Report Auxin-Regulated Reversible Inhibition of TMK1 Signaling by MAKR2 Modulates the Dynamics of Root Gravitropism Graphical Abstract Authors Maria Mar Marquès-Bueno, Laia Armengot, Lise C. Noack, ..., Ana I. Caño-Delgado, Jirı́ Friml, Yvon Jaillais Correspondence yvon.jaillais@ens-lyon.fr In Brief Marquès-Bueno, Armengot et al. show that the unstructured protein MAKR2 controls the dynamics of the root gravitropic response by acting as a negative regulator of the TMK1 receptor kinase. In addition, the MAKR2 inhibitory effect on TMK1 signaling is antagonized by auxin itself, which triggers rapid MAKR2 membrane dissociation in a TMK1-dependent manner. Highlights d MAKR2 is co-expressed with PIN2 and regulates the pace of root gravitropism d MAKR2 controls PIN2 asymmetric accumulation at the root level during gravitropism d MAKR2 binds to and is a negative regulator of the TMK1 receptor kinase d Auxin antagonizes the MAKR2 inhibition of TMK1 by delocalizing MAKR2 in the cytosol Marquès-Bueno et al., 2021, Current Biology 31, 228–237 January 11, 2021 ª 2020 The Author(s). Published by Elsevier Inc. https://doi.org/10.1016/j.cub.2020.10.011 ll ll OPEN ACCESS Report Auxin-Regulated Reversible Inhibition of TMK1 Signaling by MAKR2 Modulates the Dynamics of Root Gravitropism Maria Mar Marquès-Bueno,1,6,8 Laia Armengot,1,8 Lise C. Noack,1 Joseph Bareille,1 Lesia Rodriguez,2 Matthieu Pierre Platre,1 Vincent Bayle,1 Mengying Liu,1 Davy Opdenacker,3,4 Steffen Vanneste,3,4,5 Barbara K. Möller,3,4 Zachary L. Nimchuk,7 Tom Beeckman,3,4 Ana I. Caño-Delgado,6 Jirı́ Friml,2 and Yvon Jaillais1,9,* veloppement des Plantes, Universite 1Laboratoire Reproduction et De  de Lyon, ENS de Lyon, UCB Lyon 1, CNRS, INRAE, 69342 Lyon, France 2Instituteof Science and Technology Austria (IST Austria), Am Campus 1, 3400 Klosterneuburg, Austria 3Center for Plant Systems Biology, VIB, Technologiepark 71, 9052 Ghent, Belgium 4Department of Plant Biotechnology and Bioinformatics, Ghent University, Technologiepark 71, 9052 Ghent, Belgium 5Lab of Plant Growth Analysis, Ghent University Global Campus, Songdomunhwa-Ro, 119, Yeonsu-gu, Incheon 21985, Republic of Korea 6Department of Molecular Genetics, Center for Research in Agricultural Genomics (CRAG), CSIC-IRTA-UAB-UB, Campus UAB, Bellaterra (Cerdanyola del Vallès), 08193 Barcelona, Spain 7Department of Biology, University of North Carolina at Chapel Hill, Chapel Hill, NC 27599, USA 8These authors contributed equally 9Lead Contact *Correspondence: yvon.jaillais@ens-lyon.fr https://doi.org/10.1016/j.cub.2020.10.011 SUMMARY Plants are able to orient their growth according to gravity, which ultimately controls both shoot and root ar- chitecture.1 Gravitropism is a dynamic process whereby gravistimulation induces the asymmetric distribu- tion of the plant hormone auxin, leading to asymmetric growth, organ bending, and subsequent reset of auxin distribution back to the original pre-gravistimulation situation.1–3 Differential auxin accumulation during the gravitropic response depends on the activity of polarly localized PIN-FORMED (PIN) auxin-efflux car- riers.1–4 In particular, the timing of this dynamic response is regulated by PIN2,5,6 but the underlying molec- ular mechanisms are poorly understood. Here, we show that MEMBRANE ASSOCIATED KINASE REGU- LATOR2 (MAKR2) controls the pace of the root gravitropic response. We found that MAKR2 is required for the PIN2 asymmetry during gravitropism by acting as a negative regulator of the cell-surface signaling medi- ated by the receptor-like kinase TRANSMEMBRANE KINASE1 (TMK1).2,7–10 Furthermore, we show that the MAKR2 inhibitory effect on TMK1 signaling is antagonized by auxin itself, which triggers rapid MAKR2 mem- brane dissociation in a TMK1-dependent manner. Our findings suggest that the timing of the root gravitropic response is orchestrated by the reversible inhibition of the TMK1 signaling pathway at the cell surface. RESULTS AND DISCUSSION perception, BRI1 phosphorylates BKI1 on a conserved tyrosine within the membrane hook,14 triggering an electrostatic switch Receptor-like kinases (RLKs) are involved in all aspects of plant that releases BKI1 from the plasma membrane into the life, including development, immunity, reproduction, and envi- cytosol17,18 and allowing the transphosphorylation of BRI1/ ronmental interactions.11 Yet we are still lacking mechanistic de- BAK1 kinases and subsequent activation of the pathway.19 tails on how those receptors are activated and regulated. The presence of both the cationic membrane hook and the Notably, the functions and mechanisms of RLK negative regula- BRI1-binding peptide at the C terminus defines a novel family tion have rarely been addressed, although it is established that of proteins named MEMBRANE ASSOCIATED KINASE REGU- receptor inhibition plays a critical role in signaling and diseases LATOR (MAKR) composed of 7 members (BKI1 and MAKR1– in metazoans.12 BRI1 KINASE INHIBITOR1 (BKI1) is a plant-spe- MAKR6).14 Like BKI1, these proteins are unstructured cytosolic cific unstructured protein that negatively regulates the activity of proteins that are targeted to the plasma membrane via electro- the plant steroid receptor BRASSINOSTEROID INSENSITIVE1 static interactions.17 However, with the exception of MAKR1, (BRI1).13–15 BKI1 acts through two evolutionarily conserved they are unable to bind to BRI1 kinase and thus they likely control linear motifs: a C-terminal alpha helix of 20 residues that binds different signaling pathways.14,20,21 For example, the auxin- the BRI1 kinase domain and inhibits the interaction between inducible MAKR4 is involved in lateral root formation,21 whereas BRI1 and its co-receptor BRI1 ASSOCIATED KINASE1 MAKR5 is involved in protophloem differentiation.20 The latter (BAK1),13–16 and a cationic membrane hook, which targets acts as a positive downstream effector of the leucine-rich-repeat BKI1 to the plasma membrane.14,17 Upon brassinosteroid (LRR) RLK BARELY ANY MERISTEM3 (BAM3), suggesting that 228 Current Biology 31, 228–237, January 11, 2021 ª 2020 The Author(s). Published by Elsevier Inc. This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/). ll Report OPEN ACCESS MAKR proteins may act as positive or negative regulators of RLK reported with the GFP-ROP6 reporter lines,8,26,27 we found signaling.20,22 that our mCit-ROP6 reporter was expressed in the root tip Here, we addressed the function of MAKR2, a so far uncharac- epidermis and cortex cells, albeit to a lower level than in internal terized member of the MAKR family. We raised MAKR2 gain- and tissues (Figure 2B). Therefore, MAKR2 and ROP6 expression loss-of-function transgenic Arabidopsis lines via overexpression partially overlap. Next, we addressed the genetic relationship and artificial microRNA (amiMAKR2), respectively. To monitor between ROP6 and MAKR2 by crossing a ROP6-Ox line with protein accumulation and localization, we fused MAKR2 at its our MAKR2-Ox1 line, which show fast- and slow-gravitropic re- C terminus with either the red fluorescent protein 2xmCHERRY sponses, respectively. ROP6-Ox;MAKR2-Ox1 double trans- (2x35Sprom::MAKR2-2Ch, hereafter designated as MAKR2- genics showed a wild-type-like response, suggesting that Ox1) or the yellow fluorescent protein mCITRINE (2x35Sprom:: ROP6 overexpression mitigates the strong agravitropic pheno- MAKR2-mCit, hereafter designated as MAKR2-Ox2). Quantita- type induced by MAKR2 overexpression (Figure 2C). tive RT-PCR and confocal analyses of tagged proteins ROP6 has been proposed to mediate root gravitropic bending confirmed the overexpression of MAKR2 in MAKR2-Ox lines by regulating the trafficking of the auxin-efflux carrier PIN2.2,4,8,9 and its downregulation in each independent artificial microRNA In particular, ROP6 mediates PIN2 accumulation in the epidermis line (Figures 1A, S1A, and S1C). The roots overexpressing on the gravity-stimulated side of the root (lower side of the root, MAKR2 did not grow vertically, as manifested by an increased facing the new gravity vector).2 We therefore analyzed whether gravitropic index (Figure 1B). Analysis of the synthetic auxin MAKR2 could control PIN2 dynamics during gravitropism. First, output reporter DR5prom::GUS showed an arrow-like pattern we raised a MAKR2prom::MAKR2-2Ch line and crossed it with a of GUS accumulation at the root tip of MAKR2-Ox1 lines with PIN2prom::PIN2-GFP line to monitor their co-expression and an increased signal on both flanks of the lateral root caps (Fig- localization. We found that MAKR2 and PIN2 were co-expressed ure 1C). This DR5 arrow-like pattern at the root tip is typically and co-localized at the plasma membrane of root epidermis and observed in pin2 loss-of-function alleles.23,24 Consistent with a cortex cells (Figure S2D). Next, we crossed the MAKR2-Ox1 and potentially impaired PIN-FORMED2 (PIN2) activity, MAKR2 amiMAKR2.1 lines with the PIN2prom::PIN2-GFP reporter and overexpression inhibited the establishment of the asymmetric followed PIN2-GFP accumulation during gravitropism using a patterns observed after 5 h of gravistimulation in both vertical stereomicroscope setup.28 High-resolution time-lapse DR5prom::GUS and DR5prom::GFP reporter lines (Figures 1C analyses validated the slow- and fast-gravitropic response of and S1B). Quantitative analyses of root bending following grav- MAKR2-Ox1;PIN2prom::PIN2-GFP and amiMAKR2;PIN2- istimulation showed that MAKR2-Ox lines reoriented slowly to prom::PIN2-GFP, respectively (Figure S2E; Videos S1 and S2). the new gravity vector (Figure 1D). In contrast, three independent Using time-lapse analysis, we noticed that each root had slightly amiMAKR2 lines had the opposite phenotype, displaying fast different gravitropic dynamics (Figure S2E), which made it gravitropic bending (Figures 1D and S1C). To validate the spec- difficult to pool the quantification of PIN2-GFP fluorescence be- ificity of our amiMAKR2 lines, we created a crispr allele (makr2- tween replicates. We thus decided to trace PIN2-GFP fluores- 1). This allele led to a truncated protein of 37 residues, cence in individual roots shown as independent replicates in Fig- comprising only the first 8 residues of MAKR2 and an additional ure 2D. Importantly, although we observed some root-to-root 29 random residues. The amiMAKR2 lines and the makr2-1 allele variations in PIN2-GFP dynamics, the overall trend was never- had identical gravitropic phenotypes (Figure S1D). Both the theless robust from replicate to replicate (Figure 2D). Quantita- MAKR2-Ox and amiMAKR2.1 lines had slightly shorter primary tive measurements of PIN2-GFP fluorescence on the upper roots than the wild type (Figure S1E); however, they had opposite and lower sides of the root confirmed that PIN2-GFP is retained gravitropic phenotypes (Figure 1D). Furthermore, we found no on the lower side of the root longer than on the upper side (Fig- correlation between root length (Figure S1E) and the strength ure 2D; Videos S1 and S2).2,29,30 In particular, PIN2-GFP signal at of the agravitropic phenotypes of the MAKR2-Ox1 and the lower part of the wild-type root initially increased before MAKR2-Ox2 lines (Figure 1D). Together, these data suggest decreasing (Figure 2D). Such signal increase was not observed that primary root growth is unlikely to explain the gravitropic phe- at the upper part of the root, which instead showed a steady notypes of MAKR2 gain- and loss-of-function mutants. decrease of fluorescence (Figure 2D). The differential PIN2- The pace of root gravitropism is regulated by Rho GTPase of GFP accumulation between the upper and lower parts of the Plants 6 (ROP6), with the roots of ROP6 loss-of-function mutants root was abolished in the MAKR2-Ox1-overexpressing line (Fig- responding slowly to gravistimulation and the roots of ROP6 ure 2D; Video S1). By contrast, PIN2-GFP accumulation at the gain-of-function mutants (e.g., ROP6-Ox) responding faster lower part of the root in the amiMAKR2 line was more pro- than wild-type roots.8,9,25 Because the loss- and gain-of-func- nounced and lasted longer than in the wild type (Figure 2D; Video tion mutants of both MAKR2 and ROP6 have opposite pheno- S2). Together, these results indicate that MAKR2, like ROP6, is types, we hypothesized that MAKR2 may act as a negative regu- required for dynamic PIN2 accumulation during root gravitrop- lator of the ROP6 signaling pathway. To test this, we first ism, which could explain the relative gravitropic phenotypes of assessed whether MAKR2 is expressed in the same tissues as the MAKR2-Ox and amiMAKR2 lines. ROP6 using a transcriptional reporter line, MAKR2prom::VE- We next investigated whether MAKR2 may also regulate the NUSNLS, and translational fusion lines, MAKR2prom::MAKR2- activity of an RLK upstream of ROP6 activation. In the context tdYFP, MAKR2prom::MAKR2-GUS, and ROP6prom::mCitrine- of pavement-cell-shape morphogenesis, ROP6 acts down- ROP6. MAKR2 was expressed in the root meristem in the stream of the LRR RLKs from the TRANSMEMBRANE KINASE epidermis and cortex cell layers, as well as in the quiescent cen- (TMK) family, which were proposed to operate as a relay for ter and surrounding initials (Figures 2A and S2A–S2C). As perception of extracellular auxin.2,7,31 We thus wondered Current Biology 31, 228–237, January 11, 2021 229 ll OPEN ACCESS Report Figure 1. MAKR2 Regulates the Pace of the Root Gravitropic Response (A) qRT-PCR analyses of MAKR2 expression in 2x35Sprom::MAKR2-2xmCherry (MAKR2-Ox1), 2x35Sprom::MAKR2-mCitrine (MAKR2-Ox2), and amiMAKR2.1 lines relative to MAKR2 expression in wild-type seedlings (mean ± SEM). (B) Pictures showing the root phenotypes of the genotypes indicated at the bottom and related quantification of the horizontal growth index (Tukey boxplot). Plants were grown at a 45 angle with respect to the vertical axis. Scale bars represent 5 mm. (C) DR5prom::GUS accumulation pattern in the absence and after 5 h of gravistimulation at a 135 angle in wild-type and MAKR2-Ox1 plants and related quantification (Tukey boxplot). The white asterisks indicate the arrow-like pattern observed in MAKR2-Ox1 lines; the white arrow indicates the asymmetric GUS signal observed after gravistimulation in the wild type. Scale bars represent 50 mm. (D) Representative pictures of the root gravitropic curvature 48 h after reorienting seedlings at a 135 angle and related quantification of root gravitropic bending over time (mean ± SEM). Scale bars represent 2 mm. See Figure S1F for a statistical comparison. For the horizontal gravitropic index and the kinetics of the gravitropic response, a linear model was fitted on measurements from wild-type plants and the different mutants using lm() function from stats package available in R software (https://www.r-project.org/). This model estimates a weight for each variable (wild-type and mutant plants) and the associated probability that such weight is different from zero based on a t test. The probability derived from the t test is the p value in this comparison and significant differences were considered when p < 0.05. See also Figure S1. whether TMKs may also participate in root gravitropism. TMKs double mutant showed a reduced root gravitropic response (Fig- form a family of redundant receptors, with single mutants having ure S3A). Although consistent with the notion that TMK receptors no or subtle root phenotypes,32 whereas higher-order mutants may be involved in root gravitropic bending, the tmk1;tmk4 have strong pleiotropic developmental defects.33 The tmk1;tmk4 mutant also had stunted root growth,33 making it difficult 230 Current Biology 31, 228–237, January 11, 2021 ll Report OPEN ACCESS Figure 2. MAKR2 Mediates PIN2-GFP Dy- namic Accumulation during Gravitropism (A) Confocal pictures of the MAKR2prom::MAKR2- tdYFP line showing the MAKR2-tdYFP localization and expression pattern at the root tip. Left: yellow fluorescent protein (YFP) channel; right: overlay between YFP channel (yellow) and membranes counterstained by FM4-64 (red). (B) Confocal pictures of the complemented ROP6prom::mCitrine-ROP6/rop6-2 line showing the mCit-ROP6 localization and expression pattern at the root tip. (C) Kinetics of root gravitropic bending after reor- ienting seedlings at a 135 angle. See Figure S1F for a statistical comparison. A linear model was fitted on measurements from wild-type plants and the different mutants using lm() function from stats package available in R software (https:// www.r-project.org/). This model estimates a weight for each variable (wild-type and mutant plants) and the associated probability that such weight is different from zero based on a t test. The probability derived from the t test is the p value in this comparison and significant differences were considered when p < 0.05. (D) Quantification of PIN2-GFP in the upper (blue diamonds) and lower (black squares) part of the root in the PIN2prom::PIN2-GFP, PIN2prom:: PIN2-GFP;MAKR2-Ox1, and PIN2prom::PIN2-GFP; amiMAKR2.1 lines. Each graph shows the response in a single individual root (see also Videos S1 and S2). In each case, fluorescence intensities were normalized with respect to the initial fluores- cence value (time 0 min). Scale bars represent 30 mm. See also Figures S1 and S2 and Videos S1 and S2. to conclude whether its gravitropic phenotype was a primary or domain of HAESA-LIKE1 (HSL1cyt-HA), which has a related ki- secondary phenotype. A transcriptional reporter line, nase domain to TMK1, did not interact with Flag-Halo-MAKR2 TMK1prom::2ChNLS, confirmed that TMK1 is expressed in all (Figure S3D). Furthermore, full-length TMK1 (TMK1-3HA), but the tissues of the root meristem, including the epidermis and cor- not a kinase-deleted version (TMK1Dkinase-3HA), co-immunopre- tex, where MAKR2, PIN2, and ROP6 are also expressed (Fig- cipitated with MAKR2-mCit when co-expressed in protoplasts ure S3B). We therefore analyzed the phenotype of TMK1 overex- (Figure 3C). One hour of auxin treatment (1 mM indole 3-acetic pression by generating a TMK1-2xmCherry line driven under the acid; IAA) did not have a strong effect on the interaction between control of the ubiquitous promoter of the UBIQUITIN10 gene TMK1-3HA and MAKR2-mCit in this protoplast assay (Figure 3C). (UBQ10prom::TMK1-2Ch, hereafter referred to as TMK1-Ox). Next, we tested whether MAKR2 interaction with TMK1 was Similar to the ROP6-Ox and amiMAKR2 lines, the TMK1-Ox dependent upon its kinase activity and whether TMK1 may phos- line displayed a fast root gravitropic response (Figure 3A). phorylate MAKR2. To this end, we co-expressed in bacteria HA- Together, the tmk1;tmk4 loss-of-function and TMK1-Ox gain- MAKR2 with the isolated cytosolic domain of TMK1 in its wild- of-function phenotypes suggest that TMK1 may act upstream type or kinase-dead form (6His-Flag-TMK1cyt and 6His-Flag- of ROP6 signaling both for pavement cell morphogenesis in TMK1cyt-K616R, respectively). We purified both TMK1 proteins leaves and in root gravitropism. Interestingly, TMK1-Ox; on a nickel column and identified potential interacting proteins MAKR2-Ox2 double transgenics had a wild-type-like root gravi- by mass spectrometry. We found MAKR2 to be the only protein tropic response (Figure 3A). This genetic analysis shows that represented by more than one peptide to co-purify with both overexpression of MAKR2 is able to counteract the phenotypic active and inactive TMK1 kinase domains. In each case, we effects of TMK1 overexpression, suggesting that MAKR2 may recovered 13 unique peptides in MAKR2, representing a 42% act as a negative regulator of TMK1, upstream of ROP6 peptide coverage (63% coverage for both TMK1cyt and activation. TMK1cyt-K616R) (Figure 3D). These results indicate that MAKR2 We next tested whether MAKR2 interacts with TMK1. We directly interacts with the kinase domain of TMK1 in vitro, irre- found that Flag-Halo-MAKR2 directly interacted with the isolated spective of its kinase activity. We next assessed the phosphory- cytosolic domain of TMK1 in vitro (TMK1cyt-HA; hemagglutinin), lation status of each peptide recovered during the mass whereas Flag-Halo-mCitrine did not (Figure 3B). This interaction spectrometry experiments. Such analysis of the phosphosites was specific for the cytosolic domain of TMK1, as the cytosolic revealed that the MAKR2 C terminus was phosphorylated Current Biology 31, 228–237, January 11, 2021 231 ll OPEN ACCESS Report Figure 3. TMK1 Interacts with and Phosphor- ylates MAKR2 and Acts Upstream of MAKR2 in the Regulation of Root Gravitropism (A) Kinetics of root gravitropic bending after reor- ienting seedlings of the genotypes indicated in the top left corner at a 135 angle. See Figure S3C for a statistical comparison. A linear model was fitted on measurements from wild-type plants and the different mutants using lm() function from stats package available in R software (https://www. r-project.org/). This model estimates a weight for each variable (wild-type and mutant plants) and the associated probability that such weight is different from zero based on a t test. The probability derived from the t test is the p value in this comparison and significant differences were considered when p < 0.05. (B) Pull-down assay using in-vitro-transcribed/ translated proteins and Halo-tag purification. Co- purified proteins were visualized using an anti-HA antibody (labeled Halo pull-down). The inputs (labeled Inputs) and supernatant (labeled Sup) were tested to show the relative amounts of Halo- and HA-tagged proteins and the binding efficiency to HaloLink magnetic beads (as described in Yazaki et al.34). TMK1cyt corresponds to the isolated TMK1 cytoplasmic domain. (C) Co-immunoprecipitation of full-length TMK1- 3HA but not TMK1Dkinase-3HA with MAKR2-mCi- trine. Immunoprecipitation (IP) of MAKR2-mCitrine with an anti-GFP antibody and immunoblotting (IB) using an anti-GFP antibody or anti-HA antibody. Protoplasts were incubated or not for 1 h with 1 mM IAA. (D) The scheme represents the MAKR2 protein, with the peptides recovered by mass spectrometry highlighted in green and the phosphorylation sites shown by arrowheads (only found with active TMK1cyt but not inactive TMK1cyt-K616R). Black arrowheads indicate phosphorylation sites that could be deter- mined with 100% accuracy, whereas gray arrowheads indicate ambiguity on which of the two consecutive serines is phosphorylated. The residues corre- sponding to the conserved C-terminal tail are underlined. The blue box indicates the position of the putative cationic membrane hook, and the corresponding Arg/Lys residues are highlighted in bold. See also Figure S3. on 5 serines when it was co-expressed and co-purified with by pretreatment with the protein synthesis inhibitor cyclohexi- TMK1cyt (Figure 3D). By contrast, we found no phosphorylation mide (CHX) (Figure S4B). Furthermore, inhibition of protein sites when MAKR2 was co-expressed and co-purified with degradation by the proteasome inhibitor MG-132, which is TMK1cyt-K616R. Altogether, our results suggest that MAKR2 required for auxin-mediated gene expression regulation by the directly interacts with and is phosphorylated by TMK1 in vitro, TIR1 family,36 had no effect on auxin-triggered MAKR2 plasma and interacts with full-length TMK1 in vivo. membrane dissociation (Figure S4B). This suggested that the MAKR2prom::MAKR2-tdYFP expression was too low to MAKR2 plasma-membrane-to-cytosol localization switch was follow its localization during the gravitropic response, which regulated by a potential ‘‘non-transcriptional’’ arm of auxin provides an endogenous auxin treatment on the lower (i.e., grav- signaling at or close to the plasma membrane, rather than by a istimulated) side of the root. As an alternative, we followed TIR1-mediated regulation of transcription.2 Accordingly, the MAKR2 localization after exogenous auxin treatments. We auxin antagonist PEO-IAA, known to inhibit TIR1-mediated nu- found a time- and dose-dependent effect of the synthetic auxin clear activity but not the non-transcriptional arm of auxin 1-naphthaleneacetic acid (NAA), which induced the relocaliza- signaling,29,37 efficiently displaced MAKR2 away from the tion of MAKR2prom::MAKR2-tdYFP into the cytosol as early as plasma membrane (Figure S4C). By contrast, 5-F-IAA, an auxin 5 min post treatment (Figure 4A). This rapid effect of auxin treat- analog that is able to activate TIR1-mediated gene expression ment was also observed after 5 min of IAA application (Figure 4A). but not the ROP6 pathway,29,37 had little effect on MAKR2 local- In addition, microfluidics, coupled with time-lapse imaging of ization (Figure S4C). Furthermore, benzoic acid (BA), an inactive MAKR2prom::MAKR2-tdYFP localization, confirmed that this ef- auxin analog with a pKa similar to that of NAA, and brassinolide fect was rapid (i.e., within 2 min following either NAA or IAA treat- had no effect on MAKR2prom::MAKR2-tdYFP localization (Fig- ment) (Figures 4B and S4A; Video S3).35 MAKR2 released into ure S4D). To address whether this auxin effect was dependent the cytosol was independent of protein translation, as shown upon the TMK receptors and to bypass the problem due to 232 Current Biology 31, 228–237, January 11, 2021 ll Report OPEN ACCESS Figure 4. Auxin Triggers MAKR2 Plasma Membrane Dissociation in a TMK1-Dependent Manner to Antagonize MAKR2 Inhibitory Activity (A) Confocal pictures of the MAKR2prom::MAKR2-tdYFP line following NAA or IAA treatment for the time and concentration indicated in each panel and related quantification. n indicates the number of cells counted. A pairwise comparison between mock plants and plants subjected to different treatments was performed using a t test with Welch’s correction to account for unequal variances using R software (https://www.r-project.org/). The probability derived from the t test is the p value in this comparison and significant differences were considered when p < 0.01. (B) Successive confocal pictures of the MAKR2prom::MAKR2-tdYFP line before and after 1 min of benzoic acid (BA; control) or IAA treatment (Video S3). White arrows indicate MAKR2 plasma membrane localization, whereas the yellow arrowheads show MAKR2 disappearance from the plasma membrane upon IAA but not BA treatment. (legend continued on next page) Current Biology 31, 228–237, January 11, 2021 233 ll OPEN ACCESS Report functional redundancy between the four TMK family members, putative membrane hook (Figure 3D) into neutral glutamines we used a dominant-negative strategy, by overexpressing a ki- (MAKR211Q-mCit). MAKR211Q-mCit was cytosolic (Figure 4E), nase-dead version of full-length TMK1 (TMK1K616R).7,38 confirming that MAKR2 likely localizes to the plasma membrane TMK1K616R overexpression severely impaired the auxin-induced through electrostatic interactions with anionic lipids. Importantly, MAKR2-mCit release from the plasma membrane, whereas unlike MAKR2-Ox2, MAKR211Q-mCit-overexpressing lines did overexpression of the wild-type version of TMK1 did not (Figures not have an elevated horizontal gravitropic index even when ex- 4C and S5A). Note that TMK1K616R-mCH-overexpressing plants pressed at similar levels (Figures 4D–4G). Together, these results had a mosaic expression and that the inhibition of MAKR2-mCit suggest that MAKR2 inhibits gravitropism at the plasma mem- released from the plasma membrane into the cytosol following brane, likely through its interaction with the TMK1 receptor, and auxin treatment was only observed in cells expressing that auxin, via the activity of the TMK1 receptor itself, antagonizes TMK1K616R-mCh (Figure S5B). Together, these results suggest this inhibition by triggering the relocalization of MAKR2 into the that auxin rapidly regulates MAKR2 localization, via a non-tran- cytosol. scriptional, TMK-dependent mechanism. Altogether, our results suggest that MAKR2 acts as an up- We next addressed the functional impact of the MAKR2 local- stream negative regulator of ROP6 during the gravitropic ization switch on root gravitropism. To this end, we first quantified response by directly interacting with the TMK1 kinase domain. the relative plasma membrane and cytosolic localization of However, the exact mechanism by which TMK1/MAKR2 regu- MAKR2 in the MAKR2-Ox1 and MAKR2-Ox2 lines (Figure S5C). late ROP6 activity remains unresolved. Both TMK1 and ROP6 We found that MAKR2 in MAKR2-Ox1, which is less expressed have been shown to be involved in fast non-transcriptional than in the MAKR2-Ox2 line (Figure 1A), had a more pronounced auxin response,7–9,25,32 although the exact mode of auxin localization in the cytosol and accumulated less at the plasma perception at or near the cell surface is still unclear.2 We pro- membrane (Figure S5C). This result is consistent with a model pose that the MAKR2-mediated negative regulation of TMK1 in which MAKR2 inhibits the activity of TMK1, which itself triggers activity is counterbalanced by auxin itself, which triggers the relocalization of MAKR2 in the cytosol. Indeed, according to MAKR2 relocalization from the plasma membrane into the this model, a strong MAKR2 overexpression would lead to a cytosol. It is possible that this relocalization is induced by strong inhibition of TMK1 activity, which would not be able to TMK1-mediated phosphorylation. However, it is unlikely that induce the efficient release of MAKR2 into the cytosol. By the phosphorylation sites that we uncovered in the MAKR2 contrast, a mild overexpression of MAKR2 would lead to a milder C-terminal tail are directly involved in the regulation of inhibition of TMK1, which would be able to trigger more MAKR2 MAKR2 localization, because they are far away from the release from the plasma membrane into the cytosol. To further MAKR2 membrane hook and their exact function remains to test this model, we engineered MAKR2 mutant versions that be experimentally determined. are constitutively localized at the plasma membrane or in the Although BKI1 and MAKR5 appear to essentially work as in- cytoplasm. To lock MAKR2 at the plasma membrane, we added hibitor and activator, respectively, of the BRI1 and BAM3 a C-terminal geranylgeranylation sequence (MAKR2-mCitGEGE). signaling pathways,15,20 our results suggest a parallel mode of MAKR2-mCitGEGE was exclusively found at the plasma mem- action of MAKR2 and BKI1 in downregulating TMK1 and BRI1 brane, by comparison with MAKR2-mCit, which localized both signaling at the cell surface, respectively. We propose that to the plasma membrane and in the cytosol (Figure 4E). Lines MAKR2/TMK antagonist activity allows finely tuning ROP6 overexpressing MAKR2-mCitGEGE had a strong agravitropic signaling during the gravitropic response and thereby regulates phenotype, similar to or even stronger than the MAKR2-Ox2 lines the timing of root bending in response to gravity. Together, our (Figures 4F and 4G), whereas their expression levels were much results emphasize the importance of RLK negative regulation, lower (Figure 4D). This result indicates that a MAKR2 protein which appears critical to determine the strength and dynamics constitutively localized at the plasma membrane is extremely of the output signal. potent to inhibit root gravitropism. We previously showed that MAKR2 interacts with anionic lipids in vitro and relies on plasma STAR+METHODS membrane electrostatics for plasma membrane localization in yeast and Arabidopsis.17 To inhibit MAKR2 membrane-binding Detailed methods are provided in the online version of this paper ability, we mutated the 11 lysine and arginine residues within its and include the following: (C) Confocal pictures showing MAKR2-mCit localization (MAKR2-Ox2) in UBQ10prom::TMK1-2xmCherry (TMK1-Ox) and UBQ10prom::TMK1K616R-2xmCherry (TMK1K616R-Ox, kinase dead) in the absence or presence of NAA at the indicated time and concentration. (D) Anti-GFP western blots showing the relative accumulation of MAKR2-mCit (in the MAKR2-Ox2 line) and two independent transgenic lines overexpressing MAKR2-mCitGEGE and MAKR211Q-mCit. CBB, Coomassie brilliant blue. (E) Confocal pictures comparing the localization of 2x35Sprom::MAKR2-mCit (MAKR2-Ox2), 2x35Sprom::MAKR2-mCitGEGE (MAKR2-mCitGEGE, constitutively tethered to the plasma membrane), and 2x35Sprom::MAKR211Q-mCit (MAKR211Q-mCit, constitutively cytoplasmic). (F and G) Pictures showing the root phenotypes of the genotypes indicated at the top (F) and related quantification of the horizontal gravitropic index (G). Statistical comparison with the wild type (WT) is in blue and with MAKR2-Ox2 is in yellow. In (G), a linear model was fitted on measurements from wild-type plants and the different mutants using lm() function from stats package available in R software (https://www.r-project.org/). This model estimates a weight for each variable (wild-type and mutant plants) and the associated probability that such weight is different from zero based on a t test. The probability derived from the t test is the p value in this comparison and significant differences were considered when p < 0.05. Scale bars represent 20 mm (A), 10 mm (B, C, and E), and 5 mm (F). See also Figures S4 and S5 and Video S3. 234 Current Biology 31, 228–237, January 11, 2021 ll Report OPEN ACCESS d KEY RESOURCES TABLE quantification; Y.J. supervised research; M.M.M.-B., L.A., and Y.J. conceived d RESOURCE AVAILABILITY the study, designed the experiments, and wrote the manuscript. All the authors B Lead Contact discussed the results and commented on the manuscript. B Materials Availability DECLARATION OF INTERESTS B Data and Code Availability d EXPERIMENTAL MODEL AND SUBJECT DETAILS The authors declare no competing interests. B Plant material and Growth conditions B Plant Transformation and Selection Received: June 27, 2019 d METHOD DETAILS Revised: September 4, 2020 B Cloning and characterization of transgenic lines Accepted: October 7, 2020 B > amiMAKR2 Published: November 5, 2020 B Gravitropism experiments REFERENCES B Quantitative RT-PCR (qPCR) B Drugs and hormones treatments 1. Su, S.H., Gibbs, N.M., Jancewicz, A.L., and Masson, P.H. (2017). B Microscopy Molecular mechanisms of root gravitropism. Curr. Biol. 27, R964–R972. B In vitro Halo-pull down 2. Armengot, L., Marquès-Bueno, M.M., and Jaillais, Y. (2016). Regulation of B Co-expression, purification and mass-spectrometry polar auxin transport by protein and lipid kinases. J. Exp. Bot. 67, 4015– B Co-immunoprecipitation Assay 4037. B Image Quantification 3. Rakusová, H., Fendrych, M., and Friml, J. (2015). Intracellular trafficking d QUANTIFICATION AND STATISTICAL ANALYSIS and PIN-mediated cell polarity during tropic responses in plants. Curr. B Phenotyping Opin. Plant Biol. 23, 116–123. B Cell biology experiments 4. Adamowski, M., and Friml, J. (2015). PIN-dependent auxin transport: ac- tion, regulation, and evolution. Plant Cell 27, 20–32. 5. Zhang, Y., Xiao, G., Wang, X., Zhang, X., and Friml, J. (2019). Evolution of SUPPLEMENTAL INFORMATION fast root gravitropism in seed plants. Nat. Commun. 10, 3480. Supplemental Information can be found online at https://doi.org/10.1016/j. 6. Retzer, K., Akhmanova, M., Konstantinova, N., Malı́nská, K., Leitner, J., cub.2020.10.011. Petrásek, J., and Luschnig, C. (2019). Brassinosteroid signaling delimits root gravitropism via sorting of the Arabidopsis PIN2 auxin transporter. Nat. Commun. 10, 5516. ACKNOWLEDGMENTS 7. Xu, T., Dai, N., Chen, J., Nagawa, S., Cao, M., Li, H., Zhou, Z., Chen, X., De We thank the SiCE group for discussions and comments; S. Yalovsky, B. Rycke, R., Rakusová, H., et al. (2014). Cell surface ABP1-TMK auxin- Scheres, and the NASC/ABRC collection for providing transgenic Arabidopsis sensing complex activates ROP GTPase signaling. Science 343, 1025– lines and plasmids; L. Kalmbach and M. Barberon for the gift of 1028. pLOK180_pFR7m34GW; A. Lacroix, J. Berger, and P. Bolland for plant care; 8. Lin, D., Nagawa, S., Chen, J., Cao, L., Chen, X., Xu, T., Li, H., Dhonukshe, and M. Fendrych for help with microfluidics in the J.F. lab. We acknowledge P., Yamamuro, C., Friml, J., et al. (2012). A ROP GTPase-dependent auxin the contribution of the SFR Biosciences (UMS3444/CNRS, US8/Inser m, signaling pathway regulates the subcellular distribution of PIN2 in ENS de Lyon, UCBL) facilities: C. Lionet, E. Chatre, and J. Brocard at LBI- Arabidopsis roots. Curr. Biol. 22, 1319–1325. PLATIM-MICROSCOPY for assistance with imaging, and V. Guegen- 9. Chen, X., Naramoto, S., Robert, S., Tejos, R., Löfke, C., Lin, D., Yang, Z., Chaignon and A. Page at the Protein Science Facility (PSF) for assistance and Friml, J. (2012). ABP1 and ROP6 GTPase signaling regulate clathrin- with protein purification and mass spectrometry. Y.J. was funded by ERC mediated endocytosis in Arabidopsis roots. Curr. Biol. 22, 1326–1332. grant 3363360-APPL under FP/2007–2013. Y.J. and Z.L.N. were funded by 10. Xu, T., Wen, M., Nagawa, S., Fu, Y., Chen, J.G., Wu, M.J., Perrot- an ANR- and NSF-supported ERA-CAPS project (SICOPID: ANR-17-CAPS- Rechenmann, C., Friml, J., Jones, A.M., and Yang, Z. (2010). Cell surface- 0003-01/NSF PGRP IOS-1841917). A.I.C.-D. is funded by an ERC consolidator and Rho GTPase-based auxin signaling controls cellular interdigitation in grant (ERC-2015-CoG–683163) and BIO2016-78955 grant from the Spanish Arabidopsis. Cell 143, 99–110. Ministry of Economy and Competitiveness. Exchanges between the Y.J. and T.B. laboratories were funded by Tournesol grant 35656NB. B.K.M. was 11. De Smet, I., Voss, U., Jürgens, G., and Beeckman, T. (2009). Receptor-like funded by the Omics@vib Marie Curie COFUND and Research Foundation kinases shape the plant. Nat. Cell Biol. 11, 1166–1173. Flanders for a postdoctoral fellowship. 12. Neben, C.L., Lo, M., Jura, N., and Klein, O.D. (2019). Feedback regulation of RTK signaling in development. Dev. Biol. 447, 71–89. AUTHOR CONTRIBUTIONS 13. Belkhadir, Y., and Jaillais, Y. (2015). The molecular circuitry of brassinos- teroid signaling. New Phytol. 206, 522–540. M.M.M.-B., L.A., and M.L. performed cloning and raised and characterized the 14. Jaillais, Y., Hothorn, M., Belkhadir, Y., Dabi, T., Nimchuk, Z.L., genetic materials; M.M.M.-B., L.A., and L.C.N. quantified gravitropic bending Meyerowitz, E.M., and Chory, J. (2011). Tyrosine phosphorylation controls and performed western blot analyses of protein accumulation in MAKR2 brassinosteroid receptor activation by triggering membrane release of its mutant lines; M.M.M.-B. performed all microscopy experiments (double-blind kinase inhibitor. Genes Dev. 25, 232–237. quantifications in collaboration with L.A.); M.M.M.-B. performed DR5::GUS 15. Wang, X., and Chory, J. (2006). Brassinosteroids regulate dissociation of and DR5::GFP analyses in A.I.C.-D.’s laboratory; M.M.M.-B. performed the ki- BKI1, a negative regulator of BRI1 signaling, from the plasma membrane. nematic analysis of PIN2-GFP during gravitropism in T.B.’s laboratory (with the Science 313, 1118–1122. help of D.O., B.K.M., and S.V.); M.M.M.-B. performed the microfluidics exper- iments in J.F.’s laboratory; J.B. and L.A. performed in vitro Halo-pull down and 16. Wang, J., Jiang, J., Wang, J., Chen, L., Fan, S.L., Wu, J.W., Wang, X., and co-expression/purification in bacteria and related cloning; L.A. designed, iso- Wang, Z.X. (2014). Structural insights into the negative regulation of BRI1 lated, characterized, and phenotyped the makr2-1 crispr allele with the assis- signaling by BRI1-interacting protein BKI1. Cell Res. 24, 1328–1341. tance of Z.L.N.; L.R. performed co-immunoprecipitation in J.F.’s laboratory; 17. Simon, M.L., Platre, M.P., Marquès-Bueno, M.M., Armengot, L., Stanislas, M.P.P. provided genetic materials; V.B. assisted with microscopy and image T., Bayle, V., Caillaud, M.C., and Jaillais, Y. (2016). A PtdIns(4)P-driven Current Biology 31, 228–237, January 11, 2021 235 ll OPEN ACCESS Report electrostatic field controls cell membrane identity and signalling in plants. 34. Yazaki, J., Galli, M., Kim, A.Y., and Ecker, J.R. (2018). Profiling interactome Nat. Plants 2, 16089. networks with the HaloTag-NAPPA in situ protein array. Curr. Protoc. Plant , Y., and Jaillais, Y. (2020). Metabolic cellular communications: Biol. 3, e20071. 18. Boutte feedback mechanisms between membrane lipid homeostasis and plant 35. Fendrych, M., Akhmanova, M., Merrin, J., Glanc, M., Hagihara, S., development. Dev. Cell 54, 171–182. Takahashi, K., Uchida, N., Torii, K.U., and Friml, J. (2018). Rapid and reversible root growth inhibition by TIR1 auxin signalling. Nat. Plants 4, 19. Jaillais, Y., and Vert, G. (2016). Brassinosteroid signaling and BRI1 dy- 453–459. namics went underground. Curr. Opin. Plant Biol. 33, 92–100. 36. Finet, C., and Jaillais, Y. (2012). Auxology: when auxin meets plant evo- 20. Kang, Y.H., and Hardtke, C.S. (2016). Arabidopsis MAKR5 is a positive devo. Dev. Biol. 369, 19–31. effector of BAM3-dependent CLE45 signaling. EMBO Rep. 17, 1145– 1154. 37. Robert, S., Kleine-Vehn, J., Barbez, E., Sauer, M., Paciorek, T., Baster, P.,  Vanneste, S., Zhang, J., Simon, S., Covanová, M., et al. (2010). ABP1 me- 21. Xuan, W., Audenaert, D., Parizot, B., Möller, B.K., Njo, M.F., De Rybel, B., diates auxin inhibition of clathrin-dependent endocytosis in Arabidopsis. De Rop, G., Van Isterdael, G., Ma €hönen, A.P., Vanneste, S., and Cell 143, 111–121. Beeckman, T. (2015). Root cap-derived auxin pre-patterns the longitudinal axis of the Arabidopsis root. Curr. Biol. 25, 1381–1388. 38. Jaillais, Y., Belkhadir, Y., Balsemão-Pires, E., Dangl, J.L., and Chory, J. (2011). Extracellular leucine-rich repeats as a platform for recep- 22. Hazak, O., Brandt, B., Cattaneo, P., Santiago, J., Rodriguez-Villalon, A., tor/coreceptor complex formation. Proc. Natl. Acad. Sci. USA 108, Hothorn, M., and Hardtke, C.S. (2017). Perception of root-active CLE pep- 8503–8507. tides requires CORYNE function in the phloem vasculature. EMBO Rep. 39. Ulmasov, T., Murfett, J., Hagen, G., and Guilfoyle, T.J. (1997). Aux/IAA 18, 1367–1381. proteins repress expression of reporter genes containing natural and 23. Abas, L., Benjamins, R., Malenica, N., Paciorek, T., Wisniewska, J., highly active synthetic auxin response elements. Plant Cell 9, 1963– Moulinier-Anzola, J.C., Sieberer, T., Friml, J., and Luschnig, C. (2006). 1971. Intracellular trafficking and proteolysis of the Arabidopsis auxin-efflux 40. Benková, E., Michniewicz, M., Sauer, M., Teichmann, T., Seifertová, facilitator PIN2 are involved in root gravitropism. Nat. Cell Biol. 8, 249–256. D., Jürgens, G., and Friml, J. (2003). Local, efflux-dependent auxin 24. Zhang, X., Adamowski, M., Marhava, P., Tan, S., Zhang, Y., Rodriguez, L., gradients as a common module for plant organ formation. Cell 115, Zwiewka, M., Pukysová, V., Sánchez, A.S., Raxwal, V.K., et al. (2020). 591–602. Arabidopsis flippases cooperate with ARF GTPase exchange factors to 41. Xu, J., and Scheres, B. (2005). Dissection of Arabidopsis ADP- regulate the trafficking and polarity of PIN auxin transporters. Plant Cell RIBOSYLATION FACTOR 1 function in epidermal cell polarity. Plant Cell 32, 1644–1664. 17, 525–536. 25. Platre, M.P., Bayle, V., Armengot, L., Bareille, J., Marquès-Bueno, M.D.M., 42. Karimi, M., Bleys, A., Vanderhaeghen, R., and Hilson, P. (2007). Building Creff, A., Maneta-Peyret, L., Fiche, J.B., Nollmann, M., Miège, C., et al. blocks for plant gene assembly. Plant Physiol. 145, 1183–1191. (2019). Developmental control of plant Rho GTPase nano-organization by the lipid phosphatidylserine. Science 364, 57–62. 43. Curtis, M.D., and Grossniklaus, U. (2003). A Gateway cloning vector set for high-throughput functional analysis of genes in planta. Plant Physiol. 133, 26. Poraty-Gavra, L., Zimmermann, P., Haigis, S., Bednarek, P., Hazak, O., 462–469. Stelmakh, O.R., Sadot, E., Schulze-Lefert, P., Gruissem, W., and 44. Nito, K., Wong, C.C., Yates, J.R., III, and Chory, J. (2013). Tyrosine phos- Yalovsky, S. (2013). The Arabidopsis Rho of plants GTPase AtROP6 func- phorylation regulates the activity of phytochrome photoreceptors. Cell tions in developmental and pathogen response pathways. Plant Physiol. Rep. 3, 1970–1979. 161, 1172–1188. 45. Yazaki, J., Galli, M., Kim, A.Y., Nito, K., Aleman, F., Chang, K.N., Carvunis, 27. Sorek, N., Segev, O., Gutman, O., Bar, E., Richter, S., Poraty, L., Hirsch, A.R., Quan, R., Nguyen, H., Song, L., et al. (2016). Mapping transcription J.A., Henis, Y.I., Lewinsohn, E., Jürgens, G., and Yalovsky, S. (2010). An factor interactome networks using HaloTag protein arrays. Proc. Natl. S-acylation switch of conserved G domain cysteines is required for polar- Acad. Sci. USA 113, E4238–E4247. ity signaling by ROP GTPases. Curr. Biol. 20, 914–920. 46. Marquès-Bueno, M.M., Morao, A.K., Cayrel, A., Platre, M.P., Barberon, 28. Xuan, W., Band, L.R., Kumpf, R.P., Van Damme, D., Parizot, B., De Rop, M., Caillieux, E., Colot, V., Jaillais, Y., Roudier, F., and Vert, G. (2016). A G., Opdenacker, D., Möller, B.K., Skorzinski, N., Njo, M.F., et al. (2016). versatile multisite gateway-compatible promoter and transgenic line Cyclic programmed cell death stimulates hormone signaling and root collection for cell type-specific functional genomics in Arabidopsis. Plant development in Arabidopsis. Science 351, 384–387. J. 85, 320–333. 29. Baster, P., Robert, S., Kleine-Vehn, J., Vanneste, S., Kania, U., Grunewald, 47. Mitra, S.K., Chen, R., Dhandaydham, M., Wang, X., Blackburn, R.K., W., De Rybel, B., Beeckman, T., and Friml, J. (2013). SCF(TIR1/AFB)-auxin Kota, U., Goshe, M.B., Schwartz, D., Huber, S.C., and Clouse, S.D. signalling regulates PIN vacuolar trafficking and auxin fluxes during root (2015). An autophosphorylation site database for leucine-rich gravitropism. EMBO J. 32, 260–274. repeat receptor-like kinases in Arabidopsis thaliana. Plant J. 82, 30. Paciorek, T., Zazı́malová, E., Ruthardt, N., Petrásek, J., Stierhof, Y.D., 1042–1060. Kleine-Vehn, J., Morris, D.A., Emans, N., Jürgens, G., Geldner, N., and 48. Schneider, C.A., Rasband, W.S., and Eliceiri, K.W. (2012). NIH Friml, J. (2005). Auxin inhibits endocytosis and promotes its own efflux Image to ImageJ: 25 years of image analysis. Nat. Methods 9, from cells. Nature 435, 1251–1256. 671–675. 31. Pan, X., Fang, L., Liu, J., Senay-Aras, B., Lin, W., Zheng, S., Zhang, T., 49. Shaner, N.C., Lambert, G.G., Chammas, A., Ni, Y., Cranfill, P.J., Baird, Guo, J., Manor, U., Van Norman, J., et al. (2020). Auxin-induced signaling M.A., Sell, B.R., Allen, J.R., Day, R.N., Israelsson, M., et al. (2013). A bright protein nanoclustering contributes to cell polarity formation. Nat. monomeric green fluorescent protein derived from Branchiostoma lanceo- Commun. 11, 3914. latum. Nat. Methods 10, 407–409. 32. Cao, M., Chen, R., Li, P., Yu, Y., Zheng, R., Ge, D., Zheng, W., Wang, X., 50. Brunoud, G., Wells, D.M., Oliva, M., Larrieu, A., Mirabet, V., Burrow, A.H., Gu, Y., Gelová, Z., et al. (2019). TMK1-mediated auxin signalling regulates Beeckman, T., Kepinski, S., Traas, J., Bennett, M.J., and Vernoux, T. differential growth of the apical hook. Nature 568, 240–243. (2012). A novel sensor to map auxin response and distribution at high spa- 33. Dai, N., Wang, W., Patterson, S.E., and Bleecker, A.B. (2013). The TMK tio-temporal resolution. Nature 482, 103–106. subfamily of receptor-like kinases in Arabidopsis display an essential 51. Simon, M.L., Platre, M.P., Assil, S., van Wijk, R., Chen, W.Y., Chory, J., role in growth and a reduced sensitivity to auxin. PLoS ONE 8, e60990. Dreux, M., Munnik, T., and Jaillais, Y. (2014). A multi-colour/multi-affinity 236 Current Biology 31, 228–237, January 11, 2021 ll Report OPEN ACCESS marker set to visualize phosphoinositide dynamics in Arabidopsis. Plant J. 54. Livak, K.J., and Schmittgen, T.D. (2001). Analysis of relative gene expres- 77, 322–337. sion data using real-time quantitative PCR and the 2(Delta Delta C(T)) 52. Wang, Z.P., Xing, H.L., Dong, L., Zhang, H.Y., Han, C.Y., Wang, X.C., method. Methods 25, 402–408. and Chen, Q.J. (2015). Egg cell-specific promoter-controlled 55. von Wangenheim, D., Hauschild, R., Fendrych, M., Barone, V., Benková, CRISPR/Cas9 efficiently generates homozygous mutants for multiple E., and Friml, J. (2017). Live tracking of moving samples in confocal micro- target genes in Arabidopsis in a single generation. Genome Biol. 16, scopy for vertically grown roots. eLife 6, e26792. 144. 56. Grones, P., Chen, X., Simon, S., Kaufmann, W.A., De Rycke, R., 53. Grabov, A., Ashley, M.K., Rigas, S., Hatzopoulos, P., Dolan, L., and Nodzynski, T., Zazı́malová, E., and Friml, J. (2015). Auxin-binding pocket Vicente-Agullo, F. (2005). Morphometric analysis of root shape. New of ABP1 is crucial for its gain-of-function cellular and developmental roles. Phytol. 165, 641–651. J. Exp. Bot. 66, 5055–5065. Current Biology 31, 228–237, January 11, 2021 237 ll OPEN ACCESS Report STAR+METHODS KEY RESOURCES TABLE REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-Flag clone M2 Sigma-Aldrich Cat#1804; RRID: AB_262044 Mouse monoclonal anti-HA clone 12CA5 Sigma-Aldrich Cat#11583816001; RRID: AB_514505 Mouse monoclonal anti-GFP HRP clone Miltenyi Biotec Cat#130-091-833; RRID: AB_247003 GG4-2C2.12.10 Rat monoclonal anti-HA High Affinity clone Sigma-Aldrich Cat#11867423001; RRID: AB_390918 3F10 Bacterial and Virus Strains Agrobacteirum tumefaciens C58 GV3101 N/A N/A Escherichia coli DH5alpa N/A N/A Escherichia coli BL21 (DE3) Rosetta 2 Sigma-Aldrich Cat#69450 Novagen Chemicals, Peptides, and Recombinant Proteins Cycloheximide (CHX) Sigma-Aldrich Cat#C1988 MG-132 VWR Cat#474790-5 NAA Sigma-Aldrich Cat#N0640 IAA Sigma-Aldrich Cat#I2886 5-F-IAA Goldbiotech Cat#F-160-5 PEO-IAA Sigma-Aldrich Cat#CDS013406 Brassinolide Sigma-Aldrich Cat#B1439 Benzoid Acid (BA) Sigma-Aldrich Cat#242381 Experimental Models: Cell Lines Arabidopsis suspension culture (PSB-L) N/A N/A Experimental Models: Organisms/Strains Arabidopsis: MAKR2-Ox1 This manuscript NASC #N2110134 (2x35Sprom::MAKR2-2xmCHERRY) 17 Arabidopsis: MAKR2-Ox2 NASC #N2110135 (2x35Sprom::MAKR2-mCITRINE) Arabidopsis: amiMAKR2 This manuscript NASC #N2110142 and #N2110143 39 Arabidopsis: DR5::GUS N/A 40 Arabidopsis: DR5rev::GFP NASC #N9361 Arabidopsis: DR5::GUS;MAKR2-Ox1 This manuscript N/A Arabidopsis: DR5rev::GFP;MAKR2-Ox1 This manuscript N/A Arabidopsis: makr2-1 (crispr) This manuscript NASC #N2110144 Arabidopsis: MAKR2prom::MAKR2-tdYFP This manuscript NASC #N2110140 Arabidopsis: MAKR2prom::MAKR2-GUS This manuscript N/A Arabidopsis: MAKR2prom::VENUSNLS This manuscript NASC #N2110141 Arabidopsis: MAKR2prom::MAKR2- This manuscript N/A 2xmCHERRY 41 Arabidopsis: PIN2prom::PIN2-GFP N/A Arabidopsis: PIN2prom::PIN2- This manuscript N/A GFP;MAKR2-Ox1 Arabidopsis: PIN2prom::PIN2- This manuscript N/A GFP;amiMAKR2 25 Arabidopsis: ROP6prom::mCITRINE-ROP6 NASC #N2109740 in rop6-2 (Continued on next page) e1 Current Biology 31, 228–237.e1–e10, January 11, 2021 ll Report OPEN ACCESS Continued REAGENT or RESOURCE SOURCE IDENTIFIER 27 Arabidopsis: ROP6-Ox N/A Arabidopsis: MAKR2-Ox1;ROP6-Ox This manuscript N/A Arabidopsis: TMK1-Ox This manuscript NASC #N2110145 (UBQ10prom::TMK1-2xmCHERRY) Arabidopsis: MAKR2-Ox2;TMK1-Ox This manuscript N/A 33 Arabidopsis: tmk1-1;tmk4 SALK_01360 Wiscseq_DsLox377- 380D21.1 Arabidopsis: TMK1prom::2xmCHERRYNLS This manuscript N/A Arabidopsis: MAKR2-Ox2;TMK1K616R-Ox This manuscript N/A Arabidopsis: MAKR2-mCitGEGE This manuscript NASC #N2110136 and #N2110137 Arabidopsis: MAKR211Q-mCit This manuscript NASC #N2110138 and #N2110139 Oligonucleotides Primer: MAKR2prom-topo F This manuscript N/A GTCTCTTTCAGTCATACCTCTCTCTAA Primer: MAKR2prom-topo R This manuscript N/A TGTTGGGAAAGCCAGAATCA Primer: MAKR2-B1 This manuscript N/A GGGGACAAGTTTGTACAAAA AAGCAGGCTTAACCATGGAAGCTT TCAGTCTCCTTAAC Primer: MAKR-B2 GGGGACCACTTTGT This manuscript N/A ACAAGAAAGCTGGGTATTTCTCGTAA GAGGAAGGTTCACT Primer: tdYFP-B2R This manuscript N/A GGGGACAGCTTTCTTG TACAAAGTGGCTATGGTATCCAAAGGT GAAGAAGACA Primer: tdYFP-B3 This manuscript N/A GGGGACAACTTTGTATAAT AAAGTTGCTCACTTATACAGTTCGT CCATCCCC Primer: TMK1-B1 F GGGGACAAGTTT This manuscript N/A GTACAAAAAAGCAGGCTTAA CCATGAAGAAAAGAA GAACCTTTCTTCT Primer: TMK1-B2 R GGGGACCACTTTG This manuscript N/A TACAAGAAAGCTGGGT ATCGTCCATCTACT GAAGTGAATGACT Primer: tdYFP-B2R This manuscript N/A GGGGACAGCTTTCTTGTA CAAAGTGGCTATGGTAT CCAAAGGTGAAGAAGACA Primer: tdYFP-B3 GGGGACAACTTTGTA This manuscript N/A TAATAAAGTTGCTCACTTATACAGTTCG TCCATCCCC Primer: TMK1prom-Fw GTATAGAAAAG This manuscript N/A TTGCTGTGGAATTTTA ATCTTAATTAAGGGAAGC Primer: TMK1prom-Rev TTTTTTGT This manuscript N/A ACAAACTTGCAGCTTGA AGAAACAGAGGATTGAAGAAGAAACAG Primer: p50 -open-Fw This manuscript N/A CCTCTGTTTCTTCAAGCTGCAAGTTT GTACAAAAAAGTTGAACG (Continued on next page) Current Biology 31, 228–237.e1–e10, January 11, 2021 e2 ll OPEN ACCESS Report Continued REAGENT or RESOURCE SOURCE IDENTIFIER Primer: p50 -open-Rev This manuscript N/A TTAAGATTAAAATTCCACAGCAACTTTT CTATACAAAGTTGG Primer: TMK1KD(K616R)-F This manuscript N/A ATTGCGGTTAGGAGAATGGAGAATGGA GTTATTGCTGG Primer: TMK1KD(K616R)-R This manuscript N/A CCATTCTCCATTCTCCTAACCGCAAT CTTCGTTCCATC Primer: TMK1-FL-B1 GGGGACAAGTTTG This manuscript N/A TACAAAAAAGCAGGCTCAAT GAAGAAAAGAAGAACCTTTC Primer: TMK1-FL-B2-R GGGGACCAC This manuscript N/A TTTGTACAAGAAAGCTG GGTCTCGTCCATCTACTGAAGTGAAT Primer: TMK1-DKD-B2-R GGGGACCAC This manuscript N/A TTTGTACAAGAAAGCTGGGTCGTTGTT AGTCACAGAACGAAG Primer: F1 gRNA3 This manuscript N/A ATATATGGTCTCGATTGCTTTCAGTCTC CTTAACTACGTT Primer: F0 gRNA3 This manuscript N/A TGCTTTCAGTCTCCTTAACTACGTTTTA GAGCTAGAAATAGC Primer: R0 gRNA4 This manuscript N/A AACGCGGAGTAACGGCAAAGAGACA ATCTCTTAGTCGACTCTAC Primer: R2 gRNA4 This manuscript N/A ATTATTGGTCTCGAAACGCGGAGTAAC GGCAAAGAGACAA Primer: MAKR2 qPCR F This manuscript N/A CAACAAGATAGTATTCAAAGTGCCA Primer: MAKR2 qPCR R This manuscript N/A GAGGAAGGTTCACTCACCGA Primer: EF1 alpha qPCR F This manuscript N/A TGAGCACGCTCTTCTTGCTTTCA Primer: EF1 alpha qPCR R This manuscript N/A GGTGGTGGCATCCATCTTGTTACA Primer: GAPDH F This manuscript N/A GAATCCGAAGGCAAACTCAA Primer: GAPDH R This manuscript N/A AAACTTGTCGCTCAATGCAA Recombinant DNA 42 Empty gateway destination vector: N/A pB7m34GW 42 Empty gateway destination vector: N/A pH7m34GW Empty gateway destination vector: Gift from Lothar Kalmbach, Cambridge N/A pLOK180_FR7m34GW 43 Empty gateway destination vector: N/A pMDC32 44 Empty gateway destination vector: pTNT- N/A HA-GW (Continued on next page) e3 Current Biology 31, 228–237.e1–e10, January 11, 2021 ll Report OPEN ACCESS Continued REAGENT or RESOURCE SOURCE IDENTIFIER 45 Empty gateway destination vector: ABRC #CD3-1742 pIX:HALO:ccdB-CmR Expression plasmid: pET28-duet This manuscript N/A 46 Entry gateway vector: 2x35prom/pDONR4- NASC #N2106316 P1R 46 Entry gateway vector: UBQ10prom/ NASC #N2106315 pDONR4-P1R Entry gateway vector: MAKR2prom/ This manuscript N/A pENTR50 Entry gateway vector: TMK1prom/ This manuscript N/A pDONRP4-P1R 17 Entry gateway vector: MAKR2gnoSTOP/ N/A pDONR221 Entry gateway vector: MAKR2wSTOP/ This manuscript N/A pDONR221 Entry gateway vector: TMK1noSTOP/ This manuscript N/A pDONR221 Entry gateway vector: TMK1K616RnoSTOP/ This manuscript N/A pDONR221 Entry gateway vector: MAKR2(CDS) This manuscript N/A noSTOP/pDONR221 Entry gateway vector: MAKR211QnoSTOP/ This manuscript N/A pDONR221 14 Entry gateway vector: 2xmCHERRY- NASC #N2106292 4xMyc/pDONRP2R-P3 14 Entry gateway vector: mCITRINE/ NASC #N2106288 pDONRP2R-P3 Entry gateway vector: tdYFP/ This manuscript N/A pDONRP2RP3 Entry gateway vector: mCITRINEGEGE/ 17 N/A pDONRP2R-P3 Entry gateway vector: TMK1cyt/pDONR221 This manuscript N/A Entry gateway vector: HSL1cyt/pDONR221 47 ABRC #N1g28440Ze_K 46 Entry gateway vector: mCITRINEwSTOP/ N/A pDONR221 Entry gateway vector: TMK1Dkinase/ This manuscript N/A pDONR221 Destination expression vector: TMK1cyt/ This manuscript N/A pTNT-HA-GW Destination expression vector: HSL1cyt/ This manuscript N/A pTNT-HA-GW Destination expression vector: mCITRINE/ This manuscript N/A pIX-HA-GW Destination expression vector: MAKR2/pIX- This manuscript N/A HA-GW Expression vector: MAKR2-TMK1cyt/ This manuscript N/A pET28-duet Expression vector: MAKR2-TMK1cytK616R/ This manuscript N/A pET28-duet Destination vector: UBQ10prom::TMK1- This manuscript N/A 3HA/pB7m34GW Destination vector: This manuscript N/A UBQ10prom::TMK1Dkinase-3HA/ pB7m34GW (Continued on next page) Current Biology 31, 228–237.e1–e10, January 11, 2021 e4 ll OPEN ACCESS Report Continued REAGENT or RESOURCE SOURCE IDENTIFIER Destination vector: 2x35Sprom::MAKR2- This manuscript N/A 2xmCHERRY/pH7m34GW Destination vector: 2x35Sprom::MAKR2- This manuscript N/A mCitrine/pB7m34GW Destination vector: amiMAKR2/pMDC32 This manuscript N/A Destination vector: amiMAKR2/pB7WG2 This manuscript N/A Destination vector: MAKR2prom::MAKR2- This manuscript N/A 2xmCHERRY/pH7m34GW Destination vector: MAKR2prom::MAKR2- This manuscript N/A tdYFP/pB7m34GW Destination vector: UBQ10prom::TMK1- This manuscript N/A 2xmCHERRY-/pH7m34GW Destination vector: This manuscript N/A UBQ10prom::TMK1K616R-2xmCHERRY-/ pH7m34GW Destination vector: 2x35S::MAKR2- This manuscript N/A mCitGEGE/pB7m34GW Destination plasmid: 2x35S::MAKR211Q- This manuscript N/A mCit/pLOK180_pFR7m34GW Destination vector: MAKR2prom::MAKR2- This manuscript N/A GUS Destination vector: This manuscript N/A MAKR2prom::VENUSNLS Destination vector: This manuscript N/A TMK1prom::2xmCHERRYNLS Software and Algorithms ImageJ NIH48 https://imagej.nih.gov/ij/ R R project https://www.r-project.org/ Excel Microsoft https://www.microsoft.com/ Other Plant/Fungi RNA Purification Kit Sigma-Aldrich Cat#E4813 Reverse transcriptase SuperScript IV VILO Thermofisher Cat#11756050 Master Mix Gateway BP clonase Thermofisher Cat#11789100 Gateway LRII plus clonase Thermofisher Cat#12538120 TnT Coupled Wheat Germ Extract System Promega / Thermofisher Cat#L5030 Halo-tag magnetic beads Promega / Thermofisher Cat#7281 RESOURCE AVAILABILITY Lead Contact Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Yvon Jaillais (yvon.jaillais@ens-lyon.fr). Materials Availability There is no restriction of the material generated in this study (plasmids and Arabidopsis transgenic seeds). Data and Code Availability This study did not generate any unique datasets or code. e5 Current Biology 31, 228–237.e1–e10, January 11, 2021 ll Report OPEN ACCESS EXPERIMENTAL MODEL AND SUBJECT DETAILS Plant material and Growth conditions In all the experiments, wild-type Col-0 ecotype of Arabidopsis thaliana was used as a control and all transgenic lines were produced in Col-0 background. Plants were grown in continuous light on MS supplemented with vitamins (Duchefa) and 1% sucrose. The following transgenic lines have been described before: 35S::GFP-ROP6 (ROP6-Ox);27 DR5prom::GUS;39 DR5rev-prom::GFP;40 PIN2::PIN2- GFP;41 ROP6prom::mCitrine-ROP6g/rop6-2,25 tmk1-1 (SALK_016360) and tmk1tmk4 mutants (tmk4: Wiscseq_DsLox377-380D21.1).33 Plant Transformation and Selection Each construct was transformed into C58 GV3101 Agrobacterium tumefaciens strain and selected on YEB media (5g/L beef extract; 1g/L yeast extract; 5g/L peptone; 5g/L sucrose; 15 g/L bactoagar; pH 7.2) supplemented with antibiotics (Spectinomycin, Gentamy- cin). After two days of growth at 28 C, bacteria were collected using a single-use cell scraper, re-suspended in about 200 mL of trans- formation buffer (10mM MgCl2; 5% sucrose; 0.25% silweet) and plants were transformed by dipping. Plants from the Columbia– 0 (Col0) accession were used for transformation. Primary transformants (T1) were selected in vitro on the appropriate antibiotic/herbicide (glufosinate for mCITRINE, hygromycin for mCHERRY-tagged proteins or using the FastRed screening method). Approximately 20 independent T1s were selected for each line. In the T2 generation at least 3 independent transgenic lines were selected using the following criteria when possible: i) good expression level in the root for detection by confocal microscopy, ii) uniform expression pattern, iii) single insertion line (1 sensitive to 3 resistant segre- gation ratio). Lines were rescreened in T3 using similar criteria as in T2 with the exception that we selected homozygous lines (100% resis- tant/fluorescent). At this step, we selected one to three transgenic line(s) that was(were) used for further analyses and crosses. METHOD DETAILS Cloning and characterization of transgenic lines The cloning for the transgenic lines production was performed using the multi-site gateway system (thermofisher). Cloning of promoters into gateway entry vectors The MAKR2 promoter was amplified from Col-0 genomic DNA using MAKR2prom-topoF/MAKR2prom-topoF (Key Resources Table) and cloned into the pENTR 50 -TOPO TA vector by TOPO TA Cloning (thermofisher) to give MAKR2prom/pENTR50 . The TMK1 pro- moter was amplified from Col-0 genomic DNA using TMK1prom-Fw and TMK1prom-Rev and cloned into pDONRP4-P1R using Gibson cloning, with pDONRP4-P1R having been amplified using the p50 -open-Fw and p50 -open-rev primers, to give TMK1prom/ pDONRP4-P1R. 2x35Sprom/pDONRP4P1R and UBQ10prom/pDONRP4P1R were described previously.14,46 Cloning of genes into gateway entry vectors The MAKR2 genomic fragment was amplified from Col-0 genomic DNA using MAKR2-B1/MAKR2-B2 primers and introduced into the pDONR221 by BP recombination to give MAKR2gnoSTOP/pDONR221. TMK1 was amplified from Col-0 cDNA using TMK1-B1/ TMK1-B2 primers and recombined into pDONR221 by BP cloning to give TMK1noSTOP/pDONR221. MAKR2(CDS)noSTOP/ pDONR221 was previously described.17 TMK1KD(K616R)noSTOP/pDONR221 was obtained by site directed mutagenesis by ampli- fying TMK1noSTOP/pDONR221 with the TMK1KD-K616F/TMK1KD-K616R primer pair. The MAKR211Q (CDS) no STOP sequence was synthesized by IDT technologies in the pUCIDT-AMP vector and subsequently re- combined into pDONR221 by BP reaction to obtain MAKR211Q (CDS) no STOP/pDONR221. In the MAKR211Q sequence, the 11 posi- tively charged residues (lysine -K- or arginine -R-) of the cationic region were mutated to the neutral amino acid glutamine (Q) as follows: > MAKR2 780 gag aaa cga ttc gtg atg atg caa aag tac tta aag aag gta aaa cca ctt tac atc aga E K R F V M M Q K Y L K K V K P L Y I R gtt tca cgt cgt tac ggc gag aaa tta cga cac 870 V S R R Y G E K L R H > MAKR211Q 780 gag caa caa ttc gtg atg atg caa cag tac tta cag cag gta caa cca ctt tac atc caa E Q Q F V M M Q Q Y L Q Q V Q P L Y I Q gtt tca caa cag tac ggc gag caa tta caa cac 870 V S Q Q Y G E Q L Q H Cloning of artificial microRNAs into gateway entry vectors Artificial microRNAs were designed using web microRNA designer (http://wmd3.weigelworld.org/cgi-bin/webapp.cgi). The following sequence was synthesized by IDT technologies and subsequently recombined into pDONR/Zeo by BP recombination to give ami- MAKR2/ pDONR/Zeo: Current Biology 31, 228–237.e1–e10, January 11, 2021 e6 ll OPEN ACCESS Report > amiMAKR2 acaagtttgtacaaaaaagcaggctcaaacacacgctcggacgcatattacacatgttcatacacttaatactcgctgttttgaattgatgttttaggaatatatatgtagatatgtaaa gtggttttacctatcacaggtcgtgatatgattcaattagcttccgactcattcatccaaataccgagtcgccaaaattcaaactagactcgttaaatgaatgaatgatgcg gtagacaaattggatcattgattctctttgataggtaaaaccactttacatatctctcttttgtattccaattttcttgattaatctttcctgcacaaaaacatgcttgatccactaagtga catatatgctgccttcgtatatatagttctggtaaaattaacattttgggtttatctttatttaaggcatcgccatgacccagctttcttgtacaaagtggt Attb1 and Attb2 for gateway cloning amiMAKR2/ pDONR/Zeo was transferred by LR recombination into pMDC3243 or pB7WG2.42 Cloning of reporters into gateway entry vectors: tdYFP is a tandem dimer of dlanYFP (from Branchiostoma lanceolatum).49 The following sequence was codon optimized for Ara- bidopsis and synthetized by IDT (https://eu.idtdna.com/site): > tdYFP: atggtatccaaaggtgaagaagacaatatggcatcattacctgcaacccatgagcttcacatctttggtt cgtttaatggagtagattttgatatggttggaagagggacaggtaaccctaacgacggttatgaagaact taaccttaaatctaccaagggagatctccaattctctccttggattttggtcccacagattggttatggt tttcatcagtatttgccatttcccgacggaatgtctccattccaagcagccatgaaagacggctcgggct accaggttcacagaacaatgcaatttgaagatggtgcaagtctcacttctaactatcgttatacgtatga aggaagtcatattaaaggcgaatttcaggtaaagggaactggatttcctgccgacggaccagttatgaca aattcattgactgcagcagattggtgtgtgacaaagatgttatatccaaacgacaagactatcatctcaa cttttgattggacttacactacgggtaatggaaaaaggtatcaaagcacggcaagaaccacttacacatt cgccaagccaatggcagcaaacatactaaagaaccagccaatgttcgtttttagaaagacagagctcaag cattcaaagactgaacttaacttcaaagaatggcaaaaagcattcaccgatgtgatgggtcatggaactg gatctacgggatctggctcaagtggaacagcaagttctgaagataataatatggcatcgctgcctgcaac ccatgaacttcatatatttgggtctttcaatggagtcgattttgacatggtaggacgaggtacaggtaat cctaacgatgggtacgaggagttgaacctaaagagtactaagggagacctccagttcagtccctggattt tagtaccgcaaatcggttatggattccaccagtatttaccatttccggacggaatgtcgccctttcaggc ggcgatgaaagacggctctggatatcaggttcatagaaccatgcaatttgaggacggagcatctctgacg tccaactatagatatacttatgaaggctcgcacattaaaggagagtttcaggtgaagggaactggattcc ctgctgacggccctgtcatgacaaatagccttactgctgcggattggtgtgttaccaaaatgctctaccc taatgacaagactatcatcagtacttttgactggacttatactactggaaacgggaagcgatatcagtcc acggcaagaactacatacacctttgccaaacctatggcagccaacatcttgaaaaaccaaccaatgtttg tgttcaggaagactgaacttaaacactcaaaaaccgaactgaatttcaaagagtggcagaaagctttcac agatgttatggggatggacgaactgtataagtga The synthetic tdYFP gene was subsequently amplified using the tdYFP-B2R/tdYFP-B3 primer pair and cloned into pDONRP2R-P3 using BP recombination. mCITRINE/pDONRP2RP3, mCITRINEnoSTOP/pDONR221, mCITRINEGEGE/pDONRP2RP3, 2xmCHERRY- 4xMyc/pDONRP2RP3, GUS/pDONRP2R-P3, VENUSNLS/pDONR221 and mock/pDONRP2RP3 were described previously.14,17,46,50 All primers used for cloning are indicated in the Key Resources Table. Destination vectors and plant transformation Arabidopsis stable transformation and selection were performed as described.51 Final destination vectors for plant transformation were obtained using the LR recombination system (http://www.thermofisher.com/) using the pB7m34GW42 (basta resistant), pH7m34GW42 (hygromycin resistant), pB7WG2 (basta resistant),42 pLOK180_pFR7m34GW (gift from Lothar Kalmbach, Cambridge, similar backbone as pB7m34GW but with the basta resistance replaced by a FASTRED cassette for selection of transgenic seeds via red fluorescence) or pMDC3243 (hygromycin resistant) destination vectors. The following Gateway LR reactions were set-up to generate the corresponding destination vectors (the name of the correspond- ing transgenic line is highlighted in bold): 2x35Sprom::MAKR2-2xmCHERRY/pH7m34GW (MAKR2-Ox1) was obtained by recombining 2x35Sprom/pDONR4-P1R, MAKR2gnoSTOP/pDONR221, 2xmCHERRY-4xMyc/pDONR2R-P3, and pH7m34GW. 2x35Sprom::MAKR2-mCITRINE/pB7m34GW (MAKR2-Ox2) was obtained by recombining 2x35Sprom/pDONR4-P1R, MAKR2gnoSTOP/pDONR221, mCITRINE/pDONR2R-P3, and pB7m34GW. 2x35Sprom::amiMAKR2/pMDC32 (amiMAKR2.1 and amiMAKR2.3) 2x35Sprom::amiMAKR2/pB7WG2 (amiMAKR2.2) were obtained by recombining amiMAKR2/pDONR221, with pMDC32 or pB7WG2, respectively. MAKR2prom::MAKR2-2xmCHERRY/pH7m34GW (MAKR2::MAKR2-2Ch) was obtained by recombining MAKR2prom/ pDONR4-P1R, MAKR2gnoSTOP/pDONR221, 2xmCHERRY-4xMyc/pDONR2R-P3, and pH7m34GW. MAKR2prom::MAKR2-tdYFP/pB7m34GW (MAKR2::MAKR2-tdYFP) was obtained by recombining MAKR2prom/pDONR4-P1R, MAKR2gnoSTOP/pDONR221, tdYFP/pDONR2R-P3, and pB7m34GW. e7 Current Biology 31, 228–237.e1–e10, January 11, 2021 ll Report OPEN ACCESS MAKR2prom::MAKR2-GUS/pK7m34GW (MAKR2::MAKR2-GUS) was obtained by recombining MAKR2prom/pDONR4-P1R, MAKR2gnoSTOP/pDONR221, GUS/pDONR2R-P3, and pK7m34GW. MAKR2prom::VENUSNLS/pB7m34GW (MAKR2::VENUSNLS) was obtained by recombining MAKR2prom/pDONR4-P1R, VE- NUSNLS/pDONR221, mock/pDONR2R-P3, and pB7m34GW. TMK1prom::CHERRYNLS/pH7m34GW (TMK1::2ChNLS) was obtained by recombining TMK1prom/pDONR4-P1R, mCHERRYno- STOP/pDONR221, mCHERRYNLS/pDONR2R-P3, and pH7m34GW. UBQ10prom::TMK1-2xmCHERRY/pH7m34GW (TMK1-Ox) was obtained by recombining UBQ10prom/pDONR4-P1R, TMK1noSTOP/pDONR221, 2xmCHERRY-4xMyc/pDONR2R-P3, and pH7m34GW. UBQ10prom::TMK1K616R-2xmCHERRY/pH7m34GW (TMK1K616R-Ox) was obtained by recombining UBQ10prom/pDONR4- P1R, TMK1K616RnoSTOP/pDONR221, 2xmCHERRY-4xMyc/pDONR2R-P3, and pH7m34GW. 2x35Sprom::MAKR2-mCITRINEGEGE/pB7m34GW (MAKR2-mCitGEGE) was obtained by recombining 2x35Sprom/pDONR4- P1R, MAKR2(CDC)/pDONR221, mCITRINEGEGE/pDONR2R-P3, and pB7m34GW. 2x35Sprom::MAKR2-mCITRINEGEGE/pLOK180_pFR7m34GW (MAKR211Q-mCit) was obtained by recombining 2x35Sprom/ pDONR4-P1R, MAKR211Q(CDC)P/pDONR221, mCITRINE/pDONR2R-P3, and pLOK180_pFR7m34GW. Cloning and characterization of makr2 crispr allele The makr2-1 crispr allele (Col0) was generated using the egg cell-specific promoter (pEC1.2) CRISPR/Cas9 system described in Wang et al.52 Two single guide RNAs (sgRNA) were originally used in the construct: sgRNA3 50 -CTTTCAGTCTCCTTAACTAC-30 and sgRNA4 50 -TCTCTTTGCCGTTACTCCG-30 but mutations were only found in the sgRNA3 target sequence. Primers containing the sgRNA sequences and the BsaI restriction site were designed (F1 gRNA3: ATATATGGTCTCGATTGCTTTCAGTCTCCTTAAC TACGTT; F0 gRNA3:TGCTTTCAGTCTCCTTAACTACGTTTTAGAGCTAGAAATAGC; R0 gRNA4: AACGCGGAGTAACGGCAAAGA GACAATCTCTTAGTCGACTCTAC; R2 gRNA4: ATTATTGGTCTCGAAACGCGGAGTAACGGCAAAGAGACAA) and a fourth primer PCR was performed using the pCBC-DT1T2 vector as a template. The PCR fragment containing the sgRNAs was introduced to the binary vector pHEE401E by golden gate cloning using BsaI restriction sites. Plants were transformed and T1 plants selected by hygromicin resistance. Plants carrying mutations were selected by sequencing and, homozygous mutant plants depleted of the T-DNA were counterselected in T2. The makr2-1 mutant carries a frameshift mutation (1 nucleotide (A) insertion) at position 25 relative to the MAKR2 start ATG. The resulting predicted short MAKR2 protein comprises 37 amino acids. The first 8 amino acids correspond to MAKR2 wt sequence, and amino acids 9 to 37 represent an aberrant amino acid sequence. Gravitropism experiments The horizontal gravitropic index was quantified using imageJ as indicated in Platre et al.25 and Grabov et al.53 Plants were grown on plates with a 45 angle. The horizontal growth index was calculated on 7-day-old seedlings using the ‘‘segment line’’ tool on FIJI. Briefly, to calculate the gravitropic indexes, two length are considered, L and Lx.53 L is the total length of the roots (from base of hy- pocotyl to root tip), while Lx is the abscissa of the root tip (considered from the point of view of the base of hypocotyl). The horizontal growth index (HGI) corresponds to the ratio Lx/L. The experiments were performed 3 times and at least 21 plants of each genotype were quantified in every independent experiment. Gravitropic experiments were performed either on 5 to 6-days-old seedlings grown in MS media containing 1% sucrose. In order to align the roots, one hour prior to the experiment, seedlings were transferred in a new vertical plate. An angle of 135 was applied in darkness and the same plates were scanned after 3 or 4 hours, 6 hours, 12 hours, 24 hours or 48 hours. The angle of the root bending at each time point was quantified using ImageJ.48 The experiment was performed 3 independent times and at least 30 plants of each genotype were quantified. Kinetics of the PIN2 dynamics during gravitropism was performed as follows: 5-days-old seedlings were transferred and aligned in new 1/2 MS Petri dishes one hour prior to the experiment. In this case, an angle of 90 was applied and fluorescent images were taken every five minutes during six hours. The angle of the root bending was quantified using ImageJ. Quantitative RT-PCR (qPCR) Total RNA was isolated using the Plant/Fungi RNA Purification Kit (sigma) and quantified using Nanodrop 1000 (Thermo Scientific, http://www.nanodrop.com/). 1 mg of total RNA was reverse transcribed and amplified using the SuperScript IV VILO Master Mix (Thermofisher). Transcripts levels were measured by qPCR using amplified cDNA. The relative amount of each transcript was calcu- lated with the 2-DCT method54 using EF1-alpha and GADPH transcripts as housekeeping for data normalization. Each experiment was performed in at least three biological replicates. The qPCR primers used are described in the table below. Drugs and hormones treatments Drugs and hormones treatments were performed in liquid 1/2 MS on 5 days-old-seedlings. Cycloheximide (CHX) (stock 50 mM in DMSO) and MG-132 (stock 25 mM in DMSO) treatments were carried out at 50 mM during two hours before the NAA treatment. NAA treatments were done at 1 mM or 10 mM during 5 or 30 minutes, as indicated in the experiment. The auxin analogs 5-F-IAA (stock 10 mM in ethanol), PEO-IAA (stock 10 mM in ethanol) and benzoic acid (BA) (stock 10 mM in ethanol) were diluted in 1/2 MS at 10 mM during 30 minutes. Brassinolide (stock 10 mM in DMSO) treatments were performed at 10 mM during 30 minutes. Current Biology 31, 228–237.e1–e10, January 11, 2021 e8 ll OPEN ACCESS Report Each treatment was repeated in at least three independent experiments and quantifications were performed on at least 14 roots. The number of cells quantified is indicated in the corresponding graphs. Microscopy The experiments were performed using either the LSM710 confocal microscope using a 40X Plan-apochromatic objective (numerical aperture 1.2, oil immersion) (Zeiss) or inverted Zeiss microscope (AxioObserver Z1, http://www.zeiss.com/) equipped with a spinning disk module (CSU-W1-T3, Yokogawa, http://www.yokogawa.com/) and a ProEM+ 1024B camera (PrincetonInstrument, http://www. princetoninstruments.com/) using a 40X C-Apochromat objective (numerical aperture 1.1, water immersion). tdYFP and mCitrine were exited at 512 nm and mCherry was excited at 550 nm. FM4-64 stainning were performed as described in Marquès-Bueno et al.46 MAKR2-Ox1 imaging was performed using a FV 1000 confocal microscope (Olympus, Tokyo, Japan) mCherry was excited at 550 nm and using 40X oil objective. Microfluidic experiments were performed using a vertical ZEISS LSM700 confocal microscope with a 20x/0.8 Plan-Apochromat M27 objective.55 In this case, tdYFP was exited at 488 nm and images were taken every minute, during six minutes. First, three im- ages of roots in liquid MS media without hormones were acquired and afterward NAA 10mM or IAA 10 mM or benzoic acid 10mM were added and three additional pictures were taken. The kinetics of the PIN2 dynamics was performed using a verticaly mounted Olympus MVX10 macroview fluorescence stereomi- croscope,28 setting up the automated filterwheels to allow fluorescence imaging for GFP and using 5x magnification. (http://www. olympusamerica.com). For the time lapse imaging, ‘‘Process Manage’’ function in Cellsens Dimension software (Olympus) was used. After finishing the acquisition, the images were saved as a video and analyzed using ImageJ software. 6-days-old seedlings of MAKR2prom::MAKR2-GUS, DR5prom::GUS or MAKR2ox1-DR5prom::GUS were fixed in cold 90% acetone on ice during 20 minutes, then washed three times with 50 mM NaHPO4 buffer (pH 7.2) and stained over night with 2 mM X- Gluc staining buffer at 37 C in the darkness. Afterward, roots were washed with ethanol series from 30%, 50%, 70% 20 min each step and then finally 100%. Finally, the roots were mounted with chloralhydrate and pictures were obtained using the Leica DM6 (Leica, Germany) epifluorescence vertical microcroscope equiped with a Normansky optics and using either 20x or 40x magnification. Quantifications were done using region-of-interests drawn in the upper and lower part of the root tip and GUS/GFP intensity were quantified using the mean intensity tool from ImageJ. In the case of DR5prom::GUS, the analyses were made on 60 roots and three independent experiments (20 roots per replicate), and 42 roots and three independent experiments (14 roots per replicate) for DR5prom::GFP. In vitro Halo-pull down The cytoplasmic domains of TMK1 and HSL1 cloned into pDONR221 was recombined by LR reaction into pTNT-HA-GW.44 The HSL1cyt clone was ordered to ABRC.47 mCITRINEwSTOP/pDONR221 and MAKR2wSTOP/pDONR221 were recombined by LR re- action into pIX:Halo:ccdb.45 The TnT Coupled Wheat Germ Extract System from Promega were used for cell free expression. 4 mg of both plasmids were added to the reaction mix following the commercial protocol. The reactions were incubated at 25 C for 2 hours. The equivalent of 10 ml of dry Halo-tag magnetic beads from Promega were added and the samples were incubated at room tem- perature for 30 minutes on an orbital shaker. The supernatant was discarded and the beads were incubated for 3 minutes in PBS + 0,05% Tween20. The solution was discarded. This wash was repeated 3 times. The beads were then resuspended in SDS-PAGE loading buffer, separated by SDS-PAGE and subjected to immunoblotting using anti-Flag antibody (clone M2, F1804, Sigma) and Anti-HA antibody (12CA5, Sigma-Aldrich). Co-expression, purification and mass-spectrometry To generate the backbone plasmid for co-expression in bacteria, pET28a+ and pACYC-duet were digested using Xba1 and Xho1. The MCS cassette of pACYC-duet was inserted into pET28a+ leading to the generation of pET28-duet. MAKR2 and TMK1 were amplified by PCR from Col-0 cDNA. The tags and restriction sites were added by PCR. MAKR2 PCR fragment was cloned into pET28-duet between Nde1 and Xho1 and TMK1 PCR fragment between Nhe1 and Not1. Mutation to generate a dead kinase version of TMK1 was done by PCR. The resulting plasmids were transformed in Escherichia coli BL21 (DE3) Rosetta 2 from No- vagen that were spread on LB + 100 mg/mL kanamycin plates. Several colonies were picked and transferred into 100ml of 2xTY + 100 mg/mL kanamycin and incubated overnight at 37C under 180rpm shaking. The day after, a 250ml culture of 2xTY + 100 mg/mL kanamycin was inoculated with the preculture to reach a 0.1 OD600 and incubated at 37 C under 180 rpm shaking until OD600 0.6. Then 0.5 mM IPTG was added and the samples were incubated for 75 minutes at 37 C. The cultures were pelleted through a 5000 rcf centrifuge for 20 minutes. The pellets were resuspended in 15 mL of resuspension buffer (20 mM Tris pH8, NaCl 150mM and 20mM imidazole). The resuspended pellets were flash freezed and stored at 20 C. The pellets were unfrozen, 5 mM beta-mer- captoehanol was added, then sonicated and centrifuged at 15000 rcf for 40 minutes at 4 C. The soluble fraction was applied on 0.5 mL of IMAC-nickel resin. The resin was washed with 10 column volumes of resuspension buffer, then 5 column volumes of resuspension buffer + 40 mM imidazole. The proteins were eluted within 2 column volumes of Tris 20mM pH8, NaCl 150mM and 400 mM imidazole. The samples were analyzed by mass spectrometry (ESI/MS/MS) by PSF platform of SFR Biosciences (UMS3444/CNRS, US8/Inserm, ENS de Lyon, UCBL). e9 Current Biology 31, 228–237.e1–e10, January 11, 2021 ll Report OPEN ACCESS Co-immunoprecipitation Assay Co-immunoprecipitation assays were performed in the Arabidopsis suspension culture (PSB-L) protoplast system. Protoplast were iso- lated and transfected or co-transfected with 15 mg of plasmid DNA (UBQ10::TMK1-3HA, UBQ10::TMK1Dkinase-3HA, 2x35S::MAKR2- mCitrine) according to the method described previously.56 After transfection, protoplasts were incubated for 16 hours in the dark to allow gene expression, treated with either DMSO or 1mM IAA dissolved in DMSO for 1 hour, collected and frozen in liquid nitrogen. For coimmunoprecipitation (Co-IP) assay, 5x105 transfected protoplasts were lysed with 50 ml of extraction buffer (50 mM Tris HCl pH 7.5, 150 mM NaCl, 10 mM MgCl2, 1% (w/v) Triton X-100, 5 mM DTT, PhosSTOP phosphatase inhibitor cocktail (Roche), 1x EDTA free-Complete Protease Inhibitor Cocktail (Roche). After vortexing vigorously for 30 s, the samples were centrifuged at 14,000 3 g for 10 min at 4 C and supernatants were collected. Prior to the Co-IP assay, 25 ml of collected supernatants were analyzed by immunoblot assay to determine Co-IP input. To perform the Co-IP assay, 75 ml of extraction buffer without Triton X-100 were added to remaining 25 ml of supernatants, followed by incubation with GFP-Trap Magnetic Agarose (ChromoTek) for 1 hour at 4 C, three washing steps with washing buffer (50 mM Tris HCl pH 7.5, 200 mM NaCl, 1 mM EDTA, 0.1%Triton X-100), once with 50 mM Tris$HCl pH 7.5 and elution step with 2x-SDS-sample buffer for 10 min at 95 C. Samples were separated by SDS-PAGE and subjected to immu- noblotting using anti-GFP-HRP antibody (Miltenyi Biotec) and Anti-HA-Peroxidase, High Affinity (3F10) (Roche). To generate UBQ10::TMK1-3HA, UBQ10::TMK1Dkinase-3HA constructs, the TMK1full length/ TMK1Dkinase (amino acid 1-587) cDNA without stop codon were amplified by RT-PCR from WT total RNA using TMK1-FL-B1-F and TMK1-FL-B2-R/TMK1-DKD- B2-R primers, Key Resources Table), respectively, and inserted into the pDONR221 vector by BP recombination reaction. Next, pDONR P4-P1R-UBQ10prom, pDONR P2R-P3-3xHA and pDONR221-gTMK1/gTMK1Dkinase, were cloned into pB7m34GW vector, respectively, by MultiSite Gateway LR recombination reaction. Image Quantification The quantification of PIN2-GFP fluorescence during gravitropism was performed as followed. Using ImageJ software (https://imagej. nih.gov/ij/), we draw a line (1px in width and 200px in length) on both sides of the root (upper and lower side) at each time point and used the mean intensity fluorescence tool from ImageJ for quantification. Afterward, the ratio between t/t0 (t0 being the initial fluo- rescence intensity at the beginning of the experiment) was applied to be able to follow the difference of fluorescence. Each graph in Figure 2 were made from three independent roots. Quantifications of MAKR2 translocation from the PM to the cytoplasm was carried as described in Simon et al.17 Briefly, we scored, in a double-blind set-up, the number of cells in which MAKR2-tdYFP or MAKR2-mCit was associated or not with the plasma mem- brane. A cell was counted as positive for plasma membrane labeling when the cell outline was at least twice as fluorescent as the cytosol. All the results are expressed as a percentage of the number of cells with MAKR2 at the plasma membrane over the total number of cells counted. The number of cells (n) counted in each case is indicated on the corresponding figure. Each experiment was repeated three time and at least 14 independent roots were counted. For the microfluidic experiments, the quantification was performed by drawing a line at the plasma membrane and in the cytoplasm and quantifying the mean average intensity of both (ImageJ). With these values, the ratio of the fluorescence between the plasma membrane and the cytoplasm was applied and represented in the graphs. QUANTIFICATION AND STATISTICAL ANALYSIS Phenotyping For the horizontal gravitropic index and the kinetics of the gravitropic response, a linear model was fitted on measurements from wild- type plants and the different mutants using lm() function from stats package available in R software (https://www.r-project.org/). This model estimates a weight for each variable (wild-type and mutant plants) and the associated probability that such weight is different from zero based on a t test. The probability derived from the t test is the p value in this comparison and significant differences were considered when the p value was lower than 0.05. Cell biology experiments For translocation of MAKR2 from the plasma membrane to the cytoplasm a pairwise comparison between mock plants and plants subjected to different treatments was performed using a t test with Welch correction to account for unequal variances using R soft- ware (https://www.r-project.org/). The probability derived from the t test is the p value in this comparison and significant differences were considered when the p value was lower than 0.01. All the graphs were drawn using excel software (Microsoft, https://products.office.com/) except for the boxplots which were drawn either with excel or the R software (https://www.r-project.org/). Current Biology 31, 228–237.e1–e10, January 11, 2021 e10 Current Biology, Volume 31 Supplemental Information Auxin-Regulated Reversible Inhibition of TMK1 Signaling by MAKR2 Modulates the Dynamics of Root Gravitropism Maria Mar Marquès-Bueno, Laia Armengot, Lise C. Noack, Joseph Bareille, Lesia Rodriguez, Matthieu Pierre Platre, Vincent Bayle, Mengying Liu, Davy Opdenacker, Steffen Vanneste, Barbara K. Möller, Zachary L. Nimchuk, Tom Beeckman, Ana I. Caño-Delgado, Jirí Friml, and Yvon Jaillais Figure S1. Characterization and phenotyping of MAKR2 gain- and loss-function mutants. Related to Figure 1 and 2. A) confocal picture showing the expression and localization of MAKR2-2Ch (MAKR2-Ox1 line) and MAKR2-mCit (MAKR2-Ox2 line). Scale bars: 30 µm. B) Quantification of DR5::GFP asymmetry (ratio of lower/upper) before and after 5 hours gravistimulation at a 135° angle and related representative fluorescent images after 5 hours of gravistimulation. The white arrow indicate the accumulation of the DR5rev::GFP signal on the lower part (gravistimulated side) of the root in the wild type. Scale bars: 50 µm. C) Kinetics of root gravitropic bending after reorienting seedlings of the genotypes indicated in the top left corner at a 135° angle. See S1F for a statistical comparison of each mutant genotype with the wild type at each time point. The inset represents qRT-PCR analyses of MAKR2 expression in wild-type and two additional independent amiMAKR2 lines (amiMAKR2.2 light green and amiMAKR2.3 dark green). D) Kinetics of root gravitropic bending after reorienting seedlings of the genotypes indicated in the top left corner at a 135° angle. See figure S1F for a statistical comparison of each mutant genotype with the wild type at each time point. E) Quantification of the primary root length of the indicated genotypes. All quantitative measurements presented in different graphs have been treated as independent experiments (e.g. different wild-type). F) Tables showing the p-value, corresponding to the statistical comparison of each mutant genotype with the wild type at each time point of the gravitropic kinetics presented in Figure 1D, Figure S1C, S1D and Figure 2C. Signif. codes: 'n.s.' p>0.05, '*' 0.05>p>0.01, '**' 0.01>p>0.001, '***' 0.001>p. Figure S2. Analysis of MAKR2 expression pattern in the root. Related to Figure 2. Microscopy pictures of roots showing the expression pattern of (A) MAKR2prom::MAKR2-GUS, scale bars: 100 µm and (B) MAKR2prom::VENUSNLS, scale bar: 50 µm. C) Schematic representation of the results from single cell RNAseq for MAKR2 expression in the root, showing that cells expressing MAKR2 cluster together in a group of cells corresponding to quiescent center and young meristem cells. The graphic representation is from the Bio- Analytical Resource for Plant Biology (BAR, Toronto, https://bar.utoronto.ca/efp/cgi- bin/efpWeb.cgi?dataSource=Single_Cell) and the data are from [1]. D) Left: single channel (grey scale) of MAKR2prom::MAKR2-2Ch and PIN2prom::PIN2-GFP together with the corresponding overlay (MAKR2-2Ch in magenta, PIN2-GFP in green and colocalization in white). Right: line scan analysis of the fluorescent intensities in each channel. Note the overlapping pics, likely corresponding to the accumulation of both proteins at the plasma membrane. E) High resolution kinetics of the gravitropic response of PIN2prom::PIN2-GFP, PIN2prom::PIN2-GFPxMAKR2-Ox1 and PIN2prom::PIN2-GFP,xamiMAKR2.1 lines. Each graph shows the response of individual roots. See also Video S1 and S2. Figure S3. Quantitative analysis of the gravitropic phenotypes of tmk1;tmk4 double mutant, expression pattern of TMK1 and Halo-pull down with additional controls. Related to Figure 3. A) Kinetics of root gravitropic bending after reorienting seedlings of the genotypes indicated in the top left corner at a 135° angle. B) Confocal picture (left) and corresponding bright field image (right) showing the expression profile of TMK1 in the TMK1prom:2ChNLS transcriptional reporter line. Scale bar: 50 µm. C) Table showing the p-value at each time point of the gravitropic kinetics presented in Figure S3A and Figure 3A. Data for WT, MAKR2-Ox2 and TMK1-Ox are the same in graphs S3A and 3A. Signif. codes: 'n.s.' p>0.05, '*' 0.05>p>0.01, '**' 0.01>p>0.001, '***' 0.001>p. D) Pull-down assay using in vitro transcribed/translated proteins and Halo-tag purification. Co- purified proteins were visualized using an anti-HA antibody (labelled as Halo pull-down). The inputs (labelled Inputs) and supernatant (labelled Sup) were tested to show the relative amounts of Halo- and HA-tagged proteins and the binding efficiency to HaloLink magnetic beads (as described in [2]). TMK1cyt and HSL1cyt correspond to the isolated cytoplasmic domains and TMK1 and HSL1, respectively. Figure S4. Time lapse analysis of MAKR2 membrane release upon auxin treatment and quantification of CHX, MG132, PEO-IAA, 5-F-IAA, BA, and BL effects on MAKR2-tdYFP localization. Related to Figure 4. A) Quantification of the MAKR2 localization at the plasma membrane and the cytosol after the application of NAA, IAA or benzoic acid (BA) treatment. Y-axis represents the ratio between the relative fluorescence at the plasma membrane at time t over the fluorescence at the plasma membrane at time t0 and the X-axis represents the time in minutes. The first four minutes shows the localization before the treatment and after either 10 µM NAA, 10 µM IAA or 10 µM benzoic acid was applied. Note that because we used a vertical confocal microscope with 20X objective with a low NA and a 488nm laser (rather than the high NA 40X objective and 515nm laser used in the rest of the experiments), we had to use a higher laser intensity accounting for increased background (i.e. fluorescence in intracellular bodies) and faster photobleaching. Comparison between the quantification of the NAA/IAA and the BA treatments allowed us to evaluate the extent of photobleaching vs auxin effect. See also Video S3. B) Confocal pictures and related quantifications of the MAKR2prom::MAKR2- tdYFP line pretreated for 120 min with the protein synthesis inhibitor cycloheximide (CHX at 50 µM) or the proteasome inhibitor MG132 (25 µM) and followed by a 30 min NAA/CHX or NAA/MG132 co-treatment at the indicated concentration of NAA. Scale bars: 10 µm. C) Confocal pictures of the MAKR2prom::MAKR2-tdYFP line following a 30 min treatment with EtOH (mock), NAA (10 µM), PEO-IAA (10 µM) and 5-F-IAA (10 µM) and related quantifications of the percentage of cells with MAKR2-tdYFP signal at the plasma membrane over the total number of cells. Scale bars: 10µm. D) Confocal pictures and related quantifications of MAKR2prom::MAKR2-tdYFP lines following a 30min treatment with either benzoic acid (BA) or brassinolide (BL). Scale bars: 10µm. n in each graph indicates the total number of cells counted. Figure S5. Quantification of TMK1-Ox and TMK1K616R-Ox effect on MAKR2-mCit localization. related to Figure 4. A) Confocal pictures of roots coexpressing UBQ10prom::TMK1-2xmCherry (TMK1-Ox, left) and 2x35Sprom::MAKR2-mCitrine (MAKR2-Ox2, right) (left) and UBQ10prom::TMK1K616R-2xmCherry (TMK1K616R-Ox, kinase dead, left) and 2x35Sprom::MAKR2-mCitrine (MAKR2-Ox2, right) (right) according to the NAA treatment indicated on the left and related quantification. n indicates the number of cells counted. Note that the MAKR2-mCit picture for mock and NAA 10 µM 30 min are the same than in Figure 4C. Scale bars: 10 µm. B) Confocal pictures of roots coexpressing 2x35Sprom::MAKR2-mCitrine (MAKR2-mCit) and UBQ10prom::TMK1K616R-2xmCherry (TMK1K616R-Ox, kinase dead) showing the mosaic expression of TMK1K616R. The white asterisks indicate cells which express TMK1 K616R, and in which MAKR2-mCit does not relocalize to the cytosol following a 30-min treatment with 10 µM NAA. By contrast, the white arrows indicate cells which does not express TMK1K616R, and in which MAKR2-mCit is cytosolic after a 30-min treatment with 10 µM NAA. Scale bars: 20 µm (left), 5 µm (right). C) Quantification of the fluorescence ratio of MAKR2 plasma membrane over cytosolic signal in MAKR2-Ox1 and MAKR2-Ox2 overexpression lines. Note that the relative amount of MAKR2 at the plasma membrane correlates with the level of expression (see Figure 1A) and with the respective phenotypes of these lines (see Figure 1B and 1D). Supplemental Reference S1. Ryu, K.H., Huang, L., Kang, H.M., and Schiefelbein, J. (2019). Single-Cell RNA Sequencing Resolves Molecular Relationships Among Individual Plant Cells. Plant physiology 179, 1444-1456. S2. Yazaki, J., Galli, M., Kim, A.Y., and Ecker, J.R. (2018). Profiling Interactome Networks with the HaloTag-NAPPA In Situ Protein Array. Curr Protoc Plant Biol 3, e20071.