ORIGINAL RESEARCH published: 31 December 2021 doi: 10.3389/fcell.2021.747667 TUNAR lncRNA Encodes a Microprotein that Regulates Neural Differentiation and Neurite Formation by Modulating Calcium Dynamics Elena Senís 1, Miriam Esgleas 2, Sonia Najas 2, Verónica Jiménez-Sábado 3, Camilla Bertani 1, Marta Giménez-Alejandre 1, Alba Escriche 1, Jorge Ruiz-Orera 4, Marta Hergueta-Redondo 5, Mireia Jiménez 1, Albert Giralt 6, Paolo Nuciforo 7, M. Mar Albà 8,9, Héctor Peinado 5, Daniel del Toro 6, Leif Hove-Madsen 3, Magdalena Götz 2 and María Abad 1* 1 Edited by: Cellular Plasticity and Cancer Group, Vall d’Hebron Institute of Oncology (VHIO), Barcelona, Spain, 2Physiological Genomics, Wanting Liu, Biomedical Center (BMC), Helmholtz Center Munich, Institute of Stem Cell Research, Großhaderner Str, SyNergy Excellence Jinan University, China Cluster, Ludwig-Maximilians-Universitaet (LMU), Munich, Germany, 3Instituto de Investigación Biomédica Barcelona (IIBB-CSIC), Instituto de Investigación Biomédica Sant Pau (IIB-Sant Pau) and CIBERCV, Barcelona, Spain, 4Cardiovascular and Metabolic Reviewed by: Sciences, Max Delbrück Center for Molecular Medicine in the Helmholtz Association (MDC), Berlin, Germany, 5Microenvironment Igor Ulitsky, and Metastasis Laboratory, Molecular Oncology Programme, Spanish National Cancer Research Center (CNIO), Madrid, Spain, Weizmann Institute of Science, Israel 6 Department of Biological Sciences, Institute of Neurosciences, IDIBAPS, CIBERNED, University of Barcelona, Barcelona, Spain, Geraldine Zimmer-Bensch, 7 Molecular Oncology Group, Vall d’Hebron Institute of Oncology (VHIO), Barcelona, Spain, 8Evolutionary Genomics Group, RWTH Aachen University, Germany Research Programme on Biomedical Informatics, Hospital del Mar Medical Research Institute (IMIM) and Universitat Pompeu Atsushi P. Kimura, Fabra (UPF), Barcelona, Spain, 9Catalan Institution for Research and Advanced Studies (ICREA), Barcelona, Spain Hokkaido University, Japan *Correspondence: Long noncoding RNAs (lncRNAs) are regulatory molecules which have been traditionally María Abad mabad@vhio.net considered as “non-coding”. Strikingly, recent evidence has demonstrated that many non- coding regions, including lncRNAs, do in fact contain small-open reading frames that code Specialty section: for small proteins that have been called microproteins. Only a few of them have been This article was submitted to Signaling, characterized so far, but they display key functions in a wide variety of cellular processes. a section of the journal Here, we show that TUNAR lncRNA encodes an evolutionarily conserved microprotein Frontiers in Cell and Developmental expressed in the nervous system that we have named pTUNAR. pTUNAR deficiency in Biology mouse embryonic stem cells improves their differentiation potential towards neural lineage Received: 26 July 2021 Accepted: 03 November 2021 both in vitro and in vivo. Conversely, pTUNAR overexpression impairs neuronal Published: 31 December 2021 differentiation by reduced neurite formation in different model systems. At the Citation: subcellular level, pTUNAR is a transmembrane protein that localizes in the Senís E, Esgleas M, Najas S, Jiménez-Sábado V, Bertani C, endoplasmic reticulum and interacts with the calcium transporter SERCA2. pTUNAR Giménez-Alejandre M, Escriche A, overexpression reduces cytoplasmatic calcium, consistent with a possible role of pTUNAR Ruiz-Orera J, Hergueta-Redondo M, as an activator of SERCA2. Altogether, our results suggest that our newly discovered Jiménez M, Giralt A, Nuciforo P, Albà MM, Peinado H, Toro Dd, microprotein has an important role in neural differentiation and neurite formation through Hove-Madsen L, Götz M and Abad M the regulation of intracellular calcium. From a more general point of view, our results (2021) TUNAR lncRNA Encodes a Microprotein that Regulates Neural provide a proof of concept of the role of lncRNAs-encoded microproteins in neural Differentiation and Neurite Formation differentiation. by Modulating Calcium Dynamics. Front. Cell Dev. Biol. 9:747667. Keywords: microproteins, micropeptides, sORF encoded peptides, TUNAR, neural differentiation, neurite formation, doi: 10.3389/fcell.2021.747667 calcium, long non-coding RNAs Frontiers in Cell and Developmental Biology | www.frontiersin.org 1 December 2021 | Volume 9 | Article 747667 Senís et al. pTUNAR Microprotein Regulates Neural Differentiation INTRODUCTION exchange between the ER and the cytosol. Our findings underscore the importance of the microproteome as a source Long noncoding RNAs (lncRNAs) are RNA molecules of more of previously undescribed regulators of neural differentiation. than 200 nucleotides with diverse regulatory roles, which have been long assumed to not code for proteins. However, recent findings indicate that some lncRNAs and other assumed non- MATERIALS AND METHODS coding regions, such as microRNA precursors, introns and untranslated regions (UTRs) of coding transcripts actually General Cell Culture contain small-open reading frames (sORFs) that are translated HEK293T and NIH3T3 cells were cultured in DMEM with into bioactive small proteins (Makarewich and Olson 2017; Orr GlutaMAX supplemented with 10% of fetal bovine serum et al., 2020; Peeters and Menschaert 2020). These sORFs have (FBS) and 1% of Penicillin-Streptomycin (P/S) (Gibco). been long ignored mainly due to an arbitrary cut-off of 300 Neuro-2a (N2A) (ACC 148, German Collection of nucleotides set by ORF prediction algorithms. Therefore, proteins Microorganisms and Cell Cultures) cells media was further smaller than 100 amino acids have been systematically supplemented with non-essential aminoacids (NEAA). Mouse overlooked. The advances in ribosome profiling and embryonic stem cells (mESCs) v6.4 were cultured in DMEM proteomics have allowed the discovery and characterization of GlutaMax supplemented with 1% Sodium Pyruvate (Invitrogen), a wide variety of small proteins of less than 100 amino acids in 15% FBS, 50 mM ß-mercaptoethanol, 1% NEAA (Invitrogen), 1% length that have been called microproteins, micropeptides or P/S and 1000 U/ml LIF (ESGRO, Chemicon). SEPs (sORF-encoded peptides) (Merino-Valverde et al., 2020). Microproteins have been shown to play key functions in a In vitro Differentiation Experiments plethora of cellular processes, spanning calcium dynamics Embryoid Bodies Differentiation (Anderson et al., 2016), mRNA turnover (D’Lima et al., 2017), mESCs were cultured in hanging drops (1,000 cells/20 µL) DNA repair (Slavoff et al., 2014), mitochondrial function (Stein prepared with mESCs media without LIF for 3–4 days. Then, et al., 2018) and lipid metabolism (Polycarpou-Schwarz et al., the already formed embryoid bodies were transferred to 2018), among others. Given the large number of predicted sORF- suspension culture (in 10 cm2 Petri dishes) and were cultured peptides (in the order of tens of thousands), this might just be “the in mESC media without LIF for 10 more days. tip of the iceberg” and there might be hundreds of undescribed microproteins with important roles in diverse cellular processes. Neural Differentiation of Mouse Embryonic Stem Cells Importantly, the relevance of the microproteome regulating Mouse embryonic stem cells were differentiated to neurons using neuronal processes has not yet been revealed. the protocol previously described (Mao and Zhao, 2020). Briefly, TUNAR is a long non-coding RNA initially described in 1.5 × 106 cells were seeded in suspension (10 cm2 Petri dishes) zebrafish with the name Megamind (Ulitsky et al., 2011). It is with Basal Differentiation Media I for 2 days. Then, the embryoid expressed at very early stages of embryonic development (from bodies (EBs) formed were transferred to gelatin-coated 6 well the preimplantation embryo until the blastocyst stage) plates (approximately 50 EBs/well) and cultured in Basal (Bouckenheimer et al., 2018) and in adults it is mainly Differentiation Media I supplemented with 1 µM retinoic acid expressed in the brain, particularly in neurons and newly (Sigma) for 6 days. At that point, cells were counted and 5 × formed oligodendrocytes (Dong et al., 2015). Of note, TUNAR 105 cells were seeded in gelatin-coated 6 well plates. The next day, has been shown to maintain pluripotency and promote neural medium was changed to N2B27 medium II and cells were lineage commitment (Lin et al., 2014). Specifically, TUNAR cultured for 10 more days. N2B27 medium II was replaced lncRNA forms a complex with three RNA binding proteins every 2 days. (RBP) and this TUNAR-RBP complex binds to the promoters of the pluripotency master genes Nanog and Sox2, as well as to N2A Differentiation the promoter of the neural differentiation factor Fgf4 (Lin et al., N2A cells were seeded at 6 × 105 cells/well in 12 well plates (Ma 2014). Consistent with its pro-differentiation role, TUNAR is et al., 2015) with poly-lysine coated coverslips. The next day the downregulated in glioblastoma multiforme (Reon et al., 2016). media was changed to DMEM with GlutaMAX supplemented Here, we describe that TUNAR lncRNA encodes a 48 amino- with 1% FBS, 1% of P/S and 1% NEAA. The media was changed acid microprotein expressed in the nervous system that we have daily and the cells processed after 72 h for immunfluorescence. named pTUNAR. Parallel to our work, pTUNAR, under the name of beta cell- and neural cell-regulin (BNLN), has been E13 Cortex Primary Cultures recently described to be expressed in pancreatic ß cells E13 mice cortices were dissected removing the ganglionic contributing to their function (Li et al., 2021). In our work, we eminence, the olfactory bulb, the hippocampal anlage, and the show that pTUNAR deficiency promotes neural differentiation of meninges, and cells were mechanically dissociated with a fire mouse embryonic stem cells (mESCs) in vitro and in vivo. polish Pasteur pipette. Cells were then seeded onto poly-D-lysine- Moreover, pTUNAR overexpression impairs neurite outgrowth coated glass coverslips in DMEM-GlutaMAX with 10% FBS (Life in different models of neuritogenesis. At the subcellular level, Technologies). Plasmid transfection was done with pTUNAR localizes in the endoplasmic reticulum (ER) Lipofectamine 2000 (Life technologies) according to membrane, interacts with SERCA2 and modulates calcium manufacturer’s instruction. To be able to analyze the number Frontiers in Cell and Developmental Biology | www.frontiersin.org 2 December 2021 | Volume 9 | Article 747667 Senís et al. pTUNAR Microprotein Regulates Neural Differentiation of cells in S-phase, Bromodeoxyuridine-5-bromo-2′- Reagent (ThermoFisher) following manufacturer’s instructions. deoxyuridine (BrdU) was added to the medium for 30 min 24 hours after transfection, puromycin was added to select for prior to fix the cells. For differentiation analysis, cells were transfected cells. pTUNAR KO single colonies were picked, collected 7 days after transfection, washed in phosphate- expanded and its DNA was extracted and purified. The locus buffered saline (PBS) and fixed in 4% paraformaldehyde was PCR-amplified (Primer_mTUNAR1_F, CAAAACCCCAGC (PFA) in PBS and processed for immunostaining. CAGTACAC; Primer_mTUNAR1_R, ATGCAATGCCTGTCA ACGAA) and sent for sequencing. A clone with a homozygous Cloning Procedures substitution of pTUNAR start codon was used in this study. pTUNAR ORF was synthesized (IDT technologies) fused with a flexible linker (GGGGSGGGGSGGGGS) and an HA tag epitope Extracellular Vesicles Purification at the C-terminal part of the microprotein and flanked by EcoRI NIH3T3 cells were cultured in medium supplemented with 10% EV- enzyme restrictions sites at both ends. After enzymatic digestion, reduced FBS (FBS, Hyclone). FBS was reduced of bovine EVs by constructs were ligated into the pENTR1A vector or the pMSCV ultracentrifugation at 100,000 × g for 70 min. Supernatant fractions vector. For the lentiviral vectors, the pTUNAR-HA tag construct collected from 72 h cell cultures were pelleted by centrifugation at was obtained by recombining donor vectors with the lentiviral 500 g for 10 min. The supernatant was centrifuged at 12,000 × g for inducible system pINDUCER20 (Invitrogen) or the pLV-CAG 20 min to purify large extracellular vesicles (Witwer and Théry, system using the Gateway Cloning Technology, following 2019). Small extracellular vesicles (sEVs) (Witwer and Théry, 2019) manufacturer’s instructions. were then harvested by centrifugation at 100,000 × g for 70 min. The supernatant (conditioned medium) was collected and used as Retro- and Lentiviral Vectors Production control. The sEV pellet was resuspended in 20 ml of PBS and Procedure collected by ultracentrifugation at 100,000 × g for 70 min. All HEK293T cells were transfected with the lenti- or retroviral spins were performed at 10°C using a BECKMAN Optima X100 plasmids and the packaging plasmids indicated below using centrifuge with BECKMAN TYPE 70Ti rotor. EVs were Fugene HD (Promega) following manufacturer’s instructions. resuspended in PBS and the protein content was measured by Viral supernatants were collected twice a day on two bicinchoninic acid assay (BCA) (Pierce). consecutive days, filtered through a 0.45 µm syringe filter, supplemented with of 8 μg/ml of polybrene and used to infect NIH3T3 (inducible lentiviral vectors), N2A cells (constitutive Animal Experiments lentiviral vectors) or mESCs (retroviral vectors). Successfully All experimental procedures involving animals in this study were infected cells were established by geneticin selection (inducible reviewed and approved by the Vall d’Hebron Ethics Committee lentiviral vectors), puromycin selection (retroviral vectors) or and the Commission of Animal Experimentation of Generalitat GFP expression (constitutive lentiviral vectors). de Catalunya (Spain) and the Government of Upper Bavaria (ROB/Regierung von Oberbayern) (Germany). Plasmids Used Inducible Lentiviral Vectors Teratoma Formation pInducer-Empty (control) or pInducer-pTUNAR and packaging 2 × 106 of v6.4 WT, pTUNAR KO or pTUNAR OE mESCs were plasmids pLP-1, pLP-2 and pLP-VSVG. subcutaneously injected into the flanks of 8-week-old immunocompromised NMRI mice. Tumor growth was Constitutive Lentiviral Vectors monitored every 2 days using the formula height × width × pLV-CAG-GFP (control) or pLV-CAG-pTUNAR-IRES-GFP width × (3.1416/6) and animals were sacrificed when tumors and packaging plasmids pLP-1, pLP-2 and pLP-VSVG. reached 1.5 cm3. Retroviral Vectors In uterus Injection pMSCV-Empty (control) or pMSCV-pTUNAR and packaging E13 timed pregnant mice were anaesthetized by intraperitoneal (i.p.) plasmid pCL-Eco. injection of Fentanyl (0.05 mg/kg), Medetomidine (0.5 mg/kg) and Midazolam (5 mg/kg). LV-Piscis-IRES-eGFP and RV-RFP vectors were mixed with 0.1% Fast Green (Sigma) and 1 μL of the mix was Generation of pTUNAR-KO Mouse injected in the embryo ventricle. Anesthesia was terminated by Embryonic Stem Cells subcutaneous injection of Buprenorphine (0.1 mg/kg), Flumazenil mESCs cells were co-transfected with pSpCas9(BB)-2A-Puro (0.5 mg/kg) and Atipamezole (2.5 mg/kg), and the mice were plasmid (Plasmid #62988, Addgene) containing the sgRNAs allowed to recover on a heating pad and were closely monitored mTUNAR1 targeting the start codon of pTUNAR (ACCAAG for proper recovery. The brains were collected 10 days after birth and ATGGTAATCACGAG) and a single stranded DNA as used for further analysis. homologous recombination template (CTTCACTACAGGTTA GCCTGGAGAGGAAGATAAAGACATTTGCAACCAAGTG Ribosome Profiling Analysis AGTAATCACGAGTGGAAACGATGAAGACCGGGGAGGC We retrieved a public ribosome profiling dataset from human and CAAGAGAAAGAGAG) with Lipofectamine Stem Transfection mouse brain (ArrayExpress accession number E-MTAB-7247) Frontiers in Cell and Developmental Biology | www.frontiersin.org 3 December 2021 | Volume 9 | Article 747667 Senís et al. pTUNAR Microprotein Regulates Neural Differentiation (Wang et al., 2020) and we adapted a computational approach to above, was used to visualize pTUNAR (HA-tag antibody) and identify translated sORFs (Ruiz-Orera et al., 2018). In brief, read SERCA2 (SERCA2 ATPase antibody). Antibodies and dilutions adapters were trimmed and reads mapping to annotated are listed in Supplementary Table S2. ribosomal and transfer RNAs were filtered out. Resulting reads were mapped to the assembled mouse genome (mm10) and Immunofluorescence human genome (hg38). Next, mapped reads from Primary antibodies and dilutions are listed in Supplementary experimental replicates were merged and we used the ribORF Table S2. All secondary antibodies were purchased from Life algorithm (Ji et al., 2015) to predict translated sORFs with Technologies. significant read uniformity and frame periodicity (score ≥0.7), as this feature is indicative of active ORF translation. To calculate NIH3T3 and N2A Cells the translational efficiency (TE) we obtained the FPKMs of the NIH3T3 and N2A cells were fixed in 4% paraformaldehyde for Ribo-seq and RNA-seq data sets and made the ratio of both 15 min and permeabilized with 0.5% Triton X-100 for 7 min at FPKMs. Only genes with an FPKM ≥1 in RNA-seq were selected room temperature. Cells were blocked in 3% Bovine Serum for this calculation. Albumin (BSA) and 10% goat serum in PBS for 1 hour and incubated overnight at 4°C with the primary antibody diluted in Analysis of Gene Expression by qRT-PCR 3% BSA in PBS. Next day, secondary antibodies were incubated Total RNA was extracted with Trizol (Invitrogen) following for 1 hour at room temperature in the dark. Cells were mounted manufacturer’s protocol. Genomic DNA was cleaned up and in Prolong Mounting Medium with DAPI (Invitrogen). Images retrotranscription performed using the iScript gDNA Clear were taken in a Nikon C2 Plus Confocal Microscope. cDNA Synthesis Kit (BioRad). Gene expression was analyzed by qRT-PCR using PowerUp SYBR Green Master Mix (Thermo Adult and Embryonic Brain Fisher Scientific) in the 7900HT Fast Real-Time PCR System For adult brain immunostaining, paraffin blocks were sliced into (Applied Biosystems). Cycle threshold (Ct) values were 3 µm sections and incubated at 56°C overnight. The next day, normalized to GAPDH. Gene-specific primers are listed in tissue sections were deparaffinized with xylene (Fisher Scientific, Supplementary Table S1. Of note, TUNAR lncRNA Waltham, MA, United States) and rehydrated with decreasing expression was determined using primers mTUNAR_F and concentrations of ethanol in water. Antigen retrieval was mTUNAR_R, which do not detect exogenous pTUNAR. performed with boiling sodium citrate buffer at pH 6 for Exogenous pTUNAR expression was determined using a 7 min and sections were permeabilized with 1% Tween in PBS forward primer binding the endogenous locus for 15 min. Embryonic brain cryosections were permeabilized (mTUNAR1_qPCR_F) and a reverse primer binding the HA with 0.5% Triton X-100 for 30 min. Adult and embryonic brain tag sequence (HAtag_qPCR_R) (Supplementary Table S1). sections were blocked with PBS, 0.2% BSA, 5% goat serum, 0.2% glycine and 0.2% lysine for 2 hours at room temperature. Primary Western Blotting antibodies were diluted in PBS, 0.3% Triton X-100 and 2% goat Cells and tissues were homogenized in 2% SDS lysis buffer serum and secondary antibodies in PBS, 0.3% Triton X-100 and (50 mM Tris-HCl, pH 8.0, 1 mM EDTA, 2% SDS) 3% goat serum. Sections were mounted in Prolong Mounting supplemented with protease (Roche) and phophatase (Sigma- Medium with DAPI (Invitrogen). Immunofluorescence images Aldrich) inhibitors cocktails. Protein concentration was were taken with a C2 confocal microscope (Nikon) at ×20 determined using the Pierce ™ BCA Protein Assay Kit (Thermo Fisher). Lysates were loaded in 12% bis-tris magnification and applying optimal digital zoom calculated with the Nyquist-Shannon sampling theorem. Overviews of acrylamide gels and transferred to nitrocellulose membranes. the adult and mouse brain were taken with a Leica Thunder Primary antibodies were incubated overnight at 4°C. microscope. Secondary HRP-conjugated antibodies were incubated the following day for 1 h at room temperature, and ECL Prime P10 Brain Sections and E13 Cortex Primary Cultures Western Blotting Detection Reagent (Fisher Scientific) or For immunostainings in p10 brain sections and E13 primary ™ SuperSignal West Dura Extended Duration Substrate were used as a chemiluminescent reagent for protein detection. cultures, tissue sections (20 μm) or cells plated on poly- D -lysine-coated glass coverslips were blocked with 2% BSA, Antibodies and dilutions are listed in Supplementary Table S2. 0.5% Triton-X (in PBS) for 1 h prior to staining. Primary antibodies were applied in blocking solution overnight at 4°C. Immunoprecipitation Fluorescent secondary antibodies were applied in blocking NIH3T3 cells were lysed in a buffer containing 50 mM Tris-Hcl solution for 1 h at room temperature. DAPI (4’,6-diamidin-2- pH 7.5–8, 150 mM NaCl, 1%Triton X-100 and protease and phenylindol, Sigma) was used to visualize nuclei. Sections phosphatase inhibitors and homogenized for 30 min in a rotor were mounted in Aqua Polymount (Polysciences). Images wheel. 3 mg of lysates were immunoprecipitated with 5 μg of were taken using an Olympus FV1000 confocal laser- monoclonal HA-tag antibody (Sigma) overnight at 4°C. scanning microscope using 20×/0.85 N.A and 63×/1.35 NA. Immunocomplexes were collected using PureProteome Protein A Magnetic Beads (MERCK) and eluted by boiling for ™ water immersion objective or epifluorescence microscope (Zeiss, Axio ImagerM2) equipped with a 20×/0.8 N.A and 5 min in SDS-loading buffer. Western blotting, as described 63×/1.25 NA. oil immersion objectives. Frontiers in Cell and Developmental Biology | www.frontiersin.org 4 December 2021 | Volume 9 | Article 747667 Senís et al. pTUNAR Microprotein Regulates Neural Differentiation Scholl Analysis Expasy (https://www.expasy.org/) were used to predict sites of Sholl analysis was performed on cortical neurons from E13 glycosylation. embryos transfected with a pTUNAR-IRES-GFP plasmid or a Image analysis was performed using Fiji (Schindelin et al., GFP control plasmid and differentiated for 7 days. Briefly, 2012). To quantify the neurites observed in different fields and neurons were traced using the Simple Neurite tracer plugin the proportion of neurites/neuron the plugin NeuronJ was used (v3.1.6) for Fiji (v1.52p) and their skeletonized path was as previously described (Pemberton et al., 2018). The rendered as binary image. Intersections with the Scholl radii colocalization analysis tools from Fiji were used to calculate were counted every 20 µm and plotted against the distance from the co-localization of pTUNAR with SERCA2 and their co- the center of mass of the soma using the Sholl analysis plugin localization coefficient. Graphs and statistical analysis were (v4.0.0.) for Fiji (v1.52p). Scholl radii analysis ended at 500 µm. performed using GraphPad Prism 6. Immunohistochemistry Statistical Analysis Immunohistochemistry was performed on paraffin-embedded Data is expressed as the mean ± standard deviation (SD) or the mouse tissues. In brief, paraffin blocks were sliced into 3 µm mean ± standard error of the mean (SEM) for in vivo sections, deparaffinized with xylene (Fisher Scientific, Waltham, experiments. Differences between groups were analyzed using MA, United States) and rehydrated with decreasing one-way ANOVA, two-way ANOVA or unpaired Student’s t-test, concentrations of ethanol in water. Sections underwent as specified. p-value < 0.05 was considered statistically significant. antigenic exposure process into the Discovery Ultra (Ventana) All statistical tests were two-sided and performed using system with CC1 buffer for 64 min at 95°C. Anti-pTUNAR GraphPad Prism (GraphPad Software Inc., San Diego, CA, antibody was incubated for 1 h at RT (Supplementary Table United States). S2). Next, slides were incubated with the secondary antibody Discovery UltraMap anti-Rabbit HRP (Ventana). Hematoxilin and eosin staining was performed on 5 μm paraffin sections in a RESULTS Robust carousel tissue stainer (Slee Medical) according to common method. The lncRNA TUNAR Encodes a 48-Amino Calcium Measurements Acid Microprotein Expressed in the Nervous To measure cytoplasmic calcium, cells were incubated with 5 µM System Rhod-2 (Invitrogen) for 40 min at RT. Then, cells were washed In order to identify potential microproteins involved in cellular twice with a physiological buffer containing 132 mM NaCl, differentiation, we looked for evolutionary conserved sORFs in 0.33 mM NaH2PO4, 4 mM KCl, 4 mM NaHCO3, 2 mM CaCl2, lncRNAs reported to play pro-differentiation functions. For that 1.6 mM MgCl2, 10 mM HEPES, 5 mM glucose and 5 mM pyruvic purpose, we used PhyloCSF, a comparative genomics algorithm acid. pH was adjusted to 7.4 with NaOH and experiments were that determines the coding potential of a determined genomic done at 37°C. To release calcium from the ER, cells were region based on codon conservation across species (Lin et al., superfused with 20 mM caffeine during the indicated times. 2011). Our analysis revealed that TUNAR, a lncRNA with a role Images (512 × 512 pixels) were recorded with a resonance in pluripotency maintenance and neural differentiation, contains scanning confocal microscope Leica SP5 AOBS and a HCX PL a 48-amino acid sORF conserved across all vertebrates APO CS 20.0 × 0.70 IMM objective at a frame rate of 15 images/s. (Figure 1A), that we have named pTUNAR. Images were analyzed with Leica LAS AF Software and calcium TUNAR has been shown to be expressed mainly in the signals from individual cells in cultures were analyzed as nervous system (Lin et al., 2014; Dong et al., 2015). Indeed, described previously (Molina et al., 2016). The decaying phase GTEx (human) and our own data (in mouse) indicate that the of the calcium transient was fitted with an exponential function highest expression of the lncRNA is detected in the central indicated below during caffeine exposure and after caffeine nervous system (Figure 1B). In order to confirm pTUNAR removal. translation, we analyzed already published ribosome profiling f(x)  y0 + Ae−t/tau data (Wang et al., 2020) with RiboORF. This revealed that TUNAR is indeed translated in the human and mouse brain (Figure 1A). Moreover, we calculated the translational In silico Tools efficiency (TE) in human (TE  1.13) and in mouse (TE  TUNAR coding potential was assessed using PhyloCSF (Lin et al., 3.72) brain and showed that it is above the median TE of 2011), a comparative genomics method that analyzes a regular coding genes (TE  0.755) (Supplementary Figure multispecies nucleotide sequence alignment based on a formal S1A). In silico protein analysis tools predicts that pTUNAR statistical comparison of phylogenetic codon models. presents a transmembrane domain in the C terminal region Protter (Omasits et al., 2014) was used to visualize pTUNAR and that it contains several potential post-translational predicted topology. GPS-Sumo 2.0 (Ren et al., 2009; Zhao et al., modifications (Supplementary Figure S1B). In fact, when 2014) was used to predict sumoylation sites and SUMO-binding overexpressing hemagglutinin (HA)-tagged pTUNAR in motifs. UbPred (Radivojac et al., 2010) was used to predict NIH3T3 cells, we detected a band corresponding to the residues prone to be ubiquitinated. The glycomics tools from predicted molecular weight of the tagged pTUNAR Frontiers in Cell and Developmental Biology | www.frontiersin.org 5 December 2021 | Volume 9 | Article 747667 Senís et al. pTUNAR Microprotein Regulates Neural Differentiation FIGURE 1 | pTUNAR identification and analysis of its expression. (A) In green, PhyloCSF score across TUNAR gene. In grey, Ribo-seq and RNA-seq analysis of TUNAR transcript in human and mouse brain. In black, diagram of TUNAR locus. The sORF encoding pTUNAR is indicated with a green box. Below, pTUNAR amino acid conservation across vertebrates. (B) Bar plot showing the expression of TUNAR in different human organs (GTEx data) and in mouse organs, measured by qRT-PCR and normalized to GAPDH (data from 3 female and 3 male mice, 9 weeks old). (C) Western blot of endogenous pTUNAR in the indicated mouse adult organs (9 weeks old). (D) Immunofluorescence image showing the expression of pTUNAR and NeuN in the adult mouse brain (12 weeks old). (E) Immunofluorescence image showing the expression of pTUNAR and TUBB3 in E15.5 mouse cortex, hippocampus and thalamus. (F) Immunofluorescence images showing the expression of pTUNAR and Calbindin (Purkinje cells) in the adult mouse cerebellum (12 weeks old). (G) Immunofluorescence image showing the expression of pTUNAR and NeuN in the adult mouse spinal cord (12 weeks old). (H) Immunohistochemistry of pTUNAR in the adult mouse brain (cortex), cerebellum (Purkinje cells, black arrows) and spinal cord (motor neurons, black arrows; interneurons, white arrows) (12-week-old mice). Western blotting, immunofluorescence and immunohistochemistry have been performed using a pTUNAR custom-made antibody. Frontiers in Cell and Developmental Biology | www.frontiersin.org 6 December 2021 | Volume 9 | Article 747667 Senís et al. pTUNAR Microprotein Regulates Neural Differentiation FIGURE 2 | Analysis of pTUNAR deficiency in mouse embryonic stem cells (mESCs) differentiation. (A) Schematic representation of the pTUNAR-KO strategy. (B) Sequencing chromatogram showing homozygous substitution of pTUNAR ATG by a stop codon in pTUNAR-KO mESCs generated with the CRISPR/Cas9 system. (C) Expression analysis of TUNAR lncRNA in WT or pTUNAR-KO mESCs by qRT-PCR, normalized to GAPDH. (D) Immunofluorescence and immunohistochemistry images of teratomas generated with WT or pTUNAR-KO mESCs using a pTUNAR custom-made antibody. (E) Representative images of teratomas‘ hematoxilin and eosin staining. WT, wild type; KO, pTUNAR knock-out. (F) Expression analysis of the indicated genes in WT (N  12) and pTUNAR-KO (N  10) teratomas by qRT-PCR. Data are normalized to GAPDH. Statistical analysis is a t-test. * ≤ 0.05; ** ≤ 0.01; *** ≤ 0.001. (G) Gene expression analysis of the indicated genes by qRT-PCR in WT and pTUNAR-KO mESCs differentiated to embryoid bodies. Data are normalized to GAPDH and to control cells at day 14. Statistical analysis is a two-way ANOVA with multiple comparison. **** ≤ 0.0001. (H) Gene expression analysis of WT and pTUNAR-KO mESCs differentiated to neurons. Data are normalized to GAPDH. Statistical analysis is a t-test ** ≤ 0.01; *** ≤ 0.001. Frontiers in Cell and Developmental Biology | www.frontiersin.org 7 December 2021 | Volume 9 | Article 747667 Senís et al. pTUNAR Microprotein Regulates Neural Differentiation (7.3 KDa) and several bands with higher molecular weights, (28 days) and showed significantly higher levels of Ki67 which probably correspond to the microprotein post- expressing cells (Supplementary Figure S2F). These evidences translationally modified (Supplementary Figure S1C). This suggest that mESCs overexpressing pTUNAR display an increased result was confirmed by immunoprecipitation followed by proliferation rate in vivo. However, pTUNAR overexpression does western blotting (Supplementary Figure S1D). not influence the differentiation to any lineage, as seen by To further confirm pTUNAR expression, we generated a histopathological (Supplementary Figure S2G) and gene polyclonal antibody, designed to recognize an epitope present in expression analyses of teratomas (Supplementary Figure S2B–E). the N-terminal part of mouse pTUNAR. Using this antibody, we To further confirm the effect of pTUNAR deficiency, we used were able to detect specific expression of the microprotein in brain, two in vitro differentiation approaches. On one hand, we derived cerebellum and spinal cord by western blotting (Figure 1C). embryoid bodies (EBs) from WT and pTUNAR-KO mESCs and Moreover, we detected the endogenous protein in tissue sections analyzed the expression of typical markers of the three embryonic of these three organs by immunofluorescence (Figures 1D,F,G) germ layers at differentiation day 14. Interestingly, pTUNAR-KO and immunohistochemistry (Figure 1H). Specifically, we have EBs showed a significant increased expression of ectodermal detected pTUNAR in Purkinje cells (Calbindin+) in the lineage markers, including neural differentiation markers, cerebellum, in motor neurons and interneurons (NeuN+) in the compared to WT EBs (Figure 2G). On the other hand, we spinal cord and in neurons (NeuN+) of different brain areas: performed an in vitro mESCs neural-differentiation protocol cortex, hippocampus and thalamus (Figures 1D,F,G). (Mao and Zhao, 2020) and observed that pTUNAR deficiency Furthermore, we could also detect pTUNAR expression in ßIII- leads to higher expression of the neuroectodermal markers Nestin tubulin-positive neurons in the developing cortex, hippocampus and ßIII-Tubulin at differentiation day 18 (Figure 2H). and thalamus at embryonic day E15.5 (Figure 1E). Our results Collectively, our results in vitro and in vivo indicate that have been further supported by a recent publication showing that pTUNAR’s deficiency in mESCs promotes differentiation pTUNAR, under the name of BNLN, is also detected in pancreatic towards the neural lineage. ß cells (Li et al., 2021). Altogether, we have demonstrated that TUNAR was missannotated as a lncRNA and in fact encodes for pTUNAR protein. pTUNAR Overexpression Impairs Neurite Outgrowth To pinpoint pTUNAR’s role in neural differentiation, we perform pTUNAR Deficiency Improves Neural gain-of-function studies in vitro and in vivo mouse neural Differentiation in Mouse Embryonic Stem development systems. First, we used an in vitro system of primary Cells cells dissociated from E13 cerebral cortex, transfected with a In order to determine the function of pTUNAR in differentiation, pTUNAR-overexpressing plasmid (or control plasmid) and we knocked it out in mouse embryonic stem cells (mESCs) by differentiated for 7 days (Supplementary Figure S3A). We substituting the microprotein start codon by a stop codon using analysed the proliferation of these cells 36 h after transfection by the CRISPR/Cas9 system (Figure 2A). This way, we abolished Ki67 immunostaining or BrdU incorporation and found no pTUNAR translation while minimally modifying the sequence of differences between control and pTUNAR-overexpression the lncRNA (Figures 2A,B). In fact, we observed that the (Supplementary Figure S3B). Then, we analyzed the expression expression of TUNAR lncRNA was not significantly affected of different brain cell type markers (NeuN for neurons, Olig2 for in pTUNAR-knock out (KO) mESCs (Figure 2C). To assess oligodendrocytes, GFAP for astrocytes and Nestin for neural stem differentiation potential in vivo, we performed a teratoma cells) and did not observe any significant difference after 7 days of formation assay by injecting wild type (WT) mESCs or differentiation either (Supplementary Figure S3C). However, pTUNAR-KO mESCs in the flanks of immunocompromised pTUNAR-overexpressing neurons appeared less mature. Indeed, mice. First, we could observe that WT teratomas expressed quantifying their neurites revealed a significantly lower number of pTUNAR in neuroectoderm differentiation areas whereas neurites in total and significantly lower numbers of neurites per pTUNAR-KO teratomas did not, validating both, the neuron (Figure 3A). The same results were observed after specificity of our antibody and the CRISPR-mediated KO transducing, instead of transfecting, these cells with lentiviral (Figure 2D and Supplementary Figure S2A). Second, we vectors (Supplementary Figure S3D). Moreover, a Scholl analysis observed that pTUNAR-KO teratomas were highly enriched in indicated that there is a defect in arborization in pTUNAR neuroectodermal differentiation areas compared to WT overexpressing cells (Supplementary Figure S3E). We also teratomas (Figure 2E). Indeed, by RT-qPCR we could examined this phenotype in Neuro-2a (N2A) cells, a mouse demonstrate that they expressed significantly higher levels of neuroblastoma cell line commonly used for neurite formation neural lineage markers (Figure 2F), while we did not observe assays, and confirmed the same phenotype: pTUNAR significant differences in the expression of other differentiation overexpressing cells had both, significantly lower number of markers (Supplementary Figure S2B–E). neurites and a significantly lower number of neurites per cell Given these results, we also tested the effect of pTUNAR (Figure 3B). To further characterize this phenotype in vivo, we overexpression in teratoma formation. Surprisingly, teratomas performed in utero intracranial injections of a retroviral vector derived from pTUNAR overexpressing (OE) ESCs grew expressing RPF (control vector) and a lentiviral vector expressing significantly faster, were significantly bigger at the end point pTUNAR-IRES-GFP in E13 embryos and analyzed their brains Frontiers in Cell and Developmental Biology | www.frontiersin.org 8 December 2021 | Volume 9 | Article 747667 Senís et al. pTUNAR Microprotein Regulates Neural Differentiation FIGURE 3 | Study of pTUNAR’s role in neurite formation. (A) Schematic representation of the experiment: E13 cortex primary cultures, transfected with a CAG-GFP or a CAG-pTUNAR-IRES-GFP plasmid and differentiated for 7 days in vitro (left). Representative images of the cells stained with a GFP antibody (middle). Quantification of the neurites observed in different fields and proportion of neurites/neuron (right). (B) Schematic representation of the experiment: N2A cells transduced with lentiviral vectors encoding either GFP or pTUNAR-IRES-GFP and differentiated for 72 h with serum deprivation (1% FBS) (left). Representative images of cells stained with a GFP antibody (middle). Quantification of the neurites observed in different fields and proportion of neurites/neuron (right). (C) Schematic representation of the experiment: P10 cortex developed after in uterus injection at embryonic day E13 with a retroviral vector encoding RFP and a lentiviral vector encoding pTUNAR-IRES-GFP (left). Representative images of cortical neurons stained with RFP (control) and a GFP (pTUNAR) antibodies (middle). Quantification of the neurites observed in different fields and proportion of neurites/neuron (right). Statistical analysis is a t-test * ≤ 0.05; ** ≤ 0.01; *** ≤ 0.001. The illustrations in this figure were created using BioRender.com. postnatally at day 10. Again, we observed that cortical neurons previous experiments (Figures 1D–H), we tested whether overexpressing pTUNAR had significantly fewer neurites and also pTUNAR was located in the endoplasmic reticulum (ER). fewer neurites per neuron (Figure 3C and Supplementary Figure Indeed, we could observe that pTUNAR co-localize with the S3F). Of note, neurite length was similar between control and Sarco/Endoplasmic Reticulum Calcium ATPase (SERCA2) in pTUNAR overexpression condition in all in vivo and in vitro cerebellum and brain tissue by immunostaining (Figure 4A). experiments (Supplementary Figure S3G), suggesting that there is To further confirm this result, we overexpressed a C-terminal a defect in neurite branching rather than in extension. Altogether, domain HA-tagged pTUNAR in NIH3T3 mouse fibroblasts these results indicate that pTUNAR inhibits neurite formation and performed immunofluorescence with typical markers of in vitro and in vivo. different organelles. As expected, we found a strong co- localization of pTUNAR with SERCA2 (Figure 4B). Interestingly, we could also detect pTUNAR in small and pTUNAR Microprotein Interacts With large extracellular vesicles (Supplementary Figure S4B). We SERCA2 and Regulates Intracellular did not observe co-localization of pTUNAR with DAPI Calcium Exchange (nucleus), AIF (mitochondria), 58 K (Golgi apparatus) and In order to unravel the mechanism behind pTUNAR’s LAMP2 (lysosomes) (Supplementary Figure S4A). function, we first determined its subcellular localization. Importantly, by co-immunoprecipitation experiments we Given the perinuclear localization of pTUNAR observed by could demonstrate that pTUNAR and SERCA2 physically Frontiers in Cell and Developmental Biology | www.frontiersin.org 9 December 2021 | Volume 9 | Article 747667 Senís et al. pTUNAR Microprotein Regulates Neural Differentiation FIGURE 4 | pTUNAR subcellular localization and molecular characterization. (A) Immunofluorescence images showing expression of pTUNAR and SERCA2 in adult cerebellum (upper panel) and cerebral cortex (lower panel) (12 weeks old). Immunofluorescence has been performed using a pTUNAR custom-made antibody. (B) Immunofluorescence images of NIH3T3 cells transduced with an inducible lentiviral vector expressing HA-tagged pTUNAR. Expression was induced with 1 μg/ml of doxycycline for 72 h. Cells are co-stained with an HA tag antibody and a SERCA2 antibody. Co-localization analysis was perfomed with Fiji (ImageJ) and the co- localization coefficient (Rcoloc) shown is the average of 6 different cells. (C) Immunoprecipitation of HA-tagged pTUNAR followed by western blotting in NIH3T3 cells transduced with an inducible lentiviral vector expressing HA tagged pTUNAR or a control vector. Expression was induced with 1 μg/ml of doxycycline for 72 h. Membranes were incubated with an HA tag antibody and a SERCA2 antibody. (D) Representative calcium transients elicited by caffeine in differentiated wild-type (Continued ) Frontiers in Cell and Developmental Biology | www.frontiersin.org 10 December 2021 | Volume 9 | Article 747667 Senís et al. pTUNAR Microprotein Regulates Neural Differentiation FIGURE 4 | mESCs (WT, black), mESCs overexpressing pTUNAR (OE, green) or mESCs pTUNAR-KO (KO, red). Solid lines represent fits with an exponentially decaying function. (E) Calcium release measured by the amplitude of the caffeine-induced calcium transient in differentiated WT, pTUNAR OE and pTUNAR-KO mESCs. (F) Calcium reuptake measured by analyzing the Tau for the decay of the caffeine induced calcium transient in differentiated WT pTUNAR OE and pTUNAR-KO mESCs. (G) Representative image of the kinetics of the calcium trace during exposure to caffeine and when caffeine is washed off in differentiated pTUNAR OE mESCs. To estimate calcium removal from the cytosol during the wash phase, this part of the traces was fitted with an exponentially decaying function. (H) Impact of pTUNAR overexpression or deficiency on tau during the wash phase. Statistical analysis is a one-way ANOVA with a Dunnet correction for multiple comparisons. * ≤ 0.05; ** ≤ 0.01; **** ≤ 0.0001. interact (Figure 4C). Given the role of SERCA2 as a transporter of TUNAR lncRNA which starts in an ATG upstream pTUNAR’s calcium from the cytoplasm to the endoplasmic reticulum, we start codon. This longer isoform has 65 amino acids and shares the decided to examine the effect of pTUNAR in the regulation of C terminal domain- including the transmembrane region- with intracellular calcium. We differentiated WT mESCs, pTUNAR pTUNAR. The C terminal region, shared by both isoforms, is overexpressing (OE) mESCs or pTUNAR-KO mESCs to neurons conserved among all vertebrates, from humans to zebrafish. (Mao and Zhao, 2020) and tested their capacity to uptake and However, the initial 17 amino acids of the long isoform are less release calcium from the ER. For this purpose, we used caffeine to conserved throughout evolution. Moreover, comparing the induce calcium release from the ER and measured the resulting ribosome profiling reads of the first 17 amino acids of the long calcium transient and its decay as calcium was eliminated from the isoform with the first 17 amino acids of the short isoform cytosol by reuptake. We observed that there was a significant (pTUNAR), there are four times more reads in the latter (data increase in calcium release (shown by a higher amplitude (F/F0)) in not shown). As the long isoform contains the short isoform, we cells overexpressing pTUNAR (Figures 4D,E), likely indicating could say that the 48-amino acid microprotein is three times more that pTUNAR OE cells have higher concentrations of calcium in translated than the 65-amino acid protein. This reasoning, together the ER. We also observed that calcium reuptake was significantly with the phylogenetic conservation, made us focus on pTUNAR faster (reflected by the lower tau for the decay of the calcium rather than on longer isoform. However, it is important and transient) in pTUNAR overexpressing cells, not only while caffeine interesting to consider that TUNAR lncRNA could code for a was still present (Figures 4D,F), but also when it was removed 65-amino acid isoform which could be translated in a time or (Figures 4G,H). Altogether, these results indicate that pTUNAR tissue-specific manner. modulates intracellular calcium dynamics increasing the efficiency The Sarco/Endoplamic Reticulum Calcium ATPase (SERCA2) is by which calcium is removed from the cytoplasm, probably regulated by several microproteins. On the one hand, there is a family through its interaction with SERCA2. of SERCA-inhibiting microproteins, called regulins, which are master regulators of calcium signaling in muscle (Anderson et al., 2016). It is well known that Phospholamban (PLN) and Sarcolipin (SLN) inhibit DISCUSSION the activity of SERCA2a in the heart (MacLennan et al., 2003). Myoregulin (MLN), a lncRNA-encoded microprotein (Anderson In this manuscript, we describe a novel 48-amino acid lncRNA- et al., 2015), has been shown to inhibit SERCA in skeletal muscle. encoded microprotein, pTUNAR, which is expressed in the central Moreover, two other regulins, endoregulin (ELN) and another- nervous system. pTUNAR defficiency in mouse embryonic stem regulin (ALN), have been shown to inhibit SERCA in non-muscle cells promotes their differentiation towards the neural lineage both cells (Anderson et al., 2016). On the other hand, DWORF is a in vitro and in vivo. Moreover, pTUNAR overexpression in different microprotein that has been shown to act as a SERCA activator in models of neural differentiation impairs the formation of neurites. muscle by displacing the regulins PLN, SLN and MLN (Nelson et al., pTUNAR localizes in the membrane of the endoplasmic reticulum 2016). However, it has not been described to date any microprotein where it co-localizes and interacts with SERCA2, an ATPase that regulating calcium dynamics in the nervous system. We have shown pumps calcium from the cytoplasm to the ER. pTUNAR that pTUNAR, which is expressed in the central nervous system, overexpression increases the calcium stored in the ER and interacts with SERCA2 and improves calcium reuptake from the accelerates calcium clearance from the cytoplasm, indicating that cytoplasm. pTUNAR’s transmembrane domain does not contain the pTUNAR acts as a modulator of intracellular calcium dynamics. xLFxxF motif shared by all regulins (Anderson et al., 2016) and does Interestingly, another group has independently found that pTUNAR, not display apparent amino acid similarity with regulins or with which they named BNLN, interacts with another member of the DWORF (Supplementary Figure S4C,D). However, from a SERCA family (Li et al., 2021). In particular, they showed that functional point of view, our results suggest that pTUNAR is an pTUNAR/BNLN interacts with the islet ß cell-specific SERCA3 and, activator of SERCA2, such as DWORF. We cannot dismiss the in response to high glucose, decreases the Ca2+ reuptake capacity possibility that pTUNAR also improves the calcium clearance from from the ER. This is consistent with pTUNAR acting as a modulator the cytoplasm by other mechanisms (e.g., by regulating the plasma of calcium dynamics via SERCA family proteins, which seems to be membrane Ca2+ ATPase). context and cell-type dependent. Further research is needed to Calcium signaling has a very important role in the nervous system understand the role of pTUNAR regulating calcium dynamics since it regulates neuronal differentiation, neurotransmitter and its relationship with the SERCA family. phenotype specification, dendritic arborization and axon Our ribosome sequencing analysis indicates that, in addition to outgrowth and path finding (Rosenberg and Spitzer, 2011). In pTUNAR, there could be a longer microprotein encoded by amphibians, spontaneous elevations of intracellular calcium occur Frontiers in Cell and Developmental Biology | www.frontiersin.org 11 December 2021 | Volume 9 | Article 747667 Senís et al. pTUNAR Microprotein Regulates Neural Differentiation during gastrulation in dorsal ectodermal cells, which are the cells manuscript. MG, ME and SN performed the majority of the where neural specification take place (Leclerc et al., 2000). In mouse experiments related with neurite formation. LH-M and VJ-S embryonic stem cells, an increase of intracellular calcium is related performed and analyzed the intracellular calcium regulation with the generation of neuroectodermal cells and neurons (Lin et al., experiments. JO and MMA analyzed the Ribo-seq data. MGA 2010). Together, these data indicate that elevated levels of calcium in generated the pTUNAR-KO cell lines and provided general the cytoplasm induce neural differentiation (Leclerc et al., 2012). Our technical assistance throughout the project. AE, CB and MJ results show that pTUNAR deficiency promotes neural provided technical assistance in some of the experiments. AG differentiation from mESCs. It is conceivable that in the absence and DT provided reagents, embryonic brain samples and of pTUNAR, the activity of SERCA2 is reduced, thereby impairing general advice on brain analysis. PN performed the calcium storage in the ER and increasing cytosolic calcium that may histopathological analyses. HP and MH performed the favor neural differentiation. extracellular vesicle isolation and characterization. MA On the other hand, neurite formation depends on a fine-tuned designed and supervised the study, secured funding, regulation of intracellular calcium. Hui and others demonstrated contributed to discussion and co-wrote the manuscript. All that if calcium concentration in the cytoplasm is too low, neurites authors discussed the results and commented on the do not grow and, if is too high, neurite’s growth stalls (Hui et al., manuscript. 2007). We observe that pTUNAR overexpression impairs neurite formation in different models of neuritogenesis. This could be explained by an increase in calcium reuptake triggered by FUNDING pTUNAR (Figures 4C–G), which induces a decrease in cytoplasmic calcium levels, impairing in turn neurite formation. Work in the Abad lab is supported by VHIO, Fero Foundation, As a final remark, it has been shown that TUNAR lncRNA is La Caixa Foundation (HR18-00256), Asociación Española downregulated in glioblastoma multiforme patient’s samples (Reon Contra el Cancer (AECC), Cellex Foundation, Mutua et al., 2016). Loss of calcium homeostasis has been suggested as one Madrileña Foundation and by grants from the Spanish of the mechanisms that contribute to tumor growth (Leclerc et al., Ministry of Science and Innovation (SAF2015-69413-R; 2016) as well as therapy resistance and metastasis (Maklad et al., RTI2018-102046-B-I00). M.A. was recipient of a Ramon y 2019) in brain cancers. Thus, it is possible that the downregulation of Cajal contract from the Spanish Ministry of Science and pTUNAR microprotein might contribute the dysregulation of Innovation (RYC-2013-14747). E.S. was recipient of a calcium dynamics in these deadly tumors. AECC Postdoctoral Fellowship. L.H-M. also acknowledges In summary, we have discovered and characterized a new funding from grants SAF2017-88019-C3-1R y PID2020- lncRNA-encoded microprotein with a role in neural 116927RB-C21 from the Spanish Government. MG is differentiation through the regulation of intracellular calcium. supported by the advanced ERC grant NeuroCentro and the From a more general point of view, we have uncovered that the German Research Foundation (SFB870; SPP2202; SPP2306; microproteome regulates neural differentiation, and could hide SYNERGY; TRR274). DT is supported by the Ramón y Cajal important players involved in neural homeostasis and disease that program (RYC-2017-23486/RTI2018-095580-A-I00). MMA remain to be identified. acknowledges funding from the Spanish Ministry of Science and Innovation PGC2018-094091-B-I00 co-funded by FEDER. DATA AVAILABILITY STATEMENT The original contributions presented in the study are included in ACKNOWLEDGMENTS the article/Supplementary Material, further inquiries can be directed to the corresponding authors. We thank VHIO’s Molecular Oncology Core Facility and VHIR’s High Technology Unit for technical assistance. We acknowledge Gabriel Rabinovich, Karina Mariño and Alejandro Cagnoni ETHICS STATEMENT (CONICET, Argentina) for their help with pTUNAR glycosylation predictions. Some of the figures of this The animal studies were reviewed and approved by the Vall manuscript have been created with BioRender.com. We are d’Hebron Ethics Committee and the Commission of Animal immensely grateful to all the members of the Abad lab for Experimentation of Generalitat de Catalunya (Spain) and the generating the know-how for the identification of novel sORFs Government of Upper Bavaria (ROB/Regierung von Oberbayern) and, in general, for their constant support to this project. (Germany). SUPPLEMENTARY MATERIAL AUTHOR CONTRIBUTIONS The Supplementary Material for this article can be found online at: ES designed and performed most of the experiments and data https://www.frontiersin.org/articles/10.3389/fcell.2021.747667/ analysis, contributed to discussion and co-wrote the full#supplementary-material Frontiers in Cell and Developmental Biology | www.frontiersin.org 12 December 2021 | Volume 9 | Article 747667 Senís et al. pTUNAR Microprotein Regulates Neural Differentiation REFERENCES Merino-Valverde, I., Greco, E., and Abad, M. (2020). The Microproteome of Cancer: From Invisibility to Relevance. Exp. Cell Res. 392 (1), 111997. doi:10.1016/j.yexcr.2020.111997 Anderson, D. M., Anderson, K. M., Chang, C.-L., Makarewich, C. A., Nelson, B. R., Molina, C. E., Llach, A., Herraiz-Martínez, A., Tarifa, C., Barriga, M., Wiegerinck, McAnally, J. R., et al. (2015). A Micropeptide Encoded by a Putative Long R. F., et al. (2016). Prevention of Adenosine A2A Receptor Activation Noncoding RNA Regulates Muscle Performance. Cell 160 (4), 595–606. Diminishes Beat-To-Beat Alternation in Human Atrial Myocytes. Basic Res. doi:10.1016/j.cell.2015.01.009 Cardiol. 111 (1), 5. doi:10.1007/s00395-015-0525-2 Anderson, D. M., Makarewich, C. A., Anderson, K. M., Shelton, J. M., Nelson, B. R., Makarewich, C. A., Anderson, D. M., Winders, B. R., Troupes, C. D., Bezprozvannaya, S., Bassel-Duby, R., et al. (2016). Widespread Control of Wu, F., et al. (2016). A Peptide Encoded by a Transcript Annotated as Long Calcium Signaling by a Family of SERCA-Inhibiting Micropeptides. Sci. Signal. Noncoding RNA Enhances SERCA Activity in Muscle. Science 351 (6270), 9 (457), ra119. doi:10.1126/scisignal.aaj1460 271–275. doi:10.1126/science.aad4076 Bouckenheimer, J., Fauque, P., Lecellier, C.-H., Bruno, C., Commes, T., Lemaître, Omasits, U., Ahrens, C. H., Müller, S., and Wollscheid, B. (2014). Protter: J.-M., et al. (2018). Differential Long Non-Coding RNA Expression Profiles in Interactive Protein Feature Visualization and Integration With Experimental Human Oocytes and Cumulus Cells. Sci. Rep. 8 (1), 2202. doi:10.1038/s41598- Proteomic Data. Bioinformatics 30 (6), 884–886. doi:10.1093/bioinformatics/ 018-20727-0 btt607 D’Lima, N. G., Ma, J., Winkler, L., Chu, Q., Loh, K. H., Corpuz, E. O., et al. (2017). Orr, M. W., Mao, Y., Storz, G., and Qian, S.-B. (2020). Alternative ORFs and Small A Human Microprotein that Interacts With the mRNA Decapping Complex. ORFs: Shedding Light on the Dark Proteome. Nucleic Acids Res. 48 (3), Nat. Chem. Biol. 13 (2), 174–180. doi:10.1038/nchembio.2249 1029–1042. doi:10.1093/nar/gkz734 Dong, X., Chen, K., Cuevas-Diaz Duran, R., You, Y., Sloan, S. A., Zhang, Y., et al. Peeters, M. K. R., and Menschaert, G. (2020). The Hunt for sORFs: A (2015). Comprehensive Identification of Long Non-Coding RNAs in Purified Multidisciplinary Strategy. Exp. Cell Res. 391 (1), 111923. doi:10.1016/ Cell Types From the Brain Reveals Functional LncRNA in OPC Fate j.yexcr.2020.111923 Determination. Plos Genet. 11 (12), e1005669. doi:10.1371/ Pemberton, K., Mersman, B., and Xu, F. (2018). Using ImageJ to Assess Neurite journal.pgen.1005669 Outgrowth in Mammalian Cell Cultures: Research Data Quantification Hui, K., Fei, G.-H., Saab, B. J., Su, J., Roder, J. C., and Feng, Z.-P. (2007). Neuronal Exercises in Undergraduate Neuroscience Lab. J. Undergrad Neurosci. Educ. Calcium Sensor-1 Modulation of Optimal Calcium Level for Neurite 16 (2), A186–a194. Outgrowth. Development 134 (24), 4479–4489. doi:10.1242/dev.008979 Polycarpou-Schwarz, M., Gross, M., Mestdagh, P., Schott, J., Grund, S. E., Ji, Z., Song, R., Regev, A., and Struhl, K. (2015). Many lncRNAs, 5’UTRs, and Hildenbrand, C., et al. (2018). The Cancer-Associated Microprotein Pseudogenes Are Translated and Some Are Likely to Express Functional CASIMO1 Controls Cell Proliferation and Interacts With Squalene Proteins. Elife 4, e08890. doi:10.7554/eLife.08890 Epoxidase Modulating Lipid Droplet Formation. Oncogene 37 (34), Leclerc, C., Haeich, J., Aulestia, F. J., Kilhoffer, M.-C., Miller, A. L., Néant, I., et al. 4750–4768. doi:10.1038/s41388-018-0281-5 (2016). Calcium Signaling Orchestrates Glioblastoma Development: Facts and Radivojac, P., Vacic, V., Haynes, C., Cocklin, R. R., Mohan, A., Heyen, J. W., et al. Conjunctures. Biochim. Biophys. Acta (Bba) - Mol. Cell Res. 1863 (6), (2010). Identification, Analysis, and Prediction of Protein Ubiquitination Sites. 1447–1459. doi:10.1016/j.bbamcr.2016.01.018 Proteins 78 (2), 365–380. doi:10.1002/prot.22555 Leclerc, C., Néant, I., and Moreau, M. (2012). The Calcium: an Early Signal That Ren, J., Gao, X., Jin, C., Zhu, M., Wang, X., Shaw, A., et al. (2009). Systematic Study Initiates the Formation of the Nervous System During Embryogenesis. Front. of Protein Sumoylation: Development of a Site-Specific Predictor of SUMOsp Mol. Neurosci. 5, 3. doi:10.3389/fnmol.2012.00064 2.0. Proteomics 9 (12), 3409–3412. doi:10.1002/pmic.200800646 Leclerc, C., Webb, S. E., Daguzan, C., Moreau, M., and Miller, A. L. (2000). Imaging Reon, B. J., Anaya, J., Zhang, Y., Mandell, J., Purow, B., Abounader, R., et al. (2016). Patterns of Calcium Transients during Neural Induction in Xenopus laevis Expression of lncRNAs in Low-Grade Gliomas and Glioblastoma Multiforme: Embryos. J. Cell Sci. 113, 3519–3529. doi:10.1242/jcs.113.19.3519 An In Silico Analysis. Plos Med. 13 (12), e1002192. doi:10.1371/ Li, M., Shao, F., Qian, Q., Yu, W., Zhang, Z., Chen, B., et al. (2021). A Putative Long journal.pmed.1002192 Noncoding RNA-Encoded Micropeptide Maintains Cellular Homeostasis in Rosenberg, S. S., and Spitzer, N. C. (2011). Calcium Signaling in Neuronal Pancreatic β Cells. Mol. Ther. - Nucleic Acids. 26, 307–320. doi:10.1016/ Development. Cold Spring Harbor Perspect. Biol. 3 (10), a004259. j.omtn.2021.06.027 doi:10.1101/cshperspect.a004259 Lin, H.-H., Bell, E., Uwanogho, D., Perfect, L. W., Noristani, H., Bates, T. J. D., et al. Ruiz-Orera, J., Verdaguer-Grau, P., Villanueva-Cañas, J. L., Messeguer, X., and (2010). Neuronatin Promotes Neural Lineage in ESCs via Ca2+ Signaling. Stem Albà, M. M. (2018). Translation of Neutrally Evolving Peptides Provides a Basis Cells 28 (11), 1950–1960. doi:10.1002/stem.530 for De Novo Gene Evolution. Nat. Ecol. Evol. 2 (5), 890–896. doi:10.1038/ Lin, M. F., Jungreis, I., and Kellis, M. (2011). PhyloCSF: a Comparative Genomics s41559-018-0506-6 Method to Distinguish Protein Coding and Non-Coding Regions. Schindelin, J., Arganda-Carreras, I., Frise, E., Kaynig, V., Longair, M., Pietzsch, T., Bioinformatics 27 (13), i275–i282. doi:10.1093/bioinformatics/btr209 et al. (2012). Fiji: an Open-Source Platform for Biological-Image Analysis. Nat. Lin, N., Chang, K.-Y., Li, Z., Gates, K., Rana, Z. A., Dang, J., et al. (2014). An Methods 9 (7), 676–682. doi:10.1038/nmeth.2019 Evolutionarily Conserved Long Noncoding RNA TUNA Controls Pluripotency Slavoff, S. A., Heo, J., Budnik, B. A., Hanakahi, L. A., and Saghatelian, A. (2014). A and Neural Lineage Commitment. Mol. Cell 53 (6), 1005–1019. doi:10.1016/ Human Short Open Reading Frame (sORF)-Encoded Polypeptide That j.molcel.2014.01.021 Stimulates DNA End Joining. J. Biol. Chem. 289 (16), 10950–10957. Ma, Q., Hu, Q.-s., Xu, R.-j., Zhen, X.-c., and Wang, G.-h. (2015). Protease Omi doi:10.1074/jbc.C113.533968 Facilitates Neurite Outgrowth in Mouse Neuroblastoma N2a Cells by Cleaving Stein, C. S., Jadiya, P., Zhang, X., McLendon, J. M., Abouassaly, G. M., Witmer, N. Transcription Factor E2F1. Acta Pharmacol. Sin. 36 (8), 966–975. doi:10.1038/ H., et al. (2018). Mitoregulin: A lncRNA-Encoded Microprotein that Supports aps.2015.48 Mitochondrial Supercomplexes and Respiratory Efficiency. Cell Rep. 23 (13), MacLennan, D. H., Asahi, M., and Tupling, A. R. (2003). The Regulation of 3710–3720. e8. doi:10.1016/j.celrep.2018.06.002 SERCA-Type Pumps by Phospholamban and Sarcolipin. Ann. N. Y Acad. Sci. Ulitsky, I., Shkumatava, A., Jan, C. H., Sive, H., and Bartel, D. P. (2011). Conserved 986, 472–480. doi:10.1111/j.1749-6632.2003.tb07231.x Function of lincRNAs in Vertebrate Embryonic Development Despite Rapid Makarewich, C. A., and Olson, E. N. (2017). Mining for Micropeptides. Trends Cell Sequence Evolution. Cell 147 (7), 1537–1550. doi:10.1016/j.cell.2011.11.055 Biol. 27 (9), 685–696. doi:10.1016/j.tcb.2017.04.006 Wang, Z.-Y., Leushkin, E., Liechti, A., Ovchinnikova, S., Mößinger, K., Brüning, T., Maklad, A., Sharma, A., and Azimi, I. (2019). Calcium Signaling in Brain Cancers: et al. (2020). Transcriptome and Translatome Co-Evolution in Mammals. Roles and Therapeutic Targeting. Cancers 11 (2), 145. doi:10.3390/ Nature 588 (7839), 642–647. doi:10.1038/s41586-020-2899-z cancers11020145 Witwer, K. W., and Théry, C. (2019). Extracellular Vesicles or Exosomes? on Mao, X., and Zhao, S. (2020). Neuronal Differentiation from Mouse Embryonic Primacy, Precision, and Popularity Influencing a Choice of Nomenclature. Stem Cells In Vitro. J. Vis. Exp. 160, e61190. doi:10.3791/61190 J. Extracellular Vesicles 8 (1), 1648167. doi:10.1080/20013078.2019.1648167 Frontiers in Cell and Developmental Biology | www.frontiersin.org 13 December 2021 | Volume 9 | Article 747667 Senís et al. pTUNAR Microprotein Regulates Neural Differentiation Zhao, Q., Xie, Y., Zheng, Y., Jiang, S., Liu, W., Mu, W., et al. (2014). GPS- this article, or claim that may be made by its manufacturer, is not guaranteed or SUMO: a Tool for the Prediction of Sumoylation Sites and SUMO- endorsed by the publisher. Interaction Motifs. Nucleic Acids Res. 42, W325–W330. doi:10.1093/nar/ gku383 Copyright © 2021 Senís, Esgleas, Najas, Jiménez-Sábado, Bertani, Giménez- Alejandre, Escriche, Ruiz-Orera, Hergueta-Redondo, Jiménez, Giralt, Nuciforo, Conflict of Interest: The authors declare that the research was conducted in the Albà, Peinado, Toro, Hove-Madsen, Götz and Abad. This is an open-access absence of any commercial or financial relationships that could be construed as a article distributed under the terms of the Creative Commons Attribution License potential conflict of interest. (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that Publisher’s Note: All claims expressed in this article are solely those of the authors the original publication in this journal is cited, in accordance with accepted academic and do not necessarily represent those of their affiliated organizations, or those of practice. No use, distribution or reproduction is permitted which does not comply the publisher, the editors and the reviewers. Any product that may be evaluated in with these terms. Frontiers in Cell and Developmental Biology | www.frontiersin.org 14 December 2021 | Volume 9 | Article 747667