Journal of Environmental Chemical Engineering 9 (2021) 106622 Contents lists available at ScienceDirect Journal of Environmental Chemical Engineering journal homepage: www.elsevier.com/locate/jece Microbial communities in an anammox reactor treating municipal wastewater at mainstream conditions: Practical implications of different molecular approaches Pía Oyarzúa a, Patricia Bovio-Winkler b, Claudia Etchebehere b, María Eugenia Suárez-Ojeda a, * a GENOCOV Research Group, Department of Chemical, Biological and Environmental Engineering, School of Engineering-Edifici Q, Universitat Autònoma de Barcelona, Campus UAB, 08193 Bellaterra, Barcelona, Spain b Microbial Ecology Laboratory, Department of Microbial Biochemistry and Genomic, Biological Research Institute “Clemente Estable”, Avenida Italia 3318, CP 11600 Montevideo, Uruguay A R T I C L E I N F O A B S T R A C T Editor: Yang Liu Biases on molecular techniques used to study microbial communities in the anammox process are not always considered. This work aimed to evaluate different molecular approaches to study bacterial communities in an Keywords: anammox reactor treating real urban wastewater at mainstream conditions. 16S rRNA amplicon sequencing with Mainstream anammox different primer sets, metagenomics, and qPCR were evaluated. An enriched anammox reactor feed with syn­ Microbial community thetic wastewater was used as a positive control. We reported that, despite its in silico coverage, the universal Amplicon sequencing primers 515F-909R had, in fact, very low coverage (1%) of the Planctomycetota phylum. The functional genes Metagenomics qPCR approach showed a taxonomic resolution at the species level, although genomic database updates are a bias to be considered. From the phylogenetic analysis, coherence among the approaches was obtained. Primers targeting anammox 16S rRNA and hydrazine synthase genes in qPCR showed consistency in the quantification, making them useful for comparing similar investigations. According to the results, recommendations on the biomolecular approach to be used were outlined. 1. Introduction 2019), [22,28,38,46]. There is evidence that under the same operational conditions, the The anammox process is carried out by anammox bacteria, described nitrogen removal efficiency of various anammox systems may differ as a monophyletic order (“Candidatus” Brocadiales) in the Planctomy­ owing to the difference in the dominant anammox species, [9,62]. To cetes phylum that have the metabolic ability to catalyze the one-to-one date, six anammox genera have been described, including “Candidatus” conversion of ammonium and nitrite under anoxic conditions to form (Ca.). Brocadia, Ca. Kuenenia, Ca. Scalindua, Ca. Anammoxoglobus, Ca. dinitrogen gas [32,48]. Jettenia and Ca. Anammoximicrobium, all of them detected in different Recent research on autotrophic nitrogen removal has been focused WWTPs [20,62]. These lineages all have “Candidatus” status as it is not on partial nitrification (PN) or partial denitrification (PD) coupled to yet possible to culture them in pure culture and must be grown in lab­ anammox for its implementation in the mainstream line of urban oratory enrichments [30]. According to Yarza et al. (2014), [65] the WWTP, encouraged by the intention of achieving energy-neutral plants candidate taxonomic unit is a “biological entity that is delineated by a [12,36,46,54]. Despite the increasing experimental studies, there are monophyletic set of sequences with a sequence identity that stays still many challenges to improve the nitrogen removal efficiency at within, or very close to, the taxonomic threshold that is proposed for a mainstream conditions, including: low NH4+ concentrations, variable given rank”. nitrogen loads, low temperatures during winter season, proliferation of Giving the metabolic differences among the anammox community, nitrite oxidizing bacteria (NOB), nitrate buildup, competition between better identification of the existing anammox bacteria in a bioreactor is different classes of bacteria (autotrophic, heterotrophic), long-term of utmost importance to understand the process and improve its oper­ process stability and stringent-effluent-quality requirements (Du et al., ation [9]. But also, other microbial communities, whose identity and * Corresponding author. E-mail address: mariaeugenia.suarez@uab.cat (M.E. Suárez-Ojeda). https://doi.org/10.1016/j.jece.2021.106622 Received 19 July 2021; Received in revised form 21 September 2021; Accepted 17 October 2021 Available online 20 October 2021 2213-3437/© 2021 The Author(s). Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). P. Oyarzúa et al. Journal of Environmental Chemical Engineering 9 (2021) 106622 relationship with the anammox bacteria are still under investigation amplicon sequencing technique was performed using three primer sets, [15], are important. In this sense, Lawson et al. [30] proposed different where each primer was considered an individual approach: a) universal metabolic networks between anammox and heterotrophic bacteria. primers 515 b) universal primers 515F-909R and c) specific anammox Until now, research about anammox systems working at mainstream primers Amx368F-Amx820R. The shot-gun sequencing metagenomic conditions in real environments have provided insights into the taxo­ was the second technique evaluated, including two different ap­ nomic composition and, about the key nitrogen cycle microorganisms proaches: d) 16S rRNA sequences extracted from the metagenomic data, [22,30,33,7], but the main focus of these investigations was on oper­ and e) functional taxonomy assigned based on functional genes. These ating conditions from an engineering perspective [10]. As a result, the five approaches were sequencing-related and their respective relative actual knowledge is insufficient to reveal the complexity of the anam­ abundances were obtained. The final technique performed was qPCR mox community composition and their metabolic network. (approach f), where primers targeting 16S rRNA gene for anammox In this sense, DNA-based molecular techniques are the most widely populations, and two primer sets targeting functional genes were used. used for studying the microbial ecology in this kind of bioreactors [42, This last technique allowed an absolute quantification. Sections 2.1 and 47]. These approaches include PCR-based methods, as amplicon 2.2 contains the details about sampling and DNA extraction, respectively sequencing and qPCR, which utilize 16S rRNA gene as a molecular while in the rest of the sections each approach is explained in detail. marker for detection, identification, and/or quantification of bacterial communities. Since the 16S rRNA gene is not necessarily related to the 2.1. Anammox reactors description physiology of anammox bacteria, the use of functional gene markers as hydrazine synthase (hzsA), nitrite reductase (nirS), among others, may Samples were obtained from two different reactors. The first reactor provide alternatives for assessing these communities in anammox re­ corresponds to an anammox sludge sequential-batch-reactor (SBR) actors [18,23,53]. The most recent developed molecular approach is working at 35 ºC under stable conditions for more than six years [21]. metagenomic sequencing, which allows a functional and taxonomic This SBR was fed with a synthetic medium as influent (180 ± 30 mg analysis, besides obtaining a higher resolution of microbial and anam­ N-NH4+ L− 1, 190 ± 30 mg N-NO2- L− 1) and operated with a nitrogen mox diversity compared to amplicon sequencing [2,30]. loading rate (NLR) of 0.45 ± 0.09 g N L− 1 d− 1. The nitrogen removal rate Despite the wide variety of molecular approaches, biases in each of (NRR) was 0.36 ± 0.09 g N L− 1 d− 1. Further details about operation and them are not always considered. As an example, reliability of PCR-based performance of this reactor have been reported elsewhere [21]. The methods predominantly depends on the specificity and efficiency of the second reactor was an up-flow anammox-sludge-bed (UAnSB) reactor PCR primers [51]. Since the PCR primers are designed in silico, their working at 20 ºC at the time of sampling. This UAnSB was fed with a characteristics depend on the type of biomass, the type of sample, and wastewater from a partial nitritation reactor treating the real effluent many other factors inherent to the PCR reaction itself. Therefore, their exiting the primary settler of an urban WWTP (150.000 inhabitants practical applications do not always offer an acceptable performance equivalent) located in an industrial area of Catalonia, NE Spain. The [53]. Thus, when trying to compare similar investigations, several composition of this wastewater was: 26 ± 8 mg N-NH4+ L− 1, 36 ± 9 mg problems arise, like the inconsistency of the data obtained with the N-NO2- L− 1, 2 ± 2 mg N-NO3- L− 1, 60 ± 14 mg COD L− 1, among other different methods, as shown by Orschler et al. [42] that compared compounds). amplicon sequencing of different hypervariable regions of 16S rRNA Samples of the bottom of this reactor were taken during a stable gene in samples from partial nitrification/anammox (PN/A) reactors. operation period of 81 days, when it was operated with NLR of 0.10 ± Therefore, this work aimed to evaluate different molecular ap­ 0.02 g N L− 1 d− 1; NRR 0.10 ± 0.02 g N L− 1 d− 1, nitrogen removal ef­ proaches to determine the whole bacterial and the anammox commu­ ficiency (NRE) was 87 ± 3% (for more details, see the work of Juan-Díaz nities’ structure in a granular-sludge anammox reactor treating real et al. [22]. Samples taken from both reactors, were washed 3 times wastewater at mainstream conditions. Also, a comparison with an (5000g, 5 min) with 1 mL of 1X Phosphate Saline Buffer (PBS) and the enriched anammox reactor treating synthetic medium was used to pellet was stored at − 80 ºC for DNA extraction. Sample from SBR reactor validate the techniques and the scope and biases of each one of the was labelled as “AM” and considered as the enriched anammox reactor approaches used. treating synthetic influent. The other sample, coming from UAnSB reactor was labelled as “S1′′ . 2. Materials and methods 2.2. DNA extraction Different molecular approaches to determine the whole bacterial and the anammox communities’ structure were evaluated in a granular- For total genomic DNA obtention, frozen samples were thawed, sludge anammox reactor treating real wastewater at mainstream con­ centrifuged (5000g, 5 min) and 0.35 g of wet pellet were used for the Soil ditions. For a better understanding of the strategies used in every step of DNA Isolation Plus Kit (Norgen Biotek, Thorold, ON, Canada) according this work, we define six DNA-based approaches (Table 1), coming from to the manufacturer’s instructions. DNA quantity and integrity were three techniques: amplicon sequencing, metagenomics, and qPCR. The checked with a ND-1000 Nanodrop spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA) and stored at − 80 ºC until further use for amplicon and metagenomic sequencing. A final quantification of Table 1 DNA was determined with the Qubit fluorometric quantitative analyzer DNA-based approaches used in this work to determine the whole bacterial and (Life Technologies, Carlsbad,CA, USA) for qPCR assays. the anammox communities’ structure in a granular-sludge anammox reactor treating real wastewater at mainstream conditions. 2.3. Bacterial 16S rRNA gene analysis by amplicon sequencing Molecular technique Details Approach Amplicon sequencing Set of primers used: 515F-806R a Amplicon sequencing paired-end (PE) service of 16S rRNA genes on Set of primers used: 515F-909R b the Illumina MiSeq platform (2 × 300 bp) was performed by RTL Ge­ Set of primers used: Amx368F-Amx820R c nomics (Lubbock, TX, USA) for detecting bacteria and anammox bac­ Shot-gun sequencing 16S rRNA sequences from metagenomic data d metagenomic Functional taxonomy from functional genes e teria using primers shown in Table 2. To avoid differences in the results qPCR Functional genes (hydrazine synthase gen f due to the target of different hypervariable region (HVR) of the 16S and nitrite reductase gen) + Bacteria 16S rRNA gene, two universal primer set targeting the HVR of the 16S rRNA rRNA gen + Anammox bacteria 16S rRNA gene (V4-V5) were used as suggested by several researchers [51,53,6]. gen The Silva database Test Prime tool [26] was used to evaluate primer 2 P. Oyarzúa et al. Journal of Environmental Chemical Engineering 9 (2021) 106622 Table 2 Primers used in this study for 16S rRNA amplicon sequencing and qPCR. Application Probe/Primer set Sequence (5′ − 3′ ) Specificity Annealing Temperature (ºC) Reference 16S rRNA gene amplicon 515F GTGCCAGCMGCCGCGGTAA Bacteria and Archaea – [55] 806R GGACTACHVGGGTWTCTAAT 909R CCCCGYCAATTCMTTTRAGT Bacteria and Archaea [64] AMX368F TTCGCAATGCCCGAAAGG 16S rRNA gen specific for anammox bacteria – [57] AMX820R AAAACCCCTCTACTTAGTGCCC qPCR 519F CAGCMGCCGCGGTAANWC Bacteria 16S rRNA gen 52 [61] 907R CCGTCAATTCMTTTRAGTT AMX809F GCCGTAAACGATGGGCACT 16S rRNA gen specific for anammox bacteria 56 [63] AMX1066R AACGTCTCACGACACGAGCTG AnnirS379F TCTATCGTTGCATCGCATTT Nitrite reductase gen 54 [58] AnnirS821R GGATGGGTCTTGATAAACA AnhzsA1597F WTYGGKTATCARTATGTAG hydrazine synthase gen 51 [18] AnhzsA1857R AAABGGYGAATCATARTGGC coverage with settings recommended by Zhou et al. [53]: two maximum Brocadiaceae family from amplicon sequencing for each primer set, full- number mismatches and one site of 0-mismatch zone at 3′ end. length 16S rRNA gene sequences reconstructed from metagenome, se­ quences belonging to the Ca. Brocadiales order from an anammox study 2.4. Data processing of amplicon sequencing [53] and related environmental sequences found in GenBank using BLASTN algorithm. All sequences were aligned using SILVA v1.2.11 FastQC v.0.11.9 (https://www.bioinformatics.babraham.ac.uk/pro [45] and phylogenetic trees were performed using the maximum like­ jects/fastqc/) was used to assess raw sequences quality control and lihood method in MEGA7 software [27]. 16S rRNA sequence from Pir­ adaptors contamination. Demultiplexed sequences were imported into ellula staleyi (AJ231183) as an outgroup for rooting trees [53]. Bootstrap QIIME2™ v.2019.10 (https://qiime2.org). DADA2 denoise-paired plug- values were obtained from data resampling of 500 replicates. in [4] was used to quality filtering, trimming of poor-quality bases, de-replication, chimera filtering, merging paired-end reads, and the 2.7. Quantification of different anammox genes and total bacteria by identification of amplicon sequence variants (ASV). The resulting qPCR feature table was used for taxonomic assignment based on the Silva SSU 138 rRNA reference database pre-clustered at 99% sequence identity Two functional genes (hzsA and nirS) and one specific 16S rRNA with the QIIME2 q2-feature-classifier plugin [16]. The Bray-Curtis method were used to quantify the proportion of anammox in both re­ metric was used for calculation of beta diversity and a non-metric actors. Moreover, the total bacterial population was quantify using 16S multidimensional scaling (NMDS) plot was constructed with metaMDS rRNA gene bacterial-target primers. Table 2 shows the primers and its function (vegan package) and ggplot function (ggplot2 package) using R annealing temperatures. The calibration curves were constructed with software version 3.5.1 (R Core Team 2013) in R Studio environment positive controls. For these controls, plasmids pTOP_Blunt_V2 contain­ Version 1.0.153. The raw data was deposited at National Center for ing as insert specific anammox bacterial 16S rRNA and for the functional Biotechnology Information (NCBI) under accessing number: genes encoding hzsA and nirS were manufactured by Macrogen Inc PRJNA728853. (Seoul, South Korea). Accession number of reference genes used for synthesis were: AB277765.1, JN703716.1 and CT573071.1. Genomic 2.5. Metagenomic analysis DNA previously extracted from a strain of Pseudomonas fluorescens was used as standard for the 16S rRNA gene bacterial quantification. The DNA samples were analyzed using shotgun sequencing performed in standard samples were diluted to yield 10-fold dilutions in the range of Illumina Novaseq6000 sequencer (Macrogen, Seoul, South Korea) (2 × 104-108 DNA copies µl− 1 and subsequently used to generate q-PCR 100 bp, PE). The metagenomic data was processed and analysed with standard curves. The R2 value for each standard curve exceeded 0.99. All the following tools: FastQC (v0.11.9) for assessing sequence quality, PCR reactions were performed in a Rotor-Gene 6000 (Corbett Life Sci­ Trimmomatic (v0.36) for removal of ambiguous reads, adapters, and ence, Sydney, Australia). Fluorescence was detected at the end of the low-quality sequences to obtain high quality reads [3] with the settings extension step. The qPCR protocol was as follow: 95 ºC for 5 min fol­ SLIDINGWINDOW:4:25 and MINLEN:90, MEGAHIT v1.2.3-beta [31] for lowed by 40 cycles at 95 ºC for 10 s, 20 s at the annealing temperature metagenome assembly. Contigs shorter than 1000 bp were filtered. After and 72 ºC for 20 s. Each PCR mixture (20 µl) contained 2 µl of diluted this, metagenomic annotation and functional classification were pre­ DNA template, 10 µM of each primer, and 10 µl of 2X KAPA SYBR® FAST dicted against the KEGG GENES database using MetaErg [11]. On the qPCR Master Mix Universal (Kapa Biosystems, Wilmington, MA, USA). other side, Ribosomal Small Subnubit (SSU) from 16S rRNA genes were The specificity of the amplified PCR product was assessed by performing reconstructed from metagenomic reads using Metaxa2 v.2.1 [1] together a melting curve analysis; fluorescence readings were consecutively with the SILVA SSU 138 rRNA database. Assembly of shotgun reads collected during the melting process from 60 to 95 ºC at a heating rate of assigned to the 16S rRNA gene was performed using EMIRGE [39]. The 5 ºC s− 1. DNA concentrations were determined using the Qubit fluoro­ raw data was deposited at NCBI under accessing number: metric quantitative analyzer (Life Technologies, CarlsbadCA, USA) and PRJNA728853. gene copy numbers obtained were normalized by DNA concentrations in corresponding individual samples. All quantitative PCR reactions were 2.6. Phylogenetic analysis carried out in triplicates and statistical analysis was performed with Infostat software. Log transformed gene copy numbers were subjected to Three phylogenetic trees were constructed to determine the position ANOVA analysis. Tukey’s test was used to determine which genes copies of anammox bacteria retrieved by the different strategies. As all primer were statistically distinct (5% of significance was used). The efficiencies sets used for amplicon sequencing produced different length sizes of the of the quantitative PCR assays were over 80%, and the R2 value always PCR products, it was decided to construct one tree for each primer set. In exceeded 0.98. this way, we avoided losing information by trimming sequences. The trees included: representative sequences of ASVs classified as 3 P. Oyarzúa et al. Journal of Environmental Chemical Engineering 9 (2021) 106622 3. Results and discussion the partial nitritation system. Differences between in silico and in prac­ tical results have been previously reported by Yang et al. [51]. This may 3.1. Microbial community composition be due to the fact that in silico predictions do not consider chemical reactions and limitations that can occur in the PCR tube and therefore The microbial community composition of the samples taken from cannot truly approximate to the practical applications [19], another two anammox reactors: reactor S1 (anammox reactor treating urban possibility is that the microorganism predominant were not covered by wastewater at mainstream conditions) and reactor AM (enriched this primer set and the sequences from these microorganisms were not anammox reactor treating synthetic influent as a positive control) was deposited in the databases. In contrast, the primer set 515F-806R gave determined using: amplicon sequencing (approaches a and b) and shot- us a better representation of the anammox community, but it could lead gun sequencing metagenomic (approaches d and e). to an underestimation of the other phyla on the enriched anammox Relative abundances of the four datasets were compared at the class reactor treating synthetic influent. This is due to the amplification bias level (Fig. 1A) showing that Anaerolineae, Brocadiae, Gammaproteo­ among taxa with low estimated abundance in amplicons, as was bacteria and Ignavibacteria were the most abundant classes in both re­ demonstrated by Campanaro et al. [5]. These results agree with those of actors, although the relative abundances vary among techniques and the Ferrera and Sánchez [14], showing that there are fundamental biases reactor samples. These classes correspond to the phyla Chloroflexi, related to the PCR amplification and the primer set used that impact on Planctomycetota, Proteobacteria and Bacteroidota, respectively. This the quantitative information that was obtained from these approaches. so-called “core microbiome”, have been found in the microbial com­ The S1 reactor, instead, was dominated by the heterotroph’s classes munities of anammox bioreactors, being similar in several types of re­ Ignavibacteria, Anaerolineae and Gammaproteobacteria, not anammox. actors, despite the differences in the operation of the reactor and the The class Brocadiae was found in very low abundance (3%) with primer composition of the influent wastewater, and the molecular approach set 515F-806R and it was not detected with the universal primer set used to determine the community composition [2,30,37]. 515F-909R. The difference in abundance of the Brocadiales class be­ A very low coverage of the Brocadiae class was observed using the tween both reactors was expected, given the characteristics of the universal primers 515F-909R. In the AM reactor, the results showed that influent. The synthetic medium provided to the AM reactor and opera­ 16S rRNA amplicon with universal primers 515F-909R detected 1% tion conditions were the ideal ones for enhancing the anammox while the universal primers 515F-806R presented a relative abundance enrichment, while the presence of organic matter and other compounds of 75% (Fig. 1A). In this sense, we have selected two universal primer set in real wastewater that feeds the S1 reactor enhance the growth of targeting the same hypervariable region of the 16S rRNA gene (V4-V5), heterotrophic bacteria to the detriment of anammox bacteria. Function that showed similar coverage efficiencies and specificity for anammox of Ignavibacteria and Anaerolinea classes are not yet completely un­ bacterial detection on in silico evaluation with SILVA test prime, as derstood, but based on transcriptional insights on interactions with recommended by various investigations (Table 3) [34,51,53]. Never­ anammox, they seem to be polymer-degrading, fermentative anaerobes, theless, our results showed that primer set 515F-909R did not cover and participates in the nitrogen removal supporting complete denitri­ most of the organisms from the Brocadiae class present in our reactors, fication [15,30]. Also, they could supply short-chain volatile fatty acids underrepresenting the anammox community despite the estimated in and alcohols to support other communities as Proteobacteria, due to silico coverage (96%). In a similar work developed by Chen et al. [8] their ability to hydrolysate extracellular compounds of anammox bac­ studying the community structure of a partial nitritation system, teria [2,22]. amplicon sequencing was performed with the primer set 515F-909R, but In this reactor, as primers 515F-909R did not detect Brocadiae class, Planctomycetes or anammox bacteria were not detected, although it was Ignavibacteria represented the main class (90%). For the other two not reported as an issue. This absence of Planctomycetes disagree with datasets based on 16S rRNA gene (approaches a and d), no major dif­ Zhao et al. [52] whose pointed out that anammox reaction occurred in ferences were observed between the relative abundances of the different Fig. 1. A) Relative abundance of identified classes of the microbial community in anammox reactors using four different molecular approaches. Classes whose relative abundance among all the techniques were less than 1% were grouped as “others”. B) Relative abundance of identified anammox bacteria at the genus level using five different molecular approaches. When classification at the genus level was not obtained, the previous taxonomic level was indicated as f (family) and o (order). 4 P. Oyarzúa et al. Journal of Environmental Chemical Engineering 9 (2021) 106622 Table 3 In silico primer coverage prediction for the primers used in this study restricted to de phylum Planctomycetes in SILVA Test Prime analysis (SSU Ref 138 NR). The numbers represent the percentage of sequences deposited in the database targeted with each primer sets. A heat map color code was used, red color means lower values while green color means higher values. classes belonging to the core microbiome mentioned above. curated 16S rRNA gene databases compared to genomic databases [44]. Important differences in the relative abundance at Brocadiae class The main differences in terms of relative abundance were obtained with were observed among techniques in the AM reactor, and nevertheless, in functional taxonomy when all approaches were compared. Meta­ the S1 reactor were in a similar range (3–11%). Differences between genomics approaches, on the contrary, avoids PCR biases [35] and have amplicon sequencing and metagenomic and even between the two resulted in a turning point in studying phylogenetic and functional di­ metagenomics approaches were obtained. This could be explained versity of wastewater treatment systems [14] since it reach a much because a common bias for all the techniques studied is the databases higher resolution of taxonomic annotation [34,44]. But, on the other limitations, although there are several high quality, comprehensive and hand, its limitations include a higher cost and bionformatics complexity Fig. 2. NMDS ordination using A) the class level relative abundance data of the whole microbial community; B) the genus level relative abundance data of detected anammox bacteria. Communities’ similarities are based on the Bray–Curtis index which includes the relative abundances on each approach. 5 P. Oyarzúa et al. Journal of Environmental Chemical Engineering 9 (2021) 106622 than PCR based methods [34]. reactor. As we previously mentioned, the primers 515F-909R did not To determine how the samples analyzed with different approaches detect anammox at any taxonomic level in the S1 reactor. The 16S rRNA were grouped, an NMDS analysis was performed. The samples from metagenomic approach detected mainly Ca. Brocadia and small abun­ amplicon sequencing using the primers 515F-909R were excluded from dances of Ca. Jettenia and/or Ca. Kuenenia in both reactors, neverthe­ the analysis as this primer set did not detect Brocadiae class in the S1 less, showed a low resolution at the genus level. A high proportion of the reactor samples. The results obtained using the relative abundance of sequences were classified at previous taxonomic levels as order and the different classes showed that the communities were grouped by family (41% and 40%, for AM and S1 reactors, respectively) (Table 4). reactor (S1 and AM) (Fig. 2A). The impact of the bias on the results was Ca. Brocadia was also the genus of anammox with the highest abun­ different for the two reactors treating different influents. Thus, major dance detected by functional taxonomy in both reactors. The NMDS difference between techniques were observed in AM reactor, where analysis (Fig. 2B) showed that S1 samples grouped together while for Anaerolineae class was underrepresented in the amplicon sequencing AM samples the communities retrieved by the two metagenomics compared to the metagenome in the AM reactor, but, on the contrary, approach were closer positioned and the communities obtained using Brocadiae class was overrepresented comparing with the metagenomic the 16 S rRNA approaches were identical for the two set of primers. approach (Table 4). These differences would be explained because About the anammox bacteria community on S1 reactor, the domi­ shotgun sequencing (metagenomics) has more power to identify less nant genus was Ca. Brocadia. This has been reported in several main­ abundant taxa than amplicon sequencing of the16S rRNA gene [13], stream studies [28,36,38]. Some studies on anammox WW treatment causing a shift in the relative abundance estimation of higher abundant technologies have reported that there would be a dominant genus of taxa determined by amplicon sequencing. In our study, the concordance anammox bacteria under specific growth conditions [24], so this will between the functional and amplicon taxonomic assignment in the S1 depend on the capacity to adapt to the mainstream wastewater [40]. reactor indicates that the last is a good method to visualize the func­ Functional taxonomy from metagenomes allowed obtaining a clas­ tional abilities of this reactor. sification at species level (Fig. 3). The predominant species of anammox bacteria in the reference reactor, AM, were Ca. Brocadia sinica and Ca. Brocadia fulgida (45% each). In the S1 reactor, Ca. Brocadia fulgida 3.2. Anammox bacteria community analysis (66%) and Ca. Brocadia caroliniensis (18%) had higher relative abun­ dance. These differences could be associated with the influent charac­ To specifically study the anammox community, a third set of primers teristics, including the concentration of nitrogen compounds and the was also used for amplicon sequencing (approach c). The primers presence of organic matter. According to Narita et al. (2017), [59] the Amx368F-Amx820R were designed to target anammox bacteria and differences in physiological characteristics among anammox bacteria have 93% of coverage for the Brocadiaceae family when checked with are one of the essential key factors to understand niche differentiation. SILVA test prime SSU138 RefNR database (Table 3). Anammox se­ As an example, Ca. Brocadia fulgida has been reported to be dominant quences from each approach (a, b, c, d and e) classified at the Brocadiae on different deammonification systems [29,33,50]. Interestingly, Win­ class were separately analyzed and relative abundances of anammox kler et al. [50], reported an accumulation of this specie in granular community at deeper taxonomic levels were determined. sludge once nitrite was omitted from the feed. Also, this species was Leaving aside amplicon sequencing data obtained with primers reported to consume some organic carbon forms such as propionate, 515F-909R which did not detect Planctomycetota in the S1 reactor, formate, and dimethylamine [56]. Nevertheless, until now there is not 100% of Brocadiales order was detected. At family level, all approaches consensus about the anammox species that predominated in mainstream detected mainly Brocadiaceae in the two samples. 1% of Scalinduaceae nitrogen removal processes [33]. was found in the AM reactor with functional taxonomy (Table 4). All Down genus level, all techniques cover the same/similar anammox other methods studied were consistent in the composition of the bacteria, but the 16S rRNA sequences extracted from the metagenome anammox community down to the family taxonomic level (phylum, approach lost resolution in the taxonomic assignment and on the con­ class, order, and family). Approximately 10% of the sequences from both trary, functional taxonomy of the metagenome had a better resolution reactors’ samples were not classified at the family level with the16S on assignment at the specie level. Nevertheless, considering that func­ rRNA metagenomic approach. tional taxonomy from metagenomes is a new approach, the obtained The classification at the genus level reveals that the anammox results would depend on database updates and completeness, and one community in both reactor samples correspond mainly to Ca. Brocadia shall take into account that genome annotations pipelines are nowadays genus (Fig. 1B). All the approaches showed similar detection abilities in on constant changes [11]. both reactors. The communities obtained by amplicon sequencing with the three primer sets showed no other genus than Ca. Brocadia in the AM reactor, while a low abundance of Ca. Kuenenia was detected in the S1 Table 4 Comparative table of the relative abundance obtained for the anammox microorganisms with the different approaches. AM S1 Approach 515F-806Ra 515F-909Rb Amx368F-Amx820Rc 16S rRNA metagenomed Functional metagenomee a b c d e Taxonomic classification Phylum Plancomycetota 79 1 100 40 18 11 0 100 5 11 Class Brocadiae 75 1 100 27 8 9 0 100 3 11 Order Brocadiales 100 100 100 100 100 100 0 100 100 100 Family Brocadiaceae 100 100 100 90 99 100 0 100 89 99 Genus Ca. Brocadia 99.8 100 100 55 95.4 99 0 99 56 98 Ca. Jettenia 0 0 0 3 2 0 0 0 0 0.4 Ca. Kuenenia 0.2 0 0 1 0.5 1 0 1 4 0.9 a amplicon sequencing with universal primers 515F-806R, b amplicon sequencing with universal primers 515F-909R and c amplicon sequencing with specific anammox primers Amx368F-Amx820R, d 16S rRNA sequences extracted from the metagenomic data, and e functional taxonomy assigned based on functional gene 6 P. Oyarzúa et al. Journal of Environmental Chemical Engineering 9 (2021) 106622 next ASVs in decreasing abundance order (12% in Fig. 4A and 17% in Fig. 4B) were bunched in the same clade as the environmental clone Pla PO55–3 sequence (GQ356105), and the sequence from the recently described “Candidatus” Brocadia pituitae [41]. On the other side, Cluster B involved the dominant ASVs of the AM sample (100%) which were also present in the S1 sample (relative abundance of 8% in Figs. 4A and 4B). These ASVs and two sequences retrieved from the metagenome (Full length AM metagenome 2 and 3) were bunched in a clade, close but in a different branch to the environmental clone ZMP-3 sequence (GQ175287) and distant to the reference’s sequences of Ca. Brocadia sinica, Ca. Brocadia anammoxidans and Ca. Brocadia brasiliensis. Clusters C, D, E and F grouped sequences from other anammox genera: Ca. Kuenenia, Ca. Anammoxoglobus, Ca. Jettenia and Ca. Scalindua respectively. From these clusters, only in cluster C, sequences from ASVs (1% of relative abundance) and from the genome were positioned. As expected by the low coverage of this primer set, the sequences obtained with the primers 515F-909R detected only one ASV positioned in cluster B for the AM sample (Fig. 4C). From this phylogenetic analysis, we were struck by the fact that the sequences from the entire anammox population of our reference reactor (AM) and, also detected in the S1 reactor (8% of relative abundance), were positioned into a clade that is not directly associated with any previously described species. According to Whitman (2016), sequence of genomic DNA may also serve as the type of material that unambiguously identifies the species. Herein, we propose a new anaerobic ammonium oxidation (anammox) bacterium, namely “Candidatus” Brocadia barci­ nensis. Representative sequences were submitted to GeneBank with Fig. 3. Relative abundance of identified anammox bacteria at the specie level accession numbers: MZ242076 and MZ242077. This result was prelim­ using functional genes approach from metagenomes. Contigs with abundance inarily confirmed using the genomic centric approach from metagenome below 1% were grouped as “Others”. Results presented as “s” (specie) are not [43]. associated to a known “Candidatus” specie. 3.4. 16S rRNA and functional genes quantification by qPCR 3.3. Phylogeny of anammox microorganisms predominant in the samples To specifically quantify our target population, qPCR was performed A phylogenetic analysis was performed to elucidate the relationship targeting two functional genes: hszA and nirS. Moreover, a specific 16S between the anammox sequences obtained by the different 16S rRNA- rRNA primer set targeting all the anammox 16S rRNA genes was based approaches and the complete 16S rRNA genes retrieved from included in the analysis and first checked on a good performance in silico the metagenome without any primers bias. For the amplicon sequence (see primer coverage in Table 3) and in practical test according to analysis, the sequences were grouped in ASVs (sequences with 100% different authors [51,53]. In order to compare the values from the similarity). As different regions were targeted by the different primer different reactors a boxplot was constructed, and statistical analysis was sets, three phylogenetic trees were constructed, one for each primer set performed (Fig. 5). The results showed that 16S rRNA gene copies were (Fig. 4). Comparing the phylogenetic trees, coherence between all ap­ significantly different for both reactors with higher values for the S1 proaches in the phylogenetic analysis was observed. Most abundant reactor. In the enriched anammox reactor treating synthetic influent, ASVs retrieved with the different amplicon sequencing approaches with values of 1.04 × 106- 1.17 × 106 gene copies ng− 1 DNA of the 16S the specific set of primers (AMX368F-AMX820R, approach c) and with rRNA-amx gen were obtained. In the anammox reactor treating urban the universal primers (515F-806R, approach b), always cluster in the wastewater at mainstream conditions, values ranging from 2.32 × 105 same branch with a sequence retrieved by the metagenomics approach. to 2.58 × 105 gene copies ng− 1 DNA of the 16S rRNA-amx gen were Some ASVs sequences retrieved with the specific primers did not obtained. There were no statistically significant differences between the cluster with any of the sequences retrieved from the metagenomic anammox marker genes (16S rRNA-amx and hzsA) in both reactors. approach. Due to the low coverage of the set of primers (515F-909R) Comparing both reactors, a lower abundance of 16S rRNA-amx was only one ASV was retrieved which cluster with a sequence from the obtained in S1. Consistency in the anammox community quantification metagenomic approach. of either 16S-amx gene and hzsA gene on both reactors showed that Most of the ASV sequences were positioned in two clusters (A and B) these primers are a good choice for estimating our target and serve as a within the Ca. Brocadia genus. On one side, Cluster A grouped the most guide to further works that use anammox biomass for treating main­ abundant ASVs of the S1 sample with Ca. Brocadia fulgida reference stream MWW. Regarding nirS gene, a low quantification was obtained in sequences (around 70% of relative abundance of ASVs retrieved with both reactors compared to the other studied genes. Also, a statistically approaches b and c) and with two sequences retrieved from the meta­ different quantification between both reactors was obtained, being genome (Full length AM metagenome 1 and Full length S1 metagenome lower in the AM reactor. Han et al. [17] showed that for a sample of 1). The dominant anammox in the S1 reactor was Ca. Brocadia fulgida. WWTP, nirS primer set presented 100% efficiency, though, it was able to Anammox communities dominated by this specie have been reported in detect a large portion of denitrifiers. Other works evaluating this gene, a variety of studies on mainstream effluent treated by anammox and PN/ showed that it was absent in some genomes of Ca. Brocadia [60], A processes, though, it was mainly detected by other methods [28,30, therefore, it is not available for the detection and quantitative analysis of 36]. So, to the authors’ knowledge, there is a lack of DNA sequencing this genus [51], which is the main genus detected in our reactors. data available about the anammox “Candidatus” species present in Beyond the target gene, it is important to understand that the primers mainstream anammox which allows a comparison of our results. The influence the PCR based methods for relative quantification (as we have shown on amplicon sequence analysis) and for absolute quantification 7 P. Oyarzúa et al. Journal of Environmental Chemical Engineering 9 (2021) 106622 Fig. 4. Phylogenetic Maximum Likelihood trees based on 16S rRNA gene sequences from amplicon sequencing with primer set Amx368F-Amx820R (A), 515F-806R (B) and 515F-909R (C). ASVs of this study and full-length sequences of 16S rRNA gene reconstructed from metagenomes are shown in colors for each reactor. The relative abundance of each ASV is shown in parentheses. Accession numbers of the reference sequences and environmental clones of anammox bacteria are shown in parentheses. Bootstrap values (greater than or equal to 70%) based on 500 replications are shown at branch nodes. Pirellula staleyi was used as an outgroup for rooting trees. Bar indicates 0.01 substitutions per site. [42,51]. Besides, the differences between in silico and practical appli­ 4. Conclusions cation have been proved, which is why we pointed out that standardi­ zation is required in this field, before conducting more in-depth This work serves as a basis for studying the microbial ecology and analyzes, such as changes in communities over time. relationships in anammox reactors working at mainstream conditions. In addition to the primer bias, it is difficult to compare our results Thus, based on our previous analysis we are able to recommend with similar studies. This, because in general, the results are reported as amplicon sequencing with primer set 515F-806R if the research wants to the relative abundance of certain microbial groups (i. e., AOB, NOB, determine anammox microorganisms. However, if the focus is on the others) normalized to the abundance of total bacteria. Considering the anammox community relationships, a combination of amplicon variability of the copy numbers of 16S rRNA gen per genome in bacteria sequencing with specific primers and qPCR, targeting 16S rRNA or hzsA [25], the estimated population from the 16S rRNA gene qPCR results genes, would be more reliable. Both approaches allowed a comparison have a tendency to differ from the true number of target populations. As to determine the community dynamics. Metagenomics approaches have an example, normalizing our data with the gene’s copies of total bacteria also solved this goal but are more expensive to use for that purpose, but, a 13% and 0.3% of anammox bacteria abundance was obtained to the with the drastic decrease in sequencing costs this approach will be used AM and S1 reactor, respectively. Thus, clearly underestimate the rela­ in a near future. tives’ abundances of anammox bacteria in the anammox enriched cul­ ture (AM reactor). Also, the results should not be compared with other CRediT authorship contribution statement works, unless the same primers are used [42]. Furthermore, when the results have been reported as absolute quantification, since there is no P. Oyarzúa: Conceptualization, Methodology, Validation, Formal consensus on the normalization of the data, they have been expressed as analysis, Investigation, Writing – original draft. P. Bovio-Winkler: a function of the sample volume [42,49], ng of DNA [32]; this study), g Methodology, Validation, Formal analysis, Writing – review & editing. of dry weight [17], among others. C. Etchebehere: Conceptualization, Resources, Writing – review & 8 P. Oyarzúa et al. Journal of Environmental Chemical Engineering 9 (2021) 106622 [5] S. Campanaro, L. Treu, P.G. Kougias, X. Zhu, Taxonomy of anaerobic digestion microbiome reveals biases associated with the applied high throughput sequencing strategies, Sci. Rep. (2018) 1–12, https://doi.org/10.1038/s41598-018-20414-0. [6] A.W.Y. Chan, J. Naphtali, H.E. Schellhorn, High-throughput DNA sequencing technologies for water and wastewater analysis, Sci. Prog. 102 (2019) 351–376, https://doi.org/10.1177/0036850419881855. [7] H. Chen, T. Liu, J. Li, L. Mao, J. Ye, X. Han, M.S.M. Jetten, J. Guo, Larger anammox granules not only harbor higher species diversity but also support more functional diversity, Environ. Sci. Technol. 54 (2020) 14664–14673, https://doi.org/ 10.1021/acs.est.0c02609. [8] J. Chen, Y. Lu, Z. Ouyang, J. Zhang, Regulation of partial nitritation in constructed rapid infiltration system and analysis of microbial community structure, Pol. J. Environ. Stud. 29 (2019) 33–43, https://doi.org/10.15244/pjoes/99908. [9] S. Cho, C. Kambey, V.K. Nguyen, Performance of anammox processes for wastewater treatment: a critical review on effects of operational conditions and environmental stresses, Water (2020) 12, https://doi.org/10.3390/w12010020. [10] Z. rui Chu, K. Wang, X. kun Li, M. ting Zhu, L. Yang, J. Zhang, Microbial characterization of aggregates within a one-stage nitritation-anammox system using high-throughput amplicon sequencing, Chem. Eng. J. 262 (2015) 41–48, https://doi.org/10.1016/j.cej.2014.09.067. [11] X. Dong, M. Strous, An integrated pipeline for annotation and visualization of metagenomic contigs, Front. Genet. 10 (2019) 1–10, https://doi.org/10.3389/ fgene.2019.00999. [12] R. Du, S. Cao, H. Zhang, X. Li, Y. Peng, Flexible nitrite supply alternative for mainstream anammox: advances in enhancing process stability, Environ. Sci. Technol. 54 (2020) 6353–6364, https://doi.org/10.1021/acs.est.9b06265. [13] F. Durazzi, C. Sala, G. Castellani, G. Manfreda, D. Remondini, A.De Cesare, Comparison between 16S rRNA and shotgun sequencing data for the taxonomic characterization of the gut microbiota, Sci. Rep. (2021) 1–10, https://doi.org/ 10.1038/s41598-021-82726-y. [14] I. Ferrera, O. Sánchez, Insights into microbial diversity in wastewater treatment systems: how far have we come? Biotechnol. Adv. 34 (2016) 790–802, https://doi. Fig. 5. Boxplot of absolute quantification of bacterial genes in anammox re­ org/10.1016/j.biotechadv.2016.04.003. actors by qPCR. 16S rRNA gene for total bacteria, 16S rRNA-amx for anammox [15] G. Gonzalez-Gil, R. Sougrat, A.R. Behzad, P.N.L. Lens, P.E. Saikaly, Microbial bacteria, and functional genes hzsA and nirS were quantified. A logarithmic community composition and ultrastructure of granules from a full-scale anammox scale was chosen for the y-axis. The X on each box represents the mean value reactor, Microb. Ecol. 70 (2015) 118–131, https://doi.org/10.1007/s00248-014- from triplicate qPCR reactions. The error bars stand for the standard deviations. 0546-7. [16] M. Hall, R.G. Beiko, 2018. Chapter 8 1849, 113–129. Means with one letter in common are not significantly different (p > 0.05). [17] P. Han, U. Klümper, A. Wong, M. Li, J.G. Lin, Z. Quan, M. Denecke, J.D. Gu, Assessment of molecular detection of anaerobic ammonium-oxidizing (anammox) editing, Supervision. M.E. Suárez-Ojeda: Conceptualization, Resources, bacteria in different environmental samples using PCR primers based on 16S rRNA and functional genes, Appl. Microbiol. Biotechnol. 101 (2017) 7689–7702, https:// Writing – review & editing, Funding acquisition, Supervision. doi.org/10.1007/s00253-017-8502-3. [18] H.R. Harhangi, M. Le Roy, T. van Alen, B. lan Hu, J. Groen, B. Kartal, S.G. Tringe, Declaration of Competing Interest Z.X. Quan, M.S.M. Jetten, H.J.M. Op den Camp, Hydrazine synthase, a unique phylomarker with which to study the presence and biodiversity of anammox bacteria, Appl. Environ. Microbiol. 78 (2012) 752–758, https://doi.org/10.1128/ The authors declare that they have no known competing financial AEM.07113-11. interests or personal relationships that could have appeared to influence [19] A. Henriques, T. Cereija, A. MacHado, N. Cerca, In silico vs in vitro analysis of primer specificity for the detection of Gardnerella vaginalis, Atopobium vaginae the work reported in this paper. and Lactobacillus spp, BMC Res. Notes 5 (2012) 2–5, https://doi.org/10.1186/ 1756-0500-5-637. Acknowledgments [20] B. lan Hu, P. Zheng, C. jian Tang, J. wei Chen, E. van der Biezen, L. Zhang, B. jie Ni, M.S.M. Jetten, J. Yan, H.Q. Yu, B. Kartal, Identification and quantification of anammox bacteria in eight nitrogen removal reactors, Water Res. 44 (2010) This work was funded by Spanish Ministry of Economy and 5014–5020, https://doi.org/10.1016/j.watres.2010.07.021. Competitiveness: “HIPATIA: Towards the implementation of the concept [21] E. Isanta, T. Bezerra, I. Fernández, M.E. Suárez-Ojeda, J. Pérez, J. Carrera, of biorefinery and energy self-sustainability in an urban wastewater Microbial community shifts on an anammox reactor after a temperature shock using 454-pyrosequencing analysis, Bioresour. Technol. 181 (2015) 207–213, treatment plant” (CTQ2017-82404-R). P. Oyarzúa is funded by the Na­ https://doi.org/10.1016/j.biortech.2015.01.064. tional Agency for Research and Development (ANID) / Scholarship [22] X. Juan-Díaz, P. Julio, J. Carrera, Effective dampening of temperature effects in an Program / DOCTORADO BECAS CHILE/2017- 72180362. C. Etch­ anammox reactor treating real mainstream wastewater, J. Water Process Eng. (2020), https://doi.org/10.1016/j.jwpe.2020.101853. ebehere and P. Bovio-Winkler are funded by SNI-ANII. P. Bovio-Winkler [23] P. Junier, V. Molina, C. Dorador, O. Hadas, O.S. Kim, T. Junier, K.P. Witzel, J. is also funded by CAP-CSIC. F. Imhoff, Phylogenetic and functional marker genes to study ammonia-oxidizing microorganisms (AOM) in the environment, Appl. Microbiol. Biotechnol. 85 (2010) 425–440, https://doi.org/10.1007/s00253-009-2228-9. References [24] B. Kartal, L. Van Niftrik, J. Rattray, J.L.C.M.C.M. Van De Vossenberg, M.C. Schmid, J. Sinninghe Damsté, M.S.M.M. Jetten, M. Strous, Candidatus “Brocadia fulgida”: [1] J. Bengtsson-Palme, M. Hartmann, K.M. Eriksson, C. Pal, K. Thorell, D.G.J. Larsson, an autofluorescent anaerobic ammonium oxidizing bacterium, FEMS Microbiol. R.H. Nilsson, metaxa2: improved identification and taxonomic classification of Ecol. 63 (2008) 46–55, https://doi.org/10.1111/j.1574-6941.2007.00408.x. small and large subunit rRNA in metagenomic data, Mol. Ecol. Resour. 15 (2015) [25] J.A. Klappenbach, P.R. Saxman, J.R. Cole, T.M. Schmidt, Rrndb: the ribosomal 1403–1414, https://doi.org/10.1111/1755-0998.12399. RNA operon copy number database, Nucleic Acids Res 29 (2001) 181–184, https:// [2] A.S. Bhattacharjee, S. Wu, C.E. Lawson, M.S.M. Jetten, V. Kapoor, J.W.S. Domingo, doi.org/10.1093/nar/29.1.181. K.D. McMahon, D.R. Noguera, R. Goel, Whole-community metagenomics in two [26] A. Klindworth, E. Pruesse, T. Schweer, J. Peplies, C. Quast, M. Horn, F.O. Glöckner, different anammox configurations: process performance and community structure, Evaluation of general 16S ribosomal RNA gene PCR primers for classical and next- Environ. Sci. Technol. 51 (2017) 4317–4327, https://doi.org/10.1021/acs. generation sequencing-based diversity studies, Nucleic Acids Res. 41 (2013) 1–11, est.6b05855. https://doi.org/10.1093/nar/gks808. [3] A.M. Bolger, M. Lohse, B. Usadel, Trimmomatic: a flexible trimmer for Illumina [27] S. Kumar, G. Stecher, K. Tamura, MEGA7: molecular evolutionary genetics analysis sequence data, Bioinformatics 30 (2014) 2114–2120, https://doi.org/10.1093/ version 7.0 for bigger datasets, Mol. Biol. Evol. 33 (2016) 1870–1874, https://doi. bioinformatics/btu170. org/10.1093/molbev/msw054. [4] B.J. Callahan, P.J. Mcmurdie, M.J. Rosen, A.W. Han, A.J.A. Johnson, S.P. Holmes, [28] M. Laureni, P. Falås, O. Robin, A. Wick, D.G. Weissbrodt, J.L. Nielsen, T.A. Ternes, DADA2: high-resolution sample inference from Illumina amplicon data, Nat. E. Morgenroth, A. Joss, Mainstream partial nitritation and anammox: long-term Methods (2016) 13, https://doi.org/10.1038/nmeth.3869. process stability and effluent quality at low temperatures, Water Res. 101 (2016) 628–639, https://doi.org/10.1016/j.watres.2016.05.005. 9 P. Oyarzúa et al. Journal of Environmental Chemical Engineering 9 (2021) 106622 [29] M. Laureni, D.G. Weissbrodt, I. Szivák, O. Robin, J.L. Nielsen, E. Morgenroth, phylogeny and in situ detection, Environ. Microbiol. 3 (2001) 450–459, https:// A. Joss, I. Sziv, O. Robin, J. Lund, E. Morgenroth, A. Joss, ScienceDirect activity doi.org/10.1046/j.1462-2920.2001.00211.x. and growth of anammox biomass on aerobically pre-treated municipal wastewater, [48] M. Strous, J.J. Heijnen, J.G. Kuenen, M.S.M. Jetten, The sequencing batch reactor Water Res. 0 (2015) 325–336, https://doi.org/10.1016/j.watres.2015.04.026. as a powerful tool for the study of slowly growing anaerobic ammonium-oxidizing [30] C.E. Lawson, S. Wu, A.S. Bhattacharjee, J.J. Hamilton, K.D. McMahon, R. Goel, D. microorganisms, Appl. Environ. Microbiol. 50 (1998) 589–596, https://doi.org/ R. Noguera, Metabolic network analysis reveals microbial community interactions 10.1007/s002530051340. in anammox granules, Nat. Commun. 8 (2017) 1–12, https://doi.org/10.1038/ [49] Z. Wang, S.Q. bin, Ni, J. Zhang, T. Zhu, Y. guang Ma, X. lin Liu, Q. Kong, M. ncomms15416. sheng Miao, Gene expression and biomarker discovery of anammox bacteria in [31] D. Li, C.M. Liu, R. Luo, K. Sadakane, T.W. Lam, MEGAHIT: An ultra-fast single-node different reactors, Biochem. Eng. J. 115 (2016) 108–114, https://doi.org/10.1016/ solution for large and complex metagenomics assembly via succinct de Bruijn j.bej.2016.09.002. graph, Bioinformatics 31 (2015) 1674–1676, https://doi.org/10.1093/ [50] M.K.H. Winkler, R. Kleerebezem, M.C.M. Van Loosdrecht, Integration of anammox bioinformatics/btv033. into the aerobic granular sludge process for main stream wastewater treatment at [32] X.R. Li, B. Du, H.X. Fu, R.F. Wang, J.H. Shi, Y. Wang, M.S.M. Jetten, Z.X. Quan, The ambient temperatures, Water Res. 46 (2012) 136–144, https://doi.org/10.1016/j. bacterial diversity in an anaerobic ammonium-oxidizing (anammox) reactor watres.2011.10.034. community, Syst. Appl. Microbiol. 32 (2009) 278–289, https://doi.org/10.1016/j. [51] Y. Yang, M. Li, H. Li, X.Y. Li, J.G. Lin, M. Denecke, J.D. Gu, Specific and effective syapm.2009.03.002. detection of anammox bacteria using PCR primers targeting the 16S rRNA gene and [33] W. Liu, X. Ji, J. Wang, D. Yang, Y. Shen, C. Chen, F. Qian, P. Wu, Microbial functional genes, Sci. Total Environ. (2020), https://doi.org/10.1016/j. community response to influent shift and lowering temperature in a two-stage scitotenv.2020.139387. mainstream deammonification process, Bioresour. Technol. 262 (2018) 132–140, [52] Z. Zhao, J. Luo, B. Jin, J. Zhang, B. Li, B. Ma, X. An, S. Zhang, B. Shan, Analysis of https://doi.org/10.1016/j.biortech.2018.04.082. bacterial communities in partial nitritation and conventional nitrification systems [34] Y.X. Liu, Y. Qin, T. Chen, M. Lu, X. Qian, X. Guo, Y. Bai, A practical guide to for nitrogen removal, Sci. Rep. 8 (2018) 1–9, https://doi.org/10.1038/s41598- amplicon and metagenomic analysis of microbiome data, Protein Cell (2020), 018-30532-4. https://doi.org/10.1007/s13238-020-00724-8. [53] Z. Zhou, Q. Wei, Y. Yang, M. Li, J.D. Gu, Practical applications of PCR primers in [35] R. Logares, S. Sunagawa, G. Salazar, F.M. Cornejo-Castillo, I. Ferrera, H. Sarmento, detection of anammox bacteria effectively from different types of samples, Appl. P. Hingamp, H. Ogata, C. de Vargas, G. Lima-Mendez, J. Raes, J. Poulain, Microbiol. Biotechnol. 102 (2018) 5859–5871, https://doi.org/10.1007/s00253- O. Jaillon, P. Wincker, S. Kandels-Lewis, E. Karsenti, P. Bork, S.G. Acinas, 018-9078-2. Metagenomic 16S rDNA Illumina tags are a powerful alternative to amplicon [54] S. Cao, A. Oehmen, Y. Zhou, Denitrifiers in Mainstream Anammox Processes: sequencing to explore diversity and structure of microbial communities, Environ. Competitors or Supporters? Environ. Sci. Technol. 53 (2019) 11063–11065, Microbiol. 16 (2014) 2659–2671, https://doi.org/10.1111/1462-2920.12250. https://doi.org/10.1021/acs.est.9b05013. [36] T. Lotti, R. Kleerebezem, Z. Hu, B. Kartal, M.K. De Kreuk, C. Van Erp Taalman Kip, [55] J.G. Caporaso, C.L. Lauber, W.A. Walters, D. Berg-Lyons, J. Huntley, N. Fierer, S. J. Kruit, T.L.G. Hendrickx, M.C.M. Van Loosdrecht, Pilot-scale evaluation of M. Owens, J. Betley, L. Fraser, M. Bauer, N. Gormley, J.A. Gilbert, G. Smith, anammox-based mainstream nitrogen removal from municipal wastewater, R. Knight, Ultra-high-throughput microbial community analysis on the Illumina Environ. Technol. 36 (2015) 1167–1177, https://doi.org/10.1080/ HiSeq and MiSeq platforms, ISME J. 6 (2012) 1621–1624, https://doi.org/ 09593330.2014.982722. 10.1038/ismej.2012.8. [37] A.V. Mardanov, A.V. Beletsky, N.V. Ravin, E.A. Botchkova, Y.V. Litti, A. [56] S. Cho, C. Kambey, V.K. Nguyen, Performance of anammox processes for N. Nozhevnikova, Genome of a novel bacterium “candidatus jettenia ecosi” wastewater treatment: Acritical review on effects of operational conditions and reconstructed from the metagenome of an anammox bioreactor, Front. Microbiol. environmental stresses, Water (Switzerland) 12 (2020), https://doi.org/10.3390/ 10 (2019) 1–12, https://doi.org/10.3389/fmicb.2019.02442. w12010020. [38] Y. Miao, J. Zhang, Y. Peng, S. Wang, An improved start-up strategy for mainstream [57] A.Z. Gu, P.B. Pedros, A. Kristiansen, A. Onnis-Hayden, A. Schramm, Nitrifying anammox process through inoculating ordinary nitrification sludge and a small Community Analysis in a Single Submerged Attached-Growth Bioreactor for amount of anammox sludge, J. Hazard. Mater. 384 (2020), 121325, https://doi. Treatment of High-Ammonia Waste Stream, Water Environ. Res. 79 (2007) org/10.1016/j.jhazmat.2019.121325. 2510–2518, https://doi.org/10.2175/106143007x254566. [39] C.S. Miller, B.J. Baker, B.C. Thomas, S.W. Singer, J.F. Banfield, EMIRGE: [58] M. Li, T. Ford, X. Li, J.D. Gu, Cytochrome cd1-containing nitrite reductase reconstruction of full-length ribosomal genes from microbial community short read encoding gene nirS as a new functional biomarker for detection of anaerobic sequencing data, Genome Biol. (2011) 12, https://doi.org/10.1186/gb-2011-12-5- ammonium oxidizing (anammox) bacteria, Environ. Sci. Technol. 45 (2011) r44. 3547–3553, https://doi.org/10.1021/es103826w. [40] A. Nejidat, D. Diaz-Reck, N. Massalha, A. Arbiv, A. Dawas, C. Dosoretz, I. Sabbah, [59] Y. Narita, L. Zhang, Z. Kimura, M. Ali, T. Fujii, S. Okabe, Enrichment and Abundance and diversity of anammox bacteria in a mainstream municipal physiological characterization of an anaerobic ammonium-oxidizing bacterium wastewater treatment plant, Appl. Microbiol. Biotechnol. 102 (2018) 6713–6723, ‘Candidatus Brocadia sapporoensis’, Syst. Appl. Microbiol. 40 (2017) 448–457, https://doi.org/10.1007/s00253-018-9126-y. https://doi.org/10.1016/j.syapm.2017.07.004. [41] T. Okubo, A. Toyoda, K. Fukuhara, I. Uchiyama, Y. Harigaya, M. Kuroiwa, [60] M. Oshiki, M. Ali, K. Shinyako-Hata, H. Satoh, S. Okabe, Hydroxylamine- T. Suzuki, Y. Murakami, Y. Suwa, H. Takami, The physiological potential of dependent anaerobic ammonium oxidation (anammox) by “Candidatus Brocadia anammox bacteria as revealed by their core genome structure, DNA Res 28 (2021) sinica”, Environ. Microbiol. 18 (2016) 3133–3143, https://doi.org/10.1111/1462- 1–12, https://doi.org/10.1093/dnares/dsaa028. 2920.13355. [42] L. Orschler, S. Agrawal, S. Lackner, On resolving ambiguities in microbial [61] S. Stubner, Enumeration of 16S rDNA of Desulfotomaculum lineage 1 in rice field community analysis of partial nitritation anammox reactors, Sci. Rep. 9 (2019) soil by real-time PCR with SybrGreenTM detection, J. Microbiol. Methods 50 1–10, https://doi.org/10.1038/s41598-019-42882-8. (2002) 155–164, https://doi.org/10.1016/S0167-7012(02)00024-6. [43] P. Oyarzúa, P. Bovio-Winkler, C. Etchebehere, M.E. Suárez-Ojeda, 2021. Metabolic [62] H.P. Trinh, S.-H. Lee, G. Jeong, H. Yoon, H.-D. Park, Recent developments of the potential of metagenome-assembled genomes (MAGs) in two anammox reactors mainstream anammox processes: Challenges and opportunities, J. Environ. Chem. working at different operating conditions. In preparation. Eng. 9 (2021), 105583, https://doi.org/10.1016/j.jece.2021.105583. [44] R. Poretsky, L.M. Rodriguez-R, C. Luo, D. Tsementzi, K.T. Konstantinidis, Strengths [63] I. Tsushima, Y. Ogasawara, T. Kindaichi, H. Satoh, S. Okabe, Development of high- and limitations of 16S rRNA gene amplicon sequencing in revealing temporal rate anaerobic ammonium-oxidizing (anammox) biofilm reactors, Water Res. 41 microbial community dynamics, PLoS One (2014) 9, https://doi.org/10.1371/ (2007) 1623–1634, https://doi.org/10.1016/j.watres.2007.01.050. journal.pone.0093827. [64] N.N. Tuan, Y.C. Chang, C.P. Yu, S.L. Huang, Multiple approaches to characterize [45] E. Pruesse, J. Peplies, F.O. Glöckner, SINA: accurate high-throughput multiple the microbial community in a thermophilic anaerobic digester running on swine sequence alignment of ribosomal RNA genes, Bioinformatics 28 (2012) manure: A case study, Microbiol. Res. 169 (2014) 717–724, https://doi.org/ 1823–1829, https://doi.org/10.1093/bioinformatics/bts252. 10.1016/j.micres.2014.02.003. [46] C. Reino, M.E. Suárez-Ojeda, J. Pérez, J. Carrera, Stable long-term operation of an [65] P. Yarza, P. Yilmaz, E. Pruesse, F.O. Glöckner, W. Ludwig, K.-H. Schleifer, W. upflow anammox sludge bed reactor at mainstream conditions, Water Res. 128 B. Whitman, J. Euzéby, R. Amann, R. Rosselló-Móra, Uniting the classification of (2018) 331–340, https://doi.org/10.1016/j.watres.2017.10.058. cultured and uncultured bacteria and archaea using 16S rRNA gene sequences, Nat. [47] M. Schmid, S. Schmitz-Esser, M. Jetten, M. Wagner, 16S–23S rDNA intergenic spacer Rev. Microbiol. 12 (2014) 635–645, https://doi.org/10.1038/nrmicro3330. and 23S rDNA of anaerobic ammonium-oxidizing bacteria: Implications for 10