Plant Biotechnology Journal (2021) 19, pp. 1798–1811 doi: 10.1111/pbi.13592 A novel Transposable element-derived microRNA participates in plant immunity to rice blast disease Sonia Campo†* , Ferran Sa nchez-Sanuy†, Rosany Camargo-Ramırez†, Jorge Go mez-Ariza, Patricia Baldrich‡, § Lidia Campos-Soriano, Mauricio Soto-Su arez and Blanca San Segundo Centre for Research in Agricultural Genomics (CRAG), CSIC-IRTA-UAB-UB, Campus Universitat Autonoma de Barcelona (UAB), Bellaterra (Cerdanyola del Valles), C/ de la Vall Moronta, CRAG Building, Barcelona, 08193, Spain Revised 15 February 2021; Summary accepted 2 March 2021. MicroRNAs (miRNAs) are small non-coding RNAs that direct post-transcriptional gene silencing in *Correspondence (Tel +34 935636600, ext plant development and stress responses through cleavage or translational repression of target 3131; fax 34 935636601; email mRNAs. Here, we report the identification and functional characterization of a new member of sonia.campo@cragenomica.es) ‡ the miR812 family in rice (named as miR812w) involved in disease resistance. miR812w is present Present address: Donald Danforth Plant in cultivated Oryza species, both japonica and indica subspecies, and wild rice species within the Science Center, 975 N Warson Road, St. Louis, MO, 63132, USA Oryza genus, but not in dicotyledonous species. miR812w is a 24nt-long that requires DCL3 for § n Colombiana Present address: Corporacio its biogenesis and is loaded into AGO4 proteins. Whereas overexpression of miR812w increased n Agropecuaria. AGROSAVIA, de Investigacio resistance to infection by the rice blast fungus Magnaporthe oryzae, CRISPR/Cas9-mediated Km 14 vıa Mosquera-Bogota, Mosquera, MIR812w editing enhances disease susceptibility, supporting that miR812w plays a role in blast 250047, Colombia resistance. We show that miR812w derives from the Stowaway type of rice MITEs (Miniature † These authors contributed equally to this Inverted-Repeat Transposable Elements). Moreover, miR812w directs DNA methylation in trans work. at target genes that have integrated a Stowaway MITE copy into their 30 or 50 untranslated region (ACO3, CIPK10, LRR genes), as well as in cis at the MIR812w locus. The target genes of miR812 were found to be hypo-methylated around the miR812 recognition site, their expression being up-regulated in transgene-free CRISPR/Cas9-edited miR812 plants. These findings further support that, in addition to post-transcriptional regulation of gene expression, miRNAs can exert Keywords: microRNA, plant their regulatory function at the transcriptional level. This relationship between miR812w and immunity, transposable element, Stowaway MITEs integrated into multiple coding genes might eventually create a network for methylation, CRISPR, Oryza sativa. miR812w-mediated regulation of gene expression with implications in rice immunity. dependent RNA polymerases (RDRs) or from sense-antisense Introduction transcript pairs. MicroRNAs (miRNAs) are a class of small non-coding RNAs that Plant MIR genes are thought to have originated by duplication direct gene silencing at the post-transcriptional level in eukary- events that created perfect inverted repeat loci that evolved by otes. In plants, miRNAs are transcribed from MIR genes as long random mutation into short, imperfectly paired, stem-loop single-stranded primary transcripts containing a unique stem-loop structures characteristic of MIR genes (Allen et al., 2004). The structure which is processed in two steps by a RNAse III DICER- spontaneous evolution from hairpin structures in the genome is LIKE (DCL) protein to produce double-stranded miRNA duplexes also believed to be the origin of plant miRNAs (De Felippes et al., (miRNA-5p/miRNA-3p, previously named miRNA/miRNA* 2008; Nozawa et al., 2012). Additionally, transposable elements duplexes) (Arikit et al., 2013; Axtell, 2013; Jones-Rhoades et al., (TEs) are regarded as an important source of inverted repeats and 2006; Rogers and Chen, 2013). The two strands of the miRNA- several miRNAs have been shown to derive from TEs (Cho, 2018; 5p/miRNA-3p duplex are methylated at the 30 end and the Li et al., 2011; Piriyapongsa and Jordan, 2008). Ancient MIR functional strand of the duplex is loaded into an ARGONAUTE genes give rise predominantly to canonical 21-nt miRNAs that are (AGO)-containing RNA-induced silencing complex (RISC) (Vau- generated by DCL1 (Kurihara and Watanabe, 2004). By contrast, cheret, 2008). miRNAs guide the RISC to the target mRNA via recently evolved miRNAs are processed by DCL3 or DCL4 (rather base pairing and mediate gene silencing through target cleavage than by DCL1) to produce miRNAs of variable length, usually 23- or translational inhibition (Brodersen et al., 2008; Llave et al., to 25-nt long-miRNAs (referred to as long miRNAs or lmiRNA) 2002). (Cuperus et al., 2011; Nozawa et al., 2012; Rajagopalan et al., Besides miRNAs, many other classes of small RNAs are 2006; Vazquez et al., 2008). Changes in the fold-back structure produced in plants, collectively termed small-interfering RNAs of a miRNA precursor have been proposed to determine DCL (siRNAs) that are distinguished from miRNAs by their distinct usage in precursor processing (from DCL3/DCL4 to DCL1) biogenesis pathways. Whereas miRNAs derive from single- (Cuperus et al., 2011; Nozawa et al., 2012). In rice and stranded RNA precursors with stem-loop structures, siRNAs arise Arabidopsis, the production of functional 24 nt miRNAs by from double-stranded RNA precursors produced by RNA- DCL3 is well documented (Chellappan et al., 2010; Cuperus 1798 ª 2021 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd. This is an open access article under the terms of the Creative Commons Attribution‐NonCommercial‐NoDerivs License, which permits use and distribution in any medium, provided the original work is properly cited, the use is non‐commercial and no modifications or adaptations are made. A transposon-derived microRNA involved in rice immunity 1799 et al., 2011; Vazquez et al., 2008; Wu et al., 2010; Zhu et al., population. Rice is also considered the model organism for 2008). functional genomics in monocotyledonous plants and reference MiRNAs function as central regulators of gene expression in genomes are available for both indica and japonica subspecies many aspects of plant growth and development (Chen, 2009; (Goff et al., 2002; Yu et al., 2002). At present, rice is the third Song et al., 2019), as well as in adaptive responses to abiotic and plant species with the highest number of miRNAs annotated in biotic stresses, including pathogen infection (Baldrich and San miRBase with 738 mature miRNAs (after Glycine max and Segundo, 2016; Li et al., 2010; Navarro et al., 2006; Staiger et al., Medicago truncatula, with 756 miRNAs each (miRBase release 2013; Sunkar et al., 2012; Weiberg et al., 2014). Even though, 22) (Kozomara et al., 2019). The biological function of only a most miRNAs so far identified in plants guide cleavage or small fraction of rice miRNAs has been deciphered. translational repression of target genes, certain miRNAs have One of the major factors limiting rice production is the rice been shown to direct DNA methylation (Bao et al., 2004; Wu blast disease caused by the fungal pathogen Magnaporthe oryzae et al., 2010). (Wilson and Talbot, 2009). Previous studies revealed that a The plant immune system consists of many interconnected substantial fraction of the miRNAome is regulated during processes that are induced upon pathogen recognition which are M. oryzae infection, and/or treatment with M. oryzae elicitors defined principally according to the molecules recognized by the in rice plants (Baldrich et al., 2015; Campo et al., 2013; Li et al., host plant. Plants recognize pathogen epitopes, known as 2016). However, only few miRNAs with a function in blast Pathogen-Associated Molecular Patterns (PAMPs), also known resistance have been reported, which include positive (miR7695, as elicitors, which then activates a general defence response miR160, miR162, miR398 and miR166k-166h) and negative referred to as PAMP-triggered immunity (PTI) (Boller and Felix, (miR156, miR164, miR167, miR169, miR319, miR396, miR442 2009; Jones and Dangl, 2006; Li et al., 2020a). PTI components and miR1873) regulators of immune responses (Campo et al., include protein phosphorylation/dephosphorylation, reinforce- 2013; Chandran et al., 2019; Li et al., 2014, 2017, 2020b; ment of cell wall, production of reactive oxygen species (ROS) Salvador-Guirao et al., 2018b; S anchez-Sanuy et al., 2019; Wang and induction of defence-associated genes (i.e. Pathogenesis- et al., 2018; Zhang et al., 2018b, 2020; Zhao et al., 2020; Zhou Related or PR genes). During co-evolution, pathogens have et al., 2019). Clearly, the involvement of miRNAs in rice immunity evolved effectors that are delivered to plant cells and suppress has only begun to emerge. PTI leading to disease susceptibility. In turn, some plants have In the present study, we describe a previously uncharacterized evolved another immune response in which microbial effectors, miRNA, a member of the miR812 family of rice miRNAs. The or host proteins modified by these effectors, are recognized by newly identified miRNA is provisionally designated as miR812w. proteins encoded by Resistance (R) genes. This recognition We show that CRISPR/Cas9-induced mutations in MIR812w triggers a rapid and effective host defence called Effector- results in enhanced susceptibility to M. oryzae infection. Con- Triggered Immunity (ETI). Most studies to date on plant immunity versely, MIR812w overexpression confers resistance to infection focused on transcriptional reprogramming induced by pathogen by the rice blast fungus M. oryzae. miR812w is a DCL3- infection, and less is known about post-transcriptional processes dependent 24 nt long miRNA that specifically associates with controlling disease resistance. AGO4. We also show that miR812w directs cytosine DNA Contrary to antiviral innate immunity which relies on RNA methylation in trans at miR812w target genes as well as at its silencing mechanisms, antibacterial and antifungal immune own locus. Collectively, results here presented support a role of responses have been traditionally considered as protein-based miR812w in controlling disease resistance in rice, most probably, defence mechanisms, largely independent of RNA silencing through methylation of target genes. mechanisms. Nowadays, the scenario has changed and RNA- based silencing mechanisms are known to play an important role Results both in PTI and ETI to bacterial and fungal pathogens in plants miR812w, a novel miRNA from rice (Staiger et al., 2013). Most of our knowledge about miRNAs involved in plant immunity comes from studies in the dicotyle- In previous studies, we reported a set of small RNAs representing donous model plant A. thaliana during interaction with the novel miRNA candidates from rice (Baldrich et al., 2015; Campo bacterial pathogen Pseudomonas syringae. Here, treatment with et al., 2013). In this study, one of those miRNA candidates the flagellin-derived elicitor peptide flg22 from P. syringae causes (previously named as miR-75; Campo et al., 2013) was selected an increase in miR393, and subsequent down-regulation of auxin for further investigation. receptor genes, leading to antibacterial resistance (Navarro et al., Initially, we investigated whether this small RNA fulfils the 2006). Other miRNAs with a known function in disease resistance criteria already established for the assignment of small RNA in Arabidopsis are: miR156, miR160, miR396, miR398, miR400, sequences as miRNAs (Axtell and Meyers, 2018). They included: miR472, miR773, miR844, miR858 and miR863 (Boccara et al., the structural features of the miRNA precursor and small RNAs 2014; Camargo-Ramırez et al., 2018; Lee et al., 2015; Li et al., mapping to this precursor, evidence of excision from the stem- 2010; Niu et al., 2016; Park et al., 2014; Salvador-Guirao et al., loop precursor structure and expression (RNA gel blotting and 2018a; Soto-Suarez et al., 2017; Yin et al., 2019). However, even data from small RNA-seq libraries), and existence of small RNA though an important number of miRNAs have been shown to be sequences forming a miRNA-5p/miRNA-3p duplex with 2 pathogen-responsive in different plant species, the biological nucleotide (nt) 30 overhands (a typical feature of DCL cleavage). function and mode of action of most of these pathogen- We also examined the accumulation of this small RNA in DCL and regulated miRNAs in immunity remains elusive. Key challenges RDR mutants, and its association to AGO proteins. remain with respect to the role of miRNAs controlling disease The predicted secondary structure for the precursor of the resistance in crop species. miRNA candidate under study is presented in Figure 1a. By Rice (Oryza sativa L) is one of the most important cereal crops mapping all small RNAs identified in small RNA libraries from rice and the primary source of food for more than half of the world’s tissues (leaves, roots) (Baldrich et al., 2015), a centred distribution ª 2021 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd., 19, 1798–1811 1800 Sonia Campo et al. of sequences mapping to the opposite arms of this structure (or the small RNAs mapping to the stem-loop region of this precursor isomiRs) was observed (Figure S1). miRNA isomers are known to were 24 nt in length (Figure S1). be produced during miRNA biogenesis and have been proposed A search in the miRBase registry revealed homology of the to be caused by DCL slippage (Gozmanova et al., 2017). Most of nucleotide sequence of this precursor with that of miR812 precur- sors from rice, the miR812 family consisting of 22 members (miR812a to miR812v) (Figure S2). The small RNA sequence mapping to the 3p arm of the precursor structure also showed A U U A (a) A A G G U U U U U 0.4 U RPM U U partial homology with mature miR812 sequences registered in C UU C U U miR812w-5p 0.2 U UUU A U U U C GUUA 5’ 0 U U C G A UA GU GC AU A UA GC AU GC GC GC AU GC GC CG A AU C GA GU GC GU UA UA UA CG UA CG UG AU GC GU AU AU UA GC AU CG UA AU UA UA UA GC A U CG UA AU GU CG GC CG AU GC CG AU AU AU GC AU GC UA UA UA GU GU AU GC UA GC UA AU AU AU U AC UA UA AU GC GU UA UA AU UA UA UA UA AU miRBase (Figure S3). Here, it should be mentioned that the UA 3’ U U C 0 A U G C A RPM GU 0.2 AU CU miR812w-3p U U annotated mature miR812 family members have substantial differ- A U 0.4 C U U U U U U A U A U U U (b) ences among them (Figure S3). Likely previously performed anno- pre-miR812w miR812w-5p miR812w-3p tations of miR812 species need to be revised. Following naming in 0.6 Expression level miRBase, we provisionally named this miRNA as miR812w. 24nt MIR812w was expressed in leaves of rice plants, but not in 0.3 21nt roots (Figure 1b, left panel). Most notably, DNA sequencing of the RT-PCR products using specific primers designed to amplify U6 snRNA the precursor structure revealed that both 5p and 3p small RNAs 0.0 Leaf Root are comprised in the miR812w precursor transcription unit, confirming the identity of the miR812w precursor and excluding (c) Monocotyledonous Dicotyledonous the possible amplification of other miR812 precursors. Small RNA northern blot analysis confirmed the accumulation of both N. benthamiana S. lycopersicum miR812w-5p and miR812w-3p small RNA species in rice leaves, B. dystachion M. truncatula T. aestivum of which miR812w-3p sequences accumulated at the highest A. thaliana H. vulgare S. bicolor T. durum O. sativa Z. mays C. melo level (Figure 1b, right panel). The higher accumulation of G. max miR812w-3p sequences was also observed by sRNAseq analysis in rice leaves (Figure 1a; Figure S1). Together, these findings miR812w support that miR812w represents a previously uncharacterized U6 snRNA member of the miR812 family. (d) miR812w is detected in rice, but not in other plant Cultivated rice Wild rice species O. sativa O. glaberrima According to miRBase, miR812 family members are identified only in japonica indica javanica rice. To investigate whether miR812w is present in plant species IRGC 103544 IRGC 104042 other than rice, we examined miR812w accumulation in several O.spontanea O. barthii (1) O. barthii (2) O. rufipogon Nipponbare ARC 13309 ARC 10557 ARC 10276 O.officinalis Ketan Jobe Razza 115 O. latifolia monocotyledonous and dicotyledonous species. As shown in O. nivara Dongjin Figure 1c, miR812w was detected only in rice but not in any of the IR36 IR64 other monocotyledonous or dicotyledonous species assayed in this work. This finding suggests miR812w might be a rice-specific miRNA miR812w that could have evolved after monocot-dicot divergence. U6 snRNA Next, we examined miR812w accumulation in cultivated and wild rice species. The genus Oryza comprises two cultivated Figure 1 Validation of the novel miRNA candidate under study as a species, Oryza sativa (Asian rice) and Oryza glaberrima (African novel miRNA from rice. The newly identified miRNA is a member of the rice). Oryza sativa is the most extended cultivated rice and rice miR812 family, which has been named as miR812w. (a) Structure of comprises japonica and indica subspecies. Further, japonica rice is the miRNA precursor. The small RNAs identified in small RNA-seq classified into temperate japonica (japonica) and tropical japonica datasets (Baldrich et al.,2015) mapping to the 50 and 30 arm of this (javanica). In this work, rice varieties representative of O. sativa precursor (named as miR812w-5p and miR812w-3p) are 24-nt in length (japonica, javanica and indica) and O. glaberrima were examined and have 2-nt overhangs at both 30 ends. RPM, Reads per million. (b) for miR812w accumulation (rice accessions and genome type are Accumulation of miR812w precursor transcripts in leaves and roots of indicated in Table S1). Although at a different level, miR812w 21 days-old rice plants (left panel) as determined by RT-qPCR. Northern accumulated in all the cultivated rice varieties, both O. sativa and blot detection of miR812w-5p and miR812w-3p (right panel) in leaves of O. glaberrima cultivars (Figure 1d). When examining miR812w 21 days-old rice plants. A representative blot out of three independent accumulation in wild rice, miR812w accumulation was observed biological replicates is shown. (c) Northern blot analysis of osa-miR812w in monocotyledonous and dicotyledonous species. (d) Northern blot in O. rufipogon, O. nivara and O. spontanea, but not in O. lat- analysis of osa-miR812w in cultivated varieties of the genus Oryza ifolia or O. officinalis (Figure 1d). miR812w also accumulated in (O. sativa, Asian rice; O. glaberrima, African rice) and wild species of the O. barthii, the wild relative of O. glaberrima (African rice) genus Oryza. The small RNA fraction obtained from 100 lg of total RNA (Figure 1d). All the wild species in which miR812w was present was probed with a P32-labelled synthetic oligonucleotide complementary have an AA-genome type, while Oryza species in which miR812 to the miR812w-3p sequence (indicated in Table S4). RNA blots were was absent have a CC (O. latifolia) or CCDD (O. officinalis) also probed with the U6 probe for loading control (lower panel). genome (Table S1). The observation that miR812w is present in Oligonucleotide sequences used as primers are listed Table S4. The the ancestors of modern Oryza cultivars, namely O. nivara and complete list and geographical distribution of Oryza species analysed in O. rufipogon (the two closest relatives of Asian rice O. sativa) this study is indicated at Table S1 (Choi et al., 2017; Wang et al., 2014) and O. barthii (the wild ª 2021 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd., 19, 1798–1811 A transposon-derived microRNA involved in rice immunity 1801 ancestor of African rice O. glaberrima) (Choi et al., 2017; Wang (a) (b) et al., 2014) might be indicative of conservation during domes- 0.6 WT dcl1 dcl3 dcl4 miR812w tication of Oryza rice (Asian and African rice). (RPM) miR812w 0.3 miR812w is processed by DCL3 and specifically associates U6 snRNA with rice AGO4 0.0 WT 1 3 As previously mentioned, ancient miRNAs are generated by DCL1 dcl3-a which gives rise to 21-nt canonical miRNAs, whereas recently (c) (d) evolved miRNAs are preferentially processed by DCL3 and/or 50 AGO4b-bound 50 AGO1a-bound small RNAs (RPM) small RNAs (RPM) DCL4 to produce different sizes of miRNAs (Cuperus et al., 2011; Rajagopalan et al., 2006; Vazquez et al., 2008). In this study, we 25 25 investigated the accumulation of miR812w sequences in knock- down Osdcl1, Osdcl3 and Osdcl4 rice mutants (Liu et al., 2005, 2007; Song et al., 2012). Northern blot analysis of small RNAs 0 0 revealed that, compared with the wild-type plants, the accumu- 5p 3p 5p 3p lation of miR812w was compromised in the dcl3, but not in the 50 AGO4a-bound 50 AGO1b-bound small RNAs (RPM) small RNAs (RPM) dcl1 or dcl4 mutants (Figure 2a). Definitive probe of DCL3 dependence for miR812w production was obtained by surveying the pre-miR812w-derived small RNA sequences in available data 25 25 sets of rice dcl mutants (Wei et al., 2014), observing a strong decrease in miR812w species in dcl3a mutants (Figure 2b), but 0 0 not in the dcl1 mutant (Figure S4). More importantly, miR812w 5p 3p 5p 3p accumulation was not abolished in the rdr2-2 mutant, indicating that the biogenesis of miR812w does not require RDR2 (Fig- 50 Total RNA 50 Total RNA small RNAs (RPM) small RNAs (RPM) ure S4). Instead, miR812w accumulated in the rdr2-2 mutant plants, a phenomenon that has been previously observed for 25 25 other rice and Arabidopsis miRNAs in rdr2 mutants (Kasschau et al., 2007; Wu et al., 2010). An overrepresentation of miRNAs appears to occur when the production of RDR2-dependent 24-nt 0 0 siRNAs is lost in the rdr2 mutant plants (Wu et al., 2010). 5p 3p 5p 3p Altogether, these results support the involvement of DCL3 in the Figure 2 Biogenesis of miR812w. (a) Northern blot analysis of miR812w production of mature 24-nt MIR812w species. in rice dcl1, dcl3 and dcl4 mutants. RNA blots were also probed with the Apart from their biogenesis, the mode of action of small RNAs U6 probe for loading control (lower panel). (b) Abundance of miR812w-3p is tightly related with the Argonaute protein, the effector protein in dcl3a rice mutant lines. (c-d) Total sRNA and AGO-bound reads plotted of the RISC, to which they can bind (Vaucheret, 2008). Whereas over the miR812w precursor. The 5p and 3p arms are indicated. (b-d) canonical 21-nt miRNAs having a 50 -terminal uridine (5’ U) Small RNA data were obtained from published libraries from seedlings of preferentially and stably associate with AGO1, AGO4 predomi- O. sativa cv Nipponbare of dcl3a mutant lines (Wei et al.,2014) and nantly recruits 24-nt small RNAs with a 50 -terminal adenine (50 A). immunoprecipitation with AGO proteins (Wu et al.,2009, 2010). Scale bar Examining AGO-bound sRNA is then a starting point in distin- indicate small RNA read number normalized per one million reads (RPM) guishing functional from non-functional miR812w species. To determine miR812w AGO loading preference, we examined available datasets of AGO-associated small RNAs from rice, namely AGO1 (AGO1a and AGO1b) and AGO4 (AGO4a and gene or expressing an artificial target mimics. The target mimicry AGO4b) (Wu et al.,2009, 2010). Sequences from the miR812w- technology, however, does not discriminate among miRNA family 3p strand were found to be specifically associated with AGO4b members sharing mature miRNA sequences. and to a lesser extent also to AGO4a (Figure 2c). Conversely, no miR812w was originally identified in a search for miRNAs miR812w enrichment was observed in any of the AGO1 proteins whose accumulation is regulated by treatment with elicitors (Figure 2d). This fact agrees with preferential loading of AGO4, as obtained from the rice blast fungus M. oryzae (Campo et al., miR812w-3p is a 24-nt small RNAs with a 50 -terminal adenine 2013; previously named as miR-75). To investigate whether (50 A). These findings suggest that miR812w-3p exerts its function MIR812w plays a role in blast resistance, we used the CRISPR/ through the AGO4-containing RISC and that miR812w-3p is the Cas9 technology. A sgRNA was designed for targeting the functional strand of the miR812w duplex. MIR812w precursor sequence which contains a Protospacer Adjacent Motif (PAM) sequence (UGG) close to the 50 end of CRISPR/Cas9-mediated mutagenesis of MIR812w the mature miR812w sequence (Figure 3a). PCR analysis of enhances susceptibility to infection by M. oryzae genomic DNA followed by DNA sequencing using gene-specific The functional analysis of MIR genes has been challenging, in primers located upstream and downstream of the target site was part, due to the lack of effective approaches to obtain loss-of- used to identify CRISPR/Cas9-induced mutations. In this way, function mutations of MIR genes. Traditional approaches to study three independent mutant alleles were identified in hygromycin- the function of MIR genes (e.g. mutagenesis) are largely resistant T0 plants, which contained a deletion of 22 nucleotides ineffective due to the small size of MIR genes, and most of our (D22nt), a deletion of 3 nucleotides (D3nt), or an insertion of 1 current understanding of miRNA function comes from transgenic nucleotide (+1nt) (Figure 3a). Mutations detected in T0 followed lines overexpressing either a miRNA or a miRNA-resistant target Mendelian inheritance without the occurrence of mutations ª 2021 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd., 19, 1798–1811 1802 Sonia Campo et al. different from those mentioned above. Plants bearing one of abolish mature miR812w accumulation, which can be attributed these alleles (D22nt, D3nt or +1nt,) were selected for subsequent to either inefficient processing of the miR812w precursor or analyses. cross-hybridization with other miR812 family members. An examination of the predicted secondary structure of the Homozygous Cas9-free CRISPR/Cas9-edited miR812 plants CRISPR/Cas9-edited mutant alleles revealed that the D22nt harbouring the 22 deletion at the miR812w locus were deletion removes the lower stem region of the miR812w identified (Figure S5a). The miR812w-Δ22 plants grew and precursor, whereas the D3nt or +1nt mutations does not developed normally, although at the adult stage these plants substantially affect its secondary structure (Figure 3b). We were slightly smaller in height than wild-type plants (Figure S5b). reasoned that the 22 nt deletion may have a significant impact Next, we examined whether the D22 mutation generated in on miR812w production. Along with this, small RNA northern the MIR812w precursor by the CRISPR/Cas9 system has a blot analysis revealed a drastic reduction on the accumulation of consequence in blast disease resistance of rice. For this, three- mature miR812w sequences in the D22nt mutant (hereafter week-old mir812w-Δ22 mutant and control plants were spray- named as miR812w-Δ22 plants) (Figure 3c). In contrast, inoculated with M. oryzae spores, and disease symptoms were miR812w accumulation was not affected in the +1nt mutant followed over time. Compared with wild-type plants, the plants (Figure 3c). The D22nt deletion, however, did not totally homozygous mir812w-Δ22 plants consistently exhibited higher (a) PAM miR812w-5p Δ22nt CUCCC-----------------------UCUGGAUUUUCGUGUCCAACUUUGAUUGUCCGUCUUA Δ3nt CUCCCUCCGUUCUAAAAAAAGGCA----UCUGGAUUUUCGUGUCCAACUUUGAUUGUCCGUCUUA +1nt CUCCCUCCGUUCUAAAAAAAGGCAAAACUCUGGAUUUUCGUGUCCAACUUUGAUUGUCCGUCUUA WT CUCCCUCCGUUCUAAAAAAAGGCAAA.CUCUGGAUUUUCGUGUCCAACUUUGAUUGUCCGUCUUA A U U A A A G GU U U U U U U U C UU C U Δ22nt U U Δ3nt UUU A U U U U C GUUA 5’ +1nt A PAM miR812w-5p U U C G A UA GU GC AU A UA GC AU GC GC GC AU GC CG GC A AU C GA GU GC GU UA UA UA CG UA CG UG AU AU GC GU AU UA GC AU CG AU UA UA UA UA GC A U CG UA AU GU CG GC CG AU AU GC CG AU GC AU AU UA AU GC GC UA UA GU GU UA GC AU UA AU AU U AC UA AU UA GC GU UA UA AU UA UA UA UA AU UA 3’ U U C U A G C A 248nt, 107.10 kcal/mol U UG AU C U U A U C U U U U U U A U A U U U (b) Lower Upper Terminal stem stem loop U A U U G G U A U A A U U U U U U C C U U U U A UA Δ22nt GU UUU A U U GC C GUU AU UA U GC G A A AU UU AC GC U U A GU A A A A A GC U A A U GC A GC U A U A U A A U A U U A AU A U A U GC CG A U GC GC A U CG GU A GC GU U U U U U U CG U A A UA A U A U CA U GC GU C A UA GC UA GC CG GU CG A U U GCGU GC A U A U A U A G A U CG A A G C GU U A (c) CG U UU U UG CU UUG UU U U A G U U U U A U U U C U U U U A U A U U U U 226nt, 79.00 kcal/mol U U CG U A CRISPR U A A A U U U U U U Δ3nt U C U G U miR812w U AU U C GUU U UUU A U G A A UU AC A U GU UA A GC A A A U AU UA A UA GU GC AU UA GC AU UA GC UA AU UA GC AU GC AU AU UA AU GC GC CG AU GC CG GC GC AU CG AU GU GU GU GC CG GU UA AU AU C GA UA AU GC UA GC CG UA GC UA UA GU CG AU UA GC AU U U U AU U U UA AU A AU U CG CG A UA UG UA AU GC GC GU UA Δ22nt +1nt A WT A G C GU U A C U U U U U U 245nt, 98.90 kcal/mol CU AU U U U A U miR812w-3p C U U U U A U A U U U U U CG U A U U A A A U U U U U U U miR812w-5p C U U G +1nt U AU U C GUU UUU A U U G A A A A U U AC U C AU GC GU UA AU UA UA UA UA UA AU UA AU UA UA AU UA AU C GA AU UA CG GC AU GC CG GC U AA AU GU CG GU CG CG AU UA AU CG AU AU AU AU AU GC AU GU GC GC GC AU UA UA GU GC UA UG GC UA CG CG GU GC AU GC AU GC GC GC AU GC GC AU GU GC GU UA UA UA UA UA UA UA UA UA U C A G U U GU U C A U6 snRNA U 249nt, 103.30 kcal/mol CU AU U U U A U C U U U U U A U A U U U (d) CRISPR miR812w (e) WT Δ22nt +1nt 10 1.6 * Fungal Biomass Lesion area (%) * 5 0.8 0 0.0 WT Δ22nt +1nt WT Δ22nt +1nt CRISPR miR812w CRISPR miR812w 1 cm Figure 3 CRISPR/Cas9-induced mutations in the MIR812w gene and infection phenotype to M. oryzae. (a) Mutations generated by CRISPR/Cas9 editing are shown in the upper part of the miR812w precursor structure. Three miR812w alleles were obtained: D22nt, D3nt and +1nt. Dashes indicate deletions. In bold, single nucleotide insertion. The PAM motif (UGG) is next to miR812w-5p. WT, Wild-type. (b) Predicted secondary structure of the mutated miR812w precursor (Δ22nt, Δ3nt, +1nt) using RNAfold. The length of the precursor (nt) and the minimum free energy of folding (MFE, kcal/mol) are indicated. The position of the CRISPR/Cas9 mutation is indicated by an arrow. (c) Accumulation of miR812w as determined by northern blot using a 32P- labelled oligonucleotide for detection of miR812w-3p and miR812w-5p (Table S4). The small RNA fraction was isolated from total RNA of leaves (WT, D22nt, +1nt plants). RNA blots were also probed with the U6 probe for loading control (lower panel). (d–e) Disease phenotype of mir812w-Δ22 and mir812w+1 rice plants. (d) Representative images of M. oryzae-infected CRISPR/Cas9-edited miR812w plants at 7dpi. (e) Quantification of blast lesions was carried out by image analysis (left panel). Relative quantification of fungal biomass was determined by qPCR using specific primers for M. oryzae 28S DNA (values are fungal DNA levels normalized against the rice Ubiquitin 1 gene (right panel). Primers are listed in Table S4. Data from one representative experiment of three independent experiments are presented as the mean  SE (n = 15) (Student t-test, *P < 0.05), which gave similar results ª 2021 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd., 19, 1798–1811 A transposon-derived microRNA involved in rice immunity 1803 susceptibility to M. oryzae infection (Figure 3d). The enhanced (a) susceptibility of mir812w-Δ22 plants was confirmed by quantifi- pre-MIR812w 14 Expression level cation of the area of blast lesions and the amount of fungal * biomass in the infected leaves (Figure 3e). No clear differences 7 * were observed in disease susceptibility between CRISPR/Cas9- edited MIR812w plants carrying the +1nt insertion (mir812w+1) * compared to wild-type plants (Figure 3d, e), which is consistent 0 with the observation that the 1 nt insertion does not greatly EV AZ affect miR812w accumulation (Figure 3c). It is tempting to miR812w-3p hypothesize that removal of the lower stem region of miR812w U6 snRNA precursor structure in the mir812w-Δ22 mutant might affect WT 3 6 9 miR812w precursor processing, hence, miR812w function. miR812w OE Taken together, these results demonstrate that a deletion of 22nt in the MIR812w precursor is accompanied by an increase on (b) miR812w OE susceptibility to infection by the blast fungus M. oryzae. These EV AZ WT 3 6 9 findings also illustrate the usefulness of the CRISPR/Cas9 tech- nology for the analysis of miRNA function. MIR812w overexpression increases resistance to M. oryzae infection Knowing that a mutation generated by CRISPR/Cas9 editing 1 cm results in enhanced susceptibility to M. oryzae infection, we (c) sought to investigate the effect of miR812w overexpression in Fungal Biomass Lesion area (%) 50 pathogen resistance. For this, we generated transgenic rice (O. sativa cv Nipponbare) constitutively expressing MIR812w (hereafter named as miR812w-OE plants) (Figure S6a). Before 25 transforming rice, we confirmed efficient processing of the cloned pre-osa-miR812w precursor into mature miR812w by transient expression in Nicotiana benthamiana (Figure S6b). 0 * * * 1.6 Compared with control plants (wild-type, empty vector trans- genic plants and azygous lines segregated from T0 plants), the miR812w-OE lines accumulated higher levels of precursor and 0.8 mature miR812w sequences (Figure 4a). No obvious phenotypical differences between homozygous miR812w-OE plants and wild- type plants were observed (Figure S6c). The transgenic miR812w- 0.0 EV AZ WT *3 *6 *9 OE lines contained a single copy of the transgene (T3 generation) miR812w OE as revealed by qPCR using the singly copy SPS (sucrose phosphate synthase) gene for normalization (Table S2). Figure 4 Resistance of rice plants overexpressing MIR812w (miR812w- Blast resistance assays were performed with three independent OE) to M. oryzae infection. Three independent miR812w-OE lines and homozygous miR812w-OE lines. By visual inspection, the control plants (EV, AZ and WT) were assayed. WT, wild-type; EV, miR812w-OE plants consistently showed reduced disease symp- transgenic empty vector; AZ, segregated azygous plants. (a) Accumulation toms as compared with control plants (Figure 4b). Quantification of miR812w precursor transcripts (upper panel) and mature miR812w of symptoms in leaves confirmed that miR812w-OE plants (lower panel) sequences in transgenic rice lines determined by RT-qPCR exhibited smaller areas of blast lesions and less fungal biomass and small RNA northern blot analysis, respectively. Lower panels show U6 small RNA (snRNA) as loading controls. (b–c) Disease phenotype of than those on control plants (Figure 4c). Same results were miR812w-OE plants (d) Representative images of M. oryzae-infected observed at the T2 and T3 generation. Consistent with the miR812w-OE plants at 7dpi. Scale bar (1 cm). (e) Quantification of blast phenotype of blast resistance, miR812w-OE plants exhibited a lesions and fungal biomass was carried out by image analysis and qPCR higher induction of PR1 expression (a marker of pathogen- using specific primers for M. oryzae 28S DNA, respectively (as in Figure 3). induced defence responses) compared to that in wild-type plants Primers are listed in Table S4. Data from one representative experiment of (Figure S7). In contrast, M. oryzae inducibility was compromised three independent experiments are presented as the mean  SE (n = 15) in mir812w-Δ22 (Figure S7). Collectively, results here presented (Student t-test, *P < 0.05), which gave similar results indicated that MIR812w overexpression enhances resistance to infection by the blast fungus M. oryzae, while CRISPR/Cas9- edited mir812w-Δ22 rice plants exhibited blast susceptibility. These findings further support for the involvement of miR812w in on the host response to pathogen infection, we sought to blast resistance in rice. determine whether MIR812w expression was itself pathogen- responsive in wild-type plants. Compared with non-infected H2O2 accumulation in M. oryzae-infected leaves of plants, MIR812w expression was transiently activated during miR812w overexpressor and CRISPR/Cas9-edited plants M. oryzae infection (at 48 h post-inoculation) (Figure 5a, left Knowing that an alteration in MIR812w expression by either panel). Treatment with a crude preparation of M. oryzae elicitors overexpression or CRISPR/Cas9-induced mutation has an effect also increased MIR812w expression (Figure 5a, right panel). ª 2021 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd., 19, 1798–1811 1804 Sonia Campo et al. The accumulation of reactive oxygen species (ROS) is a (a) common feature of basal resistance to pathogen infection in 1.2 4.4 * Expression level plants (Torres et al., 2006). ROS act as antimicrobial agents and * signalling molecules during the plant response to pathogen infection. In this work, 3,30 -diaminobenzidine (DAB) staining was 0.6 2.2 used to visualize H2O2 accumulation in leaves of miR812w-OE and CRISPR/Cas9-edited (mir812w-Δ22) plants. Histochemical 0.0 0.0 analyses showed that, compared to wild-type plants, miR812w- 0h - + - + - + - + - + - + OE plants accumulated more hydrogen peroxide (H2O2) after 24h 48h 72h 96h 30’ 2h infection with M. oryzae spores or treatment with M. oryzae (b) miR812w elicitors (Figure 5b, c). To note, miR812w-OE plants does not WT OE #6 OE #9 CRISPR Δ22nt accumulate H2O2 in a constitutive manner, but only after inoculation with fungal spores (or elicitor application). As for Mock the CRISPR/Cas9-edited rice plants, H2O2 was barely detected in M. oryzae-infected or elicitor-treated leaves of these plants (Figure 5b, c). The enhanced accumulation of H2O2 in leaves of Elicitors mi812w-OE plants might well help to prevent disease progres- sion, which is consistent with the phenotype of disease resistance observed in these plants. Infection miR812w is a MITE-derived miRNA Earlier studies in rice and Arabidopsis reported that lmiRNAs (e.g. 24-nt long miRNAs) might arise from Transposable elements (TE) (c) Infection (Vazquez et al., 2008; Wu et al., 2010). In this work, we carried 30 out a search for homologous sequences in transposable elements using the RepeatMasker web server (www.repeatmasker.org/). This analysis revealed strong sequence similarity between 20 % Area MIR812w and the miniature inverted-repeat element (MITE) stowaway family of non-autonomous DNA transposons from rice (Figure S8). MITEs are non-autonomous Transposable elements 10 (TEs) that are often found in untranslated regions (UTRs) of coding genes (Casacuberta et al., 1998; Santiago et al., 2002), and Stowaway is one of the most abundant type of MITEs in the 0 rice genome (Feschotte et al., 2003). It is also known that the WT OE #6 OE #9 Δ22nt miR812w presence of the Stowaway family is highly associated with speciation in the AA-type genome lineage of Oryza species Figure 5 MIR812w expression in wild-type rice plants during M. oryzae (Kanazawa et al., 2000), which is consistent with our finding that infection, and H2O2 accumulation in miR812-OE and CRISPR/Cas9-edited miR812w is detected in wild species that have an AA-type plants. (a) The accumulation of miR812w precursor transcripts was genome, but not in wild species with a CC (O. officinalis) or determined by RT-qPCR at the indicated times after inoculation with a CCDD (O. latifolia) genome (shown in Figure 1d). Whether suspension of M. oryzae spores (left panel) or treatment with M. oryzae miR812w is specific of AA-genome wild rice species deserves elicitors (right panel). Data from one representative experiment of three further investigation. independent experiments are presented as the mean  SE (n = 3; each sample consisted of a pool of 10 individual leaves; *P < 0.05, ANOVA Rice genes carrying an insertion of a Stowaway MITE are test). (b) DAB staining to visualize H2O2 accumulation in wild-type, predicted as mi812w target genes miR399-OE and CRISPR/Cas9-edited plants carrying the Δ22 deletion. Unlike animal miRNAs, plant miRNAs require extensive com- miR812w-OE plants inoculated with M. oryzae accumulated more H2O2 plementarity for target recognition (Axtell and Meyers, 2018). that did wild-type plants, whereas little DAB staining could be observed in In this work, the psRNATarget server was used for prediction of M. oryzae-inoculated leaves of mir812w-Δ22 plants. (c) H2O2 miR812w target genes (Dai et al., 2018). By using a score accumulation in M. oryzae-infected leaves was quantified on digital threshold of 3, up to 39 genes were predicted as target genes photographs using imageJ (https://imagej.nih.gov/ij/) for miR812w, these genes functioning in diverse biological processes, including signalling processes and defence responses (Table S3). Furthermore, we noticed that 36 out of the 39 predicted target genes of miR812w contained a Stowaway reported Parallel Analysis of RNA Ends (PARE) libraries obtained MITE insertion embedded within their untranslated region from rice tissues (Baldrich et al., 2015). PARE analyses did not (UTR), most of them at the 30 UTR (29 genes at the 30 UTR; yield high-confidence miR812w targets. Equally, no target 6 genes at the 50 UTR) (Table S3). On this basis, we reasoned cleavage was detected by RLM-RACE for any of the predicted that Stowaway-containing target genes could be target genes miR812w targets here examined (e.g. bHLH064, RIP1, CIPK10, of miR812w. LRR, ACO3, Glucan endo-1,3-b-glucosidase 7, UDP-glucoronosyl We investigated whether miR812w could direct cleavage of and UDP-glucosyl transferase). This observation suggests that predicted target transcripts. For this, we initially searched for miR812w is unlikely to function by directing cleavage of cleavage products of the predicted target genes in previously Stowaway-containing target genes. ª 2021 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd., 19, 1798–1811 A transposon-derived microRNA involved in rice immunity 1805 plants (Figure 7). The observed reduction of DNA methylation miR812w mediates DNA methylation of target genes caused by a mutation in the miR812w locus (miR812w-D22 and at its own locus plants) is associated to the activation of ACO3, CIPK10 and LRR In rice, DCL3-dependent 24nt-long miRNAs are known to direct expression. This observation is indicative of a miR812w-mediated DNA methylation at their target genes (in trans), as well as at loci regulation of ACO3, CIPK10 and LRR expression, most probably, of their origin (in cis) in rice (Hu et al., 2014; Wu et al., 2010). This through DNA methylation, with potential influence on disease piece of evidence together with the observation that miR812w susceptibility. However, the possibility that other targets of was found to associate with AGO4, which is involved in DNA miR812w may also function in resistance to M. oryzae infection methylation, prompted us to investigate whether miR812w can in rice plants should not be ruled out. direct DNA methylation either in trans (at its predicted target transcripts), or in cis (at its own locus). Discussion Bisulfite sequencing was used to analyse the status of DNA methylation of 3 genes that were predicted as miR812w target In this study, we provide evidence that miR812w represents a genes. They were: 1-aminocyclopropane-1-carboxylate oxidase3 new member of the miR812 family of rice miRNAs that mediates (ACO3, Os02g53180), Calcineurin B Like (CBL)-interacting serine– pathogen resistance. We demonstrated that constitutive expres- threonine protein kinase (CIPK10, Os03g22050) and Leucine sion of MIR812w confers resistance to M. oryzae infection. Repeat-containing protein (LRR, Os06g04830) genes (Figure 6a). Conversely, CRISPR/Cas9-edited MIR812w rice plants are more The Stowaway MITE was present at the 50 UTR (ACO3) or the 30 susceptible to infection. Not only pathogen infection, but also UTR (CIPK10, LRR), and contained the miR812w-3p target treatment with fungal elicitors is accompanied by a transient sequences (the alignment of the MIR812w precursor sequence increase in MIR812w expression. with that of the MITE sequence embedded in ACO3, CIPK10 and Several pieces of data support that miR812w is a novel, LRR genes is shown in Figure S9). Regarding the function of these evolutionarily recent MIR gene from rice. First, the MIR812w genes, ACO genes are known to be involved in the final step of precursor is processed by DCL3 and gives rise to 24-nt long ethylene biosynthesis, this hormone being a modulator of disease mature miR812w species (as revealed by northern blotting and resistance in plants (van Loon et al., 2006). A function of disease analysis of small RNA populations in dcl mutants). The miR812w resistance (R) gene is predicted for the LRR gene examined in this precursor structure also shows a high degree of complementarity work (Plant Resistance Genes database, from Pythozome, http:// in the stem region, as it is generally observed in precursor prgdb.crg.eu). CIPK serine–threonine protein kinases are known structures of evolutionary young MIR genes. Second, the 24-nt- to interact with CBL proteins (Ca2+ sensor proteins) for the derived miR812w-3p species were found to associate with AGO4, regulation of biotic stress responses. Distinct CIPKs from rice were supporting that miR812w is functional. In this respect, it is well reported to play a role in PTI and ROS production in rice (Kurusu known that DCL3-processed 24-nt long miRNAs are specifically et al., 2010). sorted into AGO4 (Wu et al., 2010), whereas ancient 21-nt DNA methylation of ACO3, CIPK10 and LRR was examined in miRNAs are recruited in AGO1 complexes. Finally, miR812w is wild-type and CRISPR/Cas9-edited (miR812w-D22) plants. In detected in rice, but not in any of the other monocotyledonous or wild-type plants, cytosine methylation was identified in the CG, dicotyledonous species examined in this study. CHG and CHH sequence contexts in the 3 target genes Because 24nt siRNAs can be produced from long, double- (Figure 6a), with maximum methylation levels in the CG context stranded (dsRNAs) that are processed by DCL3 and are loaded (Figure S10a). Cytosine methylation was limited to the 75nt into AGO4, the two classes of 24-nt small RNAs (e.g. those region around the miR812w-3p recognition site (Figure 6a). Of derived from MIRNA precursors or from long dsRNAs) can be interest, the methylation levels in miR812w-D22 plants were confounded. Nevertheless, an important distinction is made reduced compared to wild-type plants, at a different extent between 24-nt miRNAs and 24-nt siRNAs with respect to their depending on the methylation site and the target gene (Fig- origin. Thus, the 24-nt miRNAs are produced from single- ure 6a). These findings support that miR812w function is stranded precursors that adopt a fold-back structure, while required for DNA methylation of the ACO3, CIPK10 and LRR loci. siRNAs are produced from long double-stranded RNAs with We then investigated whether miR812w could mediate perfect complementarity. Importantly, in this study we show that methylation at its own locus. Bisulfite sequencing showed mature miR812w sequences, miR812w-5p and miR812w-3p, cytosine methylation in all the sequence contexts of the MIR812w derive from a single-stranded precursor transcript, as revealed by locus, which were concentrated at the two arms of the stem DNA sequencing of RT-PCR products of MIR812w precursor region of the miR812 precursor structure, with less methylated transcripts and agroinfiltration experiments in N. benthamiana sites at the loop region (Figure S10b). Similar results were leaves. Hence, it can be concluded that miR812w represents a previously reported for another miRNA from rice, miR1873, that bona fide 24-nt miRNA. directs cytosine DNA methylation at its own locus (Wu et al., An interesting finding of this work was the observation that 2010; Zhang et al., 2018a). Compared to wild-type, miR812w- miR812w originated from a Stowaway MITE. Although in animals D22 plants showed reduced levels of DNA methylation at the it is generally accepted that TEs are responsible for the formation miR812w sequence (Figure 6b). Thus, miR812w appears to of MIR loci, our understanding on MIR genes originating from TEs mediate methylation not only at target genes, but also at its in plants is still limited (Cho, 2018; Poretti et al., 2020; Roberts own locus. et al., 2014; Wei et al., 2014; Zhang et al., 2011). Intriguingly, an Methylation of cytosine residues is generally associated with examination of the genomic context of plant miRNAs registered transcriptional silencing. Accordingly, we examined ACO3, in miRBase revealed that a considerable number of plant miRNAs CIPK10 and LRR expression in wild-type and miR812w-D22 are identical or homologous to TEs (Li et al., 2011; Piriyapongsa plants. Compared to wild-type plants, a significant increase in and Jordan, 2008). Furthermore, in that study the authors ACO3, CIPK10 and LRR expression occurred in miR812w-D22 identified four members of the rice miR812 family (miR812f, ª 2021 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd., 19, 1798–1811 1806 Sonia Campo et al. (a) ACO3 ORSgTEMT01600998 1 3 2 osa-miR812w-3p 3’ GCACGGGUUGCAAACUGGCAGGCA 5’ :: :.::::: :::::.::::::: Os02g53180.2 5’ CGCGUCCAAC-UUUGAUCGUCCGU 3’ Position -37 -34 -33 -31 -30 -26 -25 -11 -10 -1 1 3 6 7 10 17 20 21 24 35 77 78 83 Type CHH CHH CHH CHG CG CHH CHH CHH CHH CHG CG CG CHH CHH CHH CG CHG CG CHH CHH CHH CHH CHH WT 53 42 21 32 53 63 63 100 95 100 100 89 89 84 95 95 84 95 95 58 53 63 32 Δ22nt 14 23 0 14 36 45 27 95 91 95 95 100 77 95 91 86 82 77 86 64 41 55 14 ORSgTEMT01602352 CIPK10 1 2 3 4 osa-miR812w-3p 3’ GCACGGGUUGCAAACUGGCAGGCA 5’ .::::.:::::::::::::::::: Os03g22050 5’ UGUGCUCAACGUUUGACCGUCCGU 3’ Position -58 -53 -49 -45 -37 -34 -33 -31 -30 -27 -26 -14 -10 5 7 10 17 18 21 22 25 65 67 69 78 Type CG CHH CHG CHG CHH CHH CHH CHG CG CHH CHH CHG CG CHH CHH CG CHG CG CHG CG CHH CHH CHH CHH CHH WT 77 23 54 85 69 77 46 77 92 69 62 77 100 54 100 100 46 92 62 100 77 46 38 46 62 Δ22nt 43 14 29 71 57 43 29 36 93 64 64 93 100 36 86 100 36 93 57 86 71 21 29 50 50 ORSgTEMT01601299 LRR 1 osa-miR812w-3p 3’ GCACGGGUUGCAAACUGGCAGGCA 5’ ::: :::::.:::::::::::::: Os06g04830 5’ CGUACCCAAUGUUUGACCGUCCGU 3’ Position -9 -8 -1 1 5 6 7 17 18 21 22 25 35 60 67 69 71 83 93 96 100 Type CHH CHG CHG CG CHH CHH CHH CHG CG CHG CG CHH CHH CHH CG CHH CHH CHH CHH CHH CHH WT 76 100 88 100 76 76 88 18 100 76 100 53 18 41 100 41 41 53 71 65 71 Δ22nt 65 88 82 82 82 59 76 59 100 71 94 41 18 35 100 24 35 41 47 59 47 (b) miR812w-5p Position -52 -50 -45 -41 -38 -36 -35 -34 -32 -31 -27 -16 -12 -10 -1 5 6 9 19 20 23 47 55 Type CG CHG CHH CHH CHH CHH CHH CHH CHG CG CHH CHH CHH CHG CG CHH CHH CHH CHG CG CHH CG CG WT 50 22 33 39 28 44 72 33 56 67 78 89 94 100 100 78 83 83 78 94 83 100 100 22nt 28 28 7 21 36 21 71 71 92 0 0 0 0 0 100 93 100 86 93 93 86 86 100 Δ22nt miR812w-3p Position -34 -19 2 6 10 14 21 23 29 30 40 54 Type CHH CHH CG CG CHH CG CHH CG CHH CHH CHH CG WT 33 67 100 100 100 94 89 100 89 89 72 100 22nt 29 71 93 100 86 93 93 100 79 86 71 93 Figure 6 miR812w directs DNA methylation at DNA sequences (in trans) as well as at its own locus (in cis). (a) Analysis of DNA methylation at the miR812w target transcripts in wild-type (WT) and miR812w-D22 (-D22nt) by bisulfite sequencing. The target genes examined were: ACO3 (Os02g53180, upper panel), CIPK10 (Os03g22050, medium panel) and LRR (Os06g04830, lower panel). Data was analysed using the Kismeth software (Gruntman et al.,2008). Numbers represent the percentage of methylation at each cytosine methylation context (CG, CHG and CHH). The first nucleotide of the target site is set as position +1. A 75nt surrounding the mir812w target site (shaded in yellow) is shown. Red colour indicates those cytosine contexts with lower methylation in miR812w-D22 (-D22nt) compared to wild-type (WT) plants (in bold italics are indicated those with a decrease higher than 10%). Schematics representation for each target gene is shown (wide black boxes, exons; grey thin boxes, Untranslated regions (UTR); thin lines, introns). Purple boxes indicate the position and code ID for the Stowaway MITE inserted at the UTR of each target gene. (b) miR812w directs DNA methylation in cis at its own locus. DNA methylation status was analysed and represented as in (a). The 50 nucleotide of mature miR812w-5p (shaded in blue) and miR812w-3p (shaded in pink) is set as position +1. The 22nt deletion next to miR812w-5p is indicated in miR812w-D22 rice plants with an orange square. Details on DNA methylation at the MIR812w precursor sequence can be found in Figure S10b. These experiments were carried out two times with similar results ª 2021 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd., 19, 1798–1811 A transposon-derived microRNA involved in rice immunity 1807 ∗ TIR non-autonomous TE TIR Relative expression (x1000) 4.0 ACO3 5kb 2.0 non-autonomous TE inverted repeats transposase (Stowaway MITE) 100-500bp 0.0 ∗ Relative expression 5.0 CIPK10 proto-MIR812w siRNAs gene with MITE insertion (x1000) 2.5 adaptation to AGO4 miRNA pathway miR* MIR812w 0.0 transcritional AGO4 repression Relative expression 3.0 LRR ∗ miR DCL3 (x1000) Figure 8 Proposed model for the origin and mode of action of miR812w 1.5 in rice. MITEs are non-autonomous transposable elements (TEs) that derive from autonomous TEs and depend on their transposases for mobilization and integration elsewhere in the genome (i.e protein-coding genes). 0.0 Terminal inverted repeats (TIR, 10–15 bp) are indicated by black arrows. A WT Δ22nt proto-MIR812w would be formed from a Stowaway MITE that further evolved to become a MIR812w precursor that is processed DCL3. During Figure 7 Expression analysis of ACO3 (Os02g53180), CIPK10 miR812w evolution, small RNAs might have been generated from the (Os03g22050) and LRR (Os06g04830) in wild-type and miR812w-D22 rice proto-MIR812w. The functional strand of the miR812w-5p/miR812w-3p plants by qRT-PCR. The rice ubiquitin1 gene was used for normalization. duplex (miR812w-3p) would be loaded into the AGO4 clade protein to Data from one representative experiment of three independent mediate DNA methylation at their target transcripts (in trans), as well as at experiments are presented as the mean  SE (n = 3, each biological its own locus (in cis). During evolution, MITEs from the Stowaway family replicate is a pool of 3 individual leaves) (Student t-test, *P < 0.05). would have integrated into the 3’ UTR region of protein-coding genes, Primers are indicated in Table S4 such as the ACO3, CIPK10 and LRR genes. The miR812w could then be derived from a Stowaway MITE, while the Stowaway MITE would serve as a source for the origin of potential target genes for miR812w. Adapted from Li et al., (2011) miR812h, miR812i and miR812j) having homology with TEs, but the significance of this homology was not investigated (Li et al., 2011). In wheat, TamiR113 was reported to originate from a member of the MITE VRN family (Yu et al., 2014). within the 80nt region around the miR812w recognition sites A model is presented in Figure 8 to explain the possible origin (Wu et al., 2010; Zhang et al., 2018a). A reduction in cytosine and mechanism of action of miR812w in rice. According to this methylation of ACO3, CIPK10 and LRR in miR812w-D22 plants model, miR812w evolved from a Stowaway MITE, and the was accompanied by a higher expression of these genes in incorporation of cognate MITEs into protein-coding genes would miR812w-D22 plants. In Arabidopsis, a miR156/166-dependent have created target sites for miR812w. In favour of this possibility, methylation of the PHABULOSA (PHB) and PHABOLUTA (PHV) a search for target genes of miR812w revealed multiple genes genes controlling leaf development was previously described containing the recognition site for miR812w, mostly at their 3‘- (Bao et al., 2004). It is worth mentioning that for another UTR. In this way, the presence of cognate target sequences in member of the miR812 family, miR812q, a miR812q-guided protein-coding genes might have conferred miR812w regulation cleavage of CIPK10 was reported (Jeong et al., 2011). It is to these genes while allowing the creation of a network of tempting to assume that during evolution, the various miR812w-mediated gene regulation. Such regulatory system miR812w family members might have evolved a dual function would allow the plant to activate an appropriate spectrum of for regulation of target gene expression at the transcriptional responses that would enhance the plant’s ability to stop the (e.g. miR812w-mediated DNA methylation) and post-transcrip- spread of the pathogen. The existence of regulatory systems tional (e.g. miR812q-mediated cleavage of CIPK10) levels. contributing to the evolution of miRNA regulatory systems has Regarding methylation at the MIR812w locus, the possibility long been proposed (Piriyapongsa and Jordan, 2008; Roberts that changes in DNA methylation in the miR812 precursor DNA et al., 2014). sequence has an effect on MIR812w transcription, hence, Our results show that miR812w can direct cytosine DNA accumulation of mature miR812w-3p sequences, should be methylation in trans at target genes (e.g. ACO3, CIPK10 and considered. A recent study in soybean/Cyst nematode interac- LRR), as well as in cis at the locus from which miR812w is tions demonstrated that differentially methylated MIR genes produced. Consistent with results previously reported by other modulate susceptibility to infection by soybean Cyst nema- authors, miR812w-mediated methylation occurs approximately todes, indicating that DNA methylation of MIR genes might be ª 2021 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd., 19, 1798–1811 1808 Sonia Campo et al. important in the adaptive response of plants to biotic stress Target prediction (Rambani et al., 2020). Although we provide evidence for a function of miR812w in Target prediction was done using the Plant Small RNA Target resistance to infection by the blast fungus, the challenge is now to Analysis Server (psRNATarget) program by aligning mature understand how a miR812w-directed methylation at target sites, miR812w sequences with MSU Rice Genome Annotation (v7) as well as at its own locus, might regulate immune responses in (http://bioinfo3.noble.org/psRNATarget; release 17). Default set- rice. In this work, only 3 of the Stowaway-containing target genes tings were used (Dai et al., 2018). predicted for miR812w were investigated, whose expression was Bioinformatics analysis of sequencing data found to be up-regulated in miR812w-D22 plants compared with wild-type plants. Given that miR812w appears to be involved in Raw reads of sRNAs and PARE data were downloaded from the the methylation of ACO3, CIPK10 and LRR, one would expect Sequence Read Archive (SRA, http://www.ncbi.nlm.nih.gov/sra). that Stowaway-containing genes, other than ACO3, CIPK10 and Rice sRNA datasets used in this study included GSE66611 (for LRR, might also be regulated by miR812w, which incidentally, leaves and roots treated with M. oryzae elicitors) (Baldrich et al., might modulate blast disease resistance. Along with this, multiple 2015), GSE18251 (for OsAGO1a and OsAGO1b IPs) (Wu et al., candidate target genes have been identified in silico as potential 2009), GSE20748 (for OsDCL1IR-2 and Osrdr2 mutants, and targets of miR812w, and for many of them a regulation during OsAGO4a and OsAGO4b IPs) (Wu et al., 2010) and GSE50778 M. oryzae infection has been described (Table S3). Here, it should (for the Osdcl3a mutant) (Wei et al., 2014). PARE datasets used in be taken into account that, even though DNA methylation is most this study included GSE66611 (for leaves and roots treated with commonly associated with transcriptional repression, positive M. oryzae elicitors) (Baldrich et al., 2015). All datasets were associations of DNA methylation to gene expression have also trimmed for adaptors using Trimmomatic v0.32 (Bolger et al., been reported (Erdmann and Picard, 2020; Harris et al., 2018). 2014). sRNA datasets were mapped to miR812 precursors using Therefore, both repressive and activating transcriptional effects Bowtie2 (Langmead and Salzberg, 2012). PARE datasets were should be considered when investigating the impact of miR812w- analysed using CleaveLand v4.5 (Addo-Quaye et al., 2009) and mediated methylation on target genes. Based on the results here MSU Rice Genome Annotation Project Release 7 (Kawahara et al., presented on the accumulation of H2O2 in miR812w-OE and 2013). CRISPR/Cas9-edited miR812w rice plants, it will be also of interest Bisulfite sequencing to investigate how miR812w might exert its regulatory role in oxidative stress responses, either directly or indirectly. In other Genomic DNAs from wild-type (WT) and CRISPR-edited (D22nt) studies, a MITE-derived miRNA from wheat, Tae-miR1436, has rice plants were extracted as described (S anchez-Sanuy et al., been shown to have a MITE copy integrated into mildew 2019). Bisulfite conversion of gDNAs (500 ng) was done with the resistance genes which led the authors to propose that MITE- EZ DNA Methylation-Gold kit following the manufacturer’s derived miRNAs might contribute to the wheat immune response instructions (ZYMO Research). Then, 3 µl of bisulfite-treated (Poretti et al., 2020). Further investigation is needed to identify DNAs were used for PCR amplification of different loci using the MITE-derived miRNAs in plant species and to elucidate the GoTaq G2 Flexi DNA Polymerase (Promega) with the following mechanisms by which these miRNAs contribute to plant immu- conditions: 95°C, 2 min; 45 cycles of (95°C, 30 s; 52°C, 30 s; nity. 72°C, 30 s); 72°C, 5 min. PCR products were gel purified and Finally, results here presented reinforce the notion that, in cloned into pGEM-T easy vector (Promega). For each region, 20 addition to post-transcriptional regulation of gene expression, individual top-strand clones were sequenced. Primers were miRNAs can also exert their regulatory function at the transcrip- designed at flanking regions of the miRNA-binding sites and tional level by directing DNA methylation. A better understanding avoiding repetitive regions with the Kismeth software (Gruntman of gene regulatory networks in which miR812w participates will et al., 2008) (Table S4). Sequencing data analysis was done with provide useful tools for developing novel strategies for crop the Kismeth software selecting 75 bp up- and downstream of the protection. miRNA target sites. Other methods Experimental procedures Details on Growth of Plant Material, Elicitor treatment, Vector Blast resistance assays construction, Rice transformation, Transient expression in N. ben- The fungus M. oryzae (strain Guy-11) was grown in Complete thamiana, Histological detection of ROS accumulation, northern Media Agar (CMA, containing 30 mg/L chloramphenicol) for blot and quantitative RT-PCR analysis are available in Methods S1. 15 days under controlled conditions (28°C, 16 h/8 h). Soil-grown plants at the 3–4 leaf stage were infected by spraying a M. oryzae Acknowledgements spore suspension (105 spores/ml; 0.2 ml/plant; prepared as described, (Campo et al., 2013) with an aerograph at 2 We thank Dr. X. Cao (Chinese Academy of Sciences, Beijing, atmospheres of pressure (Sesma and Osbourn, 2004). Plants China) for providing us with seeds of dcl mutants and Dr. D. were maintained overnight in the dark under high humidity. The Baulcombe (University of Cambridge, UK) for the N. benthamiana percentage of leaf area affected by blast lesions was determined RdR6i line. This research was supported by the Ministerio de at 7 days post-inoculation by image analysis. Quantification of n y Universidades (MCIU)-Agencia Estatal de Ciencia, Innovacio fungal DNA biomass was carried out by real-time PCR using n (AEI) y el Fondo Europeo de Desarrollo Regional Investigacio specific primers for the Magnaporthe oryzae 28S and normalized (FEDER) (RTI2018-101275-B-I00). We also acknowledge support to the rice Ubiquitin1 an internal control (Table S4) (Qi and Yang, from the CERCA Program (‘Generalitat de Catalunya’), and 2002). At least, 4 independent experiments were carried out with Ministerio de Economıa y Competitividad (‘Severo Ochoa Pro- similar results. gramme for Centres of Excellence in R&D’ 2016-2019, SEV-2015- ª 2021 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd., 19, 1798–1811 A transposon-derived microRNA involved in rice immunity 1809 0533). RCR was a recipient of a Ph.D. grant from the Ministerio Chellappan, P., Xia, J., Zhou, X., Gao, S., Zhang, X., Coutino, G. et al. (2010) n, Cultura y Deporte (FPU12/02812). de Educacio siRNAs from miRNA sites mediate DNA methylation of target genes. Nucleic Acids Res. 38, 6883–6894. Chen, X.M. (2009) Small RNAs and their roles in plant development. Annu. Rev. Author contributions Cell Dev. Biol. 25, 21–44. Cho, J. (2018) Transposon-derived non-coding RNAs and their function in SC and BSS planned and designed the research. SC, FSS, RCR, plants. Front. Plant Sci. 9, 600. JGA, LCS and MSS performed the experiments. SC and PB carried Choi, J.Y., Platts, A.E., Fuller, D.Q., Hsing, Y.-I., Wing, R.A. and Purugganan, out the bioinformatics analyses. SC, BSS and FSS analysed data M.D. (2017) Rice paradox: multiple origins but single domestication in asian and wrote the manuscript. All authors read and approved the rice. Mol. Biol. Evol. 34, 969–979. final manuscript. Cuperus, J.T., Fahlgren, N. and Carrington, J.C. (2011) Evolution and functional diversification of MIRNA genes. Plant Cell 23, 431–442. Dai, X., Zhuang, Z. and Zhao, P.X. (2018) psRNATarget: a plant small RNA Conflict of interest target analysis server (2017 release). Nucleic Acids Res. 46, W49–W54. De Felippes, F.F., Schneeberger, K., Dezulian, T., Huson, D.H. and Weigel, D. The authors declare that they have no conflict of interest. (2008) Evolution of Arabidopsis thaliana microRNAs from random sequences. RNA 14, 2455–2459. References Erdmann, R.M. and Picard, C.L. (2020) RNA-directed DNA methylation. PLoS Genet. 16, e1009034. Addo-Quaye, C., Miller, W. and Axtell, M.J. (2009) CleaveLand: a pipeline for Feschotte, C., Swamy, L. and Wessler, S.R. (2003) Genome-wide analysis of using degradome data to find cleaved small RNA targets. Bioinformatics 25, mariner-like transposable elements in rice reveals complex relationships with 130–131. Stowaway miniature inverted repeat transposable elements (MITEs). Genetics Allen, E., Xie, Z., Gustafson, A.M., Sung, G.H., Spatafora, J.W. and Carrington, 163, 747–758. J.C. (2004) Evolution of microRNA genes by inverted duplication of target Goff, S.A., Ricke, D., Lan, T.-H., Presting, G., Wang, R., Dunn, M. et al. (2002) A gene sequences in Arabidopsis thaliana. Nat. Genet. 36, 1282–1290. draft sequence of the rice genome (Oryza sativa L. ssp. japonica). Science Arikit, S., Zhai, J. and Meyers, B.C. (2013) Biogenesis and function of rice small 296, 92–100. RNAs from non-coding RNA precursors. Curr. Opin. Plant Biol. 16, 170–179. Gozmanova, M., Baev, V., Apostolova, E., Sablok, G. and Yahubyan, G. (2017) Axtell, M.J. (2013) Classification and comparison of small RNAs from plants. Growing diversity of plant microRNAs and MIR-derived small RNAs. Plant Annu. Rev. Plant Biol. 64, 137–159. Epigenetics, pp. 49–67. Cham: Springer. Axtell, M.J. and Meyers, B.C. (2018) Revisiting criteria for plant microRNA Gruntman, E., Qi, Y., Slotkin, R.K., Roeder, T., Martienssen, R.A. and annotation in the Era of big data. Plant Cell 30, 272–284. Sachidanandam, R. (2008) Kismeth: Analyzer of plant methylation states Baldrich, P., Campo, S., Wu, M.-T., Liu, T.-T., Hsing, Y.-I.-C. and Segundo, B.S. through bisulfite sequencing. BMC Bioinformatics 9, 371. (2015) MicroRNA-mediated regulation of gene expression in the response of Harris, C.J., Scheibe, M., Wongpalee, S.P., Liu, W., Cornett, E.M., Vaughan, rice plants to fungal elicitors. RNA Biol. 12, 847–863. R.M., Li, X. et al. (2018) A DNA methylation reader complex that enhances Baldrich, P. and San Segundo, B. (2016) MicroRNAs in rice innate immunity. gene transcription. Science 362, 1182–1186. Rice 9, 1–6. Hu, W., Wang, T., Xu, J. and Li, H. (2014) MicroRNA mediates DNA methylation Bao, N., Lye, K.W. and Barton, M.K. (2004) MicroRNA binding sites in of target genes. Biochem. Biophys. Res. Commun. 444, 676–681. Arabidopsis class III HD-ZIP mRNAs are required for methylation of the Jeong, D.-H., Park, S., Zhai, J., Gurazada, S.G.R., De Paoli, E., Meyers, B.C. and template chromosome. Dev. Cell 7, 653–662. Green, P.J. (2011) Massive analysis of rice small RNAs: mechanistic Boccara, M., Sarazin, A., Thiebeauld, O., Jay, F., Voinnet, O., Navarro, L. and implications of regulated microRNAs and variants for differential target Colot, V. (2014) The Arabidopsis miR472-RDR6 silencing pathway modulates RNA cleavage. Plant Cell 23, 4185–4207. PAMP- and effector-triggered immunity through the post-transcriptional Jones, J.D.G. and Dangl, J.L. (2006) The plant immune system. Nature 444, control of disease resistance genes. PLoS Pathog. 10, e1003883. 323–329. Bolger, A.M., Lohse, M. and Usadel, B. (2014) Trimmomatic: a flexible trimmer Jones-Rhoades, M., Bartel, D. and Bartel, B. (2006) MicroRNAs and their for Illumina sequence data. Bioinformatics 30, 2114–2120. regulatory roles in plants. Annu. Rev. Plant Biol. 57, 19–53. Boller, T. and Felix, G. (2009) A renaissance of elicitors: perception of microbe- Kanazawa, A., Akimoto, M., Morishima, H. and Shimamoto, Y. (2000) Inter- associated molecular patterns and danger signals by pattern-recognition and intra-specific distribution of Stowaway transposable elements in AA- receptors. Annu. Rev. Plant Biol. 60, 379–406. genome species of wild rice. Theor. Appl. Genet. 101, 327–335. Brodersen, P., Sakvarelidze-Achard, L., Bruun-Rasmussen, M., Dunoyer, P., Kasschau, K.D., Fahlgren, N., Chapman, E.J., Sullivan, C.M., Cumbie, J.S., Yamamoto, Y.Y., Sieburth, L. and Voinnet, O. (2008) Widespread Givan, S.A. and Carrington, J.C. (2007) Genome-wide profiling and analysis translational inhibition by plant miRNAs and siRNAs. Science 320, 1185–1190. of Arabidopsis siRNAs. PLoS Biol. 5, e57. Camargo-Ramırez, R., Val-Torregrosa, B. and San Segundo, B. (2018) MiR858- Kawahara, Y., de la Bastide, M., Hamilton, J.P., Kanamori, H., McCombie, W.R., mediated regulation of flavonoid-specific MYB transcription factor genes Ouyang, S., Schwartz, D.C. et al. (2013) Improvement of the Oryza sativa controls resistance to pathogen infection in Arabidopsis. Plant Cell Physiol. Nipponbare reference genome using next generation sequence and optical 59, 190–204. map data. Rice 6, 3–10. Campo, S., Peris-Peris, C., Sire, C., Moreno, A.B., Donaire, L., Zytnicki, M. et al. Kozomara, A., Birgaoanu, M. and Griffiths-Jones, S. (2019) miRBase: from (2013) Identification of a novel microRNA (miRNA) from rice that targets an microRNA sequences to function. Nucleic Acids Res. 47, D155–D162. alternatively spliced transcript of the Nramp6 (Natural resistance-associated Kurihara, Y. and Watanabe, Y. (2004) Arabidopsis micro-RNA biogenesis macrophage protein 6) gene involved in pathogen resistance. New Phytol. through Dicer-like 1 protein functions. Proc. Natl. Acad. Sci. USA 101, 199, 212–227. 12753–12758. Casacuberta, E., Casacuberta, J.M., Puigdomenech, P. and Monfort, A. (1998) Kurusu, T., Hamada, J., Hamada, H., Hanamata, S. and Kuchitsu, K. (2010) Presence of miniature inverted-repeat transposable elements (MITEs) in the Roles of calcineurin B-like protein-interacting protein kinases in innate genome of Arabidopsis thaliana: characterisation of the emigrant family of immunity in rice. Plant Signal. Behav. 5, 1045–1047. elements. Plant J. 16, 79–85. Langmead, B. and Salzberg, S.L. (2012) Fast gapped-read alignment with Chandran, V., Wang, H., Gao, F., Cao, X.-L., Chen, Y.-P., Li, G.-B. et al. (2019) Bowtie 2. Nat Methods 9, 357–359. miR396-OsGRFs module balances growth and rice blast disease-resistance. Lee, H.J., Park, Y.J., Kwak, K.J., Kim, D., Park, J.H., Lim, J.Y. et al. (2015) Front. Plant Sci. 9, 1999. MicroRNA844-guided downregulation of cytidinephosphate diacylglycerol ª 2021 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd., 19, 1798–1811 1810 Sonia Campo et al. synthase3 (CDS3) mRNA Affects the response of Arabidopsis thaliana to Salvador-Guirao, R., Hsing, Y.-I. and San Segundo, B. (2018b) The polycistronic bacteria and fungi. Mol. Plant-Microbe Interact. 28, 892–900. miR166k-166h positively regulates rice immunity via post-transcriptional Li, P., Lu, Y.J., Chen, H. and Day, B. (2020a) The lifecycle of the plant immune control of EIN2. Front. Plant Sci. 9, 337. system. CRC. Crit. Rev. Plant Sci. 39, 72–100. Sanchez-Sanuy, F., Peris-Peris, C., Tomiyama, S., Okada, K., Hsing, Y.-I., San Li, X.-P., Ma, X.-C., Wang, H.e., Zhu, Y., Liu, X.-X., Li, T.-T., Zheng, Y.-P. et al. Segundo, B. and Campo, S. (2019) Osa-miR7695 enhances transcriptional (2020b) Osa-miR162a fine-tunes rice resistance to Magnaporthe oryzae and priming in defense responses against the rice blast fungus. BMC Plant Biol. yield. Rice 13, 38. 19, 563. Li, Y., Li, C., Xia, J. and Jin, Y. (2011) Domestication of transposable elements Santiago, N., Herraiz, C., Ramo n Gon~i, J., Messeguer, X. and Casacuberta, J.M. into microRNA genes in plants. PLoS One 6, e19212. (2002) Genome-wide analysis of the Emigrant family of MITEs of Arabidopsis Li, Y., Lu, Y.-G., Shi, Y., Wu, L., Xu, Y.-J., Huang, F. et al. (2014) Multiple rice thaliana. Mol. Biol. Evol. 19, 2285–2293. microRNAs are involved in immunity against the blast fungus Magnaporthe Sesma, A. and Osbourn, A.E. (2004) The rice leaf blast pathogen undergoes oryzae. Plant Physiol. 164, 1077–1092. developmental processes typical of root-infecting fungi. Nature 431, 582. Li, Y., Zhang, Q., Zhang, J., Wu, L., Qi, Y. and Zhou, J.-M. (2010) Identification Song, X., Li, P., Zhai, J., Zhou, M., Ma, L., Liu, B. et al. (2012) Roles of DCL4 and of microRNAs involved in pathogen-associated molecular pattern-triggered DCL3b in rice phased small RNA biogenesis. Plant J. 69, 462–474. plant innate immunity. Plant Physiol. 152, 2222–2231. Song, X., Li, Y., Cao, X. and Qi, Y. (2019) MicroRNAs and their regulatory roles Li, Y., Zhao, S.-L., Li, J.-L., Hu, X.-H., Wang, H., Cao, X.-L. et al. (2017) Osa- in plant-environment interactions. Annu. Rev. Plant Biol. 70, 489–525. miR169 negatively regulates rice immunity against the blast fungus Soto-Suarez, M., Baldrich, P., Weigel, D., Rubio-Somoza, I. and San Segundo, B. Magnaporthe oryzae. Front. Plant Sci. 8, 2. (2017) The Arabidopsis miR396 mediates pathogen-associated molecular Li, Z.-Y., Xia, J., Chen, Z., Yu, Y., Li, Q.-F., Zhang, Y.-C. et al. (2016) Large-scale pattern-triggered immune responses against fungal pathogens. Sci. Rep. 7, rewiring of innate immunity circuitry and microRNA regulation during initial 44898. rice blast infection. Sci. Rep. 6, 25493. Staiger, D., Korneli, C., Lummer, M. and Navarro, L. (2013) Emerging role for Liu, B., Chen, Z., Song, X., Liu, C., Cui, X., Zhao, X. et al. (2007) Oryza sativa RNA-based regulation in plant immunity. New Phytol. 197, 394–404. Dicer-like4 reveals a key role for small interfering RNA silencing in plant Sunkar, R., Li, Y.-F. and Jagadeeswaran, G. (2012) Functions of microRNAs in development. Plant Cell 19, 2705–2718. plant stress responses. Trends Plant Sci. 17, 196–203. Liu, B., Li, P., Li, X., Liu, C., Cao, S., Chu, C. and Cao, X. (2005) Loss of function Torres, M.A., Jones, J.D.G. and Dangl, J.L. (2006) Reactive oxygen species of OsDCL1 affects microRNA accumulation and causes developmental signaling in response to pathogens. Plant Physiol. 141, 373–378. defects in rice. Plant Physiol. 139, 296–305. Vaucheret, H. (2008) Plant argonautes. Trends Plant Sci. 13, 350–358. Llave, C., Xie, Z., Kasschau, K.D. and Carrington, J.C. (2002) Cleavage of Vazquez, F., Blevins, T., Ailhas, J., Boller, T. and Meins, F. Jr. (2008) Evolution of Scarecrow-like mRNA targets directed by a class of Arabidopsis miRNA. Arabidopsis MIR genes generates novel microRNA classes. Nucleic Acids Res. Science 297, 2053–2056. 36, 6429–6438. van Loon, L.C., Geraats, B.P.J. and Linthorst, H.J.M. (2006) Ethylene as a Wang, M., Yu, Y., Haberer, G., Marri, P.R., Fan, C., Goicoechea, J.L. et al. modulator of disease resistance in plants. Trends Plant Sci. 11, 184–191. (2014) The genome sequence of African rice Oryza glaberrima and evidence Navarro, L., Dunoyer, P., Jay, F., Arnold, B., Dharmasiri, N., Estelle, M., Voinnet, for independent domestication. Nat. Genet. 46, 982–988. O. and et al. (2006) A plant miRNA contributes to antibacterial resistance by Wang, Z., Xia, Y., Lin, S., Wang, Y., Guo, B., Song, X. et al. (2018) Osa- repressing auxin signaling. Science 312, 436–439. miR164a targets OsNAC60 and negatively regulates rice immunity against the Niu, D., Lii, Y.E., Chellappan, P., Lei, L., Peralta, K., Jiang, C. et al. (2016) blast fungus Magnaporthe oryzae. Plant J. 95, 584–597. miRNA863-3p sequentially targets negative immune regulator ARLPKs and Wei, L., Gu, L., Song, X., Cui, X., Lu, Z., Zhou, M. et al. (2014) Dicer-like 3 positive regulator SERRATE upon bacterial infection. Nat. Commun. 7, 11324. produces transposable element-associated 24-nt siRNAs that control Nozawa, M., Miura, S. and Nei, M. (2012) Origins and evolution of microRNA agricultural traits in rice. Proc. Natl. Acad. Sci. USA 111, 3877–3882. genes in plant species. Genome Biol. Evol. 4, 230–239. Weiberg, A., Wang, M., Bellinger, M. and Jin, H. (2014) Small RNAs: A new Park, Y.J., Lee, H.J., Kwak, K.J., Lee, K., Hong, S.W. and Kang, H. (2014) paradigm in plant-microbe interactions. Annu. Rev. Phytopathol. 52, 495– MicroRNA400-guided cleavage of pentatricopeptide repeat protein mRNAs 516. renders Arabidopsis thaliana more susceptible to pathogenic bacteria and Wilson, R.A. and Talbot, N.J. (2009) Under pressure: investigating the biology fungi. Plant Cell Physiol. 55, 1660–1668. of plant infection by Magnaporthe oryzae. Nat. Rev. Microbiol. 7, 185– Piriyapongsa, J. and Jordan, I.K. (2008) Dual coding of siRNAs and miRNAs by 195. plant transposable elements. RNA 14, 814–821. Wu, L., Zhang, Q.Q., Zhou, H.Y., Ni, F.R., Wu, X.Y. and Qi, Y.J. (2009) Rice Poretti, M., Praz, C.R., Meile, L., K€alin, C., Schaefer, L.K., Schl€afli, M. et al. microRNA effector complexes and targets. Plant Cell 21, 3421–3435. (2020) Domestication of high-copy transposons underlays the wheat small Wu, L., Zhou, H., Zhang, Q., Zhang, J., Ni, F., Liu, C. and Qi, Y. (2010) DNA rna response to an obligate pathogen. Mol. Biol. Evol. 37, 839–848. methylation mediated by a microRNA pathway. Mol. Cell 38, 465–475. Qi, M. and Yang, Y. (2002) Quantification of Magnaporthe grisea during Yin, H., Hong, G., Li, L., Zhang, X., Kong, Y., Sun, Z. et al. (2019) miR156/SPL9 infection of rice plants using real-time polymerase chain reaction and regulates reactive oxygen species accumulation and immune response in northern blot/phosphoimaging analyses. Phytopathology 92, 870–876. Arabidopsis thaliana. Phytopathology 109, 632–642. Rajagopalan, R., Vaucheret, H., Trejo, J. and Bartel, D.P. (2006) A diverse and Yu, J., Hu, S., Wang, J., Wong, G.-K.-S., Li, S., Liu, B. et al. (2002) A draft evolutionarily fluid set of microRNAs in Arabidopsis thaliana. Genes Dev. 20, sequence of the rice genome (Oryza sativa L. ssp. indica). Science 296, 79– 3407–3425. 92. Rambani, A., Hu, Y., Piya, S., Long, M., Rice, J.H., Pantalone, V. and Hewezi, T. Yu, M., Carver, B.F. and Yan, L. (2014) TamiR1123 originated from a (2020) Identification of differentially methylated miRNA genes during family of miniature inverted-repeat transposable elements (MITE) compatible and incompatible interactions between soybean and soybean including one inserted in the Vrn-A1a promoter in wheat. Plant Sci. cyst nematode. Mol. Plant Microbe Interact. 33, 1340–1352. 215–216, 117–123. Roberts, J.T., Cardin, S.E. and Borchert, G.M. (2014) Burgeoning evidence Zhang, H., Lang, Z. and Zhu, J.K. (2018a) Dynamics and function of DNA indicates that microRNAs were initially formed from transposable element methylation in plants. Nat. Rev. Mol. Cell Biol. 19, 489–506. sequences. Mob. Genet. Elements 4, e29255. Zhang, L.-L., Li, Y., Zheng, Y.-P., Wang, H., Yang, X., Chen, J.-F. et al. (2020) Rogers, K. and Chen, X. (2013) Biogenesis, turnover, and mode of action of Expressing a target mimic of miR156fhl-3p enhances rice blast disease plant microRNAs. Plant Cell 25, 2383–2399. resistance without yield penalty by improving SPL14 expression. Front. Genet. Salvador-Guirao, R., Baldrich, P., Weigel, D., Rubio-Somoza, I. and San 11, 327. Segundo, B. (2018a) The MicroRNA miR773 Is involved in the Arabidopsis Zhang, X., Bao, Y., Shan, D., Wang, Z., Song, X., Wang, Z. et al. (2018b) immune response to fungal pathogens. Mol. Plant-Microbe Interact. 31, 249– Magnaporthe oryzae induces the expression of a microRNA to suppress the 259. immune response in rice. Plant Physiol. 177, 352–368. ª 2021 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd., 19, 1798–1811 A transposon-derived microRNA involved in rice immunity 1811 Zhang, Y., Jiang, W. and Gao, L. (2011) Evolution of microRNA genes in Oryza Figure S4 Abundance of miR812w-3p in dcl1 and rdr2 rice sativa and Arabidopsis thaliana: an update of the inverted duplication model. mutants. PLoS One 6, e28073. Figure S5 Characterization of wild-type (WT) and CRISPR-edited Zhao, Z.X., Feng, Q., Cao, X.L., Zhu, Y., Wang, H., Chandran, V. et al. (2020) rice plants harbouring the D22nt mutant allele (mir812w-Δ22). Osa-miR167d facilitates infection of Magnaporthe oryzae in rice. J. Integr. Figure S6 Constitutive expression of MIR812w in rice. Plant Biol. 62, 702–715. Zhou, S., Zhu, Y., Wang, L., Zheng, Y., Chen, J., Li, T. et al. (2019) Osa-miR1873 Figure S7 Accumulation of PR1 transcripts in miR812w overex- fine-tunes rice immunity against Magnaporthe oryzae and yield traits. J. pressor and CRISPR-edited rice plants. Integr. Plant Biol. jipb.12900. Figure S8 MIR812w has homology to the MITE from the Zhu, Q.-H., Spriggs, A., Matthew, L., Fan, L., Kennedy, G., Gubler, F. and Stowaway family. Helliwell, C. (2008) A diverse set of microRNAs and microRNA-like small RNAs Figure S9 Alignment of the MIR812w precursor sequence and in developing rice grains. Genome Res. 18, 1456–1465. the MITE sequence embedded in the miR812w target transcript. Figure S10 miR812w directs DNA methylation at its target genes (in trans) and at its own locus (in cis). Supporting information Table S1 Oryza species analysed in this study, their genome type, Additional supporting information may be found online in the accession number and geographical region of cultivation. Supporting Information section at the end of the article. Table S2 T-DNA copy number in mir812w overexpressor and empty vector rice plants. Figure S1 Nucleotide sequence of the novel miRNA candidate Table S3 Putative target genes for osa-miR812w. under study. Table S4 Oligonucleotides used in this study. Methods S1 Supplemental Experimental procedures. Figure S2 Alignment of the precursor sequences of the rice miR812 family. Figure S3 Alignment of mature sequences of the rice miR812 family with miR812w-3p. ª 2021 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd., 19, 1798–1811