PERSPECTIVE published: 21 May 2021 doi: 10.3389/fcell.2021.636704 A Benchmark Side-by-Side Comparison of Two Well-Established Protocols for in vitro Hematopoietic Differentiation From Human Pluripotent Stem Cells Francisco Gutierrez-Agüera 1 , Virginia Rodriguez-Cortez 1 , Paolo Petazzi 1 , Clara Bueno 1,2* and Pablo Menendez 1,2,3* 1 Josep Carreras Research Institute, Barcelona, Spain, 2 Centro de Investigación Biomédica en Red de Cáncer (CIBER-ONC), Instituto de Salud Carlos III (ISCIII), Barcelona, Spain, 3 Instituciò Catalana de Recerca i Estudis Avançats Edited by: (ICREA), Barcelona, Spain Emanuele Azzoni, University of Milano Bicocca, Italy Reviewed by: The generation of transplantable hematopoietic stem cells (HSCs) from human Majlinda Lako, pluripotent stem cells (hPSCs) remains challenging. Current differentiation protocols Newcastle University, United Kingdom Dominic Owens, from hPSCs generate mostly hematopoietic progenitors of the primitive HSC- University of Oxford, United Kingdom independent program, and it remains unclear what is the best combination of cytokines *Correspondence: and hematopoietic growth factors (HGFs) for obtaining functional hematopoietic cells Clara Bueno cbueno@carrerasresearch.org in vitro. Here, we have used the AND1 and H9 hESC lines and the H9:dual- Pablo Menendez reporter RUNX1C-GFP-SOX17-Cherry to compare the hematopoietic differentiation pmenendez@carrerasresearch.org in vitro based on the treatment of embryoid bodies (EBs) with the ventral mesoderm Specialty section: inducer BMP4 plus HGFs in the absence (protocol 1) or presence (protocol 2) of This article was submitted to stage-specific activation of Wnt/β-catenin and inhibition of Activin/Nodal. Despite Stem Cell Research, a slight trend in favor of protocol 1, no statistically significant differences were a section of the journal Frontiers in Cell and Developmental observed between protocols at any time point analyzed throughout EB development Biology regarding the frequency of hemogenic endothelial (HE) precursors; CD43+ CD45−, Received: 01 December 2020 CD45+, and CD45 + CD34 + hematopoietic derivatives; or the output of clonogenic Accepted: 09 April 2021 Published: 21 May 2021 progenitors. Similarly, the kinetics of emergence throughout EB development of both Citation: SOX17 + HE and RUNX1C + definitive hematopoiesis was very similar for both Gutierrez-Agüera F, protocols. The expression of the early master mesendodermal transcription factors Rodriguez-Cortez V, Petazzi P, Brachyury, MIXL1, and KDR revealed similar gene expression kinetics prior to the Bueno C and Menendez P (2021) A Benchmark Side-by-Side Comparison emergence of RUNX1C + definitive hematopoiesis for both protocols. Collectively, the of Two Well-Established Protocols simpler protocol 1 is, at least, as efficient as protocol 2, suggesting that supplementation for in vitro Hematopoietic Differentiation From Human with additional morphogens/HGFs and modulation of Activin/Nodal and Wnt/β-catenin Pluripotent Stem Cells. pathways seem dispensable for in vitro hematopoietic differentiation of hPSCs. Front. Cell Dev. Biol. 9:636704. doi: 10.3389/fcell.2021.636704 Keywords: HPSC, hematopoiesis, differentiation, cytokines, WNT/B-CATENIN Frontiers in Cell and Developmental Biology | www.frontiersin.org 1 May 2021 | Volume 9 | Article 636704 Gutierrez-Agüera et al. Hematopoietic Differentiation From hPSCs INTRODUCTON MATERIALS AND METHODS Directed differentiation of human pluripotent stem cells (hPSCs) Maintenance of hPSC Lines into specific cell types would enable the generation of large Human embryonic stem cell (hESC) lines, including the dual numbers of patient- or donor-derived cells for regenerative reporter SOX17 mCHERRY/W RUNX1CGFP/W H9 cells [kindly medicine and the implementation of unique in vitro models for provided by Prof. Andrew Elefanty (Murdoch Children’s studying developmental biology, disease modeling, and drug Research Institute, Monash University, VIC, Australia) and screening (Menendez et al., 2006). In the hematopoietic setting, Dr. Andrea Ditadi (Ospedale San Raffaelo, Milan, Italy)], the generation of transplantable hematopoietic stem cells (HSCs) were maintained undifferentiated in T25 flasks on a layer of from hPSCs remains challenging because both the primitive irradiated murine embryonic fibroblasts in complete Dulbecco’s and definitive developmental programs are intermingled, modified Eagle’s medium (DMEM) containing 20% knockout and current hPSC differentiation protocols generate mostly (KO) serum replacement and 8 ng/ml basic fibroblast growth hematopoietic progenitors of the primitive HSC-independent factor (bFGF) as extensively described (Chadwick et al., 2003; program (Medvinsky et al., 2011). However, multiple studies Ramos-Mejia et al., 2014; Bueno et al., 2019). The medium was have reported the generation of distinct hematopoietic cell changed daily and cells were passaged weekly by dissociation types from hPSCs in vitro, either by co-culturing them with with 1:1 collagenase type IV:dispase (Invitrogen, Carlsbad, CA, stromal cell layers such as OP9 cells or by directing their United States). Cultures were visualized daily by phase contrast differentiation through embryoid body (EB) development with microscopy. Approval for the hESC work was obtained from specific morphogens and hematopoietic growth factors (HGFs) our local health authorities and the Spanish National Pluripotent (Demirci et al., 2020). Ethical Committee (0336E/14973/2017). Hematopoietic development from hPSCs arises from early VEGF receptor (KDR) + CD34−CD31− mesodermal progenitors, and it transitions through CD34 + CD31 + CD45− Hematopoietic Differentiation From hemogenic endothelium (HE) precursors (Chadwick et al., hPSCs by EB Formation 2003; Wang et al., 2004). The expression of glycophorin A On the day of passage, undifferentiated hESCs at confluence (CD235) is used as a surrogate marker to identify the primitive in T25 culture flasks (∼8 × 106 alive cells) were first (CD235+) or definitive (CD235−) hematopoietic potential treated with collagenase type IV:dispase for 1 h at 37◦ C, (Sturgeon et al., 2014). HE precursors further differentiate and dispersed cells were transferred to six-well low-attachment toward CD43 + CD45− and then CD45 + hematopoietic plates (∼1 × 106 alive cells/well/condition; alive cells were cells (Chadwick et al., 2003; Menendez et al., 2004; Wang measured by trypan blue exclusion) and incubated overnight et al., 2004, 2005). Early protocols for the successful EB-based in differentiation medium (DM; KO-DMEM supplemented in vitro-directed differentiation of hPSCs into hematopoietic with 20% fetal bovine serum, 1% non-essential amino acids, cells relied on the use of the master early ventral mesoderm 1 mmol/L L-glutamine, and 0.1 mmol/L β-mercaptoethanol). inducer BMP4 and different cocktails of HGFs including Media changes and supplementation with BMP4, different HGFs, the early acting hematopoietic cytokines SCF and FLT3L and inhibitors were performed as in Figure 1A. Concentrations (Chadwick et al., 2003; Wang et al., 2004, 2005; Ledran used were as follows: 3 µM CHIR99021, 3 µM SB-431542, et al., 2008; Ditadi et al., 2017). Further studies over the 25 ng/ml BMP4, 300 ng/ml stem cell factor (SCF), 300 ng/ml last decade suggested that Activin/Nodal and Wnt/β-catenin FMS-like tyrosine kinase 3 ligand (Flt3L), 10 ng/ml interleukin pathways regulate primitive vs. definitive in vitro hematopoietic (IL)-3, 10 ng/ml IL-6, 50 ng/ml granulocyte-colony stimulating specification from hPSCs (Sturgeon et al., 2014; Ditadi and factor (G-CSF), 15 ng/ml VEGF, 10 ng/ml basic fibroblast growth Sturgeon, 2016; Ditadi et al., 2017). These studies suggest that factor 2 (FGF2), 25 ng/ml insulin-like growth factor-1 (IGF1), the specification of definitive hematopoiesis requires early 30 ng/ml thrombopoietin (TPO), and two IU erythropoietin stage-specific activation of Wnt/β-catenin and inhibition of (EPO) (all from R&D Systems, Minneapolis, MN, United States) Activin/Nodal signaling pathways, which is efficiently achieved (Chadwick et al., 2003; Sturgeon et al., 2014; Ditadi and Sturgeon, by treatment with the GSK-3 inhibitor CHIR99021, a Wnt 2016). In the serum-free experiments, the basal media SFD agonist, and the Activin/Nodal inhibitor SB-431542, respectively composed of IMDM and Ham’s F12 (Gibco) supplemented with (Bendall et al., 2007; Kennedy et al., 2012). Although many L -glutamine (2 mM), ascorbic acid (1 mM), monothioglycerol studies have investigated early hematopoietic development by (MTG, 4 × 10−4 M; Sigma), transferrin (150 µg/ml), N2 (100×), interrogating the role of instructive transcription factors, it B27 (100×), and bovine serum albumin (BSA) 0.1% was used. remains unclear what is the best combination of morphogens, Embryoid bodies were dissociated at different time points cytokines, and HGFs to be used for obtaining functional during development using collagenase B and enzyme-free hematopoietic cells in vitro. Here, we have compared the cell dissociation buffer (Invitrogen). Dissociated cells were hematopoietic differentiation in vitro of two well-established stained with anti-CD34-PE, anti-CD31-FITC, anti-CD45-APC or protocols which rely on EB treatment with BMP4 plus a anti-CD34-PE-Cy7, CD31-BV510, anti-glycophorin A-PE, anti- different cocktail HGFs in the absence or presence of CD43-FITC, and anti-CD45-APC antibodies and 7-actinomycin stage-specific activation of Wnt/β-catenin and inhibition D (7AAD) for exclusion of dead cells and analyzed using a FACS of Activin/Nodal. Canto flow cytometer (BD Biosciences). The emergence of alive Frontiers in Cell and Developmental Biology | www.frontiersin.org 2 May 2021 | Volume 9 | Article 636704 Gutierrez-Agüera et al. Hematopoietic Differentiation From hPSCs FIGURE 1 | Side-by-side comparison of two well-established EB-based directed hematopoietic differentiation protocols. (A) Schematic of the differentiation protocols (protocol 1 and protocol 2) and time-point analyses. (B) Cartoon depicting the hematopoietic cell fate specification through the formation of hEBs. (C) Representative FACS analysis and identification of the indicated alive hematopoietic cell populations analyzed during hematopoietic commitment of hPSCs. (D) Frequency of alive (7AAD–) HE precursors (CD45–CD43–CD34 + CD31 +), CD43 + CD45– and CD45 + hematopoietic cells, and hematopoietic progenitors (CD45 + CD34 +) analyzed at the indicated time points throughout EB development (n = 8). (E) Clonogenic progenitors detected by hematopoietic CFU assays were analyzed at the indicated time points (n = 8). Each individual dot represents the value for each independent in vitro differentiation experiment. Data were plotted as mean ± SD. n.s., not significant. *p value < 0.05. (7AAD−) SOX17 + and RUNX1C + cells during EB development time points along EB differentiation by plating 5 × 104 EB- was analyzed using Cherry and GFP reporters, respectively. derived cells onto serum-free methylcellulose H4435 (Stem Cell Colony-forming unit (CFU) assays were performed at different Technologies, Vancouver, BC, Canada). Colonies were scored Frontiers in Cell and Developmental Biology | www.frontiersin.org 3 May 2021 | Volume 9 | Article 636704 Gutierrez-Agüera et al. Hematopoietic Differentiation From hPSCs after 12 days using standard CFU scoring assays (Chadwick et al., followed by treatment with SCF, VEGF, FGF2, FLT3L, IL-3, IL-6, 2003; Ramos-Mejia et al., 2014; Bueno et al., 2019). IGF1, TPO, and EPO from day 4 of EB development onward (termed as protocol 2, Figure 1A). The in vitro efficiency of both Real-Time Reverse protocol 1 and protocol 2 was compared side-by-side using the Transcriptase-Polymerase Chain hESC lines AND1 and H9 (n = 8 independent experiments). The Reaction frequency of HE precursors (CD45−CD43−CD34 + CD31+), hematopoietic cells (both CD43 + CD45− and CD43 + CD45 +), DNAse-treated total RNA was extracted from EBs using the and hematopoietic progenitors (CD45 + CD34 +) as well as the Maxwell RSC simplyRNA Cells Kit (Promega, Madison, WI, output of clonogenic progenitors detected by hematopoietic United States). Two hundred and fifty nanograms of RNA was CFU assays was analyzed at indicated time points throughout retrotranscribed with random hexamers using the Superscript EB development (Figures 1B–E). Overall, although a slight III first-strand synthesis kit (Thermo Fisher Scientific, Waltham, trend in favor of protocol 1 was consistently observed, MA, United States). The resulting cDNA was diluted 1:2 and no statistically significant differences were observed in the analyzed for differential gene expression using the PowerUp frequency of either HE precursors; CD43 + CD45−, CD45+, SYBR Green Master Mix (Thermo Fisher Scientific, Waltham, or CD45 + CD34 + hematopoietic derivatives (Figure 1D); or MA, United States) on a Bio-Rad CFX384 qPCR Platform the output of clonogenic progenitors (Figure 1E) at any time (Bio-Rad, Hercules, CA, United States). Relative expression of point analyzed (from day 7 to day 22 of EB development). Of the mesoderm markers was calculated with the 11Ct method note, ∼95% of the HE precursors were CD235− regardless of the using RPL19 as the housekeeping gene. Primer sequences were protocol employed (Figure 1C). as follows: KDR: Fw-CCACTGGTATTGGCAGTTGGA, Rev- We next took advantage of the RUNX1C-GFP-SOX17-Cherry CACAAGGGTATGGGTTTGTCAACT (80 bp, exons 10–11); dual reporter H9 hESC line to track the endothelial (SOX17 +) T/BRACHYURY: Fw-ATGAGCCTCGAATCCACATAGT, to definitive hematopoietic (RUNX1C+) transition (Ng et al., Rev-TCCTCGTTCTGATAAGCAGTCA (108 bp, exon 2016). Our data showed that the protocol employed (protocol 1 vs 3); MIXL1: Fw-GGATCCAGGTATGGTTCCAG, Rev- protocol 2) had no impact on the kinetics of emergence of either GGAGCACAGTGGTTGAGGAT (130 bp, exons 1–2); SOX17 + HE or RUNX1C + definitive hematopoiesis throughout and RPL19: Fw-GCGGAAGGGTACAGCCAAT, Rev- the 22 days of EB development (n = 4, Figures 2A,B). The limited AGCAGCCGGCGCAAAATCC (78 bp, exon 4). The impact of the early stage-specific activation of Wnt/β-catenin and absence of genomic DNA contamination was confirmed by inhibition of Activin/Nodal pathways in definitive hematopoietic running RT controls. development in vitro was further confirmed at the molecular Statistical Analyses level. Real-time reverse transcriptase-PCR-based expression of the early master mesendodermal transcription factors Brachyury, Data are plotted as mean ± standard deviation (SD). p values MIXL1, and KDR revealed very similar gene expression kinetics were calculated using paired two-tailed Student’s t test for each prior to the emergence of RUNX1C + definitive hematopoiesis time point using the Prism software version 8.0 (GraphPad Prism (n = 4, Figure 2C). Software Inc., San Diego, CA, United States). Protocol 1 has been historically used in the presence of serum and protocol 2 in the absence of serum. To assess whether RESULTS the presence of serum masks the differences between both protocols, the RUNX1C-GFP-SOX17-Cherry H9 hESC line was We have compared whether two extensively employed EB- differentiated (n = 2) for 22 days in serum-free medium with based directed differentiation protocols influence hPSC-derived the morphogens and HGFs of protocol 1 vs. protocol 2. As hematopoietic differentiation in vitro. The differentiation shown in Figures 2D–E, no significant differences were observed protocols exclusively differed in the cocktail of morphogens either in frequencies or in absolute numbers between protocols and HGFs used during EB development (Figure 1A). The for either RUNX1C + or SOX17 + cells, indicating that the lack simpler protocol was developed by Bhatia’s lab in 2003 and of significant differences in the hematopoietic output between used the ventral mesoderm inducer BMP4 plus the HGFs SCF, both protocols is not attributable to (masked by) the presence FLT3L, IL-3, IL-6, and G-CSF throughout the entire 22-day of serum. Collectively, our in vitro data using different hESC differentiation protocol (Chadwick et al., 2003; Menendez lines demonstrate that the simpler protocol 1 is, at least, as et al., 2004; Wang et al., 2004, 2005) (termed as protocol 1, efficient as protocol 2, suggesting that the supplementation with Figure 1A). The other differentiation protocol was developed additional morphogens/HGFs and modulation of Activin/Nodal later on by Keller’s lab and employed a more complex setup of and Wnt/β-catenin pathways seem dispensable for in vitro morphogens and HGFs suggested to more efficiently promote hematopoietic differentiation of hPSCs. EB differentiation toward the definitive hematopoietic program (Kennedy et al., 2012; Ditadi and Sturgeon, 2016; Ditadi et al., 2017). It includes an 8-day treatment with BMP4 and a DISCUSSION concomitant stage-specific (day 2 to day 4 of EB development) Wnt/β-catenin activation with the GSK-3 inhibitor CHIR99021 Human PSCs have long been postulated as an unprecedented and Activin/Nodal inhibition with the inhibitor SB-431542 model for studies on human development and disease modeling Frontiers in Cell and Developmental Biology | www.frontiersin.org 4 May 2021 | Volume 9 | Article 636704 Gutierrez-Agüera et al. Hematopoietic Differentiation From hPSCs FIGURE 2 | Impact of both differentiation protocols on the emergence kinetics of SOX17 + HE and RUNX1C + definitive hematopoietic cells. (A) Frequency of alive (7AAD–) SOX17:Cherry + and RUNX1C:GFP + cells along EB differentiation with protocol 1 and protocol 2 (n = 4). (B) Left panel, representative flow cytometry plots displaying how (SOX17/Cherry +) and definitive hematopoietic cells (RUNX1/GFP +) are identified. The right panel shows mCherry and GFP expression within differentiating EBs by fluorescence microscopy. (C) Gene expression kinetics of the mesendodermal transcription factors Brachyury (T), MIXL1, and KDR during mesoderm induction and early hematopoietic differentiation with protocol 1 and protocol 2 (n = 4). (D,E) Frequency (D) and absolute numbers (E) of RUNX1/GFP + definitive hematopoietic cells and SOX17/Cherry + HE cells at endpoint (day 22) of in vitro differentiation using protocol 1 or protocol 2 in a serum-free media. Data were plotted as mean ± SD. n.s., not significant. and for drug testing (Menendez et al., 2006). Many studies Two well-established, widely used in vitro hematopoietic have investigated early hematopoietic development by differentiation protocols exist. The first protocol, initially interrogating the role of instructive transcription factors developed by Bhatia’s lab (termed as protocol 1 in this study), (Real et al., 2012, 2013; Ramos-Mejia et al., 2014; Ayllón relies on EB treatment with the ventral mesoderm inducer BMP4 et al., 2015; Bueno et al., 2019). Nonetheless, it remains together with the HGFs SCF, FLT3L, IL-3, IL-6, and G-CSF for unclear regarding the best combination of cytokines further blood specification for 22 days (Chadwick et al., 2003; and growth factors, the timing of treatment, and the Menendez et al., 2004; Wang et al., 2004, 2005). The other methodology to be used for obtaining fully functional protocol developed by Keller’s lab employs BMP4 together with a hematopoietic cells in vitro. There are a large number concomitant stage-specific (days 2–4 of EB development) Wnt/β- of published in vitro protocols for differentiation of catenin activation with the GSK-3 inhibitor CHIR99021 and hPSCs toward hematopoietic cells. These protocols largely Activin/Nodal inhibition with the inhibitor SB-431542 followed differ in many aspects including (i) the use of several by treatment with SCF, VEGF, FGF2, FLT3L, IL-3, IL-6, IGF1, EB systems (spin and non-spin EBs) vs. stromal cells TPO, and EPO from day 4 of EB development onward (termed such as OP9, MSCs, AGM feeders, fetal liver feeders, as protocol 2 in this study) (Kennedy et al., 2012; Sturgeon etc.; (ii) the absence or presence of sera from different et al., 2014; Ditadi and Sturgeon, 2016; Ditadi et al., 2017). The mammalian sources; and (iii) a never-ending combination GSK-3 inhibitor CHIR99021 and the Activin/Nodal inhibitor of morphogens and HGFs, among others. However, none SB-431542 were selected based on previous reports showing of the protocols used so far render hPSC hematopoietic that WNT3A exposure during mesoderm patterning of hESCs derivatives capable of reconstituting the hematopoietic system in suppresses primitive hematopoiesis (Gertow et al., 2013) and that immune-deficient mice. WNT agonists or ACTIVIN antagonists may support definitive Frontiers in Cell and Developmental Biology | www.frontiersin.org 5 May 2021 | Volume 9 | Article 636704 Gutierrez-Agüera et al. Hematopoietic Differentiation From hPSCs hematopoiesis from hPSCs (Kennedy et al., 2012; Sturgeon et al., ETHICS STATEMENT 2014). Both inhibitors are used between day 2 and day 4 of EB differentiation, the period during which HOX gene expression is Approval for hESC work was obtained from the ISCIII-Comisión initiated (Ramos-Mejia et al., 2014; Ng et al., 2016). Nacional de Garantías (0336E/14973/2017). In this study, we have used several wild-type and reporter hPSC lines to compare the hematopoietic differentiation in vitro based on the treatment of EBs with BMP4 AUTHOR CONTRIBUTIONS plus HGFs in the absence (protocol 1) or presence (protocol 2) of stage-specific activation of Wnt/β-catenin FG-A designed and performed the experiments and analyzed and inhibition of Activin/Nodal. We demonstrate that the the data. VR-C and PP performed the experiments. CB and PM simpler protocol 1 is, at least, as efficient as protocol conceived the study, designed the experiments, analyzed the data, 2, suggesting that the supplementation with additional and wrote the manuscript. All authors contributed to the article morphogens/HGFs and modulation of Activin/Nodal and and approved the submitted version. Wnt/β-catenin pathways seem dispensable for yielding a higher number of hematopoietic (progenitor) derivatives for subsequent downstream in vitro applications. Furthermore, FUNDING preliminary data suggest that a similar trend of hematopoietic differentiation was observed in serum-free conditions We thank CERCA/Generalitat de Catalunya and Fundació Josep indicating that the lack of significant differences in the Carreras-Obra Social la Caixa for institutional support. Financial hematopoietic output between both protocols is not support for this work was obtained from the Generalitat de masked by the presence of serum. Further side-by-side Catalunya (SGR180, PERIS 2017–2019) and the Spanish Ministry in vitro comparisons should comprehensively investigate of Economy and Competitiveness (RTC2018-4603-1) to PM. the hematopoietic output of the multiple combinations of PM is an investigator of the Spanish Cell Therapy cooperative morphogens and HGFs used in parallel or sequentially in EB- network (TERCEL). CB acknowledges financial support from based hematopoietic differentiation protocols reported from Health Institute Carlos III (PI20/00822). multiple laboratories. ACKNOWLEDGMENTS DATA AVAILABILITY STATEMENT We would like to thank Andrea Ditadi (Ospedale San Raffaelo, Milan, Italy) and Prof. Andrew Elefanty (Murdoch Children’s The raw data supporting the conclusions of this article will be Research Institute and Monash University, VIC, Australia) for made available by the authors, without undue reservation. sharing their H9:SOX17-Cherry-RUNX1C-GFP cell line. REFERENCES Gertow, K., Hirst, C. E., Yu, Q. C., Ng, E. S., Pereira, L. A., Davis, R. P., et al. (2013). WNT3A promotes hematopoietic or mesenchymal differentiation from hESCs Ayllón, V., Bueno, C., Ramos-Mejía, V., Navarro-Montero, O., Prieto, C., depending on the time of exposure. Stem Cell Rep. 1, 53–65. doi: 10.1016/j. Real, P. J., et al. (2015). The Notch ligand DLL4 specifically marks stemcr.2013.04.002 human hematoendothelial progenitors and regulates their hematopoietic fate. Kennedy, M., Awong, G., Sturgeon, C. M., Ditadi, A., LaMotte-Mohs, R., Zuniga- Leukemia 29, 1741–1753. doi: 10.1038/leu.2015.74 Pflucker, J. C., et al. (2012). T lymphocyte potential marks the emergence Bendall, S. C., Stewart, M. H., Menendez, P., George, D., Vijayaragavan, K., of definitive hematopoietic progenitors in human pluripotent stem cell Werbowetski-Ogilvie, T., et al. (2007). IGF and FGF cooperatively establish differentiation cultures. Cell Rep. 2, 1722–1735. doi: 10.1016/j.celrep.2012.11. the regulatory stem cell niche of pluripotent human cells in vitro. Nature 448, 003 1015–1021. doi: 10.1038/nature06027 Ledran, M. H., Krassowska, A., Armstrong, L., Dimmick, I., Renstrom, J., Lang, R., Bueno, C., Calero-Nieto, F. J., Wang, X., Valdes-Mas, R., Gutierrez-Aguera, F., et al. (2008). Efficient hematopoietic differentiation of human embryonic stem Roca-Ho, H., et al. (2019). Enhanced hemato-endothelial specification during cells on stromal cells derived from hematopoietic niches. Cell Stem Cell 3, 85–98. human embryonic differentiation through developmental cooperation between doi: 10.1016/j.stem.2008.06.001 AF4-MLL and MLL-AF4 fusions. Haematologica 104, 1189–1201. doi: 10.3324/ Medvinsky, A., Rybtsov, S., and Taoudi, S. (2011). Embryonic origin of the adult haematol.2018.202044 hematopoietic system: advances and questions. Development 138, 1017–1031. Chadwick, K., Wang, L., Li, L., Menendez, P., Murdoch, B., Rouleau, A., et al. doi: 10.1242/dev.040998 (2003). Cytokines and BMP-4 promote hematopoietic differentiation of human Menendez, P., Bueno, C., and Wang, L. (2006). Human embryonic stem cells: embryonic stem cells. Blood 102, 906–915. doi: 10.1182/blood-2003-03-0832 A journey beyond cell replacement therapies. Cytotherapy 8, 530–541. doi: Demirci, S., Leonard, A., and Tisdale, J. F. (2020). Hematopoietic stem cells from 10.1080/14653240601026654 pluripotent stem cells: Clinical potential, challenges, and future perspectives. Menendez, P., Wang, L., Chadwick, K., Li, L., and Bhatia, M. (2004). Retroviral Stem Cells Transl. Med. 9, 1549–1557. doi: 10.1002/sctm.20-0247 transduction of hematopoietic cells differentiated from human embryonic stem Ditadi, A., and Sturgeon, C. M. (2016). Directed differentiation of definitive cell-derived CD45(neg)PFV hemogenic precursors. Mol. Ther. 10, 1109–1120. hemogenic endothelium and hematopoietic progenitors from human doi: 10.1016/j.ymthe.2004.08.016 pluripotent stem cells. Methods 101, 65–72. doi: 10.1016/j.ymeth.2015.10.001 Ng, E. S., Azzola, L., Bruveris, F. F., Calvanese, V., Phipson, B., Vlahos, K., et al. Ditadi, A., Sturgeon, C. M., and Keller, G. (2017). A view of human haematopoietic (2016). Differentiation of human embryonic stem cells to HOXA(+) hemogenic development from the Petri dish. Nat. Rev. Mol. Cell. Biol. 18, 56–67. doi: vasculature that resembles the aorta-gonad-mesonephros. Nat. Biotechnol. 34, 10.1038/nrm.2016.127 1168–1179. doi: 10.1038/nbt.3702 Frontiers in Cell and Developmental Biology | www.frontiersin.org 6 May 2021 | Volume 9 | Article 636704 Gutierrez-Agüera et al. Hematopoietic Differentiation From hPSCs Ramos-Mejia, V., Navarro-Montero, O., Ayllon, V., Bueno, C., Romero, T., Real, cells originates from primitive endothelium with hemangioblastic properties. P. J., et al. (2014). HOXA9 promotes hematopoietic commitment of human Immunity 21, 31–41. doi: 10.1016/j.immuni.2004.06.006 embryonic stem cells. Blood 124, 3065–3075. doi: 10.1182/blood-2014-03- Wang, L., Menendez, P., Shojaei, F., Li, L., Mazurier, F., Dick, J. E., et al. (2005). 558825 Generation of hematopoietic repopulating cells from human embryonic stem Real, P. J., Ligero, G., Ayllon, V., Ramos-Mejia, V., Bueno, C., Gutierrez- cells independent of ectopic HOXB4 expression. J. Exp. Med. 201, 1603–1614. Aranda, I., et al. (2012). SCL/TAL1 regulates hematopoietic specification doi: 10.1084/jem.20041888 from human embryonic stem cells. Mol. Ther. 20, 1443–1453. doi: 10.1038/mt.2012.49 Conflict of Interest: The authors declare that the research was conducted in the Real, P. J., Navarro-Montero, O., Ramos-Mejía, V., Ayllón, V., Bueno, C., absence of any commercial or financial relationships that could be construed as a and Menéndez, P. (2013). The role of RUNX1 isoforms in hematopoietic potential conflict of interest. commitment of human pluripotent stem cells. Blood 121, 5250–5252. doi: 10.1182/blood-2013-03-487587 Copyright © 2021 Gutierrez-Agüera, Rodriguez-Cortez, Petazzi, Bueno and Sturgeon, C. M., Ditadi, A., Awong, G., Kennedy, M., and Keller, G. (2014). Wnt Menendez. This is an open-access article distributed under the terms of the Creative signaling controls the specification of definitive and primitive hematopoiesis Commons Attribution License (CC BY). The use, distribution or reproduction in from human pluripotent stem cells. Nat. Biotechnol. 32, 554–561. doi: 10.1038/ other forums is permitted, provided the original author(s) and the copyright owner(s) nbt.2915 are credited and that the original publication in this journal is cited, in accordance Wang, L., Li, L., Shojaei, F., Levac, K., Cerdan, C., Menendez, P., et al. with accepted academic practice. No use, distribution or reproduction is permitted (2004). Endothelial and hematopoietic cell fate of human embryonic stem which does not comply with these terms. Frontiers in Cell and Developmental Biology | www.frontiersin.org 7 May 2021 | Volume 9 | Article 636704