., Podgórska, K., Brar, M.S., Bálint, Á., Cadar, D., Celer, V., Dénes, L., Dirbakova, signalling pathway limited type I IFN production during coronavirus Z., Jedryczko, A., Márton, L., Novosel, D., Petrović, T., Sirakov, I., Szalay, D., Toplak, I., Leung, F.C.C., Stadejek, T., 2018. Genetic diversity of PRRSV 1 in Central Eastern infection protecting the host from cytokine storm (Vaine and Soberman, Europe in 1994–2014: origin and evolution of the virus in the region. Sci. Rep. 8 (1), 2014). In addition, FoxP3 has been reported as a potential inhibitor of 1–12. https://doi.org/10.1038/s41598-018-26036-w. the cell-mediated immune response in pigs upon PRRSV infection Bordet, E., Maisonnasse, P., Renson, P., Bouguyon, E., Crisci, E., Tiret, M., Descamps, D., Bernelin-Cottet, C., Urien, C., Lefèvre, F., Jouneau, L., Bourry, O., Leplat, J.J., (Ferrarini et al., 2015; Silva-Campa et al., 2009, 2010); but also in- Schwartz-Cornil, I., Bertho, N., 2018. Porcine alveolar macrophage-like cells are pro- duction of Tregs has been described in the lungs and tracheobronchial inflammatory pulmonary intravascular macrophages that produce large titers of lymph nodes in PRRSV-infected pigs (Nedumpun et al., 2018). How- porcine reproductive and respiratory syndrome virus. Sci. Rep. 8 (1), 10172. https:// ever, its role in the immunopathogenesis of PRRSV-induced lung injury doi.org/10.1038/s41598-018-28234-y. Brockmeier, S.L., Loving, C.L., Nelson, E.A., Miller, L.C., Nicholson, T.L., Register, K.B., is unexplored. PD1/PDL1 modulation and FoxP3+ cells have been Grubman, M.J., Brough, D.E., Kehrli, M.E., 2012. The presence of alpha interferon at pointed out to play a dual role upon viral infections, restricting immune the time of infection alters the innate and adaptive immune responses to porcine inflammation-induced tissue damage and encouraging lung repair reproductive and respiratory syndrome virus. Clin. Vaccine Immunol. 19 (4), 508–514. https://doi.org/10.1128/CVI.05490-11. during acute phase of infection (Lin et al., 2018; Singh et al., 2019), but Brockmeier, S.L., Loving, C.L., Palmer, M.V., Spear, A., Nicholson, T.L., Faaberg, K.S., leading to exhaustion and suppression of antiviral immune responses in Lager, K.M., 2017. Comparison of Asian porcine high fever disease isolates of porcine the chronic infection (Arpaia et al., 2015; Schönrich and Raftery, 2019; reproductive and respiratory syndrome virus to United States isolates for their ability to cause disease and secondary bacterial infection in swine. Vet. Microbiol. 203, Wang et al., 2018). Taken together, our results highlight the upregu- 6–17. https://doi.org/10.1016/j.vetmic.2017.02.003. lation of CD200R1 and FoxP3 as mechanisms involved in the constraint Burkard, C., Lillico, S.G., Reid, E., Jackson, B., Mileham, A.J., Ait-Ali, T., Whitelaw, and recovery of lung injury during acute PRRSV infection. Further C.B.A., Archibald, A.L., 2017. Precision engineering for PRRSV resistance in pigs: Macrophages from genome edited pigs lacking CD163 SRCR5 domain are fully re- studies are needed to determine the mechanisms involved in the acti- sistant to both PRRSV genotypes while maintaining biological function. PLoS Pathog. vation of these molecules during acute PRRSV as well as their role and 13 (2), e1006206. https://doi.org/10.1371/journal.ppat.1006206. related signalling pathways along the persistent infection. Canelli, E., Catella, A., Borghetti, P., Ferrari, L., Ogno, G., De Angelis, E., Corradi, A., Passeri, B., Bertani, V., Sandri, G., Bonilauri, P., Leung, F.C., Guazzetti, S., Martelli, P., 2017. Phenotypic characterization of a highly pathogenic Italian porcine re- 5. Conclusion productive and respiratory syndrome virus (PRRSV) type 1 subtype 1 isolate in ex- perimentally infected pigs. Vet. Microbiol. 210 (July), 124–133. https://doi.org/10. The present study dissects the immunopathology of lung injury 1016/j.vetmic.2017.09.002. Chen, Xxin, Quan, R., Guo, Xkun, Gao, L., Shi, J., Feng, Whai, 2014. Up-regulation of pro- along an acute infection with PRRSV-1 strains of different virulence, inflammatory factors by HP-PRRSV infection in microglia: implications for HP- revealing a drop in the number of CD163+ cells together with an en- PRRSV neuropathogenesis. Vet. Microbiol. 170 (1–2), 48–57. https://doi.org/10. hancement in the expression of CD14 and iNOS as mechanisms involved 1016/j.vetmic.2014.01.031. Cho, W.S., Chae, C., 2002. Immunohistochemical detection and distribution of inducible in the earlier and higher extent of lung lesion in Lena-infected piglets. nitric oxide synthase in pigs naturally infected with Actinobacillus pleur- These changes could sensitise the lung to future secondary bacterial opneumoniae. J. Comp. Pathol. 126 (2–3), 109–114. https://doi.org/10.1053/jcpa. infections. In addition, the increase in the number of CD14+ cells is 2001.0529. Costa-Hurtado, M., Olvera, A., Martinez-Moliner, V., Galofré-Milà, N., Martínez, P., likely to respond to an attempt to replenish the CD163+ macrophages Dominguez, J., Aragon, V., 2013. Changes in macrophage phenotype after infection subset lost along the infection with both PRRSV-1 strains. On the other of pigs with haemophilus parasuis strains with different levels of virulence. Infect. hand, the increase in the expression of CD200R1 and FoxP3 represents Immun. 81 (7), 2327–2333. https://doi.org/10.1128/IAI.00056-13. Darwich, L., Gimeno, M., Sibila, M., Diaz, I., de la Torre, E., Dotti, S., Kuzemtseva, L., potential pathways activated to contain the inflammatory response. Martin, M., Pujols, J., Mateu, E., 2011. Genetic and immunobiological diversities of porcine reproductive and respiratory syndrome genotype I strains. Vet. Microbiol. Declaration of Competing Interest 150 (1–2), 49–62. https://doi.org/10.1016/j.vetmic.2011.01.008. Das, P.B., Dinh, P.X., Ansari, I.H., De Lima, M., Osorio, F.A., Pattnaik, A.K., 2010. The minor envelope glycoproteins GP2a and GP4 of porcine reproductive and respiratory The authors declare that they have no competing interest. syndrome virus interact with the receptor CD163. J. Virol. 84 (4), 1731–1740. https://doi.org/10.1128/JVI.01774-09. wivedi, V., Manickam, C., Binjawadagi, B., Linhares, D., Murtaugh, M.P., Renukaradhya, Acknowledgements G.J., 2012. Evaluation of immune responses to porcine reproductive and respiratory syndrome virus in pigs during early stage of infection under farm conditions. Virology We express our appreciation to Gema Muñoz, Alberto Alcántara and Journal 9 (1), 45. https://doi.org/10.1186/1743-422X-9. Duan, X., Nauwynck, H.J., Pensaert, M.B., 1997. Virus quantification and identification of Esmeralda Cano for their technical assistance and Dr. Hans Nauwynck cellular targets in the lungs and lymphoid tissues of pigs at different time intervals for providing us the PRRSV-1 subtype 3 Lena strain. This work was after inoculation with porcine reproductive and respiratory syndrome virus (PRRSV). supported by the Spanish Ministry of Economy and Competitiveness Vet. Microbiol. 56 (1–2), 9–19. https://doi.org/10.1016/S0378-1135(96)01347-8. Elmore, M.R.P., Burton, M.D., Conrad, M.S., Rytych, J.L., Van Alstine, W.G., Johnson, (AGL2016-76111-R). J. Gómez-Laguna is supported by a “Ramón y R.W., 2014. Respiratory viral infection in neonatal piglets causes marked microglia Cajal” contract of the Spanish Ministry of Economy and activation in the hippocampus and deficits in spatial learning. J. Neurosci. 34 (6), Competitiveness (RyC-2014-16735). 2120–2129. https://doi.org/10.1523/JNEUROSCI.2180-13.2014. Fabriek, B.O., Van Bruggen, R., Deng, D.M., Ligtenberg, A.J.M., Nazmi, K., Schornagel, K., Vloet, R.P.M., Dijkstra, C.D., Van Den Berg, T.K., 2009. The macrophage scavenger Appendix A. Supplementary data receptor CD163 functions as an innate immune sensor for bacteria. Blood 113 (4), 887–892. https://doi.org/10.1182/blood-2008-07-167064. Ferrari, L., Canelli, E., De Angelis, E., Catella, A., Ferrarini, G., Ogno, G., Bonati, L., Supplementary material related to this article can be found, in the Nardini, R., Borghetti, P., Martelli, P., 2018. A highly pathogenic porcine re- online version, at doi:https://doi.org/10.1016/j.vetmic.2020.108744. productive and respiratory syndrome virus type 1 (PRRSV-1) strongly modulates cellular innate and adaptive immune subsets upon experimental infection. Vet. References Microbiol. 216, 85–92. https://doi.org/10.1016/j.vetmic.2018.02.001. Ferrarini, G., Borghetti, P., De Angelis, E., Ferrari, L., Canelli, E., Catella, A., Di Lecce, R., Martelli, P., 2015. Immunoregulatory signal FoxP3, cytokine gene expression and Akaike, T., Maeda, H., 2000. Nitric oxide and virus infection. Immunology 101 (3), IFN-γ cell responsiveness upon porcine reproductive and respiratory syndrome virus 300–308. https://doi.org/10.1046/j.1365-2567.2000.00. (PRRSV) natural infection. Res. Vet. Sci. 103, 96–102. https://doi.org/10.1016/j. Amarilla, S.P., Gómez-Laguna, J., Carrasco, L., Rodríguez-Gómez, I.M., Caridad y Ocerín, rvsc.2015.09.018. 10 J.M. Sánchez-Carvajal, et al. Veterinary Microbiology 246 (2020) 108744 Frydas, I.S., Verbeeck, M., Cao, J., Nauwynck, H.J., 2013. Replication characteristics of Ogno, G., Rodríguez-Gómez, I.M., Canelli, E., Ruedas-Torres, I., Álvarez, B., Domínguez, porcine reproductive and respiratory syndrome virus (PRRSV) European subtype 1 J., Borghetti, P., Martelli, P., Gómez-Laguna, J., 2019. Impact of PRRSV strains of (Lelystad) and subtype 3 (Lena) strains in nasal mucosa and cells of the monocytic different in vivo virulence on the macrophage population of the thymus. Vet. lineage: indications for the use of new receptors of PRRSV (Lena). Vet. Res. 44 (1), Microbiol. 232, 137–145. https://doi.org/10.1016/j.vetmic.2019.04.016. 73. https://doi.org/10.1186/1297-9716-44-73. Pasternak, J.A., MacPhee, D.J., Harding, J.C.S., 2019. Development and application of a Geldhof, M.F., Vanhee, M., Van Breedam, W., Van Doorsselaere, J., Karniychuk, U.U., porcine specific ELISA for the quantification of soluble CD163. Vet. Immunol. Nauwynck, H.J., 2012. Comparison of the efficacy of autogenous inactivated Porcine Immunopathol. 210, 60–67. https://doi.org/10.1016/j.vetimm.2019.03.011. Reproductive and Respiratory Syndrome Virus (PRRSV) vaccines with that of com- Poderoso, T., Martínez de la Riva, P., Uenishi, H., Alvarez, B., Toki, D., Nieto-Pelegrín, E., mercial vaccines against homologous and heterologous challenges. BMC Vet. Res. 8 Alonso, F., Domínguez, J., Ezquerra, A., Revilla, C., 2019. Analysis of the expression (1), 182. https://doi.org/10.1186/1746-6148-8-182. of porcine CD200R1 and CD200R1L by using newly developed monoclonal anti- Gerner, W., Talker, S.C., Koinig, H.C., Sedlak, C., Mair, K.H., Saalmüller, A., 2015. bodies. Dev. Comp. Immunol. 100 (June), 103417. https://doi.org/10.1016/j.dci. Phenotypic and functional differentiation of porcine αβ T cells: Current knowledge 2019.103417. and available tools. Mol. Immunol. 66 (1), 3–13. https://doi.org/10.1016/j.molimm. Renson, P., Rose, N., Le Dimna, M., Mahé, S., Keranflec’h, A., Paboeuf, F., Belloc, C., Le 2014.10.025. Potier, M.F., Bourry, O., 2017. Dynamic changes in bronchoalveolar macrophages Gimeno, M., Darwich, L., Diaz, I., De La Torre, E., Pujols, J., Martín, M., Inumaru, S., and cytokines during infection of pigs with a highly or low pathogenic genotype 1 Cano, E., Domingo, M., Montoya, M., Mateu, E., 2011. Cytokine profiles and phe- PRRSV strain. Vet. Res. 48 (1), 15. https://doi.org/10.1186/s13567-017-0420-y. notype regulation of antigen presenting cells by genotype-I porcine reproductive and Rodríguez-Gómez, I.M., Gómez-Laguna, J., Barranco, I., Pallarés, F.J., Ramis, G., respiratory syndrome virus isolates. Vet. Res. 42 (1), 9. https://doi.org/10.1186/ Salguero, F.J., Carrasco, L., 2013. Downregulation of antigen-presenting cells in 1297-9716-42-9. tonsil and lymph nodes of porcine reproductive and respiratory syndrome virus-in- Gómez-Laguna, J., Salguero, F.J., Barranco, I., Pallarés, F.J., Rodríguez-Gómez, I.M., fected pigs. Transbound. Emerg. Dis. 60 (5), 425–437. https://doi.org/10.1111/j. Bernabé, A., Carrasco, L., 2010. Cytokine expression by macrophages in the lung of 1865-1682.2012.01363.x. pigs infected with the porcine reproductive and respiratory syndrome virus. J. Comp. Rodríguez-Gómez, Irene M., Sánchez-Carvajal, J.M., Pallarés, F.J., Mateu, E., Carrasco, L., Pathol. 142 (1), 51–60. https://doi.org/10.1016/j.jcpa.2009.07.004. Gómez-Laguna, J., 2019. Virulent Lena strain induced an earlier and stronger Gómez-Laguna, J., Salguero, F.J., Pallarés, F.J., Carrasco, L., 2013. Immunopathogenesis downregulation of CD163 in bronchoalveolar lavage cells. Vet. Microbiol. 235, of porcine reproductive and respiratory syndrome in the respiratory tract of pigs. Vet. 101–109. https://doi.org/10.1016/j.vetmic.2019.06.011. J. 195 (2), 148–155. https://doi.org/10.1016/j.tvjl.2012.11.012. Rowland, R.R.R., Steffen, M., Ackerman, T., Benfield, D.A., 1999. The evolution of por- Gorbalenya, A.E., Krupovic, M., Siddell, S., Varsani, A., K. J, 2018. International cine reproductive and respiratory syndrome virus: quasispecies and emergence of a Committee on Taxonomy of Viruses (ICTV). Retrieved 6 April 2019, from virus subpopulation during infection of pigs with VR-2332. Virology 259 (2), International Committee on Taxonomy of Viruses (ICTV) Website:. https://talk. 262–266. https://doi.org/10.1006/viro.1999.9789. ictvonline.org/taxonomy/p/taxonomy-history?taxnode_id=20186087. Ruedas-Torres, I., Rodríguez-Gómez, I.M., Sánchez-Carvajal, J.M., Pallares, F.J., Greenbaum, E., Furst, A., Kiderman, A., Stewart, B., Levy, R., Schlesinger, M., Morag, A., Barranco, I., Carrasco, L., Gómez-Laguna, J., 2020. Activation of the extrinsic Zakay-Rones, Z., 2001. Area under the viraemia curve versus absolute viral load: apoptotic pathway in the thymus of piglets infected with PRRSV-1 strains of different utility for predicting symptomatic cytomegalovirus infections in kidney transplant virulence. Vet. Microbiol. 243, 108639. https://doi.org/10.1016/j.vetmic.2020. patients. J. Med. Virol. 65 (1), 85–89. https://doi.org/10.1002/jmv.2005. 108639. Halbur, P.G., Paul, P.S., Meng, X.J., Lum, M.A., Andrews, J.J., Rathje, J.A., 1996. Sánchez, C., Doménech, N., Alonso, F., Ezquerra, A., Domínguez, J., Vázquez, J., 1999. Comparative pathogenicity of nine US porcine reproductive and respiratory syn- The porcine 2A10 antigen is homologous to human CD163 and related to macro- drome virus (PRRSV) isolates in a five-week-old cesarean-derived, colostrum-de- phage differentiation. J. Immunol. 162 (9), 5230–5237. prived pig model. J. Vet. Diagn. Investig. 8 (1), 11–20. https://doi.org/10.1177/ Sánchez-Carvajal, J.M., Rodríguez-Gómez, I.M., Carrasco, L., Barranco, I., Álvarez, B., 104063879600800103. Domínguez, J., Salguero, F.J., Gómez-Laguna, J., 2019. Kinetics of the expression of Karniychuk, U.U., Geldhof, M., Vanhee, M., Van Doorsselaere, J., Saveleva, T.A., CD163 and CD107a in the lung and tonsil of pigs after infection with PRRSV-1 strains Nauwynck, H.J., 2010. Pathogenesis and antigenic characterization of a new East of different virulence. Vet. Res. Commun. 43 (3), 187–195. https://doi.org/10.1007/ European subtype 3 porcine reproductive and respiratory syndrome virus isolate. s11259-019-09755-x. BMC Vet. Res. 6 (1), 30. https://doi.org/10.1186/1746-6148-6-30. Schönrich, G., Raftery, M.J., 2019. The PD-1/PD-L1 axis and virus infections: a delicate Käser, T., Gerner, W., Hammer, S.E., Patzl, M., Saalmüller, A., 2008. Detection of Foxp3 balance. Frontiers in Cellular and Infection Microbiology, vol. 9 Frontiers Media protein expression in porcine T lymphocytes. Vet. Immunol. Immunopathol. 125 S.A.https://doi.org/10.3389/fcimb.2019.00207. p. 207. (1–2), 92–101. https://doi.org/10.1016/j.vetimm.2008.05.007. Shi, M., Lam, T.T.Y., Hon, C.C., Hui, R.K.H., Faaberg, K.S., Wennblom, T., Murtaugh, Lee, S.M., Kleiboeker, S.B., 2005. Porcine arterivirus activates the NF-κB pathway through M.P., Stadejek, T., Leung, F.C.C., 2010. Molecular epidemiology of PRRSV: a phy- IκB degradation. Virology 342 (1), 47–59. https://doi.org/10.1016/j.virol.2005.07. logenetic perspective. Virus Res. 154 (1–2), 7–17. https://doi.org/10.1016/j.virusres. 034. 2010.08.014. Lin, S., Wu, H., Wang, C., Xiao, Z., Xu, F., 2018. Regulatory T cells and acute lung injury: Sibila, M., Calsamiglia, M., Segalés, J., Blanchard, P., Badiella, L., Le Dimma, M., Jestin, cytokines, uncontrolled inflammation, and therapeutic implications. Frontiers in A., Domingo, M., 2004. Use of a polymerase chain reaction assay and an ELISA to Immunology, vol. 9 Frontiers Media S.A.https://doi.org/10.3389/fimmu.2018. monitor porcine circovirus type 2 infection in pigs from farms with and without 01545. Issue JULY. postweaning multisystemic wasting syndrome. Am. J. Vet. Res. 65 (1), 88–92. Liu, Y., Shi, W., Zhou, E., Wang, S., Hu, S., Cai, X., Rong, F., Wu, J., Xu, M., Xu, M., Li, Q., https://doi.org/10.2460/ajvr.2004.65.88. 2010. Dynamic changes in inflammatory cytokines in pigs infected with highly pa- Silva-Campa, E., Flores-Mendoza, L., Reséndiz, M., Pinelli-Saavedra, A., Mata-Haro, V., thogenic porcine reproductive and respiratory syndrome virus. Clin. Vaccine Mwangi, W., Hernández, J., 2009. Induction of T helper 3 regulatory cells by den- Immunol. 17 (9), 1439–1445. https://doi.org/10.1128/CVI.00517-09. dritic cells infected with porcine reproductive and respiratory syndrome virus. Lu, W., Sun, B., Mo, J., Zeng, X., Zhang, G., Wang, L., Zhou, Q., Zhu, L., Li, Z., Xie, Q., Bi, Virology 387 (2), 373–379. https://doi.org/10.1016/j.virol.2009.02.033. Y., Ma, J., 2014. Attenuation and immunogenicity of a live high pathogenic PRRSV Silva-Campa, E., Cordoba, L., Fraile, L., Flores-mendoza, L., Montoya, M., Hernández, J., vaccine candidate with a 32-Amino acid deletion in the nsp2 protein. J. Immunol. 2010. European genotype of porcine reproductive and respiratory syndrome (PRRSV) Res. 2014, 1–11. https://doi.org/10.1155/2014/810523. infects monocyte-derived dendritic cells but does not induce Treg cells. Virology 396 Mair, K.H., Sedlak, C., Käser, T., Pasternak, A., Levast, B., Gerner, W., Saalmüller, A., (2), 264–271. https://doi.org/10.1016/j.virol.2009.10.024. Summerfield, A., Gerdts, V., Wilson, H.L., Meurens, F., 2014. The porcine innate Singh, R., Alape, D., de Lima, A., Ascanio, J., Majid, A., Gangadharan, S.P., 2019. immune system: an update. Developmental and Comparative Immunology, vol. 45. Regulatory t cells in respiratory health and diseases. Pulm. Med. 2019. https://doi. Elsevier Ltd., pp. 321–343. https://doi.org/10.1016/j.dci.2014.03.022. Issue 2. org/10.1155/2019/1907807. Mattsson, J.G., Bergström, K., Wallgren, P., Johansson, K.-E.E., 1995. Detection of Sinn, L.J., Klingler, E., Lamp, B., Brunthaler, R., Weissenböck, H., Rümenapf, T., Ladinig, Mycoplasma hyopneumoniae in nose swabs from pigs by in vitro amplification of the A., 2016. Emergence of a virulent porcine reproductive and respiratory syndrome 16S rRNA gene. J. Clin. Microbiol. 33 (4), 893–897. http://www.ncbi.nlm.nih.gov/ virus (PRRSV) 1 strain in Lower Austria. Porcine Health Manag. 2, 1–10. https://doi. pubmed/7540629. org/10.1186/s40813-016-0044-z. Møller, H.J., 2012. Soluble CD163. Scand. J. Clin. Lab. Invest. 163 (1), 1–13. https://doi. Snelgrove, R.J., Goulding, J., Didierlaurent, A.M., Lyonga, D., Vekaria, S., Edwards, L., org/10.3109/00365513.2011.626868. Gwyer, E., Sedgwick, J.D., Barclay, A.N., Hussell, T., 2008. A critical function for Morgan, S.B., Graham, S.P., Salguero, F.J., Sánchez Cordón, P.J., Mokhtar, H., Rebel, CD200 in lung immune homeostasis and the severity of influenza infection. Nat. J.M.J., Weesendorp, E., Bodman-Smith, K.B., Steinbach, F., Frossard, J.P., 2013. Immunol. 9 (9), 1074–1083. https://doi.org/10.1038/ni.1637. Increased pathogenicity of European porcine reproductive and respiratory syndrome Stadejek, T., Larsen, L.E., Podgórska, K., Bøtner, A., Botti, S., Dolka, I., Fabisiak, M., virus is associated with enhanced adaptive responses and viral clearance. Vet. Heegaard, P.M.H., Hjulsager, C.K., Huć, T., Kvisgaard, L.K., Sapierzyński, R., Nielsen, Microbiol. 163 (1–2), 13–22. https://doi.org/10.1016/j.vetmic.2012.11.024. J., 2017. Pathogenicity of three genetically diverse strains of PRRSV Type 1 in spe- Morgan, S.B., Frossard, J.P., Pallares, F.J., Gough, J., Stadejek, T., Graham, S.P., cific pathogen free pigs. Vet. Microbiol. 209 (April), 13–19. https://doi.org/10.1016/ Steinbach, F., Drew, T.W., Salguero, F.J., 2016. Pathology and virus distribution in j.vetmic.2017.05.011. the lung and lymphoid tissues of pigs experimentally inoculated with three distinct Thanawongnuwech, R., Halbur, P.G., Thacker, E.L., 2000. The role of pulmonary in- type 1 PRRS virus isolates of varying pathogenicity. Transbound. Emerg. Dis. 63 (3), travascular macrophages in porcine reproductive and respiratory syndrome virus 285–295. https://doi.org/10.1111/tbed.12272. infection. Animal Health Research Reviews/Conference of Research Workers in Nedumpun, T., Sirisereewan, C., Thanmuan, C., Techapongtada, P., Puntarotairung, R., Animal Diseases, vol. 1. pp. 95–102. https://doi.org/10.1017/S1466252300000086. Naraprasertkul, S., Thanawongnuwech, R., Suradhat, S., 2018. Induction of porcine Issue 2. reproductive and respiratory syndrome virus (PRRSV)-specific regulatory T lym- Vaine, C.A., Soberman, R.J., 2014. The CD200-CD200R1 inhibitory signaling pathway. phocytes (Treg) in the lungs and tracheobronchial lymph nodes of PRRSV-infected Immune regulation and host-pathogen interactions. Advances in Immunology, vol. pigs. Vet. Microbiol. 216, 13–19. https://doi.org/10.1016/j.vetmic.2018.01.014. 121. Academic Press Inc, pp. 191–211. https://doi.org/10.1016/B978-0-12-800100- 11 J.M. Sánchez-Carvajal, et al. Veterinary Microbiology 246 (2020) 108744 4.00005-2. https://doi.org/10.1111/sji.12715. Van Gorp, H., Van Breedam, W., Delputte, P.L., Nauwynck, H.J., 2008. Sialoadhesin and Weesendorp, E., Morgan, S., Stockhofe-Zurwieden, N., De Graaf, D.J.P., Graham, S.P., CD163 join forces during entry of the porcine reproductive and respiratory syndrome Rebel, J.M.J., 2013. Comparative analysis of immune responses following experi- virus. J. Gen. Virol. 89 (12), 2943–2953. https://doi.org/10.1099/vir.0.2008/ mental infection of pigs with European porcine reproductive and respiratory syn- 005009-0. drome virus strains of differing virulence. Vet. Microbiol. 163 (1–2), 1–12. https:// Van Gucht, S., Labarque, G., Van Reeth, K., 2004. The combination of PRRS virus and doi.org/10.1016/j.vetmic.2012.09.013. bacterial endotoxin as a model for multifactorial respiratory disease in pigs. Vet. Weesendorp, E., Rebel, J.M.J., Popma-De Graaf, D.J., Fijten, H.P.D., Stockhofe- Immunol. Immunopathol. 102 (3), 165–178. https://doi.org/10.1016/j.vetimm. Zurwieden, N., 2014. Lung pathogenicity of European genotype 3 strain porcine re- 2004.09.006. productive and respiratory syndrome virus (PRRSV) differs from that of subtype 1 Van Gucht, S., Van Reeth, K., Nauwynck, H., Pensaert, M., 2005. Porcine reproductive strains. Vet. Microbiol. 174 (1–2), 127–138. https://doi.org/10.1016/j.vetmic.2014. and respiratory syndrome virus infection increases CD14 expression and lipopoly- 09.010. saccharide-binding protein in the lungs of pigs. Viral Immunol. 18 (1), 116–126. Whitworth, K.M., Rowland, R.R.R., Ewen, C.L., Trible, B.R., Kerrigan, M.A., Cino-Ozuna, https://doi.org/10.1089/vim.2005.18.116. A.G., Samuel, M.S., Lightner, J.E., McLaren, D.G., Mileham, A.J., Wells, K.D., Prather, Van Reeth, K., Nauwynck, H., 2000. Proinflammatory cytokines and viral respiratory R.S., 2016. Gene-edited pigs are protected from porcine reproductive and respiratory disease in pigs. Vet. Res. 31 (2), 187–213. https://doi.org/10.1051/vetres:2000113. syndrome virus. Nat. Biotechnol. 34 (1), 20–22. https://doi.org/10.1038/nbt.3434. Vlahos, R., Stambas, J., Bozinovski, S., Broughton, B.R.S., Drummond, G.R., 2011. Yan, M., Hou, M., Liu, J., Zhang, S., Liu, B., Wu, X., Liu, G., 2017. Regulation of iNOS- Inhibition of Nox2 oxidase activity ameliorates influenza a virus-induced lung in- derived ROS generation by HSP90 and Cav-1 in porcine reproductive and respiratory flammation. PLoS Pathog. 7 (2), 1001271. https://doi.org/10.1371/journal.ppat. syndrome virus-infected swine lung injury. Inflammation 40 (4), 1236–1244. https:// 1001271. doi.org/10.1007/s10753-017-0566-9. Wang, L., Wang, X., Tong, L., Wang, J., Dou, M., Ji, S., Bi, J., Chen, C., Yang, D., He, H., Zanoni, I., Granucci (2013), F., 2020. Role of C in host protection against infections and in Bai, C., Zhou, J., Song, Y., 2018. Recovery from acute lung injury can be regulated via metabolism regulation. Frontiers in Cellular and Infection Microbiol.(3(JUL)). modulation of regulatory T cells and Th17 cells. Scand. J. Immunol. 88 (5), e12715. https://doi.org/10.3389/fcimb.2013.00032. 12