This is the accepted version of the article: Yang, Liang; Guan, Dailu; Valls, Marc; [et al.]. «Sustainable natural bioresources in crop protection : antimicrobial hydroxycoumarins induce membrane depolarization-associated changes in the transcriptome of Ralstonia solanacearum». Pest Management Science, (July 2021). DOI 10.1002/ps.6557 This version is available at https://ddd.uab.cat/record/249287 under the terms of the license Ding Wei (Orcid ID: 0000-0001-8536-5233) Sustainable natural bioresources in crop protection: antimicrobial hydroxycoumarins induce membrane depolarization-associated changes in the transcriptome of Ralstonia solanacearum Liang Yang,ab Dailu Guan,b Marc Vallsb,c and Wei Dinga* a. Laboratory of Natural Products Pesticides, College of Plant Protection, Southwest University, Chongqing 400715, China b. Centre for Research in Agricultural Genomics (CRAG), CSIC-IRTA-UAB-UB, Campus UAB, Bellaterra, 08193 Barcelona, Catalonia, Spain. c. Genetics Section, Facultat de Biologia, Universitat de Barcelona, 08028 Barcelona, Catalonia, Spain. * Correspondence to: Wei Ding. Laboratory of Natural Products Pesticides, College of Plant Protection, Southwest University, Chongqing, 400716 China. E-mail: dingw@swu.edu.cn. Running title: Antimicrobial hydroxycoumarins induce transcriptome change of Ralstonia solanacearum This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process which may lead to differences between this version and the Version of Record. Please cite this article as doi: 10.1002/ps.6557 This article is protected by copyright. All rights reserved. Abstract: BACKGROUND: Ralstonia solanacearum is one of the most devastating pathogen affect crop production worldwide. Hydroxycoumarin (umbelliferone, esculetin, daphnetin) imply as sustainable natural bioresources on controlling of plant bacterial wilt. However, the antibacterial mechanism of hydroxycoumarins against plant pathogen still remains poorly understood. RESULTS: Here we characterized the effect of three hydroxycoumarins on the transcriptome of R. solanacearum. All three hydroxycoumarins were able to kill R. solanacearum, but their antibacterial activity impacted differently the bacterial transcriptome, indicating that their modes of action might be different. Treatment of R. solanacearum cultures with hydroxycoumarins resulted in a large number of the differentially expressed genes (DEGs), involved in basic cellular functions and metabolic process, such as downregulation of genes involved in fatty acid synthesis, lipopolysaccharides biosynthesis, RNA modification, ribosomal submits, oxidative phosphorylation and electrontransport, as well as upregulation of genes involved in transcriptional regulators, drug efflux, and oxidative stress responses. Future studies based on in vitro experiments are proposed to investigate lipopolysaccharides biosynthesis pathway leading to R. solanacearum cell death caused by hydroxycoumarins. Deletion of lpxB substantially inhibited the growth of R. solanacearum, and reduced virulence of pathogen on tobacco plants. CONCULSION: Our transcriptomic analyses show that hydroxycoumarins specific suppressed genes expression involved in fatty acid synthesis, RNA modification, ribosomal submits, oxidative phosphorylation and electrontransport. These findings provide evidence that hydroxycoumarins inhibit R. solanacearum growth through affect multi-target effect. Hydroxycoumarins could serve as sustainable natural bioresources against plant bacterial wilt through membrane destruction targeting the lipopolysaccharides biosynthesis pathway. Keywords: transcriptome analysis, R. solanacearum; hydroxycoumarins, antibacterial activity, membrane 1 INTRODUCTION Ralstonia solanacearum (R. solanacearum) represents one of the most devastating plant bacterial pathogens among the top ten plant pathogens, infecting more than 250 plant species and causing bacterial wilt worldwide. 1, 2 The limitation of control methods may aggravate the harm of bacterial wilt in agriculture. 3 In addition, the increasing host range of R. solanacearum, its complex pathogenicity and the wide range of hosts makes it a threat to agriculture. 4-6 Currently, the primary method for controlling bacterial wilt is by using chemical pesticides7; however, the extensive application of synthetic pesticide resulted in resistance in pathogen populations, and safety environmental concerns. 3 Thus, development of the potential control methods from natural bioresources for bacterial wilt is highly demanded. In continuation of discovering new natural products bactericidal agents, we found that coumarins inhibit bacteria growth and suppress the virulence-associated factors of R. solanacearum. 8, 9 Furthermore, coumarins could preserve the host endogenous microbiome and exert little selective pressure, avoiding the rapid appearance of resistance. 10 Coumarins are natural secondary metabolites composed of fused benzene and α- pyrone rings produced via the phenylpropanoid pathway and accumulate in response to infection by bacteria, fungi, virus and oomycetes. 11-13 The extent and timing of coumarin accumulation has often been associated with the level of disease resistance. For instance, young leaves of Nicotiana attenuata show higher resistance against Alternaria alternata than mature leaves, which is correlated with stronger induction of scopoletin. 14 Nicotiana tabacum cv. Petit Havana resistance to Botrytis cinerea is due to the accumulation of scopoletin and PR proteins. 15 Similarly, Scopoletin accumulated in the resistant tomato line 902 upon tomato yellow leaf curl virus (TYLCV) infection. 16 Besides their role in aboveground plant tissues, the coumarins scopolin, coniferin and syringing have shown to be rapidly processed in the Arabidopsis roots upon infection by the oomycete pathogen Pythium sylyaticum, giving rise to cell wall- fortifying lignin and antimicrobial scopoletin. 17 Moreover, in the wild tobacco N. attenuata, the content of the phytoalexin scopoletin in roots was enhanced after infection by fungus A. alternata. 18 The accumulation of specific coumarins in roots plays a role in defense against soil-borne pathogens. For instance, umbelliferone suppresses the expression of T3SS regulatory and effector genes and alters the virulence of R. solanacearum on tobacco. 19 However, the ecological relevance and the underlying biological mechanisms of coumarins against pathogens remain largely unknown. 13 Several studies have proven that diverse coumarins showed antimicrobial activities against plant and animal pathogens. Recently discovered coumarins from plant sources, exerted antibacterial activity against R. solanacearum and the hydroxylation on C-6, C-7 and C-8 enhanced this activity. 20 Similarly, the phenolic coumarin scopoletin showed strong antibacterial against Escherichia coli by reducing biofilm formation. 21 Recent studies evidenced that coumarins induced strong non- receptor mediated membrane lysis as their primary microbicide strategy. 8, 22 Exposure to coumarin and umbelliferone clearly reduce fimbriae production and biofilm formation of Escherichia coli. 21 Indeed, scopoletin and daphnetin were proved as promising inhibitors of the bacterial cell division protein FtsZ, and its hydroxyl, diethyl, or dimethyl amino substituents in the 7th carbon enhanced this inhibitory activity, halting the first step of bacterial cell division. 23 Moreover, coumarins inhibit proliferation of Mycobacteria by targeting the assembly of MtbFtsZ. 24 Hydroxycoumarins also displayed antibacterial activity through inhibiting isoleucyl- transfer RNA (tRNA) synthetase gene expression. 25 Besides their mentioned role damaging the cell membrane, coumarins might efficiently traverse them and bind to the DNA or RNA ligase to reduce the biosynthesis of these molecules. These actions can then control the expression of genes encoding transcriptional regulators and other downstream genes. However, the antibacterial mechanism of coumarins against plant pathogen still remains poorly understood. Recently, transcriptional analysis was proven a useful means to reveal antibacterial mechanism of certain compounds against pathogen. 26-28 For instance, Genome-wide gene expression profiling enables to investigate the antimicrobial mechanism of peptides against Streptococcus pneumonia. 26 Transcriptome analysis of Escherichia coli exposed to lysates of lettuce leaves revealed the upregulation of numerous genes associated with attachment and virulence, oxidative stress, antimicrobial resistance to detoxification of noxious compounds, as well as DNA repair. 29 Hydroxycoumarins were proven to destabilize the cell membrane and inhibit biofilm formation. 20 Transcriptome analysis of R. solanacearum provides a way to understand the antibacterial mechanism of hydroxycoumarins. In this work, we aimed to investigate the effect of three hydroxycoumarins (umbelliferone, esculetin and daphnetin) on the gene expression of R. solanacearum using RNA sequencing (RNA-seq) approach. To better understand their mechanism of action and how their hydroxylation at the C-6, C-7 or C-8 position significantly enhanced the antibacterial activity against R. solanacearum. 2 MATERIALS AND METHODS 2.1 Strain and compounds The bacterial wilt pathogen R. solanacearum CQPS-1 (phylotype I, race 1, biovar 3) used in this study (accession number NZ_CP016914.1), was originally isolated from an infected tobacco plant in Chongqing, China by Laboratory of Natural Products Pesticides. 30 The strain was preserved in nutrient broth supplemented with 25% glycerol stocked and stored at -80 °C and grown in rich B medium or minimal medium (M63) incubated at 28 °C. Umbelliferone (7-hydroxycoumarin, ES), esculetin (6,7-dihydroxycoumarins, ES), and daphnetin (7,8-dihydroxycoumarins, DA) were purchased from Shanghai Yuanye Bio-Technology Co., Ltd. (Shanghai, China), and the purity of compounds (> 98%) was validated by using High Performance Liquid Chromatography and Mass Spectrometry. 2.2 Total RNA extraction R. solanacearum was overnight inoculated in rich B medium, then the bacterial suspension (108 to 109 CFU per mL) was centrifugated at 5000 rpm for 10 min, the bacteria were collected and diluted in M63 medium adjusted to with OD600 0.2 and incubated on a shaker at 180 rpm and 28 °C for 4-5 h. Then bacterial cells were treated with hydroxycoumarins at the concentration with half of minimum inhibitory concentration (MIC) for 1 h (UM 128 mg L-1, ES 96 mg L-1, and DA 32 mg L-1). The 0.1% DMSO treatment was used as the control (CK). 20 The 1 h treatment duration was chosen as it was found that treatment for 2 h or more caused lower yield and poor quality of the RNA obtained, probably due to bacterial lysis by hydroxycoumarins and release of RNA before extraction. The samples were harvested by centrifugation at 5000 rpm for 10 min at 4 °C, the supernatants were removed, and the treated bacterial cells were collected and frozen in liquid nitrogen if RNA isolation was not conducted immediately. RNA was extracted by using TRNzol reagent according to the manufacturer’s instructions (Tiangen Biotech Co. Ltd, Beijing, China) and then treated with RNase-free DNase I (Tiangen Biotech Co. Ltd, Beijing, China) to remove genomic DNA contaminations. RNA degradation and contamination were checked on 1% agarose gels and RNA concentration and purity were monitored using the Nanovue UV-Vs spectrophotometer (GE Healthcare Bio-Science, Uppsala, Sweden). All experiments were performed three times, which constituted biological replicas. 2.3 RNA-Seq library construction RNA concentrations were assessed using Qubit® RNA Assay Kit in Qubit® 2.0 Flurometer (Life Technologies, CA, United States) and Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, United States). The quality standard of RNA samples including minimum RNA integrity number (RIN) of 7, absorbance values A260/280 in the range 1.8-2.0 and A260/230 over 1.8. Libraries construction and RNA-Seq were performed by Shenzhen Hengchuan (Shenzhen, China). RNA-Seq libraries were generated using NEBNext® Ultra ™ RNA library Prep Kit for Illumina (NEB, United States) following manufacturer’s recommendations. After synthesis first strand cDNA and second strand cDNA, the samples were sequenced on the Agilent Bioanalyzer 2100 system. The length of the reads was around 150 bp. Quality control of the RNA-Seq raw data was performed using FastQC. 31 2.4 Mapping and differential gene expression analysis The reference genome of R. solanacearum CQPS-1 was downloaded from GenBank (NZ_CP016914.1). 30 The raw data were filtered by discarding low-quality sequences and removing adaptor sequences. Read mapping against the reference genome was performed by using HITAT2. 32 To determinant the expression level for each gene, we measured numbers of reads uniquely mapped to the specific gene and total number of uniquely mapped reads in the sample using the feature counts tool. Differentially expressed genes (DEGs) upon hydroxycoumarin treatments were obtained using the DESeq2. 33 To extract genes with differentially expression changes, the cutoff of q-value < 0.05 and ǀlog2 Fold changeǀ > 2 was applied. 34 Moreover, we performed gene set enrichment analysis (GSEA) on the basis of q-values resulted from differential expression analysis with the OmicsBox 1.2.4 (https://www.biobam.com/omicsbox/). 2.5 Validation of the RNA-Seq using qRT-PCR To validate the results of RNA-Seq, ten differentially expressed genes (DEGs) (seven down-regulated and three up-regulated) were examined using quantitative real-time PCR (qRT-PCR). Independent RNA samples were collected as described for RNA-Sequencing and first-strand cDNA was synthesized using the iScript gDNA clear cDNA synthesis kit (Bio-Rad, Hercules, CA, USA) according to the manufacturer’s instructions. Primers were synthesized by BGI Technologies (Shenzhen, Guangzhou, China) (Table S1) and qRT-PCR analysis was carried out in 96-well plates in a 20 μL reaction system with C1000 Thermal Cycler (Bio-Rad, Hercules, CA, USA). Three technical replicate reactions were used for each sample. Normalized gene expression was calculated by Bio-Rad CFX and SerC was used as the reference gene to normalize gene expression. 35 All assays were carried out three times using biological replicas. 2.6 Construction of lpxB deletion mutant of R. solanacearum In this study, the lpxB deletion mutant was generated by pK18mobsacB- based homolog recombination as previously described. 36 The primer pairs lpxB_A1B (GCGGATCCTGCATGCGACCATGCT) with lpxB_B1C (ATCTTCTGAACTTGCGTCATTCAGTCG GCCCACGCCGTCT) and lpxB_A2C (AGACGGCGTGGGCCGACTGAATGACGCAAGTTCAGAA GAT) with lpxB_B2H (ATAAGCTTGCCCAATCGCCCACTTCC) were used for constructing plasmid pK18-lpxB-d. After validating the sequence, the pK18-lpxB-d was horizontal transferred from E. coli S17-1 into R. solanacearum strain CQPS-1. The lpxB deletion mutant were confirmed by cloning PCR. 2.7 Bacterial biofilm formation, swimming activity and virulence assay Biofilm formation of R. solanacearum and lpxB mutant were performed in 96-well polystyrene microtiter plates. 37 Briefly, bacteria suspension mix with B medium were inoculated in plates at 30 °C for 24 h. Then biofilms were stained with crystal violet, dissolved in 95% ethanol and quantified by absorbance at 530 nm (OD530). Swimming motility were assessed on M63 minimal medium supplemented with 20 mM L-Glutamate. 38 The bacteria suspension was stab-inoculated into agar with sterilized tips. The diameter of swimming halo was measured after 36 h, 48 h and 60 h cultivation at 30 °C. The drenching assay was used to evaluate virulence of R. solanacearum and lpxB mutant as described previously. 9 Tobacco plants (Yunyan 87) were used to virulence assay with soil-soaking, which mimics the natural invasion through the roots. Each assay was repeated independently three times with 16 plants. Wilt symptoms of plants were scared daily using disease index (scale of 1-4) and the mean values of all experiments were averaged with SD. The data were analyzed with the SPSS 17.0 statistical software program using student’s t test under the significance level of 0.05 (P-value=0.05) 2.8 Molecular docking Molecular docking was performed using AutoDock 4.2 as previously described.39 The three-dimensional (3D) model of LpxB and its binding pocket were generated by the I-TASSER server (http://zhanglab.ccmb.med.umich.edu/I-TASSER/).40 The 3D model of the ligands and their energy minimization were established by ChemOffice 2004. The model results were analyzed by Discovery Studio Visualizer 4.5 (Accelrys Software Inc., San Diego, CA, USA). 41 3 RESULTS 3.1 R. solanacearum transcriptome signatures influenced by hydroxycoumarins We profiled R. solanacearum transcriptomes under three hydroxycoumarin treatments in M63 medium. As showed in Figure 1B, all three treatments significantly affect the transcriptome of R. solanacearum compared to the control treatment. Furthermore, the effect of daphnetin (DA) and esculetin (ES) on bacteria were similar, but different to the umbelliferone (UM) treatment. In total, differential expression of 344 genes in R. solanacearum supplemented with UM treatment (representing 6.46% of the predicted protein-coding sequences in the CQPS-1 genome) could be observed, including 163 genes up-regulated and 181 genes down-regulated. Esculetin affected a higher number of genes than UM, causing up- and down-regulation of 326 and 372 genes. Furthermore, DA, which exhibits the strongest antibacterial activity against R. solanacearum showed the biggest number of differential expressed genes, including up-regulation of 420 genes and down- regulation of 502 genes (Fig. 2A, Fig. S1). There were 191 common genes involving in three hydroxycoumarins treated bacteria, including 90 upregulated genes and 94 downregulated genes (Fig. 2, Fig. S2). In addition, there were seven upregulated genes (Rsc0540, Rsp0417, Rsp0418, Rsp0419, Rsp0421, Rsp0422, and Rsp0423) in DA treatment, which were downregulated in UM treatment (Table S2). The numbers of up-regulated and down-regulated genes of DA and ES were similar, and higher than UM treatment. To validate the RNA-Seq results, a total of ten genes were selected from DGEs for qRT-PCR analysis. The results indicated gene-expression data obtained by this RNA- Seq strategy strongly correlated with RT-PCR measurements (Fig.1(C)). 3.2 Treatment by any of the hydroxycoumarins alters expression of 191 R. solanacearum genes We investigated the functional categories enriched by con differential expression genes treated with three hydroxycoumarins. In cellular component category, intracellular, intracellular organelle, intracellular non-membrane-bounded organelle, non-membrane-bounded organelle, organelle, and protein-containing complex were enriched. Then, structural molecule activity, structural constituent of ribosome, binding, transporter activity were enriched in molecular function category. In biological process, cellular metabolic process, primary metabolic process, peptide process, protein metabolic process, transport, transmembrane transport was enriched (Table 1). Hydroxycoumarin treatments up-regulated expression of different family transcriptional regulators (Rsc0149, Rsc1997, Rsc1851, Rsp0447, Rsp0443, Rsp1668 and Rsp0816), genes coding for drug efflux lipoprotein and transmembrane proteins (Rsc0009, Rsc2499, Rsc1852, Rsp0819, Rsp0818, Rsc1294 and Rsp0817), several genes involved in putative signal peptide proteins (Rsc0153, Rsc3092, Rsc2725, and Rsp0992), and genes encoding stress-related proteins (coxM and Rsp0993) (Table S2). Otherwise, hydroxycoumarins significantly suppressed expression of genes involved in intracellular organelle, such as fatty acid synthesis genes (accC1, accB1, Rsp0035, Rsp0782, and Rsp0783) and lipopolysaccharides biosynthesis genes (Rsc0686 and Rsc0685). Genes coding for peptide proteins (Rsc3300, Rsc3285, Rsp1461, Rsp1269, Rsp0811, and Rsp0699), RNA modification related genes (Rsc1419 and Rsp0782), translation (tsf, infA, and Rsp0039), subunits of 50S and 30S ribosomal proteins (rplS, rplJ, rplL, rpoC, rplE, rpsH, rpsF, rpsR, rpsE, rpmD, rplO, rpmJ, rpsM, rpsK, rplQ, prmA, rpmG, rplT, rplI, and rpsR), and oxidative phosphorylation and electron transport (cyoB1, cyoC1, and cyoD1) were down-regulated by hydroxycoumarins (Table S2). 3.3 DA and ES treatment cause similar change on R. solanacearum transcriptome We investigated the functional categories enriched by 395 differential expression genes treated with DA and ES treatment. As showed in Table 1, in cellular component category, membrane and plasma membrane were enriched. In molecular function, rRNA binding, heterocyclic compounds binding, organic cyclic compound binding and nucleic acid binding were enriched. There were more biological process categories were enriched, such as cellular biosynthetic process, metabolic process, translation and gene expression. Based on enriched GO terms and the antibacterial effect of DA and ES treatment against R. solanacearum, we choose the differential expression genes enriched in GO terms and involved in bacterial basic processed. Lipopolysaccharides and fatty acid play a key role in cell membrane components in R. solanacearum. As showed in Table 2, the gene expression of lipopolysaccharides biosynthesis clusters (LpxA, LpxB, LpxD and FabZ) and lipid A biosynthesis lauroyl acyltransferase (Rsc0135 and Rsc0136) were significantly inhibited by DA and ES treatments. Mostly of fatty acid synthesis pathway genes (fabB, fabD, fabG, fabH, fabI) and fatty acid synthesis regulated associated genes (Rsc0265, Rsp0652, Rsp0648, acpF, Rsc0434, and Rsc2546) were down-regulated by DA and ES treatments. Meanwhile, genes coding for modification of RNA (cysS, yibK, hrpA), elongation factor Tuf showed decreased transcriptional expression. Certain genes involved in transcription, transcriptional regulation and membrane transport were down-regulated. The expression of genes coding for the two component response regulator transcription regulators Rsc3160, cold shock-like transcription regulator CspC, and response transcription regulators (Rsc2430 and Rsc1584), LPS export ABC transporter permease (LptG and LptF), D-xylose ABC transporter substrate- binding proteins (XylF, XylG and XylH) and protein translocase subunit (SecF and SecD) were significantly reduced by DA and ES treatments. Furthermore, DA and ES affect energy production in R. solanacearum by suppression gene expression of oxidative phosphorylation and electron transport (ctaG, xyoA1, atpB, atpE, atpF, atpA, atpD, atpC, nuoH, nuoJ, nuoK, nuoL, nuoM and nuoN). Furthermore, we analysis the differential genes involved in generally upregulated function by DA and ES treatments. 6 genes coding of fatty acid degradation pathway (pcaB, pcaC, pcaD, pcaF, pcaJ, Rsc0161) were upregulated. Several genes involved in transcriptional regulation and membrane transport were significantly induced by DA and ES treatments, such as RSc2361, RSc2114, RSc1857, RSc1185, RSc0993, RSp0415, fur2, emrB, exbD1, exbB1. Furthermore, the expression of two genes involved in stress related proteins (MsrA and RpoN2) were increased (Table 2). In order to determinate the specific molecular mode action of DA and ES on transcriptome of R. solanacearum, we performed the RT-PCR assay to check the expression of lipopolysaccharides biosynthesis genes and fatty acid biosynthesis genes supplemented with hydroxycoumarin and coumarin treatments. Compared to coumarin treatment, the expression of lipopolysaccharides biosynthesis genes (lpxA, lpxB, lpxC, lpxD) were specific suppressed by ES and DA treatments, the expression of Rsc0135 was significantly inhibited by coumarin and hydroxycoumarin treatment (Fig. S3). Furthermore, the expression of fatty acid biosynthesis genes (fabB, fabD, fabG, fabH and fabI) were specific suppressed by Platensimycin (the fatty acid biosynthesis inhibitor)42, ES and DA treatment (Fig. S4). The results indicate that ES and DA cause the similar change on R. solanacearum transcriptome. 3.4 Hydroxycoumarins specifically alter the expression of R. solanacearum gene sets ES and DA treatment resulted in similar expression changes, and UM treatment showed different expression pattern (Fig. 3). The type of up-regulated and down- regulated genes of DA and ES were similar, but different to UM treatment (Table 2, Fig S5). In order to investigate the specific gene regulation in hydroxycoumarin treatments, we used the Venn diagrams of differential expression genes to identify specific genes of each hydroxycoumarin treatment (UM, ES and DA). UM treatment specifically resulted in 33 genes down-regulation and 44 genes up- regulation (Table S3), such as flagellar-associated genes flgC, flgF, flgH, fliJ and fliK were down-regulated about 4-fold; also type III secretion system transcription regulator gene prhG was down-regulated by UM treatment. Among the up-regulated genes, there were several genes coding for myo-inositol catabolim pathway (Rsc1247, Rsc1246, iolH and Rsc1242) were up-regulated about 4-fold. There were 44 genes down-regulated and 48 genes up-regulated in ES treatment. Among the down regulation genes, 8 open reading frames coding for hypothetical proteins, seven genes coding for transcriptional regulator (Rsc1016, livH2, Rsc2437, Rsc0002, Rsp0985, and Rsp0983). In addition, there were 48 specifically up-regulated genes by ES treatment, including 10 genes involved in hypothetical proteins, 4 genes involved in transcriptional regulator (Rsc2325, Rsc0029, Rsp0821 and BC350_RS25620), and several genes involved in virulence-associated genes (fliO, hrcC and hrpK). Two genes related with tryptophan synthesis pathway (trpE and trpB) were up-regulated in ES treatment (Table S4). Due to the strongest antibacterial activity against R. solanacearum, DA treatment resulted in 126 specifically genes up-regulation and 150 genes down-regulation. As showed in Table S5, the significant enrich gene ontology (GO) terms of specifically genes were focused on biological process, such as nucleotide biosynthetic process, ion transmembrane transport and phosphorus metabolic process. In the molecular function, RNA binding, nucleotide binding, nucleoside phosphate binding and cation transmembrane were enriched. Among the up-regulated genes, certain genes were involved in basic cellular functions, such as transcriptional regulators (Rsc1201, Rsc0635, Rsc0302, Rsc2505, Rsc2498, Rsc2466, BC350_RS12595, Rsc2018, Rsc1960, Rsc1511, BC350_RS16690, Rsp0440, Rsp1512, Rsp1616, Rsp1667, Rsp1178 and BC350_RS23395), molecular chaperone DnaK and two DNA damage-inducible mutagenesis protein (Rsp0799 and imuA) involved in DNA damage. Gene coding for basic biological process such as prpC, prpB, paaE, paaB, paaA, otsB, paaC, paaD, trxB, xdhB and xdhC were enriched. The expression of 150 specifically genes were suppressed by DA treatment, including several genes encoding extracellular polysaccharide (epsA, epsP, epsB, epsC, wecC, epsF, Rsp1013, Rsp1012, Rsp1011, Rsp1010 and xpsR), type III secretion system (prhA, hrpG and prhJ), type VI secretion system (Rsp0746, Rsp0745, Rsp0629 and tssH), ATP synthase subunit (atpH and atpG), IS3 and IS4 family transposase (BC350_RS12015 and BC350_RS15970) (Table S5). 3.5 Enrichment analysis of GO pathway Based on the Gene Ontology (GO) - cellular component (CC), molecular function (MF) and biological process (BP), we observed that among the DEGs in R. solanacearum responded to hydroxycoumarins, the GO terms of DA treatment was more than other two hydroxycoumarins (ES and UM). In cellular component, ribosome, membrane, plasma membrane, and cell periphery were enriched. Structural constituent of ribosome, heterocyclic compound binding, organic cyclic compound binding, nucleotide binding, transporter activity, transmembrane transporter activity and nucleic acid binding were enriched in molecular function category. Primary metabolic process, protein metabolic process, transport, peptide biosynthetic process, translation, cation transport, cation transmembrane transport and lipid metabolic process were enriched in biological process category (Table 1). 3.6 DA and ES inhibit bacterial growth and virulence of R. solanacearum by altering lpxB expression DA and ES treatment significantly reduced expression of genes coding for lipopolysaccharides synthase pathway (Table 2). Furthermore, the expression of lipopolysaccharides synthase genes (lpxA, lpxB, lpxC, lpxD and Rsc0135) were significantly inhibited by ES and DA treatments in a concentration-dependent manner (Fig. S6). Especially, expression of lpxB involved in lipid-A-disaccharide synthase was most down-regulated with 9.58-fold and 10.83-fold. LpxB involved in one of key step for lipid A biosynthesis and is important for bacterial cell membrane (Fig. 4(A)). So, we generated a lpxB in-frame-deleted mutant (ΔlpxB) to confirm its effect on bacterial growth and virulence. Compared with WT (CQPS-1), lpxB mutant exhibited slower bacterial growth in liquid medium (P < 0.05) (Fig. 4(C)). Biofilm formation and swimming motility are important for virulence of R. solanacearum in host plants. The lpxB mutant forms red and small colonies with less mucoid, indicating that EPS production was suppressed by lpxB deletion (Fig. 4(B)). The biofilm formation and swimming motility of lpxB deletion were significantly inhibited (Fig 5(A), (B)). The lpxB mutant significantly altered the disease progress of bacterial wilt (P < 0.05). The results suggest that lpxB is required for extracellular polysaccharide (EPS) production, biofilm formation, swimming motility and virulence of R. solanacearum. 3.7 Molecular docking To examine the interaction between daphnetin and LpxB and evaluate the structure-activity relationship, molecular docking was performed to analysis the binding mode of daphnetin within the binding pocket of LpxB. The docking results of daphnetin binding to LpxB were shown in Table S6. The binding energy of daphnetin was calculated to be -5.35 kcal mol-1, which indicates that daphnetin can be considered a specific ligand of LpxB. The binding modes and orientations of daphnetin with LpxB were showed in Fig. 6(D,E). Five key amino acids (GLY262, ALA236, ALA237, PRO235, and LEU201) were interacted with daphnetin via conventional hydrogen bonding and hydrophobic interactions in the binding pocket of LpxB (Fig. 6(F). The hydrogen atoms of the hydroxyls at positions 8 of the benzene ring form a conventional hydrogen bond (1.82 and 2.10) with GLY262 and ALA236, respectively. In addition, the acidic residues PRO202, GLY203, SER204, SER264, HIS 265, GLN263, and VAL260 interact with daphnetin via Van der Waals interactions in the binding pocket of LpxB. 4 DISCUSSION Coumarins are produced via the phenylpropanoid pathway and accumulated in plant tissues, responded to infection of a diversity of pathogens and play dual roles in plant defense due to the antimicrobial activity and plant defense signaling. 12, 13 Further, coumarins play role in the interaction of plant and soil-borne pathogens. As a landmark discovery, advances in the study of interaction between plant pathogen and host have provided evidence that metabolites could inhibit pathogen growth and the transcriptome of R. solanacearum. 43, 44 Plant-derived antibacterial compounds were originally proposed to change plasma membrane permeability, leading to membrane rupture and rapid lysis of microbial cells. Recently, it has been proposed that coumarin induces strong non-receptor mediated membrane lytic mechanism as the primary microbicide strategy. 8 In this study, potent antibacterial properties of three hydroxycoumarins were demonstrated, indicating the potential use in plant protection. Hydroxycoumarins (UM, ES, DA) were proved strong antibacterial activity against R. solanacearum. 20 At present, the mode of action of hydroxycoumarins is not known, although in our previous work the PI stain results indicated that the compounds changed the permeability of the bacterial membranes. 9 To further investigate the molecular mechanism of actions of hydroxycoumarins against R. solanacearum, we perform RNA-Seq to study the transcriptomic response of R .solanacearum treated with three hydroxycoumarins. Our results revealed that the expression of genes involved in fatty acid synthesis, lipopolysaccharides biosynthesis, RNA modification, ribosomal submits was extensively down regulated by hydroxycoumarins treatment (Fig. 1, Table 2). In addition, the bactericidal action of hydroxyl-substituents on C-6, C-7 and C-8 in three hydroxycoumarins might be differentially accessible in the various species. Coumarins, naturally plant derived secondary metabolites composed of fused benzene and а-pyrone rings. Umbelliferone (7-hydroxycoumarin), esculetin (6, 7- dihydroxycoumarins) and daphnetin (7, 8-dihydroxycoumarins) have different number of hydroxyl-substituents in different position. Further, our previous study indicated that three hydroxycoumarins have different antibacterial activity, the MICs of UM, ES and DA were 256 mg L-1, 192 mg L-1 and 64 mg L-1, respectively. 20 Based on the previous results, we hypothesize that these compounds might destroy cell membranes or affect specific action targets. In this study, the antibacterial mechanisms affected upon in vitro exposure to the hydroxycoumarins were studied by transcriptome analysis of R. solanacearum. We infer similar or different modes of action of the tested compounds from the changes in the expression of different genes at the tested time. This does not preclude the possibility that similar genes are expressed with a different timing, which would not imply a similar mode of action, as has been widely demonstrated in plant immunity. 45, 46 The effect of ES and DA on the bacterium were similar, but different to the UM treatment (Fig. 1A, Fig. 3, Fig S3 and Fig S4), indicating that the number of hydroxyl-substituent was more important than the hydroxyl-position in antibacterial activity. DA, which exhibits the strongest antibacterial activity against R. solanacearum showed the biggest number of differential expressed genes. There were 191 common genes involving in three hydroxycoumarins treated bacterial, including 90 upregulated genes and 94 downregulated genes (Fig. 2, Fig. S2). These founding indicated that the core potent target protein might play important role in the antibacterial activity of Hycs. The outer membrane (OM) of Gram-negative bacteria is essential for sustaining cell morphology and poses a significant barrier to unwanted molecules from entering the cell and thus accumulating to toxic levels inside of the pathogen. 47, 48 The membrane of bacteria usually contains three major macromolecules, including lipopolysaccharides, outer membrane proteins and lipoproteins. 47 Since the OM serves as a protective barrier, disruption or interference with the biosynthesis of the OM presents an attractive strategy for antibacterial drug discovery. It’s been proved that polymyxin involves binding to the lipid A component of lipopolysaccharide portion of OM, indicated strong antibacterial activity. 49 In this study, the expression of genes involved in the biosynthesis of lipopolysaccharides (lpxA, lpxB, lpxD, fabZ, Rsc0135 and Rsc0136) were significantly suppressed supplemented with ES and DA treatment (Table 2). Furtherly, lpxB is required for extracellular polysaccharide (EPS) production, biofilm formation, swimming motility and virulence of R. solanacearum (Fig. 5). Molecular docking and homology modeling are novel and effective approaches to characterize conformation protein-ligand interaction patterns. 39 Our docking results indicated that the critical residues of domain in the binding pocket of the LpxB protein, such as GLY262, ALA236, ALA237, PRO235, and LEU201, interact with daphnetin via conventional hydrogen bonding and hydrophobic interactions. Fatty acids are essential components of membranes and are important sources of metabolic energy in bacteria. There, fatty acid biosynthesis and degradation pathways could be switched on and off according to the availability of fatty acids to maintain membrane lipid homeostasis. 50 The indispensable fatty acid synthase pathway is a special attractive target for antibacterial agents. Platensimycin, platencin and phomallenic were demonstrated to inhibit the condensation step in in the bacteria fatty acid biosynthesis pathway. 42 Recent studies showed that antibacterial peptides NCR335 reduced the expression of fatty acid biosynthesis genes. 51 In the current study, we found that Hycs might altered the expression of genes involved in basic cellular function. DA and ES treatment suppressed the expression of several genes involved in fatty acid synthesis pathway (fabB, fabD, fabG, fabH and fabI). Further, a variety of genes coding fatty acid degradation pathway (pcaB, pcaF, gabD, pcaJ and Rsc0161) were induced. The expression of fatty acid biosynthesis genes (fabB, fabD, fabG, fabH and fabI) were specific suppressed by Platensimycin, ES and DA treatment (Fig. S4). The results indicate that ES and DA cause the similar change on R. solanacearum transcriptome. These results indicated that Hycs might destroyed membrane lipid homeostasis by suppressing gene expression of lipopolysaccharide synthesis pathway in R. solanacearum, and imbalance availability of fatty acid by suppressing gene expression of fatty acid biosynthesis pathway and inducing gene expression of fatty acid pathway degradation pathway. The global transcriptional response of R. solanacearum to Hycs indicated that exposure to these chemical is stressful to the pathogen. Compared with DMSO treatment, Hycs downregulated these genes involved in basic cellular functions, such as transporter activity, oxidative phosphorylation and ribosomal. Compared with the limited data available on the effect of antibacterial agents, salicylic acid demonstrated similar result in down-regulation of the transcription-translation machinery in R. solanacearum. 43 Furthermore, The F0F1 ATP synthase genes involved in oxidative phosphorylation were down-regulated by DA and ES treatment. Similar with diarylquinolines target subunit c of mycobacterial ATP synthase. 52 Hycs inhibited the expression of ribosomal subunits, like the nodule-specidic cysteine-rich reptides down-regulated the expression of ribosomal subunits and shown antifungal activity against Sinorhizobium meliloti. 51 Meanwhile, antimicrobial peptide MAF-1A reduced the ribosomal subunits transcription level in Candida albicans. 27 Oxidative stress is caused by exposure to reactive oxygen intermediates, which can damage cell membranes proteins, and nucleic acids. 53 Recent studies proven that oxidative stress could suggested as a key antibacterial mechanism of nanoparticles (NPs), such as fullerene and graphene oxide. 54 The produced ROS mediated by oxidative stress can irreversibly damage bacteria (e. g., their membrane, DNA), resulting in bacteria death. 55 Salicylic acid was demonstrated to cause oxidative stress in R. solanacearum, upregulated expression of oxidative stress genes. 43 In this study, Hycs treatment induced oxidative stress genes in R. solanacearum (coxM and Rsp0993). In order to adapt to antibacterial agent stress, bacteria encode drug efflux pump protein to exudate the toxic chemicals. In present study, we found that Hycs treatment up- regulated expression of drug efflux pump genes (Rsc0009, Rsc2499, Rsc1852, Rsp0819, Rsp0818, Rsc1294 and Rsp0817). Similarly, R. solanacearum also upregulates drug efflux pump genes in response to a high concentration of 500 µM SA. 43 Following exposure to UM, R. solanacearum cells displayed reduced expression of virulence genes encoding type III secretion components (PrhG) and flagellar-associated genes. These results were similar with our previously study, which proven that UM could suppressed expression of T3SS regulators through the HrpG-HrpB and PrhG-HrpB pathways. 19 This is consistent with multiple effect of plant-derived compounds on virulence genes in plant pathogen. For example, Oleanolic acid induces the type III secretion system of R. solanacearum. 56 Salicylic acid derivative compound inhibited the expression of type III secretion components. 57 Interesting, extracellular polysaccharide biosynthesis enzymes were specially suppressed by DA treatment. Hycs indicated inhibition effect on virulence genes, might suggest these compounds not only could use as antibacterial agents, but also might be virulence inhibitor under low concentration. 5 CONCLUSION In summary, it was demonstrated that plant-derived metabolites hydroxycoumarins (umbelliferone, esculetin and daphnetin) significantly alter the transcriptome level of R. solanacearum. The transcription change pattern of DA was similar with ES treatment, different to the pattern exposure to UM. Compared with the hydroxyl substituent site, the number of hydroxylation substituent of hydroxycoumarins shown more important role in changing the gene expression in R. solanacearum. Transcriptome analysis of cells treated with Hycs revealed characteristic genes expression change, mainly included fatty acid pathway, lipopolysaccharides biosynthesis pathway and ATP synthase pathway, accompanied with the stress caused by the disruption of bacteria cell membrane, which can cause the death of bacterial cells. These results demonstrate that the mode of action of esculetin and daphnetin against R. solanacearum may be via inhibiting lipopolysaccharides biosynthesis genes. This study provided important insights into the bactericidal actions of Hycs against R. solanacearum. ACKNOWLEDGMENT The study was supported by the key project of the China National Tobacco Corporation (110201901042, 110201601025) and the National Natural Science Foundation of China (31972288). And Liang Yang was funded by a Joint-PhD fellowship from the China Scholarship Council (CSC, 201806990060). SUPPORTING INFORMATION Supporting information may be found in the online version of this article. References 1. Mansfield J, Genin S, Magori S, Citovsky V, Sriariyanum M, Ronald P, et al., Top 10 plant pathogenic bacteria in molecular plant pathology. Mol Plant Pathol 13: 614-629 (2012). 2. Genin S, Molecular traits controlling host range and adaptation to plants in Ralstonia solanacearum. New Phytol 187: 920-928 (2010). 3. Yuliar, Nion YA and Toyota K, Recent trends in control methods for bacterial wilt diseases caused by Ralstonia solanacearum. Microbes Environ 30: 1-11 (2015). 4. Álvarez B, Biosca EG and López MM, On the life of Ralstonia solanacearum, a destructive bacterial plant pathogen. Current research, technology and education topics in applied microbiology and microbial biotechnology 1: 267-279 (2010). 5. Genin S and Denny TP, Pathogenomics of the Ralstonia solanacearum species complex. Annu Rev Phytopathol 50: 67-89 (2012). 6. Peeters N, Guidot A, Vailleau F and Valls M, Ralstonia solanacearum, a widespread bacterial plant pathogen in the post-genomic era. Mol Plant Pathol 14: 651-662 (2013). 7. Jiang SC, Tang X, Chen M, He J, Su S, Liu L, et al., Design, synthesis and antibacterial activities against Xanthomonas oryzae pv. oryzae, Xanthomonas axonopodis pv. Citri and Ralstonia solanacearum of novel myricetin derivatives containing sulfonamide moiety. Pest Manag Sci 76: 853-860 (2020). 8. Chen JN, Yu YM, Li SL and Ding W, Resveratrol and coumarin: Novel agricultural antibacterial agent against Ralstonia solanacearum in vitro and in vivo. Molecules 21: 1501 (2016). 9. Yang L, Wu LT, Yao XY, Zhao SY, Wang J, Li SL, et al., Hydroxycoumarins: new, effective plant- derived compounds reduce Ralstonia pseudosolanacearum populations and control tobacco bacterial wilt. Microbiol Res 215: 15-21 (2018). 10. Voges MJ, Bai Y, Schulze-Lefert P and Sattely ES, Plant-derived coumarins shape the composition of an Arabidopsis synthetic root microbiome. Proc Natl Acad Sci USA 116: 12558-12565 (2019). 11. Barot KP, Jain SV, Kremer L, Singh S and Ghate MD, Recent advances and therapeutic journey of coumarins: current status and perspectives. Med Chem Res 24: 2771-2798 (2015). 12. Gnonlonfin GJB, Sanni A and Brimer L, Review scopoletin-a coumarin phytoalexin with medicinal properties. Crit Rev Plant Sci 31: 47-56 (2012). 13. Stringlis IA, de Jonge R and Pieterse CMJ, The age of coumarins in plant-microbe interactions. Plant Cell Physiol 60: 1405-1419 (2019). 14. Sun HH, Wang L, Zhang BQ, Ma JH, Hettenhausen C, Cao GY, et al., Scopoletin is a phytoalexin against Alternaria alternata in wild tobacco dependent on jasmonate signalling. J Exp Bot 65: 4305-4315 (2014). 15. El Oirdi M, Trapani A and Bouarab K, The nature of tobacco resistance against Botrytis cinerea depends on the infection structures of the pathogen. Environ Microbiol 12: 239-253 (2010). 16. Sade D, Shriki O, Cuadros-Inostroza A, Tohge T, Semel Y, Haviv Y, et al., Comparative metabolomics and transcriptomics of plant response to Tomato yellow leaf curl virus infection in resistant and susceptible tomato cultivars. Metabolomics 11: 81-97 (2015). 17. Bednarek P, Schneider B, Svatoš A, Oldham NJ and Hahlbrock K, Structural complexity, differential response to infection, and tissue specificity of indolic and phenylpropanoid secondary metabolism in Arabidopsis roots. Plant Physiol 138: 1058-1070 (2005). 18. Santhanam R, Menezes RC, Grabe V, Li DP, Baldwin IT and Groten K, A suite of complementary biocontrol traits allows a native consortium of root‐associated bacteria to protect their host plant from a fungal sudden‐wilt disease. Mol Ecol 28: 1154-1169 (2019). 19. Yang L, Li SL, Qin XY, Jiang GF, Chen JN, Li BD, et al., Exposure to umbelliferone reduces Ralstonia solanacearum biofilm formation, transcription of type III secretion system regulators and effectors and virulence on tobacco. Front Microbiol 8: 1234 (2017). 20. Yang L, Ding W, Xu YQ, Wu D, Li SL, Chen JN, et al., New insights into the antibacterial activity of hydroxycoumarins against Ralstonia solanacearum. Molecules 21: 468 (2016). 21. Lee JH, Kim YG, Cho HS, Ryu SY, Cho MH and Lee J, Coumarins reduce biofilm formation and the virulence of Escherichia coli O157:H7. Phytomedicine 21: 1037-1042 (2014). 22. Azelmat J, Fiorito S, Taddeo VA, Genovese S, Epifano F and Grenier D, Synthesis and evaluation of antibacterial and anti-inflammatory properties of naturally occurring coumarins. Phytochem Lett 13: 399-405 (2015). 23. Duggirala S, Nankar RP, Rajendran S and Doble M, Phytochemicals as inhibitors of bacterial cell division protein FtsZ: Coumarins are promising candidates. Appl Biochem Biotechnol 174: 283-296 (2014). 24. Sridevi D, Sudhakar KU, Ananthathatmula R, Nankar RP and Doble M, Mutation at G103 of MtbFtsZ altered their sensitivity to coumarins. Front Microbiol 8: 578 (2017). 25. Veselinović JB, Matejić JS, Veselinović AM and Sokolović D, Coumarin structure as a lead scaffold for antibacterial agents-molecular docking. Biologica Nyssana 7: 167-170 (2016). 26. Le CF, Gudimella R, Razali R, Manikam R and Sekaran SD, Transcriptome analysis of Streptococcus pneumoniae treated with the designed antimicrobial peptides, DM3. Sci Rep 6: 26828 (2016). 27. Wang T, Xiu JF, Zhang YC, Wu JW, Ma XL, Wang Y, et al., Transcriptional Responses of Candida albicans to Antimicrobial Peptide MAF-1A. Front Microbiol 8: 894 (2017). 28. Zeng D, Wang MW, Xiang M, Liu LW, Wang PY, Li Z, et al., Design, synthesis, and antimicrobial behavior of novel oxadiazoles containing various N-containing heterocyclic pendants. Pest Manag Sci 76: 2681-2692 (2020). 29. Kyle JL, Parker CT, Goudeau D and Brandl MT, Transcriptome Analysis of Escherichia coli O157:H7 Exposed to Lysates of Lettuce Leaves. Appl Environ Microbiol 76: 1375-1387 (2010). 30. Liu Y, Tang YM, Qin XY, Yang L, Jiang GF, Li SL, et al., Genome sequencing of Ralstonia solanacearum CQPS-1, a phylotype I strain collected from a highland area with continuous cropping of tobacco. Front Microbiol 8: 974 (2017). 31. Ewels P, Magnusson M, Lundin S and Käller M, MultiQC: summarize analysis results for multiple tools and samples in a single report. Bioinformatics 32: 3047-3048 (2016). 32. Kim D, Langmead B and Salzberg SL, HISAT: a fast spliced aligner with low memory requirements. Nat Methods 12: 357 (2015). 33. Love MI, Huber W and Anders S, Moderated estimation of fold change and dispersion for RNA- seq data with DESeq2. Genome Biol 15: 550 (2014). 34. Nobori T, Velásquez AC, Wu JN, Kvitko BH, Kremer JM, Wang YM, et al., Transcriptome landscape of a bacterial pathogen under plant immunity. Proc Natl Acad Sci USA 115: E3055- E3064 (2018). 35. Monteiro F, Genin S, van Dijk I and Valls M, A luminescent reporter evidences active expression of Ralstonia solanacearum type III secretion system genes throughout plant infection. Microbiology 158: 2107-2116 (2012). 36. Zhang Y, Luo F, Wu D, Hikichi Y, Kiba A, Igarashi Y, et al., PrhN, a putative marR family transcriptional regulator, is involved in positive regulation of type III secretion system and full virulence of Ralstonia solanacearum. Front Microbiol 6: 357 (2015). 37. Yao J and Allen C, The plant pathogen Ralstonia solanacearum needs aerotaxis for normal biofilm formation and interactions with its tomato host. J Bacteriol 189: 6415-6424 (2007). 38. Perrier A, Peyraud R, Rengel D, Barlet X, Lucasson E, Gouzy J, et al., Enhanced in planta fitness through adaptive mutations in EfpR, a dual regulator of virulence and metabolic functions in the plant pathogen Ralstonia solanacearum. PLoS Pathog 12: e1006044 (2016). 39. Zhou H, Guo FY, Luo JX, Zhang YQ, Liu JL, Zhang YC, et al., Functional analysis of an upregulated calmodulin gene related to the acaricidal activity of curcumin against Tetranychus cinnabarinus (Boisduval). Pest Manag Sci 77: 719-730 (2021). 40. Yang JY, Yan RX, Roy A, Xu D, Poisson J and Zhang Y, The I-TASSER Suite: protein structure and function prediction. Nat Methods 12: 7-8 (2015). 41. Patil R, Das S, Stanley A, Yadav L, Sudhakar A and Varma AK, Optimized hydrophobic interactions and hydrogen bonding at the target-ligand interface leads the pathways of drug- designing. Plos One 5: e12029 (2010). 42. Wright HT and Reynolds KA, Antibacterial targets in fatty acid biosynthesis. Curr Opin Microbiol 10: 447-453 (2007). 43. Lowe-Power TM, Jacobs JM, Ailloud F, Fochs B, Prior P and Allen C, Degradation of the plant defense signal salicylic acid protects Ralstonia solanacearum from toxicity and enhances virulence on tobacco. mBio 7: e00656-00616 (2016). 44. Li LC, Feng XJ, Tang M, Hao WT, Han Y, Zhang GB, et al., Antibacterial activity of Lansiumamide B to tobacco bacterial wilt (Ralstonia solanacearum). Microbiol Res 169: 522-526 (2014). 45. Mine A, Seyfferth C, Kracher B, Berens ML, Becker D and Tsuda K, The defense phytohormone signaling network enables rapid, high-amplitude transcriptional reprogramming during effector-triggered immunity. Plant Cell 30: 1199-1219 (2018). 46. Dodds PN and Rathjen JP, Plant immunity: towards an integrated view of plant-pathogen interactions. Nat Rev Genet 11: 539-548 (2010). 47. Brown DG, Drug discovery strategies to outer membrane targets in Gram-negative pathogens. Bioorg Med Chem 24: 6320-6331 (2016). 48. Nikaido H, Molecular basis of bacterial outer membrane permeability revisited. Microbiol Mol Biol R 67: 593-656 (2003). 49. Velkov T, Thompson PE, Nation RL and Li J, Structure-activity relationships of polymyxin antibiotics. J Med Chem 53: 1898-1916 (2009). 50. Fujita Y, Matsuoka H and Hirooka K, Regulation of fatty acid metabolism in bacteria. Mol Microbiol 66: 829-839 (2007). 51. Tiricz H, Szűcs A, Farkas A, Pap B, Lima RM, Maróti G, et al., Antimicrobial nodule-specific cysteine-rich peptides induce membrane depolarization-associated changes in the transcriptome of Sinorhizobium meliloti. Appl Environ Microbiol 79: 6737-6746 (2013). 52. Koul A, Dendouga N, Vergauwen K, Molenberghs B, Vranckx L, Willebrords R, et al., Diarylquinolines target subunit c of mycobacterial ATP synthase. Nat Chem Biol 3: 323 (2007). 53. Storz G and Imlayt JA, Oxidative stress. Curr Opin Microbiol 2: 188-194 (1999). 54. Liu SB, Zeng TY, Hofmann M, Burcombe E, Wei J, Jiang RR, et al., Antibacterial activity of graphite, graphite oxide, graphene oxide, and reduced graphene oxide: membrane and oxidative stress. ACS Nano 5: 6971-6980 (2011). 55. Hajipour MJ, Fromm KM, Ashkarran AA, de Aberasturi DJ, de Larramendi IR, Rojo T, et al., Antibacterial properties of nanoparticles. Trends Biotechnol 30: 499-511 (2012). 56. Wu DS, Ding W, Zhang Y, Liu XJ and Yang L, Oleanolic acid Induces the type III secretion system of Ralstonia solanacearum. Front Microbiol 6: 1466 (2015). 57. Puigvert M, Solé M, López-Garcia B, Coll NS, Beattie KD, Davis RA, et al., Type III secretion inhibitors for the management of bacterial plant diseases. Mol Plant Pathol 20: 20-32 (2018). Figure 1. R. solanacearum transcriptome signatures influenced by hydroxycoumarins. (A) Chemical structure of hydroxycoumarins (umbelliferone, UM; esculetin, ES; daphnetin, DA). (B) Principal component analysis (PCA) analysis of transcriptome level supplemented with hydroxycoumarins. (C) Comparison of ten genes expression levels between RNA-Seq and qRT-PCR. Choose genes involved in F0F1 ATP synthase subunits (atpB, atpD, atpD and atpG), lipopolysaccharides biosynthesis (lpxB and Rsc0135), fatty acid biosynthesis (accC1), and fatty acid degradation (Rsc0064 and Rsc0161) and out membrane drug efflux lipoprotein Rsp0817. The gene- expression data obtained by RNA-Seq strategy strongly correlated with RT-PCR measurements. Figure 2. Differentially expressed genes supplemented with three hydroxycoumarins (UM, ES and DA). (A) Differentially up and down-regulated genes number under hydroxycoumarins. (B) The volcano plots of up-regulated genes in R. solanacearum regulated by hydroxycoumarins. (C) The volcano plots of down-regulated genes in R. solanacearum regulated by hydroxycoumarins. Figure 3. Heatmaps of read counts of differentially expressed genes (q-value ≤ 0.05， ǀlog2 Fold changeǀ > 2). The color going white to red represents the number of reads from low to high, respectively. The grouping of samples is indicated in the tips of the vertical clustering tree with red (CK), green (UM), purple (DA) and blue colors (ES). Each group is classified into eight clusters. Figure 4. Hydroxycoumarins significantly reduce expression of genes coding for lipopolysaccharides biosynthesis. (A) Biosynthesis pathway of lipopolysaccharides in R. solanacearum, there were nine enzymes involved in the pathway. (B) R. solanacearum wild-type (CQPS-1) and lpxB mutant grow on solid medium after inoculated 48 h. (C) The growth curve of wild-type (CQPS-1) and lpxB mutant in rich B liquid medium. Bacterial density was measured at OD600 every two hour during 24 hours inoculation in liquid medium. * indicates statistically significant differences between lpxB mutant and WT (CQPS-1) with student’s t test analysis (P<0.05). Figure 5. Effect of LpxB on biofilm formation, swimming motility and virulence of R. solanacearum on tobacco. (A) Biofilm formation of R. solanacearum in polystyrene microtiter plates. Bacterial suspension were inoculated in rich medium and kept at 30 °C for 24 h without shaking. Biofilm formation was measured by OD530 after stained with crystal violet. (C) Swimming motility of R. solanacearum in minimal medium. The diameter of swimming halo was measured after 36 h, 48 h and 60 h cultivation at 30 °C. Figure 6. Molecular docking of LpxB protein to daphnetin. (A) Chemical structural formula of daphnetin. (B) The cartoon representation of curcumin. Red regions represent oxygen atoms; gray region indicate carbon atoms. (C) Homology modeling 3D-structure of LpxB. (D) Best conformation of daphnetin docked to binding pocket of LpxB. (E) The recognized binding modes and molecular interactions of daphnetin in the active site of LpxB. (F) The two-dimensional interactions scheme of daphnetin to LpxB. Table 1. The significant enrich Gene ontology (GO) terms of differentially expressed genes (DEGs) of R. solanacearum under hydroxycoumarins treatment. Table 2. Selected differentially expression genes in R. solanacearum regulated by DA and ES treatments based on GO term enrichment. Table 1 The significant enrich Gene ontology (GO) terms of differentially expressed genes (DEGs) of R. solanacearum under hydroxycoumarins treatment. FDR q-value GO GO ID GO Name Category DA vs CK ES vs CK UM vs CK Cellular GO:0005622 intracellular 1.68 × 10 -7 7.32× 10-3 1.61 × 10-2 component GO:0043229 intracellular organelle 2.50 × 10-4 7.66 × 10-3 1.16 × 10-2 intracellular non-membrane-bounded GO:0043232 4.39 × 10-4 6.92 × 10-3 1.56 × 10-2 organelle GO:0005840 ribosome 1.22 × 10-3 9.73 × 10-3 7.26 × 10-3 GO:0043228 non-membrane-bounded organelle 1.24 × 10-3 1.74 × 10-2 1.37 × 10-2 GO:0043226 organelle 1.63 × 10-3 1.62 × 10-2 1.60 × 10-2 GO:0110165 cellular anatomical entity 1.87 × 10-3 3.08 × 10-2 1.78 × 10-2 GO:0032991 protein-containing complex 3.38 × 10-2 3.63× 10-2 1.44 × 10-2 GO:0016020 membrane 1.78 × 10-3 2.45 × 10-4 NA GO:0005886 plasma membrane 1.83 × 10-3 4.55 × 10-2 NA GO:0005737 cytoplasm 2.81 × 10 -2 NA NA GO:0071944 cell periphery NA NA 1.63 × 10-2 Molecular GO:0005198 structural molecule activity 2.71 × 10-4 1.24 × 10-2 1.09 × 10-2 function GO:0003735 structural constituent of ribosome 2.32 × 10-4 1.46 × 10-2 1.65 × 10-2 GO:0005488 binding 2.68 × 10-3 4.18 × 10-2 0.011 GO:0005215 transporter activity 2.91 × 10 -2 4.56 × 10 -2 1.94 × 10-2 GO:0019843 rRNA binding 2.29 × 10-3 1.86 × 10-2 NA GO:1901363 heterocyclic compound binding 6.55 × 10 -3 4.62 × 10 -2 NA GO:0097159 organic cyclic compound binding 8.54 × 10 -3 4.41 × 10 -2 NA GO:0003676 nucleic acid binding 3.63 × 10 -2 3.76 × 10 -2 NA GO:0022857 transmembrane transporter activity 3.38 × 10 -2 NA 2.81 × 10-2 GO:0000166 nucleotide binding 2.43 × 10-2 NA NA GO:0003723 RNA binding 7.14 × 10-3 NA NA GO:1901265 nucleoside phosphate binding 3.01 × 10-2 NA NA GO:0008324 cation transmembrane transporter activity 4.05 × 10-2 NA NA GO:0044237 cellular metabolic process 3.14 × 10-11 1.67 × 10-2 4.03 × 10-2 Biological process organonitrogen compound metabolic GO:1901564 1.32 × 10-13 3.13 × 10-2 3.27 × 10-2 process GO:0044238 primary metabolic process 2.45 × 10-4 1.42 × 10-2 2.07 × 10-2 GO:0019538 protein metabolic process 3.25 × 10-4 1.14 × 10-2 7.13 × 10-3 GO:0051234 establishment of localization 6.11 × 10-4 3.19 × 10-2 3.13 × 10-2 GO:0006810 transport 5.75 × 10-4 3.11 × 10-2 1.14 × 10-2 GO:0044267 cellular protein metabolic process 6.06 × 10-4 9.22 × 10-3 1.99 × 10-2 GO:0043043 peptide biosynthetic process 7.96 × 10-4 1.79 × 10-2 1.54 × 10-2 GO:0006518 peptide metabolic process 7.60 × 10-4 1.77 × 10-2 1.64 × 10-2 GO:0055085 transmembrane transport 1.76 × 10-3 1.70 × 10-2 2.07 × 10-2 GO:0043603 cellular amide metabolic process 2.37 × 10-3 2.84 × 10-2 1.87 × 10-2 GO:0044249 cellular biosynthetic process 2.21 × 10-14 4.66 × 10-2 NA GO:0008152 metabolic process 1.76 × 10-12 3.10 × 10-2 NA GO:0071704 organic substance metabolic process 2.08 × 10-8 1.09× 10-2 NA GO:0009058 biosynthetic process 1.90 × 10-4 3.67 × 10-2 NA GO:1901576 organic substance biosynthetic process 2.95 × 10-4 4.53 × 10-2 NA GO:0044260 cellular macromolecule metabolic process 2.07 × 10 -3 8.97 × 10 -3 NA cellular macromolecule biosynthetic GO:0034645 2.31 × 10-3 1.57 × 10-2 NA process GO:0006412 translation 2.63 × 10-3 1.70 × 10-2 NA GO:0009059 macromolecule biosynthetic process 2.79 × 10-3 2.10 × 10-2 NA GO:0043170 macromolecule metabolic process 3.33 × 10-3 8.21 × 10-3 NA GO:0006807 nitrogen compound metabolic process 3.94 × 10-3 7.76 × 10-3 NA GO:0043604 amide biosynthetic process 6.80 × 10-3 2.68 × 10-2 NA cellular nitrogen compound biosynthetic GO:0044271 1.30 × 10-2 3.34 × 10-2 NA process GO:0010467 gene expression 2.95 × 10 -2 8.65 × 10 -3 NA GO:0051179 localization 5.76 × 10 -4 NA 1.02 × 10-2 GO:0044255 cellular lipid metabolic process 2.01 × 10-2 NA 1.20 × 10-2 GO:0006629 lipid metabolic process 2.26 × 10-2 NA 8.47 × 10-3 GO:0009987 cellular process 2.14 × 10-4 NA NA organonitrogen compound biosynthetic GO:1901566 5.44 × 10 -4 NA NA process GO:0019637 organophosphate metabolic process 3.61 × 10 -3 NA NA GO:0006812 cation transport 5.78 × 10 -3 NA NA GO:1901293 nucleoside phosphate biosynthetic process 5.89 × 10 -3 NA NA GO:0009165 nucleotide biosynthetic process 6.44 × 10 -3 NA NA GO:0090407 organophosphate biosynthetic process 7.12 × 10 -3 NA NA GO:0098655 cation transmembrane transport 9.48 × 10 -3 NA NA GO:1901135 carbohydrate derivative metabolic process 1.38 × 10 -2 NA NA GO:0098662 inorganic cation transmembrane transport 1.36 × 10 -2 NA NA GO:0034220 ion transmembrane transport 1.60 × 10 -2 NA NA GO:0009117 nucleotide metabolic process 2.04 × 10 -2 NA NA GO:0006753 nucleoside phosphate metabolic process 2.45 × 10-2 NA NA carbohydrate derivative biosynthetic GO:1901137 2.47 × 10-2 NA NA process phosphate-containing compound GO:0006796 2.50 × 10-2 NA NA metabolic process GO:0098660 inorganic ion transmembrane transport 2.98 × 10-2 NA NA GO:0015672 monovalent inorganic cation transport 3.02 × 10-2 NA NA GO:1902600 proton transmembrane transport 3.42 × 10-2 NA NA GO:0006793 phosphorus metabolic process 3.38 × 10-2 NA NA (DA indicates daphnetin treatment, ES indicates esculetin treatment and UM means umbelliferone treatment) Table 2. Selected differentially expression genes in R. solanacearum regulated by DA and ES treatments according to GO term enrichment. log2 Fold log2 Fold log2 Fold locus_tag GMI1000 gene Description change (DA- change change (UM vs-CK) (ES vs CK) vs CK) Lipopolysaccharides biosynthesis lipid A biosynthesis lauroyl BC350_RS06480 RSc0136 - -2.15 -2.37 #N/A acyltransferase lipid A biosynthesis lauroyl BC350_RS06485 RSc0135 - -3.16 -2.80 #N/A acyltransferase BC350_RS17350 RSc1370 lplT putative lysophospholipid transporter -2.82 -2.68 #N/A BC350_RS17110 RSc1417 lpxB lipid-A-disaccharide synthase -3.26 -3.44 #N/A UDP-N-acetylglucosamine BC350_RS17115 RSc1416 lpxA -2.49 -2.60 #N/A acyltransferase UDP-3-O-(3- BC350_RS17125 RSc1414 lpxD hydroxymyristoyl)glucosamine N- -2.42 -2.50 #N/A acyltransferase BC350_RS17120 RSc1415 fabZ 3R-hydroxyacyl-ACP dehydratase FabZ -2.75 -2.69 #N/A glucose-1-phosphate BC350_RS03430 RSc0684 rfbA -2.97 -2.00 #N/A thymidylyltransferase protein Genes encoding proteins involved in fatty acid synthesis and metabolism and membrane modification BC350_RS05760 RSc0265 - acyl-CoA carboxylase subunit alpha -2.48 -2.37 #N/A acyl-CoA dehydrogenase BC350_RS25670 RSp0652 - -2.11 -2.22 #N/A oxidoreductase protein BC350_RS25690 RSp0648 - enoyl-CoA hydratase -2.48 -3.91 #N/A enoyl-[acyl-carrier-protein] reductase BC350_RS00385 RSc1172 fabI -3.76 -2.96 #N/A FabI 3-ketoacyl-(acyl-carrier-protein) BC350_RS01040 RSc1052 fabG -2.22 -2.04 #N/A reductase acyl-carrier-protein S- BC350_RS01045 RSc1051 fabD -2.35 -2.51 #N/A malonyltransferase 3-oxoacyl-(acyl carrier protein) BC350_RS01050 RSc1050 fabH -2.85 -3.40 #N/A synthase III 3-oxoacyl-[acyl-carrier-protein] BC350_RS22070 RSp0357 fabB -2.30 -2.08 #N/A synthase I BC350_RS01035 RSc1053 acpF acyl carrier protein -3.24 -3.76 #N/A BC350_RS04755 RSc0434 - acyl carrier protein -3.97 -2.81 #N/A putative glycerol-3-phosphate BC350_RS11530 RSc2546 - -3.15 -2.39 #N/A acyltransferase PlsY BC350_RS13210 RSc2253 pcaJ 3-oxoadipate CoA transferase subunit B 2.03 2.84 #N/A BC350_RS13215 RSc2252 pcaF beta-ketoadipyl CoA thiolase 2.15 2.15 #N/A 3-carboxy-cis,cis-muconate BC350_RS13220 RSc2251 pcaB 2.65 2.49 #N/A cycloisomerase B-ketoadipate enol-lactone hydrolase BC350_RS13225 RSc2250 pcaD 2.10 2.11 #N/A transmembrane protein 4-carboxymuconolactone BC350_RS13230 RSc2249 pcaC 2.37 2.61 #N/A decarboxylase transmembrane aldehyde BC350_RS06355 RSc0161 - 3.04 2.88 #N/A dehydrogenase oxidoreductase protein Genes encoding proteins involved in conformational modification of RNA BC350_RS00415 RSc1167 cysS cysteine--tRNA synthetase -3.15 -2.88 #N/A putative tRNA/rRNA methyltransferase BC350_RS05290 RSc0358 yibK -2.58 -2.51 #N/A protein BC350_RS17950 RSc1251 hrpA ATP-dependent RNA helicase protein -2.12 -2.31 #N/A Genes encoding proteins involved in translation BC350_RS08680 RSc3041 tuf elongation factor Tu -2.73 -2.01 #N/A BC350_RS13735 RSc2152 greB transcription elongation factor GreB 2.84 2.38 #N/A Genes encoding proteins involved in transcriptional regulation two component sensor histidine kinase BC350_RS08275 RSc3160 - -2.76 -2.26 #N/A transcription regulator protein cold shock-like transcription regulator BC350_RS08305 RSc3156 cspC -2.85 -2.09 #N/A protein BC350_RS12010 RSc2430 - putative transcription regulator protein -2.31 -3.68 #N/A BC350_RS15545 RSc1584 - putative transcription regulator protein -2.35 -2.09 #N/A RNA polymerase sigma-E factor sigma- BC350_RS12345 RSc2361 - 24 homolog transcription regulator 2.51 2.13 #N/A protein BC350_RS13910 RSc2114 - transcription regulator protein 2.92 2.81 #N/A putative transcription regulator BC350_RS16745 RSc1857 - protein/PLP-dependent 2.34 2.79 #N/A aminotransferase family protein BC350_RS00285 RSc1185 - transcription regulator protein 2.80 2.44 #N/A putative transcriptional regulatory BC350_RS01335 RSc0993 - DNA-binding transcription regulator 2.82 2.40 #N/A protein extracytoplasmic function sigma factor BC350_RS18850 RSp0415 - 6.48 6.20 #N/A transcription regulator protein ferric uptake transcriptional (FUR)-like BC350_RS21525 RSp0247 fur2 4.47 4.72 #N/A transcription regulator protein BC350_RS24180 RSp0962 - putative transcription regulator protein 2.39 2.97 #N/A anaerobic nitric oxide reductase BC350_RS24195 RSp0959 - 2.57 2.23 #N/A transcription regulator Genes encoding proteins involved in transcription BC350_RS24675 RSp0849 prhI RNA polymerase sigma factor -2.06 2.14 #N/A BC350_RS00275 RSc1187 - transcription termination factor Rho -3.09 -2.86 #N/A metal/formaldehyde-sensitive BC350_RS18350 RSp0553 - -2.71 -2.65 #N/A transcriptional repressor Genes encoding proteins involved in membrane transport putative multidrug resistance-like efflux BC350_RS17375 RSc1365 - -2.11 -2.57 #N/A transmembrane protein transmembrane ABC transporter BC350_RS01230 RSc1015 - -2.33 -3.12 #N/A protein BC350_RS01425 RSc0975 - ABC transporter ATP-binding protein -2.79 -2.33 #N/A putative glutamate/aspartate transport BC350_RS04505 RSc0484 gltL -3.07 -2.58 #N/A ATP- binding ABC transporter protein glutamate/aspartate transmembrane BC350_RS04515 RSc0482 gltJ -2.47 -2.47 #N/A ABC transporter protein amino-acid-binding periplasmic (PBP) BC350_RS04520 RSc0481 - -2.23 -2.04 #N/A ABC transporter protein BC350_RS07625 RSc3344 - ABC transporter ATP-binding protein -2.47 -2.60 #N/A BC350_RS07630 RSc3343 - ABC transporter ATP-binding protein -2.54 -2.45 #N/A putative substrate-binding periplasmic BC350_RS07635 RSc3342 - -2.96 -3.10 #N/A (PBP) ABC transporter protein transmembrane ABC transporter BC350_RS07640 RSc3341 - -3.10 -2.87 #N/A protein transmembrane ABC transporter BC350_RS07645 RSc3340 - -2.30 -2.22 #N/A protein amino-acid-binding periplasmic (PBP) BC350_RS07700 RSc3329 - -2.95 -2.42 #N/A ABC transporter protein transmembrane ABC transporter BC350_RS11350 RSc2631 - -2.35 -2.32 #N/A protein putative amino acid-binding BC350_RS11955 RSc2441 - -4.01 -4.27 #N/A periplasmic ABC transporter proteinn LPS export ABC transporter permease BC350_RS12085 RSc2417 - -2.90 -3.01 #N/A LptG LPS export ABC transporter permease BC350_RS12090 RSc2416 - -3.14 -2.75 #N/A LptF phosphate ABC transporter substrate- BC350_RS15255 RSc1529 pstS1 -2.15 -2.59 #N/A binding protein PstS amino-acid-binding periplasmic (PBP) BC350_RS20000 RSp1575 - -2.98 -2.29 #N/A ABC transporter protein amino-acid transmembrane ABC BC350_RS20005 RSp1576 - -2.62 -2.59 #N/A transporter protein D-xylose ABC transporter substrate- BC350_RS20255 RSp1633 xylF -4.35 -3.95 #N/A binding protein xylose ABC transporter ATP-binding BC350_RS20260 RSp1634 xylG -3.71 -3.66 #N/A protein xylose transmembrane ABC transporter BC350_RS20265 RSp1635 xylH -3.41 -3.73 #N/A protein amino-acid ATP-binding ABC BC350_RS20540 RSp0016 - -2.66 -2.74 #N/A transporter protein amino-acid ATP-binding ABC BC350_RS20545 RSp0017 - -2.36 -2.18 #N/A transporter protein cyclolysin-type secretion composite BC350_RS21755 RSp0292 cyaB ATP-binding transmembrane ABC -3.52 -3.54 #N/A transporter protein putative acyltransferase BC350_RS04295 RSc0522 - -3.03 -2.12 #N/A transmembrane protein BC350_RS08340 RSc3150 - putative transmembrane protein -2.63 -3.10 #N/A penicillin-binding 1 transmembrane BC350_RS09510 RSc2976 mrcA -2.54 -2.32 #N/A protein putative thioredoxin-related BC350_RS10520 RSc2784 - -2.29 -2.02 #N/A transmembrane protein biopolymer transport EXBB-like BC350_RS11620 RSc2528 exbB2 -3.72 -3.16 #N/A transmembrane protein BC350_RS11645 RSc2523 - putative transmembrane protein -2.39 -2.13 #N/A amino-acid transporter BC350_RS15570 RSc1588 - -2.73 -2.74 #N/A transmembrane protein lysine-specific permease BC350_RS16185 RSc1757 - -2.25 -2.52 #N/A transmembrane protein lysine-specific permease BC350_RS16190 RSc1758 lysP -2.59 -2.55 #N/A transmembrane protein BC350_RS19280 RSp1423 - putative transmembrane protein -2.78 -2.29 #N/A putative porin B precursor outer BC350_RS20250 RSp1632 oprB -3.70 -3.38 #N/A (glucose porin) transmembrane protein general secretion pathway GSPG-like BC350_RS21080 RSp0150 - -2.20 -2.38 #N/A transmembrane protein BC350_RS21145 RSp0169 - putative transmembrane protein -3.05 -2.28 #N/A amino-acid permease transmembrane BC350_RS21700 RSp0282 - -3.70 -3.17 #N/A protein hemolysin secretion-like BC350_RS21750 RSp0291 - -3.20 -3.62 #N/A transmembrane protein BC350_RS22515 RSp1294 - serin-rich transmembrane protein -3.49 -2.52 #N/A 3-compartiment signal transduction BC350_RS24670 RSp0850 prhR system, component PRHR -2.78 2.19 #N/A transmembrane protein high affinity cobalt transporter BC350_RS25805 RSp0628 hoxN -4.07 -2.57 #N/A transmembrane protein multidrug resistance B (translocase) BC350_RS17745 RSc1292 emrB 4.97 4.48 #N/A transmembrane protein multidrug ABC transporter BC350_RS10805 RSc2726 - 2.20 2.39 #N/A transmembrane protein BC350_RS06340 RSc0164 - ABC transporter ATP-binding protein 3.62 3.92 #N/A BC350_RS16435 RSc1808 - ABC transporter ATP-binding protein 4.05 4.77 #N/A BC350_RS16440 RSc1809 - ABC transporter ATP-binding protein 4.72 5.10 #N/A transmembrane ABC transporter BC350_RS17290 RSc1382 - 4.27 4.56 #N/A protein transmembrane ABC transporter BC350_RS17295 RSc1381 - 4.34 4.90 #N/A protein substate-binding periplasmic (PBP) ABC BC350_RS17300 RSc1380 - 4.46 5.07 #N/A transporter protein BC350_RS17305 RSc1379 - ABC transporter ATP-binding protein 4.75 4.96 #N/A BC350_RS23245 RSp1145 - ABC transporter ATP-binding protein 2.54 2.08 #N/A biopolymer transport transmembrane BC350_RS14640 RSc1965 exbD1 2.81 2.49 #N/A protein biopolymer transport transmembrane BC350_RS14645 RSc1964 exbB1 protein/MotA/TolQ/ExbB proton 3.16 2.51 #N/A channel family protein BC350_RS00565 RSc1138 - putative transmembrane protein 2.29 2.84 #N/A BC350_RS07350 RSc3400 - tranporter transmembrane protein 5.09 4.32 #N/A putative transport transmembrane BC350_RS12875 RSc2324 - 4.60 4.70 #N/A protein BC350_RS12880 RSc2323 - transport transmembrane protein 2.23 2.20 #N/A putative GSPG-related transmembrane BC350_RS12945 RSc2310 - 2.60 2.12 #N/A protein BC350_RS14650 RSc1963 tonB TONB transmembrane protein 4.03 4.63 #N/A BC350_RS20335 RSp1650 - putative transmembrane protein 2.53 2.11 #N/A putative maltooligosyl trehalose BC350_RS21465 RSp0235 - 4.40 3.09 #N/A synthase transmembrane protein BC350_RS21540 RSp0250 - putative transmembrane protein 3.68 2.69 #N/A BC350_RS25600 RSp0663 - transport transmembrane protein 2.71 2.96 #N/A Genes encoding proteins involved in oxidative phosphorylation and electron transport BC350_RS05260 RSc0365 ctaG cytochrome c oxidase assembly protein -2.42 -2.39 #N/A transmembrane cytochrome O BC350_RS09820 RSc2917 cyoA1 -2.92 -2.23 #N/A ubiquinol oxidase subunit II BC350_RS07730 RSc3323 atpB F0F1 ATP synthase subunit A -2.31 -2.53 #N/A BC350_RS07735 RSc3322 atpE F0F1 ATP synthase subunit C -2.62 -2.01 #N/A BC350_RS07740 RSc3321 atpF F0F1 ATP synthase subunit B -2.43 -2.25 #N/A BC350_RS07750 RSc3319 atpA ATP synthase subunit alpha -2.94 -2.03 #N/A BC350_RS07760 RSc3317 atpD ATP synthase subunit beta -2.96 -2.17 #N/A BC350_RS07765 RSc3316 atpC ATP synthase subunit epsilon -2.80 -2.46 #N/A BC350_RS14210 RSc2055 nuoH NADH dehydrogenase subunit H -2.09 -2.03 #N/A BC350_RS14220 RSc2053 nuoJ NADH dehydrogenase subunit J -2.02 -2.19 #N/A BC350_RS14225 RSc2052 nuoK NADH dehydrogenase subunit K -2.21 -2.10 #N/A BC350_RS14230 RSc2051 nuoL NADH dehydrogenase subunit L -2.41 -2.61 #N/A BC350_RS14235 RSc2050 nuoM NADH dehydrogenase subunit M -2.26 -2.20 #N/A BC350_RS14240 RSc2049 nuoN NADH dehydrogenase subunit N -2.43 -2.21 #N/A Genes encoding stress-related proteins BC350_RS03010 RSc0764 msrA methionine sulfoxide reductase A 2.81 3.19 #N/A BC350_RS20430 RSp1671 rpoN2 RNA polymerase factor sigma-54 factor 3.60 2.92 #N/A Protein export BC350_RS10860 RSc2716 secF protein translocase subunit SecF -2.13 -2.26 #N/A BC350_RS10865 RSc2715 secD protein translocase subunit SecD -2.17 -2.16 #N/A PS_6557_PS_6557_Figure 1.tif PS_6557_PS_6557_Figure 2-Reverse.tif PS_6557_PS_6557_Figure 3.tif PS_6557_PS_6557_Figure 4-new.tif PS_6557_PS_6557_Figure 5.tif PS_6557_PS_6557_hydroxycoumarins-bacteria-RNA-Seq-ps.png