ORIGINAL RESEARCH published: 15 October 2021 doi: 10.3389/fvets.2021.686143 Microencapsulation Improved Fumaric Acid and Thymol Effects on Broiler Chickens Challenged With a Short-Term Fasting Period Nedra Abdelli 1 , José Francisco Pérez 1 , Ester Vilarrasa 2† , Diego Melo-Duran 1 , Irene Cabeza Luna 2 , Razzagh Karimirad 3 and David Solà-Oriol 1* 1 Animal Nutrition and Welfare Service (SNIBA), Department of Animal and Science, Facultat de Veterinària, Universitat Autònoma de Barcelona, Barcelona, Spain, 2 FARMFAES-TECNOVIT, Alforja, Spain, 3 Department of Animal Science, Lorestan University, Khorramabad, Iran Edited by: Shourong Shi, The first objective of this study was to demonstrate the usefulness of the Chinese Academy of Agricultural microencapsulation technique to protect fumaric acid and thymol, avoiding their early Sciences, China absorption and ensuring their slow release throughout the gastrointestinal tract (GIT). Reviewed by: For this purpose, the release of a lipid matrix microencapsulated brilliant blue (BB) was Jian Lu, Jiangsu Institute of Poultry Science assessed in vitro, using a simulated broiler intestinal fluid, and in vivo. In vitro results (CAAS), China showed that more than 60% of BB color reached the lower intestine, including 26.6 and Ilias Giannenas, Aristotle University of 29.7% in the jejunum and ileum, respectively. The second objective was to determine the Thessaloniki, Greece effects of microencapsulated fumaric acid, thymol, and their mixture on the performance *Correspondence: and gut health of broilers challenged with a short-term fasting period (FP). One-day-old David Solà-Oriol male ROSS 308 chickens (n = 280) were randomly distributed into seven treatments, David.Sola@uab.cat with 10 replicates of four birds each. Dietary treatments consisted of a basal diet as † Presentaddress: negative control (NC), which was then supplemented by either non-microencapsulated Ester Vilarrasa, Kaykun Care, Carrer del Camí de fumaric acid (0.9 g/kg), thymol (0.6 g/kg), or a mixture of them. The same additive doses Valls, Reus, Spain were also administered in a microencapsulated form (1.5 and 3 g/kg for the fumaric acid and thymol, respectively). At day 21, chickens were subjected to a 16.5-h short-term Specialty section: This article was submitted to FP to induce an increase in intestinal permeability. Growth performance was assessed Animal Nutrition and Metabolism, weekly. At day 35, ileal tissue and cecal content were collected from one bird per replicate a section of the journal to analyze intestinal histomorphology and microbiota, respectively. No treatment effect Frontiers in Veterinary Science was observed on growth performance from day 1 to 21 (p > 0.05). Microencapsulated Received: 26 March 2021 Accepted: 08 September 2021 fumaric acid, thymol, or their mixture improved the overall FCR (feed conversion ratio) Published: 15 October 2021 and increased ileal villi height-to-crypt depth ratio (VH:CD) (p < 0.001) on day 35 of the Citation: experiment. The microencapsulated mixture of fumaric acid and thymol increased cecal Abdelli N, Francisco Pérez J, Vilarrasa E, Melo-Duran D, Cabeza abundance of Bacteroidetes, Bacillaceae, and Rikenellaceae, while decreasing that of Luna I, Karimirad R and Solà-Oriol D Pseudomonadaceae. These results indicate that the microencapsulation technique used (2021) Microencapsulation Improved in the current study can be useful to protect fumaric acid and thymol, avoiding early Fumaric Acid and Thymol Effects on Broiler Chickens Challenged With a absorption, ensure their slow release throughout the GIT, and improve their effects on Short-Term Fasting Period. fasted broiler chickens. Front. Vet. Sci. 8:686143. doi: 10.3389/fvets.2021.686143 Keywords: microencapsulation, fumaric acid, thymol, gut health, broiler Frontiers in Veterinary Science | www.frontiersin.org 1 October 2021 | Volume 8 | Article 686143 Abdelli et al. Feed Additives for Broiler-Gut-Health Control INTRODUCTION drawbacks that may limit their use, such as being costly and time consuming. However, the electrohydrodynamic processes Intensive genetic selection has led to vast improvements in the used in the current study is a technique composed of two sister efficiency of the poultry industry. However, a faster growth rate technologies including electrospraying and electrospinning, under intensive conditions coupled with increasing restrictions which provides a broad range of benefits. It is considered as an on the use of antimicrobials is pushing chicken rearing to innovative, cost-effective, and one-step method that ensures the higher prevalence of intestinal diseases. The gastrointestinal scale-up processes for high-throughput production. Moreover, tract (GIT) is a highly complex and dynamic ecosystem this energy-saving technique has recently emerged as a promising involving the qualitative and quantitative equilibrium of the approach suitable for incorporation of heat-sensitive active microbial load, morphological structure of the intestinal wall, compounds (24) by preserving their structure and efficacy and the adequate activity of the immune system. An optimal upon processing, storage and delivery (21). On the other hand, gastrointestinal function is crucial for a sustainable, cost-effective vegetable oils included in the lipid matrix microparticles used animal production (1). Therefore, the “gut health” concept has in the current study are composed of long-chain triglycerides drawn significant attention among scientists (2) to develop reported to possess a slower digestion than that of proteins and nutritional strategies and natural alternatives aiming to modulate polysaccharides (25). the gut function toward a satisfactory poultry performance and Therefore, we hypothesized that microencapsulation of feed efficiency. fumaric acid and thymol, as examples of OAs and EOs, will Among the most studied alternatives, organic acids (OAs) promote a delayed release of the contained active compounds and phytogenic feed additives, including essential oils (EOs), into the targeted GIT section, exerting beneficial effects on may show antimicrobial potential to control dysbiosis and performance, immunity, and the digestive GIT functions in enhance performance of broilers raised without antimicrobials. broiler chickens. We also hypothesized that these effects will be Although most of the beneficial effects of OAs are associated more pronounced in broilers exposed to challenging conditions with their ability to lower the pH, they may also elicit direct that can negatively affect their gut health. non-pH effects on bacterial metabolism by targeting the cell Therefore, the objectives of this study were (1) to show wall, and the cytoplasmic membrane, as well as function related evidence of the progressive release of fumaric acid and thymol, to prokaryote replication and protein synthesis (3). Several as examples of OAs and EOs, when these are microencapsulated studies reported an antimicrobial activity of OAs against most in lipid matrix microparticles under in vitro and in vivo intestinal common poultry pathogens such as Clostridium perfringens (4), conditions; and (2) to evaluate the effect of microencapsulated Salmonella (5, 6), Campylobacter jejuni (7), and Escherichia coli fumaric acid and thymol on the performance and gut health of (8). On the other hand, there are also published reports that broiler chickens challenged with a short-term fasting period (FP) suggest that dietary EOs may stimulate digestive secretions for (as a model of mucosal damage and increased GIT permeability). enhancing nutrient digestibility (9), regulate the gut microbiota composition (10), maintain intestinal integrity, and strengthen mucosal barrier function (11), improve cellular and humoral MATERIALS AND METHODS immunity (12, 13), as well as modulate the immunity related gene expression of chickens (14). The antimicrobial effect of Release of Blue Brilliant (BB) Color EOs has been linked to their ability to affect the proteomes and In vitro Screening cell morphology of pathogenic bacteria (15), which is able to A simulated GIT in vitro test was designed to study the release disrupt the outer membrane lipids, and initiate cell lysis leading of a microencapsulated BB color (E133) along the GIT of to an increased permeability. Moreover, combinations of EOs broiler chickens. This microencapsulated BB included 20% of free with OAs may show a synergetic potential (16). Nevertheless, blue color protected with the same wall material (hydrogenated the positive effects of OAs and EOs remain controversial fats) used to microencapsulate the feed additives tested in the (17, 18), which may be attributed to an early absorption of in vivo experiment. the active compounds that may reduce their levels in the The first step was the preparation of a calibration curve. lower GIT (19, 20). Therefore, researchers aim to develop Quantities of 0.0125, 0.025, 0.05, 0.075, 0.1, 0.1125, 0.15, 0.175, strategies to preserve feed additives from early absorption or and 0.2 g of non-microencapsulated powdered BB color were volatilization, and to ensure their progressive delivery along placed in conical flasks (four for each dose). The following the lower GIT. Among the techniques used for protecting reagents were then added to each flask: 25 ml of phosphate buffer feed additives, microencapsulation has been widely applied. (0.1 M, pH 6.0), 10 ml of 0.2 M HCl, 1 ml of a freshly prepared In this context, multifarious strategies have been successfully pepsin, 0.5 ml of chloramphenicol solution, 27 ml of Trizma- investigated to manufacture microcapsules including chemical Maleate buffer (0.1 M, pH 7.5), 0.5 ml of CaCl2 at 325 mM, 1.5 ml methods, such as interfacial polycondensation, interfacial cross- of NaCl at 3.25 mM, 0.25 g of bile salts, and 3 ml of pancreatin. linking, and matrix polymerization; physicochemical methods, Flasks were closed and stirred gently for 2 h at 39◦ C, and then such as ionotropic gelation, coacervation-phase separation, absorbance was measured using a spectrophotometer at 450 nm. chilling, and freeze drying; and physical methods, such as pan The calibration equation obtained was Y = 725.14X−0.1887, coating, air-suspension coating, and centrifugal extrusion (21– where “Y” was the absorbance at 450 nm and “X” was the 23). Despite the benefits of these methods, they still present some concentration, and the R2 was approximately 0.98. Frontiers in Veterinary Science | www.frontiersin.org 2 October 2021 | Volume 8 | Article 686143 Abdelli et al. Feed Additives for Broiler-Gut-Health Control Afterwards, the BB release was simulated under “stomach” (CEEAH1043R2). All animal housing and husbandry conformed and “small intestine” conditions. The BB release under simulated to the European Union Guidelines (29). “stomach” conditions was evaluated according to a protocol adapted from Boisen and Fernández (26). A total of 28 conical Experimental Design, Dietary Treatments, and Animal flasks were used and a total of 0.5 g of microencapsulated BB Husbandry containing 20% of non-microencapsulated one was placed in A total of 280 1-day-old male ROSS 308 chickens were each. Afterwards, 25 ml of phosphate buffer (0.l M, pH 6.0) was purchased form a local hatchery, where they received in ovo added to each flask, followed by a gentle magnetic stirring before vaccinations for Marek disease, Gumboro disease, and infectious adding 10 ml of 0.2 M HCl. The pH was then adjusted to pH bronchitis. Upon arrival, chicks were weighed and allotted, 2.0 before adding 1 ml of freshly prepared pepsin and 0.5 ml according to initial body weight, to seven dietary treatments of chloramphenicol. Finally, the flasks were closed and stirred in a completely randomized design. Each dietary treatment for 90 min in a thermostatically controlled incubator at 39◦ C. was replicated 10 times in battery brooder cages with four This time was decided based on the study of Ravindran (27) chickens per replicate. A non-medicated (non-antibiotic or reporting that the digesta spends 90 min in the upper digestive anticoccidials drug), corn–soybean meal-based diet was used as tract. The equivalent transit time per segment was also adapted the basal diet for all treatments (Table 1). The used feed additives from the same study being as follows: 30 min in the crop (0– (Tecnovit, Alforja, Spain) including fumaric acid, thymol, and 30 min) and 60 min in the proventriculus/gizzard (30–90 min). their mixture were tested either under microencapsulated or non- Thus, during these 90 min, flasks were taken out (four per time) microencapsulated form. The microencapsulated fumaric acid at 30, 60, and 90 min, and absorbance was measured using a included 60%, while thymol contained 20% of active compounds. spectrophotometer at 450 nm. The concentration was calculated The equivalent concentration of active compounds was used for using the calibration equation, which allowed to calculate the the non-microencapsulated forms. Dietary treatments were then percentage of release per segment of the upper digestive tract. produced by supplementing the basal diet with the tested feed The BB release was then evaluated under simulated small additives as follows: (1) basal diet, negative control group (NC); intestine conditions according to Martin et al. (28). After 90 min, (2) NC+ 1.5 g/kg of microencapsulated fumaric acid; (3) NC+ 3 the rest of the flasks were removed, and the rest of the previously g/kg of microencapsulated thymol; (4) NC+ microencapsulated mentioned reagents used for the preparation of calibration curve blend of fumaric acid (1.5 g/kg) and thymol (3 g/kg); (5) NC+ 0.9 were added. Flasks were then stirred gently for 2 min before g/kg non-microencapsulated fumaric acid; (6) NC+ 0.6 g/kg free adding 3 ml of freshly prepared pancreatin. All flasks were then thymol; and (7) NC+ mixture of non-microencapsulated fumaric placed in the incubator for a total of 2 h 20 min, reported to be acid (0.9 g/kg) and thymol (0.6 g/kg). approximately the total transit time in the lower GIT (27). At the Chickens were given a two-phase feeding program consisting end of the first 30 min, the pH was adjusted to 7. Four flasks were of a starter (day 0–14) and grower (day 15–35). All diets were removed at 10, 40, 110, and 140 min post-incubation considered formulated according to CVB poultry guidelines (30). All diets as the equivalent transit time for the duodenum, jejunum, ileum, used were sampled, ground, and stored at 5◦ C until they were and cecum, respectively (27). The absorbance was measured analyzed in duplicate. using a spectrophotometer at 450 nm and the concentration was The brooder temperature was maintained at 32◦ C during the determined using the calibration equation, which allowed the first 2 days and was then gradually reduced to 25◦ C on day 14. calculation of the release percentage per segment of the lower Birds were provided with a 24-h light during the first 2 days, digestive tract. 23 h light/1 h darkness program from day 3–10, and 18 h light/6 h darkness through the remainder period (days 11–35). All birds In vivo Screening were allowed ad libitum access to feed in mash form, as well A total of seven 41-day-old Ross 308 male chickens were used as fresh water. Birds and housing facilities were inspected twice to assess the in vivo screening of both non-microencapsulated daily to control general health status, feed, and water availability, and microencapsulated (containing 20% of E133) BB color. The temperature, mortality, and any unexpected events, during the chickens received the basal diet supplemented with either 0.6% experimental period. of non-microencapsulated or 3% of microencapsulated BB color (one and six chickens, respectively) during 24 h before being Growth Performance Evaluation electrically stunned and euthanized. The entire GIT was then Body weight (BW) and feed intake (FI) from each replicate cage removed for the assessment of BB release. Six chickens were used were recorded on days 0, 7, 14, 21, 28, and 35. Average daily gain for the microencapsulated BB color to ensure that the kinetics of (ADG), average daily feed intake (ADFI), and feed conversion release were similar in all birds. ratio (FCR) were calculated. Mortality rates were recorded daily. In vivo Experiment Short-Term Fasting-Induced Challenge The study was performed at the animal experimental facilities On day 21, after finishing the productive performance control, of the Servei de Granges i Camps Experimentals (Universitat the smallest bird in each replicate was removed for stocking Autònoma de Barcelona; Bellaterra, Barcelona, Spain). The density reasons. Afterwards, a short-term FP was performed by experimental procedure received prior approval from the removing feeders for 16 h and 30 min. This aimed to induce Animal Protocol Review Committee of the same institution a challenge, as this practice has been reported as a model to Frontiers in Veterinary Science | www.frontiersin.org 3 October 2021 | Volume 8 | Article 686143 Abdelli et al. Feed Additives for Broiler-Gut-Health Control TABLE 1 | Dietary compositions and nutrient levels (% as fed-basis, unless immediately dissected and content from the cecum was collected otherwise indicated) of the basal diet. for microbiota sequencing. Ileal tissue was collected to perform Starter Growing the histomorphological analysis. Ingredient composition, g/kg diet Histomorphological Analysis Maize 550 582 Ileal samples of about 5 cm were collected at the midpoint Soybean meal 48 303 350 between Meckel’s diverticulum and the ileo-cecal junction. L-lysine HCl 1.2 0.20 Tissue sections (5 µm) were fixed in 4% paraformaldehyde DL-methionine 2.4 1.3 and then embedded in paraffin. Afterwards, the preparations Soy oil 8.0 19.0 were deparaffinized and hydrated before being subjected to Palm oil — 17.0 PAS (Periodic acid-Schiff) staining with Schiff ’s reagent for Full fat soybean 100.0 — morphometric analyses and goblet cells count. Samples were Limestone 10.3 6.3 analyzed using a light microscope. The morphometric variables Dicalcium phosphate 15.7 15.5 measured included villus height (VH), crypt depth (CD), villus Salt 2.0 2.0 height-to-relative crypt depth ratio (VH:CD), and number of Premix* 4.0 4.0 goblet cells/100 µm VH (GC). Ten villi were measured for each sample, and only complete and vertically oriented villi were Sodium bicarbonate 3.4 2.7 evaluated. The mean from 10 villi per sample was used as the Calculated composition (%) mean value for further analysis. All morphometric analysis was Dry matter 87.8 87.9 done by the same person, who was blinded to the treatments. ME (kcal/kg) 2975 3101 Crude protein 22 21 Microbial Diversity Analysis Lysine 1.35 1.18 Bacterial DNA was extracted from cecal content samples Methionine 0.59 0.47 (250 mg) using the commercial MagMAX CORE Nucleic Ca 0.95 0.78 Acid Purification 500RXN Kit (Thermo Fisher, TX, USA) and Total P 0.65 0.63 following the manufacturer’s instructions. For 16S rRNA gene Available P 0.45 0.44 sequence-based analysis, the V3–V4 region of the bacteria Analyzed composition (%) 16S ribosomal RNA gene were amplified by PCR (95◦ C for Dry matter 88.5 88.2 3 min, followed by 25 cycles at 95◦ C for 30 s, 55◦ C for 30 s, GE, kcal/kg 4100 4300 and 72◦ C for 30 s and 72◦ C for 5 min) using primers F5′ - Crude protein 21.9 21.4 barcode TCGTCGGCAGCGTCAGATGTGTATAAGAGACA Ether extract 0.43 0.54 GCCTACGGGNGGCW GCA G-3′ and R5′ -GTCTCGTGGG Crude fiber 2.9 2.7 CTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTAT Ash 5.8 5.6 CTAATCC-3′ . A negative control of the DNA extraction (*) Provided per kg of feed: Vitamin A (retinyl acetate) 10,000 IU; vitamin D3 and a positive Mock Community control were included to (cholecalciferol) 4,800 IU; vitamin B1 (Thiamine) 3 mg; vitamin B2 (riboflavin) 9 mg; ensure quality control. After 25 cycles of amplifications, 550-bp vitamin B3 (Nicotinamide) 51 mg; vitamin B6 (pyridoxine hydrochloride) 4.5 mg; vitamin amplicons were obtained. The Illumina Miseq sequencing 300 B9 (folic acid) 1.8; vitamin B12 (cyanocobalamin) 0.04 mg; vitamin E (DL-α-Tocopheryl × 2 approach was used. Raw sequencing reads were quality acetate): 45 mg; vitamin K3 (Menadione) 3 mg; pantothenic acid (calcium D-pantothenate) 16.5 mg, biotin [D-(+)-biotin] 0.15 mg; choline chloride 350 mg; iron (FeSO4 ) 54 mg; iodine clipped, assembled, and compared with available genomic [Ca(IO3 )2 ] 1.2 mg; zinc (ZnO) 66 mg; manganese (MnO) 90 mg; copper (CuSO4 ) 12 mg; sequences using a Microomics Systems S.L (Barcelona, Spain) selenium (Na2 SeO3 ) 0.2 mg; 6-Phytase EC 3.1.3.26: 1500 FYT; Butylated hydroxytoluene software and were validated and subsequently completed with (BHT) 25 mg; Colloidal silica 45 mg, Sepiolite 1,007 mg. the Kraken Metagenomics (33) and QIIME (34) software. Taxonomic assignment of phylotypes was performed using a Bayesian classifier trained with Silva database version 132 (99% increase intestinal permeability and thereby negatively affect the Operational taxonomic units full-length sequences) (35). gut integrity (31). Statistical Analysis Sampling Procedure and Analyses Statistical analyses were carried out on BW, ADG, ADFI, Diet proximate analyses were performed following Association FCR, and histomorphological analysis with ANOVA using of Official Agricultural Chemists methodology (32): dry matter the GLM procedure of SAS software (SAS 9.4 Institute Inc., (Method 934.01), crude protein (Method 968.06), crude fat Cary, NC, USA). Normal distribution and homoscedasticity of (Method 2003.05), and crude fiber (Method 962.09). Gross variances were checked prior to the analysis, using the Shapiro– energy was determined by an adiabatic calorimeter (IKAC-4000, Wilk test and Levene’s test from UNIVARIATE and GLM Janke-Kunkel; Staufen, Germany). procedures, respectively. All data related to growth performance On day 35, the bird with the closest BW to the mean of the cage and intestinal histomorphology were firstly analyzed according was stunned using an electrical stunner (Reference: 105523, FAF, to a according to a completely randomized design, considering France) before being euthanized for tissue sampling. The GIT was treatment groups as the predictor and the number of cages Frontiers in Veterinary Science | www.frontiersin.org 4 October 2021 | Volume 8 | Article 686143 Abdelli et al. Feed Additives for Broiler-Gut-Health Control FIGURE 1 | In vitro microencapsulated BB release profile in simulated stomach (0–90 min) and small intestine conditions (90–230 min). Each value is the average release of four flasks at simulated conditions of the crop, 0–30 min; gizzard, 30–90 min; duodenum, 90–100; jejunum, 100–130 min; ileum, 130–200 min; and cecum, 200–230 min. (individual broiler chickens for the histomorphology) as the experimental unit. A further analysis of contrasts excluding the NC aiming to compare the microencapsulated feed additives to the non-microencapsulated ones was also performed for the growth performance and histomorphological data. Means were compared using the Tukey multiple comparisons test and deemed significant at p ≤ 0.05. Biostatistical analysis for microbiota was performed using open-source software RStudio v.3.5.1. Diversity was analyzed at OTU level using a vegan package (36). Richness and α-diversity were calculated using raw counts based on Simpson, Shannon, and Inverse-Simpson estimators. β-diversity was evaluated by multivariate ANOVA. Finally, differential abundance analysis was performed with taxa relative abundances under a zero-inflated log normal mixture model, and p-values were corrected by false discovery rate (FDR) using a metagenomeSeq package (37). RESULTS Release of Blue Brilliant (BB) Color In vitro Screening The percentage release of microencapsulated BB was calculated taking into account the transit time (min) in the broiler GIT, adapted from (27). Figure 1 shows the results obtained, indicating that about 19.6% of microencapsulated BB were FIGURE 2 | The GIT of a 42-day-old broiler supplemented with either released in times equivalent to crop and gizzard retention, 10.9% microencapsulated (A) or non-microencapsulated BB (B). in duodenum, 26.6% in jejunum, 29.7% in ileum, and 3.8% in the cecum. In vivo Screening it was observed only from the jejunum and backwards for the Figure 2 shows the GIT of a 42-day-old broiler supplemented birds receiving the microencapsulated BB. Unfortunately, the by either microencapsulated (A) or non-microencapsulated BB quantification of the in vivo release of the microencapsulated BB (B). The blue color was observed in the entire GIT of the was not possible. The reason behind this limitation was that once broiler supplemented with non-microencapsulated BB, whereas mixed with the feed mostly composed of maize in the GIT, the Frontiers in Veterinary Science | www.frontiersin.org 5 October 2021 | Volume 8 | Article 686143 Abdelli et al. Feed Additives for Broiler-Gut-Health Control TABLE 2 | Effect of dietary treatments on growth performance of broiler chickens. Items Experimental treatments SEM p NC Microencapsulated Non-microencapsulated OA EO OA+EO OA EO OA+EO BW g Day 0 42.8 43.2 43.0 42.9 43.3 43.1 42.9 0.16 0.350 Day 21 720 719 699 699 710 705 708 15.6 0.931 Day 28 1106b 1266a 1240a 1260a 1129b 1112b 1132b 21.0 <0.001 Day 35 1694ab 1802a 1790a 1804a 1670ab 1646b 1682ab 33.2 0.001 ADG g/day Days 0–21 32.2 32.2 31.2 31.2 31.7 31.5 31.7 0.9 0.501 Days 21–28 55.1b 78.1a 77.4a 80.2a 59.7b 58.1b 60.5b 2.24 <0.001 Days 28–35 84.1 76.5 78.6 77.7 77.4 76.4 78.6 4.24 0.892 Days 0–35 47.2ab 50.3a 49.9a 50.3a 46.5ab 45.8b 46.8ab 0.95 0.001 ADFI g/day Days 0–21 44.2 44.1 43 42.3 43.1 42.5 43.2 1.13 0.460 Days 21–28 94.2b 111.9a 109.2ab 115.4a 106.3b 103.4b 102.9b 3.64 0.004 days 28–35 143.0 122.4 128.6 124.9 132.6 131.4 133.9 6.97 0.501 Days 0–35 73.1 73.3 73.4 73.5 73.6 72.4 73.3 1.70 0.990 FCR Days 0–21 1.37 1.37 1.38 1.35 1.36 1.35 1.36 0.040 0.762 Days 21–28 1.71a 1.43b 1.41b 1.44b 1.78a 1.78a 1.70a 0.036 <0.001 Days 28–35 1.70a 1.60b 1.64ab 1.61b 1.71a 1.72a 1.70a 0.021 0.006 Days 0–35 1.55a 1.46b 1.47b 1.46b 1.58a 1.58a 1.57a 0.017 <0.001 NC, negative control; OA, organic acid: fumaric; EO, essential oil: thymol. Inclusion levels: microencapsulated fumaric acid: 1.5 g/kg; microencapsulated thymol: 3 g/kg; non-microencapsulated fumaric acid: 0.9 g/kg; non-microencapsulated thymol: 0.6 g/kg. Different letters indicate significant difference between the seven dietary treatments at p ≤ 0.05. Data are presented as mean (n = 10 replicates/group for all evaluated parameters). TABLE 3 | Effect of dietary treatments on the ileal histomorphology on day 35 of age. Items Experimental treatments SEM p NC Microencapsulated Non-microencapsulated OA EO OA+EO OA EO OA+EO VH 607.8b 742.7a 720.6ab 754.8a 639.3ab 657.6ab 628.1ab 28.32 0.040 ab c c c ab b CD 81.3 66.6 64.6 64.0 82.9 76.9 86.1a 2.45 <0.001 VH:CD 7.5b 11.1a 11.2a 11.8a 7.8b 8.6b 7.3b 0.42 <0.001 a b b b a a Goblet cells/100 µm VH 27.7 14.1 15.4 16.1 24.3 23.5 26.0a 0.67 <0.001 NC, negative control; OA, organic acid: fumaric; EO, essential oil: thymol. Inclusion levels: microencapsulated fumaric acid: 1.5 g/kg; microencapsulated thymol: 3 g/kg; non-microencapsulated fumaric acid: 0.9 g/kg; non-microencapsulated thymol: 0.6 g/kg. Different letters indicate significant difference between the seven dietary treatments at p ≤ 0.05. Data are presented as mean (n = 10 replicates/group for all evaluated parameters). digesta color turns to green, making the use of the equation of fumaric acid, thymol, or their mixture (p < 0.001). The analysis the calibration curve previously established, no longer correct. of contrasts showed an improved overall ADG and FCR by the supplementation of microencapsulated form of all the feed In vivo Experiment additives (p < 0.001) as compared to the non-encapsulated ones Growth Performance and the NC. Growth performance data are shown in Table 2. No treatment effect was observed on growth performance of broiler chickens Histomorphological Analysis before performing the short-term FP challenge on day 21. The Histomorphological analysis of the middle portion of the ileum FCR from day 21 to day 28 as well as the overall FCR were is shown in Table 3. Results showed that the experimental groups improved in the experimental groups fed the microencapsulated receiving either the microencapsulated fumaric acid or the Frontiers in Veterinary Science | www.frontiersin.org 6 October 2021 | Volume 8 | Article 686143 Abdelli et al. Feed Additives for Broiler-Gut-Health Control microencapsulated mixture of fumaric acid and thymol exhibited A more in-depth examination of the individual metagenomics higher VH (p = 0.040) than the NC group. All experimental profile changes was detected on the dietary treatments using groups fed the microencapsulated feed additives showed lower log2 changes. Broilers supplemented with the microencapsulated CD, higher VH:CD ratio, and lower count of goblet cells/100 µm mixture of fumaric acid and thymol compared to those fed VH (p < 0.001). the NC (Figure 6) had significant differences in the relative abundance of Firmicutes (0.39-fold decrease; p < 0.0001) and Bacteroidetes (0.52-fold increase; p < 0.0001) phylum, and some Microbial Diversity Analysis families including Rikenellaceae (1.14-fold increase; p = 0.0034), Results of microbial diversity analysis revealed that neither α- Tannerellaceae (3.35-fold increase; p = 0.0067), Bacillaceae (1- diversity (Table 4) nor β-diversity (Figure 3) was different among fold increase; p = 0.0085), Chitinophagaceae (2.45-fold decrease, experimental groups (p > 0.05). p = 0.0027), Pseudomonadaceae (2.58-fold decrease; p = 0.0403), At the phylum level, eight phyla were determined, and Sphingomonadaceae (2.42-fold decrease; p = 0.0004). including mainly Firmicutes, Bacteroidetes, Tenericutes, and Broiler supplementation with the non-encapsulated mixture Verrucomicrobia, followed by Proteobacteria, Actinobacteria, of fumaric acid and thymol significantly changed the abundance Patescibacteria, and Cyanobacteria (Figure 4), with no of Bacteroidetes (0.34-fold increase; p = 0.0060) phyla, differences between dietary treatments (p > 0.05). The and families such as Clostridiaceae 1 (2.51-fold increase; majority of Firmicutes sequences (Figure 5) corresponded p = 0.0096), Erysipelotrichaceae (0.53-fold increase; p = to Ruminococcaceae and Lachnospiraceae while the majority 0.0020), Desulfovibrionaceae (1.02-fold increase; p = 0.0101), of the Bacteroidetes sequences correlated with sequences of Ruminococcaceae (0.27-fold decrease; p < 0.0001), and Bacteroidaceae and Rikenellaceae. Chitinophagaceae (1.15-fold decrease; p < 0.0001) compared to the NC group (Figure 7). The comparison between both forms of the mixture of fumaric acid and thymol (Figure 8) TABLE 4 | Effect of dietary treatments on microbiota α-diversity indices in cecal showed that the microencapsulated one changed the abundance content of broiler chickens on day 35. of Firmicutes (0.22-fold decrease; p < 0.0001), Bacteroidetes Experimental treatments SEM p (0.18-fold increase; p < 0.0001), Tenericutes (0.11-fold increase; p < 0.0001), and Verrucomicrobia (0.22-fold increase; p = NC Encap OA+EO Non-encap OA+EO 0.0003) phylum, and some families like Bacteroidaceae (0.05-fold Shannon 3.72 3.67 3.60 0.028 0.751 increase; p = 0.0385), Erysipelotrichaceae (0.85-fold increase; p Simpson 0.94 0.94 0.93 0.032 0.962 = 0.0021), Clostridiaceae 1 (0.61-fold decrease; p = 0.0006), and Inverse Simpson 18.7 16.5 16.4 1.22 0.570 Pseudomonadaceae (1.27-fold decrease; p = 0.0003). NC, negative control; OA, organic acid: fumaric; EO, essential oil: thymol. Encap, microencapsulated; Non-encap, non-microencapsulated. Inclusion levels: microencapsulated fumaric acid: 1.5 g/kg; microencapsulated thymol: DISCUSSION 3 g/kg; non-microencapsulated fumaric acid: 0.9 g/kg; non-microencapsulated thymol: 0.6 g/kg. In the current study, a short-term FP of 16.5 h was applied p ≤ 0.05 was considered significant. on day 21 as an experimental model to challenge gut FIGURE 3 | Non-metric multidimensional scaling (NMDS) ordination plot of bacterial communities of the different treatment groups (p = 0.430). NC, negative control; OA, organic acid: fumaric; EO, essential oil: thymol. Encap, microencapsulated; Non-encap, non-microencapsulated. Inclusion levels: microencapsulated fumaric acid: 1.5 g/kg; microencapsulated thymol: 3 g/kg; non-microencapsulated fumaric acid: 0.9 g/kg; non-microencapsulated thymol: 0.6 g/kg. Frontiers in Veterinary Science | www.frontiersin.org 7 October 2021 | Volume 8 | Article 686143 Abdelli et al. Feed Additives for Broiler-Gut-Health Control FIGURE 4 | Phyla present in the cecum microbiota of broilers from different treatment groups on day 35. NC, negative control; OA, organic acid: fumaric; EO, essential oil: thymol. Encap: microencapsulated; Non-encap, non-microencapsulated. Inclusion levels: microencapsulated fumaric acid: 1.5 g/kg; microencapsulated thymol: 3 g/kg; non-microencapsulated fumaric acid: 0.9 g/kg; non-microencapsulated thymol: 0.6 g/kg. FIGURE 5 | Abundant bacterial families present in the cecum microbiota of broilers from different treatment groups on day 35. NC, negative control; OA, organic acid: fumaric; EO, essential oil: thymol. Encap: microencapsulated; Non-encap, non-microencapsulated. Inclusion levels: microencapsulated fumaric acid: 1.5 g/kg; microencapsulated thymol: 3 g/kg; non-microencapsulated fumaric acid: 0.9 g/kg; non-microencapsulated thymol: 0.6 g/kg. health. The objective was to investigate whether the evaluated Effects of the Free Feed Additives feed additives were able to alleviate the induced negative Supplementation effects on growth performance, intestinal histomorphology, Compared to the NC, the supplementation of non- and microbiota 2 weeks later. Short-term FP up to 24 h microencapsulated fumaric acid, thymol, or their mixture did has been reported to increase intestinal permeability (38), not show any significant effect on growth performance, neither which may potentially induce bacterial translocation (39), before the short-term FP nor on day 28 or 35. A lack of effect lameness (40), and compromised growth performance (41). was also obtained with the analysis of ileal histomorphology. A recent study conducted by Herrero-Encinas et al. (31) However, the significant increase in goblet cells in the ileum of showed that a 15.5-h short-term FP induced an increase these groups may suggest a higher demand for enhanced mucin in intestinal permeability by reducing Claudin-1 expression, secretion, likely helping to reduce the possible damage of the which triggered an inflammatory response, resulting in a small intestine epithelia (42). Other studies also reported that higher CD and lower VH:CD ratio compared to control non- free OAs failed to reach the cecum in adequate concentrations fasted group. and, thus, to reduce the Campylobacter colonization in broilers Frontiers in Veterinary Science | www.frontiersin.org 8 October 2021 | Volume 8 | Article 686143 Abdelli et al. Feed Additives for Broiler-Gut-Health Control FIGURE 6 | Ln changes promoted by the supplementation of the microencapsulated mixture of fumaric acid and thymol as compared to the NC (fold discovery rate p-adjusted <0.05) in taxa. Positive values ( ) and negative values ( ) indicate greater and lower abundance. Only significant taxa are presented. Differences presented are based on all taxa detected in samples per diet. NC, negative control; OA, organic acid: fumaric; EO, essential oil: thymol. Encap: microencapsulated. Inclusion levels: microencapsulated fumaric acid: 1.5 g/kg; microencapsulated thymol: 3 g/kg. FIGURE 7 | Ln changes promoted by the supplementation of the non-encapsulated mixture of fumaric acid and thymol as compared to the NC (fold discovery rate P-adjusted <0.05) in taxa. Positive values ( ) and negative values ( ) indicate greater and lower abundance. Only significant taxa are presented. Differences presented are based on all taxa detected in samples per diet. NC, negative control; OA, organic acid: fumaric; EO, essential oil: thymol. Non-encap: non-microencapsulated. Inclusion levels: non-microencapsulated fumaric acid: 0.9 g/kg; non-microencapsulated thymol: 0.6 g/kg. (18, 43). This lack of effect may be attributed to their rapid possess high encapsulation efficiency, loading capacity, and degradation, absorption, and metabolism in the upper section of release efficiency in the small intestine (25). This slow release the GIT (before or almost just entering the duodenum) as shown throughout the GIT was confirmed by the results of the in vitro by the results of the in vivo release of non-encapsulated BB. This BB release, showing that nearly 60% was released at jejunum, early absorption means that the majority would not reach the ileum, and cecum equivalent retention times. Although the lower GIT tract where they would exert their major functions quantification was not possible, these findings were further (18), which may represent a serious limitation for their efficacy. supported by the results of the in vivo BB release, where the microencapsulated blue color was not observed in the Effects of Microencapsulated Feed duodenum, suggesting that the release started from the jejunum Additives and backwards. A similar study was performed by Lee et al. (44) The feed additives tested in the current study were to evaluate the physiochemical properties and prolonged release microencapsulated using lipid-based particles, reported to behavior of chitosan-denatured β-lactoglobulin microcapsules Frontiers in Veterinary Science | www.frontiersin.org 9 October 2021 | Volume 8 | Article 686143 Abdelli et al. Feed Additives for Broiler-Gut-Health Control FIGURE 8 | Ln changes promoted by the supplementation of the microencapsulated mixture of fumaric acid and thymol as compared to the non-encapsulated one (fold discovery rate P-adjusted <0.05) in taxa. Positive values ( ) and negative values ( ) indicate greater and lower abundance. Only significant taxa are presented. Differences presented are based on all taxa detected in samples per diet. NC, negative control; OA, organic acid: fumaric; EO, essential oil: thymol. Encap: microencapsulated; Non-encap, non-microencapsulated. Inclusion levels: microencapsulated fumaric acid: 1.5 g/kg; microencapsulated thymol: 3 g/kg; non-microencapsulated fumaric acid: 0.9 g/kg; non-microencapsulated thymol: 0.6 g/kg. for potential food applications. These authors obtained similar under conventional conditions (51) or an encapsulated blend promising results, showing that their wall matrix provided both containing 4% thyme, 4% carvacrol, 0.5% hexanoic acid, 3.5% the right timing and location for the BB dye release. benzoic acid, and 0.5% butyric acid to broiler chickens challenged Targeting the lower GIT may be advantageous to enhance with necrotic enteritis (48) resulted in longer villi and a greater the intestinal development, which helps to improve digestion VH:CD ratio. and nutrient absorption, and thereby, the growth performance In the current study, all the feed additives with the (19). Growth performances have been evaluated in several same form of presentation (microencapsulated or non- experiments in which broiler chickens were supplemented by microencapsulated) showed similar effects on the growth OAs, EOs, or the mixture of both. However, the considerable performance and histomorphological analysis. Thus, only increasing number of published articles has generated great the cecal microbiota of the chickens supplemented with the information inconsistency. Although some studies revealed mixture, either microencapsulated or not, has been analyzed improved production performance traits by protected OA as compared to the NC group. The obtained results showed supplementation (45), EO supplementation (46), or their mixture that the supplementation of the microencapsulated mixture (47–49), others reported no effect on growth performance of fumaric acid and thymol increased the relative abundance of chickens (50). This discrepancy may be attributed to the of phyla Bacteroidetes and decreased the relative abundance of heterogeneity of experimental conditions, such as the chemical phyla Firmicutes compared to the NC group. Similar results structure of the OAs or EOs used, the dose, the supplementation were obtained by Chen et al. (10) and Wu et al. (52) by the form (mixed or not), the sanitary challenge conditions, the supplementation of broiler chickens by plant essential oil and number of used chickens, the size of cages or barns, the sodium butyrate, respectively. However, the supplementation buffering capacity of feeds, the feed nutritional dietary value, and of broilers by a blend containing 4% thyme, 4% carvacrol, other factors. 0.5% hexanoic acid, 3.5% benzoic acid, and 0.5% butyric acid In the current study, the supplementation of encapsulated in Ca-alginate and whey protein microcapsules microencapsulated fumaric acid, thymol, and their mixture resulted in an increase of the relative abundance of Firmicutes improved the overall FCR during the whole experiment by while the relative abundance of Bacteroidetes decreased (48). 5.8% compared to the NC, and up to 7.0% compared to the Although an increase in fecal Bacteroidetes has been associated non-microencapsulated ones. This improvement of growth with decreased nutrient absorption (53), this phylum composed performance may, in part, be attributed to the observed of Gram-negative bacteria has been recently reported to be beneficial effects of these feed additives on ileal histomorphology gut-friendly, being involved in many important metabolic (increased VH, reduced CD, increased VH:CD ratio, and lower activities. Indeed, Bacteroidetes participate in the degradation of goblet cells/100 µm as compared to the NC group). Similar polysaccharides and other indigestible carbohydrates to produce positive effects were previously reported by other authors, short-chain fatty acids (SCFAs), especially propionate via the where feeding a protected blend containing a minimum of succinate pathway (10, 52), utilization of nitrogenous substances, 200 g/kg of sorbic acid, a minimum of 200 g/kg fumaric acid, the biotransformation of bile acids, and the prevention of a minimum of 100 g/kg thymol to broiler chickens reared pathogen colonization (54). Among the Bacteroidetes, the Frontiers in Veterinary Science | www.frontiersin.org 10 October 2021 | Volume 8 | Article 686143 Abdelli et al. Feed Additives for Broiler-Gut-Health Control microencapsulated blend tested in the current study increased diarrhea, and septicemia (65). Moreover, Pseudomonas veronii is the abundance of Rikenellaceae whose effect on the host a potential opportunistic pathogen whose abundance increased gut health remains inconsistent. Some studies considered a in broiler chickens challenged by C. perfringens (66). reduced abundance of this family to be beneficial (48) as it Surprisingly, the microencapsulated blend tested in the utilizes the mucin, involved in preventing adhesion of various current study increased the abundance of Desulfovibrionaceae, pathogens and toxins present in the intestinal lumen, as a producer of hydrogen sulfides reported to be toxic to carbon and energy source, which may decrease the intestinal mucosal tissue, which leads to severe inflammation of mucosal barrier integrity (55). However, members of this chicken GIT (67) and decreased that of Ruminococcaceae family, such as Alistipes, showed to be increased in the current and Peptostreptococcaceae, known as butyric acid-forming study, have been reported to produce propionic and succinic bacteria (58). The decrease of Peptostreptococcaceae was not acids by fermentation of glucose, lactose, mannose, and in concordance with previous studies that reported this family melibiose, and form the iso-methyl branched-chain fatty acid to be higher in broiler chickens supplemented with a blend or long-chain saturated acids (10). Tannerellaceae, a family of medium-chain fatty acids containing 0.3% capric acid and belonging to Bacteroidetes, which was also increased by the 2.7% lauric acid (68), as well as mice supplemented with 13.3 supplementation of the microencapsulated blend of fumaric mg/ml of eugenol in drinking water for 7 days (11). However, the acid and thymol, produces acetate and succinate as its major improved growth performance and intestinal histomorphology metabolic end-products. Succinate can provide energy in two of the supplemented chickens indicated these birds to possess distinct ways. It can be either taken up directly by chicken healthier intestinal microbiota compared to the NC group despite intestinal cells through a sodium-dependent transport system the above-mentioned unexpected changes of the gut microbiota. and then introduced in the tricarboxylic acid or Krebs cycle Taken together, our results indicate that microencapsulating or converted by several other Bacteroidetes bacteria into the fumaric acid and thymol using a lipid matrix prevents propionate after decarboxylation (56). As for Firmicutes, they their absorption in the upper part of the digestive tract are Gram-positive bacteria associated with the decomposition of and directs their bioactivity toward the lower GIT, mainly polysaccharides and the production of butyrate (57). Belonging the jejunum and ileum. In previous in vitro studies, we to this phylum, the abundance of Lachnospiraceae, known confirmed that the lipid base particles (empty particles per as butyric acid-forming bacteria (58), showed a numerical se) did not possess any antimicrobial activity. Therefore, increase in the chickens fed the microencapsulated blend it can be concluded that once released, fumaric acid of fumaric acid and thymol as compared to the NC group and thymol enhanced intestinal microbiota balance in (11.50 vs. 9.18%, respectively). Enhancing SCFA production favor of beneficial bacteria, which may be responsible is crucial for animal gut health. Indeed, butyrate has been for the improvement of ileum histomorphology and reported to possess anti-inflammatory properties through thereby feed efficiency of broiler chickens. The positive the inhibition of nuclear factor-kappa B activation, leading effects of microencapsulated fumaric acid, thymol, or to decreased expression of pro-inflammatory cytokines (59), their combination were observed when broilers were which may explain the decrease in necrotic lesions induced by under the challenging conditions of short-term fasting C. perfringens in the small intestine (60). It may also improve period, but not earlier, highlighting the usefulness of using growth performance through pathogen control (17), barrier such feed additives when sanitary conditions of animals integrity enhancement by upregulating the AMP-activated are compromised. protein kinase, which regulates the assembly of tight junctions (61), and the activation of goblet cells to produce mucin, which forms a protective layer on the enterocytes (62). As CONCLUSION for propionate, it can also be used as an energy source by the epithelial cells and is known to stimulate the trypsin In summary, the results of the current study confirmed activity (63) and to possess health-promoting effects, including the ability of the lipid matrix, obtained through the an anti-inflammatory activity, which may improve growth use of the electrohydrodynamic processes, to allow a performance (56). slow release of fumaric acid and thymol throughout the On the other hand, the increased abundance of Bacillaceae broiler GIT. Microencapsulated fumaric acid, thymol, or induced by the microencapsulated blend tested in the current their combination showed positive effects when broilers study may be considered beneficial as a recent study showed a were subjected to challenging conditions, alleviating positive correlation between this family and total volatile fatty the negative effects promoted by the fasting challenge acids (VFAs). Bacillaceae has also been shown to play a key on animal performance, intestinal histomorpholgy, role in improving the immune status by enhancing different and microbiota. antioxidants and tight-junction genes (64). The increase in the above-mentioned families may explain the decline observed in other families containing pathogen DATA AVAILABILITY STATEMENT bacteria such as Pseudomonadaceae. The infection of broiler chickens with Pseudomonas aeruginosa is associated with high The datasets generated for this study have been submitted to the mortality and clinical signs including respiratory manifestations, Sequence Read Archive (SRA) database of the National Center for Frontiers in Veterinary Science | www.frontiersin.org 11 October 2021 | Volume 8 | Article 686143 Abdelli et al. Feed Additives for Broiler-Gut-Health Control Biotechnology Information as FASTQ files under study accession FUNDING number PRJNA734795. This research was funded by Tecnología & Vitaminas belonging to the Spanish pharmaceutical company FAES FARMA. NA ETHICS STATEMENT was funded by an FI Ph.D. grant from the Agència de The animal study was reviewed and approved by CEEAH Gestió d’Ajuts Universitaris i de Recerca de la Generalitat de Universitat Autònoma de Barcelona. Catalunya (2018FI_B_01070). DM-D: was funded by a pre- doctoral scholarship from the Secretaria de Educación Superior, Ciencia, Tecnología e Innovación de Ecuador (SENESCYT). AUTHOR CONTRIBUTIONS NA, JFP, EV, and DS-O conceived and designed the study. NA ACKNOWLEDGMENTS and RK performed the experiments. NA and DM-D analyzed the data. NA wrote the manuscript. JFP, DS-O, EV, and IC We are grateful to the staff of the Servei de Granges i Camps corrected the manuscript. All authors read and approved the Experimentals de la UAB for the support and assistance during final manuscript. the experiment. REFERENCES performance, carcass quality and gut integrity of broiler chickens. Vet World. (2014) 7:284–90. doi: 10.14202/vetworld.2014.284-290 1. Kogut MH, Arsenault RJ. Editorial: gut health: the new paradigm in food 14. Kim DK, Lillehoj HS, Lee SH, Jang SI, Bravo D. High-throughput gene animal production. Front Vet Sci. (2016) 3:71. doi: 10.3389/fvets.2016.00071 expression analysis of intestinal intraepithelial lymphocytes after oral feeding 2. Celi P, Verlhac V, Pérez Calvo E, Schmeisser J, Kluenter AM. Biomarkers of of carvacrol, cinnamaldehyde, or Capsicum oleoresin. Poult Sci. (2010) 89:68– gastrointestinal functionality in animal nutrition and health. Anim Feed Sci 81. doi: 10.3382/ps.2009-00275 Technol. (2019) 250:9–31. doi: 10.1016/j.anifeedsci.2018.07.012 15. O’Bryan CA, Pendleton SJ, Crandall PG, Ricke SC. Potential of 3. Dittoe DK, Ricke SC, Kiess AS. Organic acids and potential for modifying the plant essential oils and their components in animal agriculture - in avian gastrointestinal tract and reducing pathogens and disease. Front Vet Sci. vitro studies on antibacterial mode of action. Front Vet Sci. (2015) (2018) 5:216. doi: 10.3389/fvets.2018.00216 2:35. doi: 10.3389/fvets.2015.00035 4. Song B, Li H, Wu Y, Zhen W, Wang Z, Xia Z, et al. Effect of microencapsulated 16. Zhou F, Ji B, Zhang H, Jiang H, Yang Z, Li J, et al. Synergistic sodium butyrate dietary supplementation on growth performance and effect of thymol and carvacrol combined with chelators and organic intestinal barrier function of broiler chickens infected with necrotic enteritis. acids against Salmonella Typhimurium. J Food Prot. (2007) 70:1704– Anim Feed Sci Technol. (2017) 232:6–15. doi: 10.1016/j.anifeedsci.2017.07.009 9. doi: 10.4315/0362-028X-70.7.1704 5. Wang J, Dai D, Zhang HJ, Wu SG, Han YM, Wu YY, et al. Organic 17. Fernández-Rubio C, Ordóñez C, Abad-González J, Garcia-Gallego A, acids modulate systemic metabolic perturbation caused by Salmonella Honrubia MP, Mallo JJ, et al. Butyric acid-based feed additives help protect Pullorum challenge in early-stage broilers. Front Physiol. (2019) broiler chickens from Salmonella Enteritidis infection. Poult Sci. (2009) 10:1418. doi: 10.3389/fphys.2019.01418 88:943–8. doi: 10.3382/ps.2008-00484 6. Zhang S, Shen YR, Wu S, Xiao YQ, He Q, Shi SR. The dietary combination 18. Metcalf JH, Donoghue AM, Venkitanarayanan K, Reyes-Herrera I, Aguiar of essential oils and organic acids reduces Salmonella enteritidis in challenged VF, Blore PJ, et al. Water administration of the medium-chain fatty acid chicks. Poult Sci. (2019) 98:6349–55. doi: 10.3382/ps/pez457 caprylic acid produced variable efficacy against enteric Campylobacter 7. Solis De Los Santos F, Donoghue AM, Venkitanarayanan K, Reyes-Herrera I, colonization in broilers. Poult Sci. (2011) 90:494–7. doi: 10.3382/ps.2010- Metcalf JH, Dirain ML, et al. Therapeutic supplementation of caprylic acid in 00891 feed reduces Campylobacter jejuni colonization in broiler chicks. Appl Environ 19. Bedford A, Gong J. Implications of butyrate and its derivatives Microbiol. (2008) 74:4564–6. doi: 10.1128/AEM.02528-07 for gut health and animal production. Anim Nutr. (2018) 8. Emami NK, Daneshmand A, Naeini SZ, Graystone EN, Broom LJ. Effects of 4:151–9. doi: 10.1016/j.aninu.2017.08.010 commercial organic acid blends on male broilers challenged with E. coli K88 20. Micciche A, Rothrock MJ Jr, Yang Y, Ricke SC. Essential oils as an intervention : Performance, microbiology, intestinal morphology, and immune response. strategy to reduce campylobacter in poultry production: a review. Front Poult Sci. (2017) 96:3254–63. doi: 10.3382/ps/pex106 Microbiol. (2019) 10:1058. doi: 10.3389/fmicb.2019.01058 9. Bravo D, Pirgozliev V, Rose SP. A mixture of carvacrol, cinnamaldehyde, 21. Drosou CG, Krokida MK, Biliaderis CG. Encapsulation of bioactive and capsicum oleoresin improves energy utilization and growth performance compounds through electrospinning/electrospraying and spray drying: a of broiler chickens fed maize-based diet. J Anim Sci. (2014) 92:1531– comparative assessment of food-related applications. Dry Technol. (2017) 6. doi: 10.2527/jas.2013-6244 35:139–62. doi: 10.1080/07373937.2016.1162797 10. Chen Y, Wang J, Yu L, Xu T, Zhu N. Microbiota and metabolome responses 22. Mohammadalinejhad S, Kurek MA. Microencapsulation of anthocyanins- in the cecum and serum of broiler chickens fed with plant essential oils or critical review of techniques and wall materials. Appl Sci. (2021) virginiamycin. Sci Rep. (2020) 10:5382. doi: 10.1038/s41598-020-60135-x 11:3936. doi: 10.3390/app11093936 11. Wlodarska M, Willing BP, Bravo DM, Finlay BB. Phytonutrient diet 23. Rostami M, Yousefi M, Khezerlou A, Mohammadi A, Jafari SM. supplementation promotes beneficial Clostridia species and intestinal mucus Application of different biopolymers for nanoencapsulation of secretion resulting in protection against enteric infection. Sci Rep. (2015) antioxidants via electrohydrodynamic processes. Food Hydrocoll. (2019) 5:9253. doi: 10.1038/srep09253 97:105170. doi: 10.1016/j.foodhyd.2019.06.015 12. Lee HS, Lillehoj HS, Jang SI, Lee KW, Bravo D, Lillehoj EP. Effects 24. Yflow R Coaxial Electrospinning & Electrospraying Tech. Available online at: of dietary supplementation with phytonutrients on vaccine-stimulated http://www.yflow.com/technology/coaxial-electrospinning/ (accessed: June 3, immunity against infection with Eimeria tenella. Vet Parasitol. (2011) 181:97– 2021) 105. doi: 10.1016/j.vetpar.2011.05.003 25. Stevanović ZD, Bošnjak-Neumüller J, Pajić-Lijaković I, Raj J, Vasiljević 13. Awaad MHH, Elmenawey M, Ahmed KA. Effect of a specific combination M. Essential oils as feed additives—Future perspectives. Molecules. (2018) of carvacrol, cinnamaldehyde, and Capsicum oleoresin on the growth 23:1717. doi: 10.3390/molecules23071717 Frontiers in Veterinary Science | www.frontiersin.org 12 October 2021 | Volume 8 | Article 686143 Abdelli et al. Feed Additives for Broiler-Gut-Health Control 26. Boisen S, Fernández JA. Prediction of the total tract digestibility of energy in necrotic enteritis caused by Clostridium perfringes in chickens. Sci Rep. (2017) feedstuffs and pig diets by in vitro analyses. Anim Feed Sci Technol. (1997) 7:7334. doi: 10.1038/s41598-017-07420-4 68:277–86. doi: 10.1016/S0377-8401(97)00058-8 47. Abdelli N, Pérez JF, Vilarrasa E, Cabeza Luna I, Melo-Duran D, D’Angelo M, 27. Ravindran V. Feed enzymes: the science, practice, and metabolic realities. J et al. Targeted-release organic acids and essential oils improve performance Appl Poult Res. (2013) 22:628–36. doi: 10.3382/japr.2013-00739 and digestive function in broilers under a necrotic enteritis challenge. 28. Martin D, Moran-Valero MI, Vázquez L, Reglero G, Torres CF. Animals. (2020) 10:259. doi: 10.3390/ani10020259 Comparative in vitro intestinal digestion of 1,3-diglyceride and 1- 48. Pham VH, Kan L, Huang J, Geng Y, Zhen W, Guo Y, et al. Dietary encapsulated monoglyceride rich oils and their mixtures. Food Res Int. (2014) essential oils and organic acids mixture improves gut health in broiler 64:603–9. doi: 10.1016/j.foodres.2014.07.026 chickens challenged with necrotic enteritis. J Anim Sci Biotechnol. (2020) 29. European Parliament. Directive 2010/63/EU of the European Parliament and 11:18. doi: 10.1186/s40104-019-0421-y of the Council of 22 September 2010 on the Protection of Animals Used for 49. Stefanello C, Rosa DP, Dalmoro YK, Segatto AL, Vieira MS, Moraes Scientific Purposes (2010). ML, et al. Protected blend of organic acids and essential oils improves 30. Blok DMC. CVB Table Booklet Feeding of Poultry. (2009). p. 1–34. growth performance, nutrient digestibility, and intestinal health of 31. Herrero-Encinas J, Blanch M, Pastor JJ, Menoyo D. Diet supplementation with broiler chickens undergoing an intestinal challenge. Front Vet Sci. (2020) a bioactive pomace extract from Olea europaea partially mitigates negative 6:491. doi: 10.3389/fvets.2019.00491 effects on gut health arising from a short-term fasting period in broiler 50. Zhang K, Yan F, Keen C, Waldroup P. Evaluation of microencapsulated chickens. Animals. (2020) 10:349. doi: 10.3390/ani10020349 essential oils and organic acids in diets for broiler chickens. Int J Poult Sci. 32. AOAC International. Official Methods of Analysis, 18th Edn. Gaithersburg, (2005) 4:612–9. doi: 10.3923/ijps.2005.612.619 MD: AOAC International (2005). 51. Yang X, Xin H, Yang C, Yang X. Impact of essential oils and organic 33. Wood DE, Salzberg SL. Kraken: ultrafast metagenomic sequence acids on the growth performance, digestive functions and immunity of classification using exact alignments. Genome Biol. (2014) broiler chickens. Anim Nutr. (2018) 4:388–93. doi: 10.1016/j.aninu.2018. 15:R46. doi: 10.1186/gb-2014-15-3-r46 04.005 34. Caporaso JG, Kuczynski J, Stombaugh J, Bittinger K, Bushman FD, Costello 52. Wu W, Xiao Z, An W, Dong Y, Zhang B. Dietary sodium EK, et al. QIIME allows analysis of high- throughput community sequencing butyrate improves intestinal development and function by data. Nat Methods. (2010) 7:335–6. doi: 10.1038/nmeth.f.303 modulating the microbial community in broilers. PLoS ONE. (2018) 35. Wang Q, Garrity GM, Tiedje JM, Cole JR. Naïve Bayesian classifier for rapid 13:e0197762. doi: 10.1371/journal.pone.0197762 assignment of rRNA sequences into the new bacterial taxonomy. Appl Environ 53. Bortoluzzi C, Pedroso AA, Mallo JJ, Puyalto M, Kim WK, Applegate Microbiol. (2007) 73:5261–7. doi: 10.1128/AEM.00062-07 TJ. Sodium butyrate improved performance while modulating the cecal 36. Oksanen J, Blanchet FG, Friendly M, Kindt R, Legendre P, Mcglinn D, et al. microbiota and regulating the expression of intestinal immune-related Package “vegan”.Community ecology package, Version 2.5-6 (2019). genes of broiler chickens. Poult Sci. (2017) 96:3981–93. doi: 10.3382/ps/ 37. Joseph A, Paulson N, Olson ND, Braccia DJ, Wagner J, Talukder H, pex218 Pop M, Bravo HC, Paulson MJN. Package ‘metagenomeSeq Statistical 54. Corrigan A, de Leeuw M, Penaud-Frézet S, Dimova D, Murphy RA. Analysis for Sparse High-throughput Sequencing Version. (2019). Available Phylogenetic and functional alterations in bacterial community compositions Online at: https://git.bioconductor.org/packages/metagenomeSeqgit_branch in broiler ceca as a result of mannan oligosaccharide. Appl Environ Microbiol. Paulson JN. metagenomeSeq: Statistical Analysis for Sparse High-Throughput (2015) 81:3460–70. doi: 10.1128/AEM.04194-14 Sequencing (2019). 55. Chen WL, Tang SGH, Jahromi MF, Candyrine SCL, Idrus Z, Abdullah 38. Gilani S, Howarth GS, Tran CD, Barekatain R, Kitessa SM, Forder RE, et al. N, et al. Metagenomics analysis reveals significant modulation of cecal Reduced fasting periods increase intestinal permeability in chickens. J Anim microbiota of broilers fed palm kernel expeller diets. Poult Sci. (2019) 98:56– Physiol Anim Nutr. (2017) 102:486–92. doi: 10.1111/jpn.12712 68. doi: 10.3382/ps/pey366 39. Vicuña EA, Kuttappan VA, Galarza-Seeber R, Latorre JD, Faulkner OB, 56. De Maesschalck C, Eeckhaut V, Maertens L, De Lange L, Marchal L, Daube Hargis BM, et al. Effect of dexamethasone in feed on intestinal permeability, G, et al. Amorphous cellulose feed supplement alters the broiler caecal differential white blood cell counts, and immune organs in broiler chicks. microbiome. Poult Sci. (2019) 98:3811–7. doi: 10.3382/ps/pez090 Poult Sci. (2015) 94:2075–80. doi: 10.3382/ps/pev211 57. Zhu N, Wang J, Yu L, Zhang Q, Chen K, Liu B. Modulation 40. Wideman RF Jr, Al-Rubaye A, Reynolds D, Yoho D, Lester H, Spencer C, of growth performance and intestinal microbiota in chickens et al. Bacterial chondronecrosis with osteomyelitis in broilers: influence of fed plant extracts or virginiamycin. Front Microbiol. (2019) sires and straight-run versus sex-separate rearing. Poult Sci. (2014) 93:1675– 10:1333. doi: 10.3389/fmicb.2019.01333 87. doi: 10.3382/ps.2014-03912 58. Onrust L, Ducatelle R, Van Driessche K, De Maesschalck C. Steering 41. Chen J, Tellez G, Richards JD, Escobar J. Identification of potential endogenous butyrate production in the intestinal tract of broilers as a tool biomarkers for gut barrier failure in broiler chickens. Front Vet Sci. (2015) to improve gut health. Front Vet Sci. (2015) 2:75. doi: 10.3389/fvets.2015. 2:14. doi: 10.3389/fvets.2015.00014 00075 42. Kim JJ, Khan WI. Goblet cells and mucins: role in innate defense in enteric 59. Place RF, Noonan EJ, Giardina C. HDAC inhibition prevents NF- k infections. Pathogens. (2013) 2:55–70. doi: 10.3390/pathogens2010055 B activation by suppressing proteasome activity : down-regulation of 43. Hermans D, Martel A, van Deun K, Verlinden M, van Immerseel F, Garmyn A, proteasome subunit expression stabilizes IkBα. Biochem Pharmacol. (2005) et al. Intestinal mucus protects Campylobacter jejuni in the ceca of colonized 70:394–406. doi: 10.1016/j.bcp.2005.04.030 broiler chickens against the bactericidal effects of medium-chain fatty acids. 60. Timbermont L, Lanckriet A, Dewulf J, Nollet N, Schwarzer K, Haesebrouck F, Poult Sci. (2010) 89:1144–55. doi: 10.3382/ps.2010-00717 et al. Control of Clostridium perfringens -induced necrotic enteritis in broilers 44. Lee PS, Yim SG, Choi Y, Van Anh Ha T, Ko S. Physiochemical properties by target-released butyric acid, fatty acids and essential oils. Avian Pathol. and prolonged release behaviours of chitosan-denatured β-lactoglobulin (2010) 39:117–21. doi: 10.1080/03079451003610586 microcapsules for potential food applications. Food Chem. (2012) 134:992– 61. Peng L, Li Z, Green RS, Holzman IR, Lin J. Butyrate enhances the 8. doi: 10.1016/j.foodchem.2012.03.006 intestinal barrier by facilitating tight junction assembly via activation of 45. Jazi V, Foroozandeh AD, Dastar B, Rezaie Koochaksaraie R, Toghyani M. AMP-activated protein kinase in Caco-2 cell monolayers. J Nutr. (2009) Effects of Pediococcus acidilactici, mannan-oligosaccharide, butyric acid and 139:1619–25. doi: 10.3945/jn.109.104638 their combination on growth performance and intestinal health in young 62. Chen J, Vitetta L. The role of butyrate in attenuating pathobiont-induced broiler chickens challenged with Salmonella Typhimurium. Poult Sci. (2018) hyperinflammation. Immune Netw. (2020) 20:e15. doi: 10.4110/in.2020.20.e15 97:2034–43. doi: 10.3382/ps/pey035 63. Wang Y, Sun J, Zhong H, Li N, Xu H, Zhu Q, et al. Effect of probiotics 46. Yin D, Du E, Yuan J, Gao J, Wang YL, Aggrey SE, et al. Supplemental thymol on the meat flavour and gut microbiota of chicken. Sci Rep. (2017) and carvacrol increases ileum Lactobacillus population and reduces effect of 7:6400. doi: 10.1038/s41598-017-06677-z Frontiers in Veterinary Science | www.frontiersin.org 13 October 2021 | Volume 8 | Article 686143 Abdelli et al. Feed Additives for Broiler-Gut-Health Control 64. Wasti S, Sah N, Singh AK, Lee CN, Jha R, et al. Dietary supplementation of Conflict of Interest: The authors declare that the research was conducted in the dried plum: a novel strategy to mitigate heat stress in broiler chickens. J Anim absence of any commercial or financial relationships that could be construed as a Sci Biotechnol. (2021) 12:58. doi: 10.1186/s40104-021-00571-5 potential conflict of interest. 65. Shukla S, Mishra P. Pseudomonas aeruginosa infection in broiler chicks in Jabalpur. Int J Extensive Res. (2015) 6:1–3. Publisher’s Note: All claims expressed in this article are solely those of the authors 66. Zhang B, Lv Z, Li Z, Wang W, Li G, Guo Y. Dietary L -arginine and do not necessarily represent those of their affiliated organizations, or those of supplementation alleviates the intestinal injury and modulates the publisher, the editors and the reviewers. Any product that may be evaluated in the gut microbiota in broiler chickens challenged by Clostridium this article, or claim that may be made by its manufacturer, is not guaranteed or perfringens. Front Microbiol. (2018) 9:1716. doi: 10.3389/fmicb.2018. endorsed by the publisher. 01716 67. Abaidullah M, Peng S, Kamran M, Song X, Yin Z. Current findings on gut microbiota mediated immune modulation against Copyright © 2021 Abdelli, Francisco Pérez, Vilarrasa, Melo-Duran, Cabeza Luna, viral diseases in chicken. Viruses. (2019) 11:681. doi: 10.3390/v110 Karimirad and Solà-Oriol. This is an open-access article distributed under the terms 80681 of the Creative Commons Attribution License (CC BY). The use, distribution or 68. Kers JG, Velkers FC, Fischer EAJ, Hermes GDA, Lamot DM, Stegeman JA, reproduction in other forums is permitted, provided the original author(s) and the et al. Take care of the environment: housing conditions affect the interplay of copyright owner(s) are credited and that the original publication in this journal nutritional interventions and intestinal microbiota in broiler chickens. Anim is cited, in accordance with accepted academic practice. No use, distribution or Microbiome. (2019) 1:10. doi: 10.1186/s42523-019-0009-z reproduction is permitted which does not comply with these terms. Frontiers in Veterinary Science | www.frontiersin.org 14 October 2021 | Volume 8 | Article 686143