G C A T T A C G G C A T genes Article Semen Modulates the Expression of NGF, ABHD2, VCAN, and CTEN in the Reproductive Tract of Female Rabbits Jaume Gardela 1,2 , Amaia Jauregi-Miguel 3 , Cristina A. Martinez 1 , Heriberto Rodriguez-Martinez 1 , Manel Lopez-Bejar 2,4 and Manuel Alvarez-Rodriguez 1,2, * 1 Division of Children’s and Women Health (BKH), Obstetrics and Gynecology, Department of Biomedical and Clinical Sciences (BKV), Linköping University, 58185 Linköping, Sweden; jaume.gardela@uab.cat (J.G.); cristina.martinez-serrano@liu.se (C.A.M.); heriberto.rodriguez-martinez@liu.se (H.R.-M.) 2 Department of Animal Health and Anatomy, Veterinary Faculty, Universitat Autònoma de Barcelona, 08193 Bellaterra, Spain; manel.lopez.bejar@uab.cat or manel.lopezbejar@westernu.edu 3 Division of Molecular Medicine and Virology (MMV), Linköping University, 58185 Linköping, Sweden; amaya.jauregi.miguel@liu.se 4 College of Veterinary Medicine, Western University of Health Sciences, Pomona, CA 91766, USA * Correspondence: manuel.alvarez-rodriguez@liu.se  Received: 17 June 2020; Accepted: 6 July 2020; Published: 7 July 2020  Abstract: Semen changes the gene expression in endometrial and oviductal tissues modulating important processes for reproduction. We tested the hypothesis that mating and/or sperm-free seminal plasma deposition in the reproductive tract affect the expression of genes associated with sperm-lining epithelium interactions, ovulation, and pre-implantation effects (nerve growth factor, NGF; α/β hydrolase domain-containing protein 2, ABHD2; C-terminal tensin-like protein, CTEN or TNS4; and versican, VCAN) in the period 10–72 h post-mating. In Experiment 1, does (n = 9) were treated with gonadotropin-releasing hormone (GnRH) (control), GnRH-stimulated, and vaginally infused with sperm-free seminal plasma (SP-AI), or GnRH-stimulated and naturally mated (NM). In Experiment 2, does (n = 15) were GnRH-stimulated and naturally mated. Samples were retrieved from the internal reproductive tracts (cervix-to-infundibulum) 20 h post-treatment (Experiment 1) or sequentially collected at 10, 24, 36, 68, or 72 h post-mating (Experiment 2, 3 does/period). All samples were processed for gene expression analysis by quantitative PCR. Data showed an upregulation of endometrial CTEN and NGF by NM, but not by SP-AI. The findings suggest that the NGF gene affects the reproductive tract of the doe during ovulation and beyond, influencing the maternal environment during early embryonic development. Keywords: gene expression; qPCR; female reproductive tract; induced ovulator 1. Introduction Rabbits (Oryctolagus cuniculus) are considered to be game, vermin, laboratory animals, pets, or livestock, and are principally consumed in Mediterranean Europe [1]. Unlike many other livestock species, rabbits are induced ovulators, requiring the generation of genital-somatosensory signals during coitus to activate midbrain and brainstem noradrenergic neurons and generate the preovulatory peak of gonadotropin-releasing hormone (GnRH) [2,3]. This mating-induced output of GnRH, which is of a far greater magnitude than what has been reported for other species, causes an immediate release of luteinizing hormone from the anterior pituitary that results in ovulation [2]. Ejaculate deposition during mating affects the molecular and cellular functions near and distant to the insemination site [4]. In rabbits, approximately 1 mL of ejaculate volume containing about Genes 2020, 11, 758; doi:10.3390/genes11070758 www.mdpi.com/journal/genes Genes 2020, 11, 758 2 of 16 300 million spermatozoa suspended in seminal plasma (SP) is deposited vaginally after mating [5]. When spermatozoa reach the oviduct, within minutes in rabbits [6], only a small number of them attaches to the oviductal epithelium [7,8]. Sperm transport along the female reproductive tract follows two phases. The first is a rapid phase, where the myometrium and myosalpinx move a vanguard of spermatozoa to the upper ampulla and beyond, ensuring that a sperm group is cleared from the oviduct before ovulation [9]. The second is a sustained phase that colonizes the tubal sperm reservoir until ovulation takes place [10]. Previous research has proposed the distal isthmus (adjacent to, or perhaps part of, the utero-tubal junction) as the principal anatomical region restricting rabbit spermatozoa, acting as a sperm reservoir [10]. In these reservoirs, the spermatozoa are entrapped and safeguarded from the female immune system by the fluid and extracellular matrix present in the lumen of the oviduct [11]. Two of the principal components of the endometrial extracellular matrix are versican and hyaluronic acid [12]. Both may interact with specific binding domains, creating open networks to facilitate cell division, movement, and sorting [13]. The CD44, a cell-surface glycoprotein involved in cell-cell adhesion, is the best-characterized ligand to hyaluronic acid that also binds to versican [14]. It is present in a wide variety of cells and tissues, including spermatozoa, facilitating the adhesion and protection of those cells in the oviductal sperm reservoir [11]. Shortly after ovulation, spermatozoa are gradually released from the sperm reservoir and moved to the ampullar site of fertilization [8,10]. Modifications of the sperm and/or the epithelium lining surface proteins produced during sperm capacitation may reduce the sperm binding affinity to the oviductal epithelium [8]. This, together with the attainment of hyperactivation motility, which is required to facilitate sperm-oocyte contact and penetration of the zona pellucida [15], would result in the detachment of spermatozoa from the oviductal sperm reservoir. Ovulation is induced around 10 h after coitus or GnRH stimulation [16], and fertilization occurs 2–3 h after ovulation [15]. All of these events are the result of endocrine and neuronal interplay mainly connected to mating, but perhaps in concerted relation to the entry of semen and their effects on the genomic response by the female genital tract, as previously suggested in other species [17–19]. The nerve growth factor (NGF) not only participates in the differentiation, plasticity, and phenotype of sensory and sympathetic neurons [20], but has also been proposed as a key ovulation-inducing factor in rabbits and other induced ovulators, due to its presence in the SP [3,21–24]. In the genital tract, NGF may display different effects, from activating sperm motility via its cytoskeleton influence, as it occurs during neuronal growth, to preventing embryo rejection through the inhibition of local immune responses [20]. The enzyme α/β hydrolase domain-containing protein 2 (ABHD2) is involved in the control of sperm hyperactivation via progesterone and cation channels of sperm, also known as CatSper Ca2+ channels [25–27]. Versican (encoded by VCAN), an extracellular matrix component [12], plays a fundamental role in embryo implantation [28]. Recently, differential VCAN and ABHD2 expression have been reported in the porcine endometrium after mating and sperm-free SP infusion [29]. Besides, differential expression of the gene encoding for the C-terminal tensin-like protein (CTEN; also known as tensin 4, TNS4), a member of the tensin family crucial for cell-matrix adhesion [30], has been reported in the porcine endometrium triggered by spermatozoa and sperm-free SP [19]. Altogether, these genes may not only participate in the endometrium-sperm interaction, but also in the interaction between the genital environment and the zygotes, which is a matter that has not yet been explored in induced ovulators. The present study tested the effect of mating and/or seminal plasma on the gene expression of the tubular internal reproductive tract of does, with special reference to genes specifically associated with sperm-lining epithelium interactions (adhesion), ovulation, and pre-implantation effects (which can be separated from the free embryo influence) in the period 10–72 h post-mating, during which all these events occur. Genes 2020, 11, 758 3 of 16 Genes 2020, 11, x FOR PEER REVIEW 3 of 16 2.2. Materials Materialsand andMethods Methods 2.1. Ethics 2.1. Ethics Statement Statement Rabbits were Rabbits were handled handled according according to to the theprinciples principles of ofanimal animalcare carepublished publishedby bySpanish SpanishRoyal Royal Decree1201/2005 Decree 1201/2005(BOE, (BOE,2005: 2005:252:34367-91) 252:34367-91)and andthe theDirective Directive2010/63/EU 2010/63/EUofofthe theEuropean EuropeanParliament Parliament andthe and theCouncil Councilofof22 22September September2010 2010on onthetheprotection protectionofofanimals animals used used for for scientific scientific purposes purposes (2010; (2010; 276:33-79). The Committee of Ethics and Animal Welfare of the Universitat Autónoma de 276:33-79). The Committee of Ethics and Animal Welfare of the Universitat Autónoma de Barcelona, Barcelona, Spain,approved Spain, approvedthis thisstudy study(Expedient (Expedient#517). #517). 2.2. 2.2. Animals Animals Six SixNew NewZealand ZealandWhite White(NZW) (NZW)adultadultrabbit rabbitbucks bucksand and2424NZW NZWadultadultrabbit rabbitdoes does(from (fromseven seven to tothirteen thirteenmonths months old)old) from fromthe thenucleus nucleus colony colony atat the the farm farm ofofthe theInstitut Institut de deRecerca Recerca iiTecnologia Tecnologia Agroalimentaries Agroalimentaries (IRTA-Torre (IRTA-TorreMarimon, Marimon,Caldes Caldesde deMontbui, Montbui, Barcelona, Barcelona, Spain) Spain) were were used used in in this this study. study. Each Each animal was housed in a single cage (85 ×× 40 animal was 40 ××3030cm) cm)equipped equippedwith withplastic plasticfootrests, footrests,a afeeder feeder(restricted (restrictedtoto180 180g/day g/dayof ofan anall-mash all-mash pellet), pellet), and and nipple-drinkers nipple-drinkers (ad libitum access to water).water). Animals Animalswere werekept keptunder undera acontrolled controlledphotoperiod photoperiod ofof1616 h of light h of and light 8 h8of and h darkness, andand of darkness, a range of a range temperature of temperature between between15 and 20 ◦20 15 and C in°Cwinter andand in winter 20 and 20 and26 ◦26 C °C in summer, in summer,with a relative with humidity a relative humidity of 60% to 75% of 60% to 75%maintained maintained by abyforced a forcedventilation system. ventilation system. All All males males started started totobebetrained trainedwithwithananartificial artificialvagina vaginaatat4.54.5months monthsofofage.age. AA homemade homemade polyvinyl polyvinylchloride chloride artificial vagina artificial vaginacontaining water containing at a temperature water of 50 ◦ Cofwas at a temperature 50 used. °C was Oneused. ejaculate One was collected ejaculate was per male. per collected Ejaculates that contained male. Ejaculates urine and that contained calcium urine carbonate and calcium depositsdeposits carbonate on visual on inspection were discarded. visual inspection were discarded. 2.3. 2.3. Experimental ExperimentalDesign Design Figure Figure 11displays displaysthe theexperimental experimentaldesign designfollowed followedin inthis thisstudy. study. Two Twoseparate separateexperiments experiments were performed. were performed. Figure1.1.Representation Figure Representationof the of experimental designdesign the experimental and tissue andsections tissue obtained sections from does. from obtained Sequential does. tissue Sequential tissue segments derived from does: endocervix (Cvx), distal uterus (DistUt), (ProxUt), segments derived from does: endocervix (Cvx), distal uterus (DistUt), proximal uterus proximal utero-tubal junction uterus (ProxUt), (UTJ), isthmus utero-tubal (Isth), junction (UTJ),ampulla isthmus(Amp), and infundibulum (Isth), ampulla (Amp), and(Inf). Intramuscular infundibulum (Inf). injection of 0.03 mg gonadotropin-releasing hormone (GnRH) was used to induce Intramuscular injection of 0.03 mg gonadotropin-releasing hormone (GnRH) was used to induceovulation in all groups of both experiments. ovulation in all groups of both experiments. In Experiment 1 (n = 9), gene expression analyses for ABHD2, NGF, CTEN, and VCAN were performed in sequential segments of the female reproductive tracts randomly chosen from one lateral Genes 2020, 11, 758 4 of 16 In Experiment 1 (n = 9), gene expression analyses for ABHD2, NGF, CTEN, and VCAN were performed in sequential segments of the female reproductive tracts randomly chosen from one lateral side. Tissue samples were collected 20 h post-induction of ovulation with 0.03 mg gonadotropin-releasing hormone (GnRH; Fertagyl® , Esteve Veterinaria, Barcelona, Spain) intramuscularly (im) (control of ovulation; Control, n = 3), 20 h post-induction of ovulation with 0.03 mg GnRH im and sperm-free SP vaginal infusion (SP-AI, n = 3), and 20 h post-induction of ovulation with 0.03 mg GnRH im and natural mating (NM, n = 3). The control group was established to highlight the effects of the SP infusion and mating, thus counteracting ovulation effects. In Experiment 2, 15 does were sequentially euthanized at 10, 24, 36, 68, or 72 h post-induction of ovulation with 0.03 mg GnRH im and natural mating (n = 3/collection time). Reproductive tract tissues, as described in Experiment 1, were collected for ABHD2, NGF, CTEN, and VCAN gene expression analysis. The 10 h post-mating group was established as the reference group. 2.4. Mating and Semen Collection The does included in the mating group of Experiment 1 and 2 were sequentially mated with two randomly selected bucks to diminish male-variation effects after the hormonal induction of ovulation with 0.03 mg GnRH im. The ovulation was assumed to happen at 10 h after GnRH stimulation for all groups. Additionally, semen was collected from the same rabbit bucks through an artificial vagina, as described above. The sperm-free SP was obtained after centrifugation at 2000× g for 10 min and checked for the absence of spermatozoa. The harvested sperm-free SP was immediately used as a pool for sperm-free SP vaginal infusions of Experiment 1 after the hormonal induction of ovulation with 0.03 mg GnRH im. 2.5. Tissue Sample Collection For each experimental condition, the does were euthanized by the administration of 600 mg pentobarbital sodium (Dolethal, Vetoquinol, Madrid, Spain) intravenously (marginal ear vein). Immediately thereafter, the right female reproductive tracts were chosen from the right lateral side in all animals and retrieved and segmented in seven consecutive compartments (endocervix, distal uterus, proximal uterus, utero-tubal junction, distal isthmus, ampulla, and infundibulum; Figure 1). In Experiment 2, before segmentation of the internal genital tract, the entire oviduct was isolated from the uterus and the ovary by cutting below the utero-tubal junction. Embryos were collected by flushing the oviduct through the infundibulum (phosphate buffer saline supplemented with 5% fetal calf serum and 1% antibiotic-antimycotic solution). All genital segments were stored in RNAlater solution at −80 ◦ C. 2.6. Quantitative PCR Analyses Total RNA was extracted following a TRIzol-based protocol. Tissues were mechanically disrupted in a 2-mL tube with 1 mL TRIzol using a bead mill (29 beats/s, 2 min) (TissueLyser II with 7 mm stainless steel beads, Qiagen, Sollentuna, Sweden). The homogenized tissues were centrifuged at 12,000× g for 10 min at 4 ◦ C. The supernatants were transferred to a new 2-mL tube and mixed by hand with bromochloropropane (100 µL/mL homogenized). After 5-min of incubation at room temperature, the mixtures were centrifuged 12,000× g for 15 min at 4 ◦ C. The aqueous phases obtained were transferred to a new 1.5-mL tube with isopropanol and RNA precipitation solution (1.2 M NaCl and 0.8 M Na2 C6 H6 O7 ) (250 µL of each/500 µL aqueous phase). After 10-min of incubation at room temperature, the mixtures were centrifuged 12,000× g 10 min at 4 ◦ C. The supernatants were discarded, and 1 mL of 75% ethanol was added to each tube. The tubes were centrifuged 7500× g for 5 min at 4 ◦ C and the supernatants were discarded. The RNA pellets obtained were dried for 30 min in the fume hood before their dissolution in 30 µL of RNase free water for 30 min on ice. The RNA concentration of the extracts was determined from the absorbance of 260 nm with Thermo Scientific NanoDropTM 2000 (Fisher Scientific, Gothenburg, Sweden). All of the samples had a 260/280 nm absorbance ratio Genes 2020, 11, 758 5 of 16 of 1.8–2.2. Additionally, the quality of the RNA was determined by the Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA), using the samples with a RNA integrity number (RIN) value higher than 8. The synthesis of the first-strand cDNA was performed using the High-Capacity RNA-to-cDNA™ Kit (Applied Biosystems™, CA, USA), which consisted of 4 µg RNA in a final volume of 20 µL. After the synthesis, the samples were stored at −20 ◦ C until further analyses. A Quantitative Polymerase Chain Reaction (qPCR) was performed using the Real-Time PCR Detection System (CFX96™; Bio-Rad Laboratories, Inc; CA, USA). The reactions consisted of 2 µL of synthesized cDNA, 250 nM of forward and reverse specific gene primers, 5 µL of PowerUp™ SYBR™ Green Master Mix (Applied Biosystems™, CA, USA), and water to a final volume of 10 µL. The protocol was as follows: one cycle of uracil-DNA glycosylase (UDG) activation at 50 ◦ C for 2 min; one cycle of denaturation at 95 ◦ C for 2 min; and 40 cycles of denaturation at 95 ◦ C for 5 s, annealing/extension at 60.2 ◦ C for 30 s, and a melting curve at 60–95 ◦ C (0.5 ◦ C increments) for 5 s/step. Two technical replicates were used for each sample. The efficiencies of the primers were calculated using five different concentrations of the same cDNA sample (serial dilutions of 1/5) and the same protocol described above. Three technical replicates were used for each concentration. The gene relative expression levels were quantified using the Pfaffl method [31]. Two housekeeping genes were initially used for cDNA normalization (β-ACTIN and GADPH). After a preliminary analysis of the results, only β-ACTIN was constantly expressed through the tissues and treatments, and was chosen for further analyses. The primer sequences, product sizes, and efficiencies are shown in Table 1. For the β-ACTIN gene, commercial gene-specific PCR primers for rabbit samples were used (PrimePCR™ SYBR® Green Assay: ACTB, Rabbit; Bio-Rad Laboratories, Inc; CA, USA). The amplicons of the qPCR were loaded into an agarose gel after being mixed with GelRed® Nucleic Acid Gel Stain (Biotium, CA, USA) to confirm the product sizes. After running the test, the gel was imaged by a gel imaging system (ChemiDoc XRS+ System, BioRad Laboratories, Inc; CA, USA). Table 1. Primers used for the quantitative PCR analyses. Gene Primer Sequence (50 –30 ) Product Size (bp) Efficiency (%) ABHD2 F: CGGAGCCACTTCTACTTTCG 159 87.7 R: GCACACCGATAGCCATTTTT β-ACTIN F: unknown 120 88.6 R: unknown CTEN F: TGGTCCACTTCAGAGTCACG 211 97.3 R: AAGAGGTGGCACACGTTCTC NGF F: CCCCTCCAACAGGACTTACA 138 103.7 R: ACCTCATTGCCCTTGATGTC VCAN F: TGCACCACAACCAACAGATT 177 89.5 R: AGCTGCGAAGAGATGTGGTT ABHD2: α/β hydrolase domain-containing protein 2; β-ACTIN: β-actin; CTEN: C-terminal tensin-like protein; NGF: nerve growth factor; VCAN: versican; F: forward; R: reverse; A: adenine; C: cytosine; G: guanine; T: thymine; bp: base pair. 2.7. Statistical Analyses All data were exported with CFX Maestro™ 1.1 software version 4.1.2433.1219 (Bio-Rad Laboratories, Inc; CA, USA). All data sets were analyzed for a normal distribution and homoscedasticity using the Shapiro–Wilk Normality test and Levene’s test. Log(x) transformation was used to restore a normal distribution prior to analysis. The statistical analysis was conducted in R version 3.6.1. [32] with nlme [33] to develop linear mixed-effects (LME) models and multcomp [34] to perform pairwise comparisons adjusted by Tukey’s test. Data are presented as the median [minimum, maximum], unless otherwise stated. The threshold for significance was set at p < 0.05. Treatments of Experiment 1 (control, SP-AI, and NM) were included as fixed effects and the females as the random part of the model. Pairwise comparisons were adjusted by Tukey’s test. Genes 2020, 11, 758 6 of 16 A second LME model was used, including the different collection times of Experiment 2 (10, 24, 36, 68, and 72 h post-mating) as fixed effects and the females as the random part of the model. Post-hoc comparisons were performed using Tukey’s multiple comparisons test. Additionally, the differential expression changes in the qPCR results among tissues (endocervix to infundibulum) in Experiments 1 and 2 were further re-analyzed, separately. Using the utero-tubal junction as an arbitrary anatomical compartment reference among all tissues examined, gene expression changes were compared, per gene, issued by the control, NM, or SP-AI (Experiment 1) or by different times post-mating (Experiment 2), among the anatomical regions of the female reproductive tract. The tissue was included as fixed effects and the females as the random part of the LME model. The LME model was followed by Tukey’s multiple comparison test, to analyze the differences among each anatomical region of the female reproductive tract. Data are presented as the median [minimum, maximum], unless otherwise stated. Data on the differential expression among tissues are presented as Row Z-Scores. The first statistical analyses were conducted to determine gene expression changes among the experimental groups for each tissue section, whereas the second statistical analyses were conducted to determine the differences between the tissue segments for every experimental group. Both analyses used the same data (expression values), but were analyzed to emphasize, in the first analysis, the different treatments and post-mating times, and in the second analysis, the differential expression among tissues. 3. Results 3.1. Differential Gene Expression in the Rabbit Female Reproductive Tract 20 h after Natural Mating or Vaginal Infusion With Sperm-Free Seminal Plasma Differences in ABHD2, NGF, and CTEN expression among the groups included in Experiment 1 are displayed in Figure 2. No differences were found in the distal isthmus, which is the sperm reservoir established in the rabbit [10]. The ABHD2 expression was downregulated by the NM group in the utero-tubal junction (p < 0.05), and downregulated by NM and SP-AI groups in the ampulla (p < 0.05). Conversely, the SP-AI group upregulated ABHD2 expression in the infundibulum compared to the NM group (p < 0.01). The NGF expression was upregulated by the NM group in the distal and proximal uterus (p < 0.05). However, the SP-AI group upregulated NGF expression in the endocervix (p < 0.05). The CTEN expression was upregulated by the NM group in the endocervix, and proximal and distal uterus (p < 0.01). Additionally, the SP-AI group downregulated CTEN expression in the endocervix and ampulla (p < 0.01). The results obtained from all of the genes and tissues analyzed are depicted in Figure S1. Genes 2020, 11, 758 7 of 16 Genes 2020, 11, x FOR PEER REVIEW 7 of 16 Figure 2. Results Figure of of 2. Results Experiment Experiment1.1. Gene expressionofof(A) Gene expression ABHD2, (A)ABHD2, (B)(B) NGF,NGF, andand (C) CTEN (C) CTEN was was statistically significant (p < statistically significant (p < 0.05) in the rabbit endocervix (Cvx), distal uterus (DistUt), proximal uterusuterus 0.05) in the rabbit endocervix (Cvx), distal uterus (DistUt), proximal (ProxUt), utero-tubal (ProxUt), junction utero-tubal (UTJ), junction ampulla (UTJ), ampulla(Amp), (Amp),andandinfundibulum infundibulum (Inf)(Inf)2020hhafter after the the induction of induction ovulation with an intramuscular injection of 0.03 mg gonadotropin-releasing hormone (GnRH) (20 of ovulation with an intramuscular injection of 0.03 mg gonadotropin-releasing hormone (GnRH) (20 h_C, n = 3), h_C, 20 nh=post-GnRH-stimulation 3), 20 h post-GnRH-stimulation and seminal and seminal plasmaplasma vaginal vaginal infusion infusion (20(20 h_SP-AI,nn== 3), h_SP-AI, 3), and and 20 h 20 h post-GnRH-stimulation post-GnRH-stimulation and natural and natural matingmating (20 h_NM, (20 h_NM, n =n3).= 3).Fold Foldchanges changes relative relativetotothe control the control of of the ovulation group are shown. Different letters a,b (a,b) represent statistical differences between the ovulation group are shown. Different letters ( ) represent statistical differences between groups groups (p < 0.05). Median [minimum, maximum]. (p < 0.05). Median [minimum, maximum]. 3.2. Differential 3.2. Differential GeneGene Expression Expression ininthe theRabbit RabbitFemale Female Reproductive ReproductiveTract Tractfrom Ovulation from (10 (10 Ovulation h Post- h Post-Mating) to up Mating) to up to 72 h Post-Mating to 72 h Post-Mating Differences Differences in ABHD2, in ABHD2, NGF,NGF, CTEN,CTEN, and VCAN and VCAN expression expression amongamong groupsgroups included included in in Experiment Experiment 2 are displayed in Figure 3. The ABHD2 expression was upregulated at 24, 36, and 72 h 2 are displayed in Figure 3. The ABHD2 expression was upregulated at 24, 36, and 72 h post-mating in the utero-tubal junction (p < 0.05), whereas it was downregulated at 24, 36, 68, and 72 h post-mating in the infundibulum (p < 0.001). The NGF expression was downregulated in the endocervix at 36 h post-mating (p < 0.01); downregulated in the distal and proximal uterus at 36, 68, and 72 h post-mating Genes 2020, 11, x FOR PEER REVIEW 8 of 16 post-mating in the utero-tubal junction (p < 0.05), whereas it was downregulated at 24, 36, 68, and 72 h post-mating Genes 2020, 11, 758 in the infundibulum (p < 0.001). The NGF expression was downregulated in 8 ofthe 16 endocervix at 36 h post-mating (p < 0.01); downregulated in the distal and proximal uterus at 36, 68, and 72 h post-mating (p < 0.05); upregulated in the distal isthmus at 36, 68, and 72 h post-mating (p < (p < 0.05); 0.05); andupregulated downregulated in theindistal isthmus at 36, 68, the infundibulum at and 24, 72 36,h68, post-mating and 72 h (p < 0.05); and(p post-mating downregulated < 0.001). The in the infundibulum at 24, 36, 68, and 72 h post-mating (p < 0.001). CTEN expression followed an NGF expression pattern with a time lag of hours in the uterine The CTEN expression followed tissues.an NGF At 24expression h post-mating,pattern the with CTEN a time lag of hours expression in the uterine was upregulated tissues. in the At 24 h (p endocervix post-mating, the CTEN < 0.01). Additionally, expression was upregulated in the endocervix (p < 0.01). Additionally, the CTEN expression was downregulated in the distal uterus at 68 and 72 h post-mating (p < 0.05); the CTEN expression was downregulated in the distal uterus at 68 and 72 h post-mating (p < 0.05); upregulated upregulated in the utero-tubal junction at 24 h post-mating (p < 0.001); upregulated in the isthmus at in the utero-tubal junction 24 and 72ath 24 h post-mating post-mating (p < and (p < 0.05); 0.001); upregulated at downregulated in24, the36, isthmus 68, andat7224h and 72 h post-mating post-mating (p < 0.05). (p < 0.05); and downregulated at 24, 36, 68, and 72 h post-mating The VCAN expression was downregulated in the endocervix at 36 and 72 h post-mating (p < 0.05). The VCAN expression was (p < 0.05); downregulated in downregulated in the the distal endocervix uterusatat36 24and and72 68hhpost-mating post-mating(p (p << 0.05); downregulated at 0.05); downregulated in 24 thehdistal post- uterus at 24 and 68 h post-mating (p < 0.05); downregulated at 24 h post-mating mating in the proximal uterus (p < 0.001); and downregulated in the infundibulum at 24, 36, 68, in the proximal uterus and 72