1   APPENDIX PDF

 2

 3   Adaptation to plant shade relies on rebalancing the transcriptional activity of

 4   the PIF7-HFR1 regulatory module.

 5

 6   Sandi Paulišić, Wenting Qin, Harshul Arora Verasztó, Christiane Then, Benjamin

 7   Alary, Fabien Nogue, Miltos Tsiantis, Michael Hothorn, Jaime F. Martínez-García

 8

 9   APPENDIX TABLE OF CONTENTS

10     1. Appendix Figure S1.

11     2. Appendix Figure S2.

12     3. Appendix Supplementary Methods.

13     4. Appendix Table S1.

14     5. Appendix Table S2.

15     6. Appendix Table S3.

16     7. Appendix References.

17

18

19




                                             1
 1   1. APPENDIX FIGURE S1.

 2




                                                                                            W+FR
                                                                                        W
                                                In A. thaliana hfr1-5                              Line:
 3
                                                  pAtHFR1         ChHFR1-3xHA                      hfr1>pAt:ChHFR1

 4                                                pAtHFR1         AtHFR1-3xHA                      hfr1>pAt:AtHFR1
                                                A. thaliana wild-type Col-0                        At WT
 5                                              A. thaliana hfr1-5                                 At hfr1-5

                                            7
 6
                                            6
 7
                                            5
 8
                    Hypocotyl length (mm)




                                            4

 9                                          3

10                                          2


11                                          1

                                            0
12                                                                 #24   #32      #22       #11        #13     #21
                                                          At
                                                  At WT hfr1-5
                                                  Col-0 hfr1-5     hfr1>pAt:ChHFR1
                                                                   hfr1>pAt:ChHFR1           hfr1>pAt:AtHFR1
                                                                                             hfr1>pAt:AtHFR1
13

14   Appendix Figure S1. ChHFR1 and AtHFR1 complement the A. thaliana hfr1-5

15   mutant long hypocotyl phenotype. Hypocotyl length of the shown lines grown as

16   indicated in Fig 3C. Values were used to generate data on Fig 3C.

17




                                                                              2
 1   2. APPENDIX FIGURE S2.

 2

 3                                                                                                **           **
                                      250
                                             PIF7
 4                                    240
                                             HFR1
                                      230
 5
                Relative expression




                                      220
                                      210
 6                                    200
                                       50
                                      40
 7
                                      30
                                      20
 8
                                      10

 9                                     0

                                            At WT
                                            Col-0   35S:ΔNt-
                                                    35S:ΔNt-    35S:PIF7
                                                               35S:PIF7      35S:PIF7
                                                                        (1) 35S:PIF7 (2)    35S:ΔNt-
                                                                                            35S:ΔNt-     35S:ΔNt-
                                                                                                         35S:ΔNt-
                                                                   #1           #2           HFR1 x       HFR1 x
10                                                    HFR1
                                                                                            35S:PIF7     35S:PIF7
                                                                                           35S:PIF7 (1) 35S:PIF7 (2)
                                                                                               #1           #2
11

12

13   Appendix Figure S2. Relative expression levels of AtHFR1 and AtPIF7 genes

14   in transgenic lines overexpressing GFP-ΔNt-HFR1 and/or PIF7-CFP. Relative

15   expression, normalized to UBQ10, was estimated in seedlings grown for 7 days in

16   W. Expression values are the mean ± SE of three independent biological replicates

17   relative to AtWT. Asterisks mark significant differences in expression (Student t-test:

18   ** p-value <0.01; * p-value <0.05) relative to 35S:GFP-ΔNt-HFR1-GFP or

19   35S:PIF7-CFP values.

20

21




                                                                     3
 1   3. APPENDIX SUPPLEMENTARY METHODS.

 2

 3   Generation of RNAi-HFR1 plants of C. hirsuta

 4         To generate an RNAi construct for silencing of the endogenous ChHFR1, a

 5   fragment of 222 bp was PCR amplified using primers CTO35 + CTO36 (Appendix

 6   Table S2) and cDNA of 7-day old C. hirsuta seedlings grown 1 h under W+FR. This

 7   partial fragment of ChHFR1 (ptChHFR1) was cloned into pCRII-TOPO (Invitrogen,

 8   www.thermofisher.com) to generate pCT17, which was confirmed by sequencing.

 9   An EcoRI fragment of pCT17 was subcloned into pENTR3C vector (Invitrogen), to

10   create the Gateway entry clone pCT19 (to have ptChHFR1 flanked with attL1 and

11   attL2, attL1<ptChHFR1<attL2). Recombination of pCT19 with the destination

12   vector pB7GWIWG2(I), which contains attR1 and attR2 sites, using Gateway LR

13   Clonase II (Invitrogen), gave pCT33 (35S:attB1<RNAi-ChHFR1<attB2). This

14   plasmid is a binary vector conferring resistance to the herbicide phosphinothricin

15   (PPT) in plants and the antibiotic spectinomycin in bacteria. Agrobacterium

16   tumefaciens    strain   C58C1   (pGV2260)   was   transformed   with   pCT33   by

17   electroporation and colonies were selected on solid YEB medium with rifampicin

18   (100 µg/mL), kanamycin (25 µg/mL) and spectinomycin (100 µg/mL). Wild-type C.

19   hirsuta (Ox, ChWT) plants were transformed by floral dipping and transgenic

20   seedlings were selected on 0.5xGM- medium (Roig-Villanova et al, 2006)

21   containing 50 µg/mL PPT. Transgene in seedlings of T1 generation was verified by

22   PCR genotyping using specific primers. Plants homozygous for the transgene were

23   finally used for experiments.

24

                                             4
 1   Isolation of HFR1 mutants of C. hirsuta

 2         To obtain loss-of-function mutants of ChHFR1 in C. hirsuta (named as chfr1)

 3   we employed the CRISPR-Cas9 gene editing system (Morineau et al, 2017). The

 4   guide RNA targeting ChHFR1 (gRNAChHFR1, 5’-GTT-GAA-GAC-TGC-AGA-TTT-GT-

 5   3’) was synthesized to be under the control of the A. thaliana U6 promoter (pU6)

 6   sequence and flanked by the Gateway attB1 and attB2 recombination sites (IDT,

 7   https://eu.idtdna.com/pages) (attB1<pU6:gRNAChHFR1<attB2). This sequence was

 8   recombined with the vector pDONR207 using Gateway BP Clonase II (Invitrogen)

 9   to generate the entry vector pSP101 (attL1<pU6:gRNAChHFR1<attL2). In a

10   recombination reaction of pSP101 with pDE-Cas9 (Fauser et al, 2014) using

11   Gateway    LR    Clonase     II,   a   binary   vector   pSP102     was    created

12   (attB1<pU6:gRNAChHFR1<attB2, Cas9). This vector, that contains the information to

13   target ChHFR1, confers resistance to PPT in plants and spectinomycin in bacteria.

14   A. tumefaciens strain C58C1 (pGV2260) was transformed with pSP102 by

15   electroporation and colonies were selected on solid YEB medium with antibiotics,

16   as indicated before for pCT33. Wild-type C. hirsuta (Ox, ChWT) plants were

17   transformed by floral dipping and resistant transgenic seedlings were selected on

18   0.5xGM- medium containing PPT (30 µg/mL). These T1 seedlings were PCR

19   genotyped using primers MJO27 and MJO28 (Appendix Table S2) to detect the

20   presence of the transgene. In the following T2 generation, a total of six seedlings

21   with a sis phenotype from 1 independent transgenic line were selected and grown

22   to maturity. An HFR1 fragment of 664 bp around the gRNAChHFR1 target sequence

23   was amplified by PCR from gDNA of each plant using primers CTO29 + CTO36

24   (Appendix Table S2). Sequencing of these fragments indicated the presence of
                                              5
 1   mutations in the ChHFR1 gene. Descendants of these plants (T3 generation) were

 2   reselected in shade and sequenced to confirm the unambiguous presence of the

 3   mutated chfr1 alleles. In the T4 generation, seedlings sensitive to PPT (indicating

 4   the loss of T-DNA insertion) were selected, which resulted in the isolation of the

 5   chfr1-1 and chfr1-2 mutant allele lines (Fig EV1). The wild-type and these mutant

 6   alleles were genotyped by PCR using primers SPO104 + SPO107 (for ChPIF7),

 7   SPO105 + SPO107 (for chfr1-1) and SPO106 + SPO107 (for chfr1-2) (Appendix

 8   Table S2).

 9

10   Generation of A. thaliana hfr1-5 transgenic lines expressing AtHFR1 or

11   ChHFR1 under the control of different promoters

12         We amplified a 2 kbp fragment of AtHFR1 promoter starting immediately

13   before the ATG of AtHFR1 gene using gDNA of A. thaliana wild-type Col-0 (AtWT)

14   as a template and primers SPO26 + SPO27 (Appendix Table S2). This fragment

15   was subcloned into pCRII-TOPO to generate pSP51. From the different clones

16   analyzed, the best one was pSP51.10, with three 1 bp-deletions in the amplified

17   region, none affecting the G-boxes, known to be necessary for PIF binding.

18         AtHFR1 coding sequence was amplified from pJB30 (Galstyan et al, 2011)

19   using primers RO25 + SPO30 (Appendix Table S2), which removed the stop codon

20   and introduced a XhoI site at the N-terminal site. After subcloning this fragment into

21   pCRII-TOPO, which gave pSP54 (AtHFR1), the insert was sequenced to confirm

22   its identity. The 3xHA fragment was amplified from plasmid pEN-R2-3xHA-L3

23   (Karimi et al, 2007) and primers SPO31 (which added a SalI site) + SPO32 (which

24   added a XhoI site, Appendix Table S2). This fragment was subcloned into pCRII-
                                               6
 1   TOPO to generate pSP55 (3xHA), whose insert was sequenced to confirm its

 2   identity. A BamHI-XhoI fragment of pSP54 was subcloned into pSP55 digested

 3   with BamHI and SalI to generate pSP57 (AtHFR1-3xHA). A BamHI-XhoI fragment

 4   of pSP57 was subcloned into the same sites of pENTR3C vector which gave

 5   pSP59. This plasmid contained AtHFR1-3xHA, with an extra XbaI site in the C-

 6   terminus end, flanked with attL1 and attL2 sites (attL1<AtHFR1-3xHAXbaI<attL2).

 7   XbaI restriction site in pSP59 was removed by filling the site with Klenow enzyme

 8   after digestion, and religation to generate pSP84 (attL1<AtHFR1-3xHA<attL2).

 9   Recombination of pSP84 with the binary vector pIR101 (attR1<ccdB<attR2)

10   (Molina-Contreras et al, 2019) (using Gateway LR Clonase II) resulted in pSP88

11   (attB1<AtHFR1-3xHA<attB2). An XbaI fragment of pSP51 was subcloned into the

12   same site of pSP88 which gave pSP90 (pAtHFR1:attB1<AtHFR1-3xHA<attB2).

13   This binary vector confers resistance to spectinomycin in bacteria and PPT in

14   plants.

15         ChHFR1 CDS was amplified using cDNA from wild-type C. hirsuta (Ox,

16   ChWT) seedlings and primers SPO28 + SPO29 (Appendix Table S2), which

17   removed the stop codon and introduced a XhoI site. This PCR product was

18   subcloned into pCRII-TOPO to generate pSP53 (ChHFR1). Selected colonies were

19   sequenced to confirm their identity. A BamHI-XhoI fragment of pSP53 was

20   subcloned into pSP55 digested with BamHI-SalI to generate pSP56 (ChHFR1-

21   3xHA). A BamHI-XhoI fragment of pSP56 was subcloned into the same site of

22   pENTR3C vector, which gave pSP58. This plasmid contained ChHFR1-3xHA, with

23   an XbaI site in the C-terminus end, flanked with attL1 and attL2 sites

24   (attL1<ChHFR1-3xHAXbaI<attL2). XbaI restriction site in pSP58 was removed by
                                            7
 1   filling the site with Klenow enzyme after digestion, and religation to generate

 2   pSP83 (attL1<ChHFR1-3xHA<attL2). Recombination of pSP83 with the binary

 3   vector pIR101 using Gateway LR Clonase II resulted in pSP87 (attB1<ChHFR1-

 4   3xHA<attB2). An XbaI fragment of pSP51 was subcloned into the same site of

 5   pSP87 which gave pSP89 (pAtHFR1:attB1<ChHFR1-3xHA<attB2). This binary

 6   vector confers resistance to spectinomycin in bacteria and PPT in plants.

 7         To overexpress ChHFR1, a BamHI-XhoI fragment of pSP58 was subcloned

 8   into the BamHI-SalI digested pCAMBIA1300 based pCS14 (Sorin et al, 2009) to

 9   generate pSP81 (35S:ChHFR1-3xHA). This binary vector confers resistance to

10   kanamycin in bacteria and hygromycin in plants.

11         A. thaliana hfr1-5 plants were transformed with pSP81, pSP89 and pSP90,

12   as previously described. Transgenic seedlings were selected on 0.5xGM- medium

13   with PPT (15 µg/mL) or hygromycin (30 µg/mL), verified by PCR genotyping using

14   specific primers. Homozygous transgenic plants with 1 T-DNA insertion were finally

15   used for experiments.

16

17   Generation of constructs for transient expression in N. benthamiana leaves

18         To overexpress ChHFR1 and AtHFR1 in N. benthamiana, a Gateway vector

19   was created using pCAMBIA1302 (35S:mGFP5) as a backbone. An NsiI-HindIII

20   fragment of pEarlyGate 100 (35S:attR1<ccdB<attR2) (Earley et al, 2006) was

21   subcloned into pCAMBIA1302 digested with PstI-HindIII, which gave pSP135

22   (35S:attR1<ccdB<attR2, 35S:mGFP5). Recombination of pSP58 and pSP59 (both

23   linearized with NheI) with the binary vector pSP135 using Gateway LR Clonase II

24   gave pSP141 (35S:attB1<ChHFR1-3xHA<attB2, 35S:mGFP5) and pSP142
                                              8
 1   (35S:attB1<AtHFR1-3xHA<attB2, 35S:mGFP5), respectively. These two binary

 2   vectors also overexpress mGFP5 and confer resistance to kanamycin in bacteria.

 3         To generate constructs overexpressing ChHFR1 and AtHFR1 with the

 4   COP1 binding domains exchanged (Fig 5C), we employed a PCR-based

 5   mutagenesis. Using pSP90 as a template, a fragment of 205 bp was amplified with

 6   RO25 and SPO126 primers, and a larger fragment of 821 bp was amplified using

 7   SPO127 and SPO32 primers. Both PCR fragments were used to amplify AtHFR1

 8   with the COP1 binding domain from ChHFR1 (named in here as AtHFR1*). The

 9   resulting fragment was subcloned into pCR8/GW/TOPO (Invitrogen) to generate

10   pSP130, which was confirmed by sequencing. Using pSP89 as a template, a

11   fragment of 291 bp was amplified with SPO28 and SPO128 primers, and a

12   fragment of 800 bp was amplified using SPO129 and SPO32. Both PCR fragments

13   were used to amplify ChHFR1 with the COP1 binding domain from AtHFR1

14   (named in here as ChHFR1*). The resulting fragment was subcloned into

15   pCR8/GW/TOPO to generate pSP131, which was confirmed by sequencing.

16   Recombination of pSP130 and pSP131 with the binary vector pSP135 using

17   Gateway    LR   Clonase    II   gave   pSP132   (35S:attB1<AtHFR1*-3xHA<attB2,

18   35S:mGFP5)      and   pSP133    (35S:attB1<ChHFR1*-3xHA<attB2,       35S:mGFP5),

19   respectively. Both vectors also overexpress mGFP5 and confer resistance to

20   kanamycin in bacteria.

21         N. benthamiana plants were agroinfiltrated with the A. tumefaciens (strain

22   GV3101) transformed with pSP141, pSP142, pSP132 or pSP133, and the same

23   strain expressing the HcPro protein (Vilela et al, 2013) and kept in the greenhouse

24   under long-day photoperiods. Samples were taken 3 days after agroinfiltration.
                                             9
 1

 2   Generation of constructs for the Yeast 2 Hybrid (Y2H) assays

 3         AtPIF7 CDS was amplified using cDNA of A. thaliana wild-type Col-0 (AtWT)

 4   seedlings and primers JO414 + JO415 (Appendix Table S2), which removed the

 5   STOP codon and introduced a XhoI site. This PCR product was subcloned into

 6   pCRII-TOPO to generate pRA1 (AtPIF7). The insert was sequenced to confirm its

 7   identity. A XhoI fragment of pRA1 was subcloned into pSP55 digested with SalI to

 8   generate pRA2 (AtPIF7-3xHA). An EcoRI fragment of pRA2 was subcloned into

 9   the same site of pENTR3C entry vector which gave pRA3 (attL1<AtPIF7-

10   3xHA<attL2). This PIF7-3xHA had a stop codon immediately before the ATG,

11   which prevented from cloning it in frame with the yeast derived proteins. Therefore,

12   the PIF7-3xHA gene was PCR amplified using pRA3 as a DNA template and

13   primers BAO4 + BAO5 (Appendix Table S2) to add attB1 and attB2 sequences

14   (attB1<AtPIF7-3xHA<attB2). This fragment was recombined with pDONR207 using

15   Gateway BP Clonase II to obtain pBA7 (attL1<AtPIF7-3xHA<attL2). The insert was

16   sequenced to confirm its identity. In a recombination reaction of pBA7 and

17   pGBKT7-GW (Chini et al, 2009) which contained the Gal4 DNA-binding domain

18   (BD, attR1<ccdB<attL2; it confers Trp auxtrophy), and pBA7 and pGADT7-GW

19   (Chini et al, 2009) which contained the Gal4 activation domain (AD,

20   attR1<ccdB<attL2; it confers Leu auxtrophy), using Gateway LR Clonase II, pBA10

21   (BD-attB1<AtPIF7-3xHA<attB2) and pBA11 (AD-attB1<AtPIF7-3xHA<attB2) were

22   obtained. These plasmids allowed expressing the fusion BD-PIF7-3xHA or AD-

23   PIF7-3xHA proteins under the ADH1 promoter in yeast, respectively.

24

                                             10
 1   Protein expression and purification for the MST experiments

 2           Sf9 cells were cultured in HyClone SFX-Insect Cell Culture Media. The

 3   codon optimized COP1 gene (residues 349-765 corresponding to the WD40

 4   domain) for expression in Sf9 cells, was PCR amplified and cloned into a modified

 5   pFastBac (Geneva Biotech) insect cell expression vector using Gibson assembly

 6   (Gibson et al, 2009). The final construct contained a tandem N-terminal His10-

 7   Twin-Strep-tags, a TEV (tobacco etch virus protease) cleavage site prior to COP1

 8   WD40 coding sequence in the pFastBac vector. This construct was transformed

 9   into DH10MultiBac cells (Geneva Biotech). White colonies, implying successful

10   recombination, were selected and bacmids were purified by the alkaline lysis

11   method. Sf9 cells were transfected with the bacmid using Profectin (AB Vector).

12   eYFP-positive cells (P0) were observed after 1 week and subjected to two rounds

13   of viral amplification. Sf9 cells at a density of 1–2 x 106 cells·ml-1 were infected with

14   amplified P2 virus at a Multiplicity of infection (MOI) between 2 to 3. Infected Sf9

15   cells were grown for 72 h at 28°C and 110 rpm. The cell pellet was then harvested

16   by centrifugation at 2000 x g for 15 min, pellets were flash frozen and stored at –

17   20°C.

18           Pellets from one liter of Sf9 cell culture were dissolved in 25 ml of buffer A

19   (20 mM HEPES pH 7.5, 300 mM NaCl, 2 mM β-ME), supplemented with 10% [v/v]

20   glycerol, a pinch of DNase, and 1 Roche cOmpleteTM protease inhibitor tablet.

21   Dissolved pellets were lysed by sonication and centrifuged at 60,000 x g for 45

22   minutes at 4°C. The supernatant was consecutively filtered through 2-μm 1-μm and

23   0.45-μm filters prior to loading onto Ni2+-affinity column (HisTrap excel, GE

24   Healthcare). After the loading, Ni2+-affinity column was washed with buffer A and
                                                11
 1   eluted directly onto a coupled Strep-Tactin Superflow XT column (IBA) using buffer

 2   B (20 mM HEPES pH 7.5, 500 mM NaCl, 500 mM imidazole, 2 mM β-ME). The

 3   Strep-Tactin column was washed with buffer A and COP1 was eluted with 1x

 4   Buffer BXT (IBA) supplemented with 2 mM β-ME. It was cleaved overnight at 4°C

 5   with TEV protease and subsequently purified from the protease and affinity tag by

 6   a second Ni2+ affinity column. COP1 WD40 was concentrated to 10 μM and was

 7   labeled immediately.

 8

 9   GUS lines

10         Transgenic lines expressing GUS were based on a modified pIR101 plasmid

11   (Molina-Contreras et al, 2019) which contains the reporter GUS gene in a

12   promoterless context (attB1<GUS<attB2). XbaI fragment of pSP51 was subcloned

13   into the same site of modified pIR101 to give pSP86 (pAtHFR1:attB1<GUS<attB2).

14   This binary vector confers resistance to spectinomycin in bacteria and PPT in

15   plants. A. thaliana wild-type Col-0 (AtWT) plants were transformed with this

16   construct as described previously.

17

18   GUS staining

19         Histochemical GUS assays were done as described (Roig-Villanova et al,

20   2006), incubating seedlings at 37ºC without ferricyanide/ferrocyanide.

21

22

23



                                             12
1   4. APPENDIX TABLE S1. Primers used for gene expression analyses. Primers

2   BO40 and BO41 for amplifying UBQ10 (Sorin et al, 2009), SPO102 and SPO103

3   (AtEF1α and ChEF1α), SPO113 and SPO114 (AtSPC25 and ChSPC25), and

4   SPO115 and SPO116 (AtYLS8 and ChYLS8) have been described before (Molina-

5   Contreras et al, 2019).

6

                              Primer
     Gene                                  Sequence (5’ – 3’)
                              name
                              CTO9 (F)     GGCCGATTGTGCTGTCCTTA
     ChEF1α
                              CTO10 (R)    TCACGGGTCTGACCATCCTTA
                              CTO13 (F)    CGGCGTCGTGTCCAGATC
     ChHFR1
                              CTO14 (R)    TGAACCTTTTCGCGTCAGTG
                              CTO17 (F)    GAAGACCCCAAAACAACGGTT
     ChPIL1
                              CTO18 (R)    CCCTCATCGTACTCGGTCTCA
                              CTO51 (F)    TTACGCCGGGAAAAAAGTTCT
     ChYUC8
                              CTO52 (R)    GCGAAATGGTTGGCTAGGTC
                              CTO69 (F)    TGGTGTTCCTTTCCCAAAAAA
     ChXTR7
                              CTO70 (R)    CCACCTCTCGTAGCCCAATC
                              SPO88 (F)    CCAGCTTCTTCTCCTCA
     AtHFR1, ChHFR1
                              SPO89 (R)    CATCGCATGGGAAGAAAAATC
                              SPO108 (F)   CCAATACCCTCCAGATGAAGAC
     AtPIF4, ChPIF4
                              SPO109 (R)   TCTCTGAGGTTGGTCTCTGG
                              SPO110 (F)   CATTAATCAGATGGCTATGCA
     AtPIF5, ChPIF5
                              SPO111 (R)   AACTGTACCGGGTTTTGACA
                              SPO112 (F)   TCCGCTCTGGATCGGAAACTC
     AtPIF7, ChPIF7           SPO64 (R)    TGCTCGTCCCCGTCGTCCAT
                              SPO142 (R)   TCTCATCCTCTGGTTTATCC
7

8




                                             13
1   5. APPENDIX TABLE S2. Primers used for cloning or/and genotyping. Primer

2   RO25 (Roig-Villanova et al, 2007) has been described before.

3

                         Primer         Sequence (5’ – 3’)
    Gene
                         name
                         SPO104 (F)     CTGTTGAAGACTGCAGATTTG
    ChHFR1 WT
                         SPO107 (R)     CCTAAGGCAAGATTCTTTGAA
    chfr1-1              SPO105 (F)     CTGTTGAAGACTGCAGATTA
    chfr1-2              SPO106 (F)     CTGTTGAAGACTGCAGATTTT
    attB1                MJO27 (F)      GGGGACAAGTTTGTACAAAAAAGCAGGCT
    attB2                MJO28 (R)      GGGGACCACTTTGTACAAGAAAGCTGGGT
                         SPO26 (F)      GCTCTAGAGTAAAGATAACGTTCT
    pAtHFR1
                         SPO27 (R)      GCTCTAGAGTTAGTTAAAGAGATA
                         SPO28 (F)      CCATGGGTTTTCCATTTTCTCG
    ChHFR1
                         SPO29 (R)      GGCTCGAGGAGTCTTCCCATCGCA
    ChHFR1               CTO29 (F)      ATGATCATCATCAAATTGTTC
                         RO25 (F)       AACATGTCGAATAATCAAGCTTTCATG
    AtHFR1
                         SPO30 (R)      GGCTCGAGTAGTCTTCTCATCGCA
                         SPO31 (F)      CCGTCGACGGTGGAGGCGGTTCAG
    3xHA
                         SPO32 (R)      GGCTCGAGTCAAGCGTAATCTGGA
                         CTO35 (F)      CAAACACATAATGATCATCATC
    RNAi-ChHFR1
                         CTO36 (R)      ATCACTCCAGATCTGGACACGA
                                        CTTCTTTATGAATCTCTGGAACAATCTGAAGA
                         SPO128 (R)
                                        TAATTATCTGTTTGATCATGACCAAAA
    ChHFR1*
                                        GTTCCAGAGATTCATAAAGAAGTAGAAAATGC
                         SPO129 (F)
                                        GAAGGAGGATTTGTTGGTTGTTGTC
                                        CTTTCTGAATCTCTGGAACAATTTGATGATGA
                         SPO126 (R)
                                        TCATTATGAGTTTGATCATGATCAAAG
    AtHFR1*
                                        GTTCCAGAGATTCAGAAAGAAGAACGACTGTT
                         SPO127 (F)
                                        GAAGACTGCAGATTTATTGGTTGTTGTC
                         JO414 (F)      TAACACATGTCGAATTATGGAG
    AtPIF7
                         JO415 (R)      GGCTCGAGATCTCTTTTCTCATGATTC
                                        GGGGACAAGTTTGTACAAAAAAGCAGGCTAC
    AtPIF7 + attB1       BAO4 (F)
                                        ATGTCGAATTATGGAGTTAAAG
                                        GGGGACCACTTTGTACAAGAAAGCTGGGTGT
    AtPIF7 + attB2       BAO5 (R)
                                        CAAGCGTAATCTGGAACGTC
4

5




                                           14
 1   6.   APPENDIX     TABLE      S3.   Synthetic   peptides   used   for   microscale

 2   thermophoresis (MST) experiments. The peptides were acetylated (Ac) at the N-

 3   terminal and aminated (-NH2) at the C-terminal. The C-terminal tyrosine (Y)

 4   residue was added to quantify peptide concentrations via absorbance at 280 nm.

 5

     Name                 Sequence                      Company
     AtHFR1 VP            Ac-YLQIVPEI-NH2               Genescript
     ChHFR1 VP            Ac-HHQIVPEIY-NH2              Genescript
     At/ChHFR1 VP         Ac-LLVVVPDEY-NH2              Genescript
     AtCRY1               Ac-EDQMVPSITY-NH2             Peptide Synthesis Laboratory
     HsTRIB1              Ac-SDQIVPEY-NH2               Peptide Synthesis Laboratory
 6

 7

 8   7. APPENDIX REFERENCES
 9

10   Chini A, Fonseca S, Chico JM, Fernandez-Calvo P, Solano R (2009) The ZIM

11          domain mediates homo- and heteromeric interactions between Arabidopsis

12          JAZ proteins. Plant J 59: 77-87

13   Earley KW, Haag JR, Pontes O, Opper K, Juehne T, Song K, Pikaard CS (2006)

14          Gateway-compatible vectors for plant functional genomics and proteomics.

15          Plant J 45: 616-629

16   Fauser F, Schiml S, Puchta H (2014) Both CRISPR/Cas-based nucleases and

17          nickases can be used efficiently for genome engineering in Arabidopsis

18          thaliana. Plant J 79: 348-359

19   Galstyan A, Cifuentes-Esquivel N, Bou-Torrent J, Martinez-Garcia JF (2011) The

20          shade avoidance syndrome in Arabidopsis: a fundamental role for atypical

                                              15
 1         basic helix-loop-helix proteins as transcriptional cofactors. Plant J 66: 258-

 2         267

 3   Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA, 3rd, Smith HO (2009)

 4         Enzymatic assembly of DNA molecules up to several hundred kilobases.

 5         Nat Methods 6: 343-345

 6   Karimi M, Depicker A, Hilson P (2007) Recombinational cloning with plant gateway

 7         vectors. Plant Physiol 145: 1144-1154

 8   Molina-Contreras MJ, Paulisic S, Then C, Moreno-Romero J, Pastor-Andreu P,

 9         Morelli L, Roig-Villanova I, Jenkins H, Hallab A, Gan X et al (2019)

10         Photoreceptor Activity Contributes to Contrasting Responses to Shade in

11         Cardamine and Arabidopsis Seedlings. Plant Cell 31: 2649-2663

12   Morineau C, Bellec Y, Tellier F, Gissot L, Kelemen Z, Nogue F, Faure JD (2017)

13         Selective gene dosage by CRISPR-Cas9 genome editing in hexaploid

14         Camelina sativa. Plant Biotechnol J 15: 729-739

15   Roig-Villanova I, Bou-Torrent J, Galstyan A, Carretero-Paulet L, Portoles S,

16         Rodriguez-Concepcion M, Martinez-Garcia JF (2007) Interaction of shade

17         avoidance and auxin responses: a role for two novel atypical bHLH proteins.

18         The EMBO Journal 26: 4756-4767

19   Roig-Villanova I, Bou J, Sorin C, Devlin PF, Martinez-Garcia JF (2006)

20         Identification of primary target genes of phytochrome signaling. Early

21         transcriptional control during shade avoidance responses in Arabidopsis.

22         Plant Physiol 141: 85-96




                                             16
1   Sorin C, Salla-Martret M, Bou-Torrent J, Roig-Villanova I, Martinez-Garcia JF

2         (2009) ATHB4, a regulator of shade avoidance, modulates hormone

3         response in Arabidopsis seedlings. The Plant Journal 59: 266-277

4   Vilela B, Moreno-Cortes A, Rabissi A, Leung J, Pages M, Lumbreras V (2013) The

5         maize OST1 kinase homolog phosphorylates and regulates the maize

6         SNAC1-type transcription factor. PLoS One 8: e58105

7




                                          17