ASENJO ET AL. 259 A C K N O WL E D G M E N T S ORCID This study was supported by Science, Technology and Inno- Zhi-Chao Yang https://orcid.org/0000-0002-8939-9219 vation Commission of Shenzhen Municipality (Grant num- Zhi-Hui Deng https://orcid.org/0000-0002-2046-1467 ber: JCYJ20190806152001762) and Shenzhen Key Medical Discipline Construction Fund (number: SZXK070). RE FER EN CES 1. Robinson J, Mistry K, McWilliam H, Lopez R, Marsh SGE. IPD- CONFLICT OF INTEREST the immuno polymorphism database. Nucleic Acids Res. 2010;38: The authors declare no conflicts of interest. D863-D869. 2. Marsh SGE, Parham P, Dupont B, et al. Killer-cell immunologbulin-like receptor (KIR) nomenclature report, 2002. A U T H O R C ON T R I B U T I O N Tissue Antigens. 2003;62:79-86. Qiong Yu: Wrote the paper. Hao Chen: Analyzed the data. Zhi-Chao Yang: Contributed essential reagents, analyzed the data. Zhi-Hui Deng: Designed the research study, contributed essential reagents, analyzed the data. All authors have read and approved the final manuscript. How to cite this article: Yu Q, Chen H, All authors performed the research. Yang Z-C, Deng Z-H. Characterization of the novel KIR2DS2*022 allele identified in a northern DATA AVAILABILITY STATEMENT Chinese Han individual. HLA. 2021;98(3):257-259. The data that support the findings of this study are available https://doi.org/10.1111/tan.14345 from the corresponding author upon reasonable request. Complete genomic characterization of a new KLRC2 allele, NKG2C*03 Judit Asenjo1 | Aura Muntasell2,3 pez-Botet3,4 | Miguel Lo | Manuela Moraru1 | Carlos Vilches1 1 Immunogenetics & Histocompatibility Lab, Instituto de Investigaci on Sanitaria Puerta de Hierro—Segovia de Arana, Madrid, Spain 2 Department of Cell Biology, Physiology and Immunology, Universitat Autonòma de Barcelona, Bellaterra, Spain 3 Hospital del Mar Medical Research Institute (IMIM), Barcelona, Spain 4 University Pompeu Fabra, Barcelona, Spain Correspondence Carlos Vilches, Servicio de Inmunología, The novel NKG2C*03 allele encodes a hybrid of the NKG2C*01 and NKG2C*02 Hospital Universitario Puerta de Hierro, primary structures. Manuel de Falla 1, 28222 Majadahonda, Spain. KEYWORDS Email: carlos.vilches@yahoo.com alleles, genetic polymorphism, HLA-E, human genetics, natural killer cell lectin-like Funding information receptors, NKG2C receptor Consejería de Sanidad de la Comunidad de Madrid, Grant/Award Number: Nominative grant to support research in FIBHUPH; FP7-MINECO Infect-ERA program, EU, Grant/Award Number: PCIN-2015-191-C02-01/02; Fundaci on Científica Asociacion Española Contra el Cancer, Grant/Award Number: Manuela Moraru and Carlos Vilches share last authorship. 260 ASENJO ET AL. GCB15152947MELE; Ministerio de Ciencia e Innovacion/Agencia Estatal de Investigacion, FEDER, EU, Grant/Award Number: PID2019-110609RB-C22/ AEI/10.13039/501100011033 The CD94:NKG2 family of heterodimeric receptors, expressed on subsets of human natural killer (NK) and T lymphocytes, monitor the expression of HLA-E, pre- senting peptides mostly derived from the signal sequence of other HLA class I alpha chains.1,2 CD94:NKG2 heterodimers deliver inhibitory or activating signals, depending on the NKG2 subunit (mainly NKG2A and NKG2C, respectively). CD94 and all NKG2 subunits are type II membrane-integral glycoproteins of the C-type- lectin-like superfamily, with 49%–94% identity in their F I G U R E 1 Representation of the CD94:NKG2C receptor, coding sequence. Their genes are located in the Natural including the signaling adaptor DAP12 and its immunoreceptor Killer gene Complex (NKC) on chromosome 12, which tyrosine-based activation motifs (ITAMs, in red). Well-characterized encompasses nearly 2 Mbp, and encodes additional polymorphisms of the NKG2C primary structure are shown homologs of the same family. The activating NKG2C (or CD159c) subunit is encoded by the KLRC2 gene (more often referred to as KLRC2F-383/KLRR+485b (50 –ctattttatcttatggcacacaatcc– NKG2C), with a length of ca. 6 kbp comprising a 696-bp 30 /50 –ctggatagctttattgaagtgtca–30 ), and KLRFg669/KLRR coding sequence segmented into six exons.1,3,4 Homo- +623 (50 –cagtgtggatcttcaatg–30 /50 –gtcataaacaatcccatcag–30 ) and heterozygous complete KLRC2/NKG2C gene dele- (PCR conditions available upon request). Sequence analysis tions are seen in up to 8% and 32%, respectively, of revealed the new allele to be most similar to the Spanish Caucasoids and other populations.3,5,6 Several NKG2C*01 sequence in NKC clone with accession num- studies have addressed the distribution, functional ber AC277791.1–5815 identities in 5820 nucleotides, the effect, and importance of NKG2C deletion in different most relevant difference being the codon 2 substitution populations and health conditions, particularly cytomeg- AGT > AAT (Ser2Asn). Following the previously used alovirus infection, which specifically triggers differentia- format,4 we have designated the new allele with the tion and expansion of NK cells that express high NKG2C name NKG2C*03 (GenBank MW291142). The limited levels, and display a characteristic phenotype and number of nucleotide changes that separate the few function.3,5,6 In contrast, studies on NKG2C sequence genomic NKG2C*01/*02 sequences available in public polymorphism are scarce,1,3,4 possibly because the databases does not allow for asserting whether receptor family is often deemed, albeit inexactly, non- NKG2C*03 is an intermediate evolutionary step between polymorphic. A common complementary DNA sequence previously known alleles or evolved from these by inter- was designated NKG2C*01 by Shum et al,1,3,4 who also allelic recombination or point mutation. The structural named NKG2C*02 a second sequence, found in individuals and functional importance of CD94/NKG2 sequence of different ethnicities, and diverging from the former by polymorphisms, as well as the detailed three- two single-nucleotide nonsynonymous polymorphisms dimensional configuration of the involved stem and (c. 5G > A, Ser2Asn, and c.305C > T, Ser102Phe). The first cytoplasmic domains, remain unexplored. change affects the cytoplasmic tail, whilst the second is located in the stem that connects the transmembrane ACKNOWLEDGMENTS region with the ligand-binding domain. We thank Dr. Elvira Ramil, from the DNA sequencing We report here a novel allele, identified in two n Sanitaria core facility of Instituto de Investigaci o unrelated Spanish Caucasoids, that encodes asparagine Puerta de Hierro—Segovia de Arana, for continued 2, like NKG2C*02; and serine 102, like NKG2C*01; being support. This work was partially funded by grants the rest of their primary structures identical (Figure 1). The SAF2016-80363-C2-1/2-R from the Spanish Ministerio complete NKG2C coding region was amplified from an de Ciencia e Innovacio n (MCINN, Agencia Estatal NKG2C-hemizygous donor in two overlapping genomic de Investigaci on-AEI/FEDER, EU), and PCIN- segments, using a proof-reading DNA polymerase and two 2015-191-C02-01/02 (FP7-MINECO ERA-NET Infect- pairs of oligonucleotide primers in separate reactions— ERA program, EU) to C.V. and M.L.B. M.M. is hired by ASENJO ET AL. 261 grant GCB15152947MELE from the Asociacio n RE FER EN CES Española contra el Cancer Foundation; J.A. is hired by 1. Cantoni C, Biassoni R, Pende D, et al. The activating form of grant PID2019-110609RB-C22/AEI/10.13039/501100011033 CD94 receptor complex: CD94 covalently associates with the (AEI/FEDER, EU) to C.V. Publication costs are defrayed Kp39 protein that represents the product of the NKG2-C gene. by a nominative grant to support research from Con- Eur J Immunol. 1998;28(1):327-338. 2. Lopez-Botet M, Llano M, Navarro F, Bellon T. NK cell recogni- sejería de Sanidad de la Comunidad de Madrid in 2021 tion of non-classical HLA class I molecules. Semin Immunol. to Fundacio n de Investigacio n Biomédica Puerta de 2000;12(2):109-119. Hierro. 3. Hikami K, Tsuchiya N, Yabe T, Tokunaga K. Variations of human killer cell lectin-like receptors: common occurrence of CONFLICT OF INTEREST NKG2-C deletion in the general population. Genes Immun. The authors declare no potential conflict of interest. 2003;4(2):160-167. 4. Shum BP, Flodin LR, Muir DG, et al. Conservation and variation in human and common chimpanzee CD94 and NKG2 genes. A U T H O R C ON T R I B U T I O NS J Immunol. 2002;168(1):240-252. Judit Asenjo designed and performed experiments, ana- 5. Lopez-Botet M, Muntasell A, Vilches C. The CD94/NKG2C lyzed and interpreted data, and wrote the manuscript. +NK-cell subset on the edge of innate and adaptive immunity to Aura Muntasell and Miguel L opez-Botet designed the human cytomegalovirus infection. Semin Immunol. 2014;26(2): study and revised the manuscript. Manuela Moraru 145-151. designed the study and directed research. Carlos Vilches 6. Muntasell A, Lopez-Montanes M, Vera A, et al. NKG2C zygosity designed the study, directed research and wrote the influences CD94/NKG2C receptor function and the NK-cell manuscript. compartment redistribution in response to human cytomegalovi- rus. Eur J Immunol. 2013;43(12):3268-3278. DATA AVAILABILITY STATEMENT The data that support the findings of this study are avail- How to cite this article: Asenjo J, Muntasell A, able from the corresponding author upon reasonable L opez-Botet M, Moraru M, Vilches C. Complete request. genomic characterization of a new KLRC2 allele, NKG2C*03. HLA. 2021;98(3):259-261. https://doi. ORCID org/10.1111/tan.14231 Carlos Vilches https://orcid.org/0000-0002-0300-9225