ORIGINAL RESEARCH published: 21 October 2021 doi: 10.3389/fphys.2021.733134 Effects of Cyclic Chronic Heat Stress on the Expression of Nutrient Transporters in the Jejunum of Modern Broilers and Their Ancestor Wild Jungle Fowl Nedra Abdelli 1,2 , Alison Ramser 2 , Elizabeth S. Greene 2 , Lesleigh Beer 2 , Travis W. Tabler 2 , Sara K. Orlowski 2 , José Francisco Pérez 1 , David Solà-Oriol 1 , Nicholas B. Anthony 2 and Sami Dridi 2* 1 Animal Nutrition and Welfare Service, Department of Animal and Food Sciences, Universitat Autònoma de Barcelona, Bellaterra, Spain, 2 Department of Poultry Science, University of Arkansas, Fayetteville, AR, United States Edited by: Michael Kogut, Heat stress (HS) has been reported to disrupt nutrient digestion and absorption in Agricultural Research Service, broilers. These effects may be more prominent in fast-growing chickens due to their United States Department of high metabolic activity. However, the underlying molecular mechanisms are not yet fully Agriculture, United States elucidated. Hence, the current study aimed to evaluate the effect of chronic HS on Reviewed by: Katarzyna B. Miska, jejunal nutrient transport in slow- (Athens Canadian Random Bred, ACRB from 1950), Beltsville Agricultural Research Center, moderate- (The 1995 random bred, 95RAN), rapid- (modern broilers, modern random Agricultural Research Service (USDA), United States bred, MRB) growing birds and their ancestor wild jungle fowl (JF). One-day male chicks Kwanseob Shim, (n = 150/line) were placed by line in environmentally controlled chambers and kept Jeonbuk National University, under the same industry-standard environmental conditions until d28. On d29, an 8-h South Korea daily cyclic HS (36◦ C) was applied to half of the chambers, which lasted until d55, *Correspondence: Sami Dridi while keeping the rest under thermal neutral (TN, 24◦ C) conditions. Jejunum tissues dridi@uark.edu were collected for morphology assessment and molecular analysis of carbohydrate-, amino acid-, and fatty acid-transporters. MRB exhibited the highest body weight (BW) Specialty section: This article was submitted to followed by 95RAN under both conditions. HS decreased feed intake (FI) in MRB and Avian Physiology, 95RAN, which resulted in lower BW compared to their TN counterparts; however, no a section of the journal Frontiers in Physiology effect was observed in ACRB and JF. MRB showed a greater villus height (VH) to crypt Received: 29 June 2021 depth (CD) ratio under both environmental conditions. Molecular analyses showed that Accepted: 16 September 2021 glucose transporter (GLUT) 2, 5, 10, and 11 were upregulated in MRB compared to Published: 21 October 2021 some of the other populations under TN conditions. HS downregulated GLUT2, 10, Citation: 11, and 12 in MRB while it increased the expression of GLUT1, 5, 10, and 11 in JF. Abdelli N, Ramser A, Greene ES, Beer L, Tabler TW, Orlowski SK, GLUT2 protein expression was higher in JF compared to ACRB and MRB under TN Pérez JF, Solà-Oriol D, Anthony NB conditions. It also showed an increase in ACRB but no effect on 95RAN and MRB under and Dridi S (2021) Effects of Cyclic Chronic Heat Stress on the HS conditions. ACRB exhibited greater expression of the EAAT3 gene as compared to Expression of Nutrient Transporters in the rest of the populations maintained under TN conditions. HS exposure did not alter the Jejunum of Modern Broilers and the gene expression of amino acid transporters in MRB. Gene expression of CD36 and Their Ancestor Wild Jungle Fowl. Front. Physiol. 12:733134. FABP2 was upregulated in HS JF birds. Protein expression of CD36 was downregulated doi: 10.3389/fphys.2021.733134 in HS JF while no effect was observed in ACRB, 95RAN, and MRB. Taken together, these Frontiers in Physiology | www.frontiersin.org 1 October 2021 | Volume 12 | Article 733134 Abdelli et al. Heat Stress and Broiler Nutrient Transport data are the first to show the effect of HS on jejunal expression of nutrient transporters in three broiler populations known to represent 70 years of genetic progress in the poultry industry and a Red Jungle Fowl population representative of the primary ancestor of domestic chickens. Keywords: broilers, heat stress, glucose transporters, amino acid transporters, fatty acid transporters INTRODUCTION the intestine of broiler chickens (Sun et al., 2015; Habashy et al., 2017a; Al-zghoul et al., 2019). Similarly, protein expressions of Heat stress (HS) is considered one of the main threats to the SGLT1, GLUT1, and GLUT10 were lowered in the intestine of poultry industry especially under continuous climate changes, laying hens subjected to HS for 12 weeks (Orhan et al., 2019). including global warming (Perini et al., 2021). The high HS has been also shown to impair fatty acid transporters (FATs), susceptibility of chickens to HS is attributed to their limited especially by reducing the gene expression of fatty acid-binding ability to regulate heat loss due to the presence of feathering proteins (FABPs), such as FABP1, irrespective of exposure time and the lack of sweat glands (Wasti et al., 2020). On the other and intensity of stress (Sun et al., 2015; Habashy et al., 2017b; Al- hand, the genetic selection of fast-growing meat-type broilers zghoul et al., 2019), the gene expression of fatty acid transport during the last few decades has focused narrowly and intensely proteins (FATPs), and the gene and protein expression of the on increasing growth rates and meat yield, improving feed cluster of differentiation 36 (CD36) (Al-zghoul et al., 2019; Orhan efficiency, and decreasing slaughter age (Wasti et al., 2020). et al., 2019). Research has shown conflicting results regarding Indeed, modern broilers are characterized by higher metabolic the effects of chronic HS on amino acid transport. Although a activities compared to their ancestors, resulting in increased decrease of PEPT1 has been reported in broilers subjected to body heat production (Al-zghoul et al., 2019). Therefore, the 35◦ C for 19 days (Habashy et al., 2017b) and laying hens exposed positive achievements in terms of growth performance were to 34 ± 2◦ C for 8 h/day during 12 weeks (Orhan et al., 2019), accompanied by higher sensitivity in the gut to HS (Havenstein other authors have observed no variation of this transporter in et al., 2003; He et al., 2018a), a lack of effective thermoregulation broilers exposed to 32◦ C for 7 days (Sun et al., 2015). In spite of and heightened metabolism, entailing a strenuous adaptation to its detrimental effects on nutrient digestibility and absorption, HS harsh environments, and difficulties to cope with HS (Perini et al., was not shown to modulate SLC7A1 and SLC7A7 gene expression 2021). (Sun et al., 2015; Yi et al., 2016; Song et al., 2017; He et al., 2018b), Heat stress occurs when heat load of an animal is greater but it rather enhances amino acid catabolism in broiler intestine than its capacity to lose heat and may cast a shadow over the (Lara and Rostagno, 2013). performance and profitability of livestock production. In this Although the aforementioned studies are seminal and sense, a growing body of scientific evidence has documented provided valuable insights, they used only modern chickens the detrimental effects of HS on broiler growth, metabolism, (broilers or layers). In fact, there is still a lack of clear and physiology, such as impairing the intestinal morphology by understanding of how the gastrointestinal tract has changed in shortening the villus and deepening the crypt (Song et al., 2017; response to intensive genetic selection for rapid growth and feed He et al., 2018a), decreasing jejunal weight and length (Garriga efficiency and how is it affected by HS. The present study was et al., 2006), impairing the intestinal integrity, and inducing performed to evaluate the effects of chronic HS on the gene and oxidative stress leading to epithelial damage and inflammatory protein expression of carbohydrate, amino acid, and FATs in the response (Lian et al., 2020). It also possesses a negative impact on jejunum of three broiler populations [slow growing 1950 (Collins the immune system (Cui et al., 2016) by triggering the expression et al., 2016), moderate growing 1995 (Harford et al., 2014), and of heat shock proteins (HSPs), and thereby leading to decreased modern fast-growing 2015 (Orlowski et al., 2017)] known to energy metabolism (Liu et al., 2015), which reduces the growth represent 70 years of broiler genetic progress, and the jungle fowl performance. The impaired poultry productivity by HS was also (JF), representative of the ancestral origin of the modern broiler attributed to the reduced utilization of nutrients, resulting from (Orlowski et al., 2017). altering the activities of enzymes, such as amylase, maltase, lipase, trypsin, and chymotrypsin (Song et al., 2017; He et al., 2018a) and MATERIALS AND METHODS modulating the expression of the genes responsible for nutrient transport (Goel et al., 2021). The abovementioned negative effects Chicken Populations may depend on both temperature and duration of HS exposure The current study involved four research lines that are housed (Goel et al., 2021). In this context, some studies reported a and maintained at the University of Arkansas research farm. The reduced glucose uptake under chronic HS as evidenced by the first line represents the commercial broiler chicken of the 1950s downregulation of the sodium-dependent glucose transporter (Athens Canadian Random Bred, ACRB) characterized by slow (SGLT) gene responsible for the glucose absorption and the growth (Collins et al., 2016). One thousand nine hundred ninety- glucose transporter 2 (GLUT2) gene, involved in the transfer of five random bred (95RAN), a moderate-growing line consisting up-taken fructose and glucose into portal blood capillaries, in of seven parent stock male and six parent stock female lines Frontiers in Physiology | www.frontiersin.org 2 October 2021 | Volume 12 | Article 733134 Abdelli et al. Heat Stress and Broiler Nutrient Transport commercially available in the 1990s (Harford et al., 2014). The randomly selected, electrically water bath stunned (11V, third line is a modern random bred (MRB) population initially 11 mA, 10), and manually cut through the left carotid artery established in 2015 at the University of Arkansas that originally and allowed to completely bleed. Samples from the jejunal consisted of four commercially available broiler packages from tissue were collected and kept in 4% paraformaldehyde in three different broiler genetics companies; Cobb MX × Cobb phosphate-buffered saline (PBS) for further analysis of intestinal 500, Ross 544 × Ross 308, Ross Yield 1 × Ross 708, and the morphology. Segments from the jejunum were harvested for Hubbard HiY package. The four packages have been blended molecular analyses as described below. The tissues were snap homogenously after five generations of random mating to create frozen in liquid nitrogen and stored at −80◦ C until analysis. a population representing a commercially available broiler from 2015 (Orlowski et al., 2017). The fourth generation is the South Intestinal Morphology Analysis East Asian JF, serving as the common ancestor to the commercial Jejunum samples collected at 55 days of age were embedded in broiler (Orlowski et al., 2017). paraffin using a tissue processor. Sections of 2.5 µm were stained All populations are maintained at the University of Arkansas with hematoxylin and eosin before being analyzed with a digital research farm under close care and supervision and are randomly microscope camera (Leica DFC450 C; Leica Microsystems Ltd.) mated each generation with the avoidance of full and half- and the ViewPoint Light software version 1.0.0.9628. Images sibling pairings. The study was conducted in accordance with the were analyzed by the same person. The morphometric variables recommendations in the guide for the care and use of laboratory measured included VH, CD, and VH to relative CD ratio (VH: animals of the National Institutes of Health and the protocols CD ratio). Twelve villi were measured for each sample and received prior approval from the University of Arkansas Animal only complete and vertically oriented villi were evaluated. The Care and Use Committee under protocols 18,083 and 16,084. mean from 12 villi per sample was used as the mean value for further analysis. Experimental Design, Environmental Exposure, and Animal Husbandry Cell Culture Day-old broiler chicks from the four chicken lines hatched at the As no established chicken jejunal cell line currently exists, University of Arkansas were vent-sexed and individually wing- the non-transformed intestinal porcine epithelial cells from banded with a number and barcode. Male chicks were separated the jejunum (IPEC-J2) were selected as an in vitro model by line and housed in 12 environmentally controlled chambers in in this study and has been used in previous chicken studies. the Poultry Environmental Research Laboratory at the University The IPEC-J2 cell line was originally derived and characterized of Arkansas. Each chamber consists of two equally sized pens from jejunal epithelia of unsuckled piglets (Schierack et al., allowing for triplication of a 4 × 2 factorial design. Twenty- 2006). The cells of the present study were a kind gift from five male chicks of the same line were randomly placed in each Dr. Maxwell C. (University of Arkansas). Cells were cultured pen and kept at an approximate density of 0.5 m2 per bird in in six-well-plates with 10% fetal bovine serum (FBS) and 1% all pens. All birds were allowed ad libitum access to feed and penicillin/streptomycin (Life Technologies, Carlsbad, CA, USA) fresh water. The lighting program was set to 23L: 1D (L: light; in Dulbecco’s Modified Eagle Medium (DMEM)/F-12/HAM (Life D: darkness) during the first week and 20L: 4D for the remainder Technologies, Carlsbad, CA, USA) at 37◦ C in a humidified period (day 8–56) of the trial. Chickens were given a two-phase atmosphere of 5% CO2 and 95% air. At ∼80–90% confluence, feeding program consisting of commercially available starter (day cells were exposed to HS (45◦ C) for 2 h. Cells maintained at 37◦ C 0–28) and finisher (day 29–55) formulated to meet or exceed were used as controls. National Research Council (NRC) recommendations (National Research Council, 1994). RNA Isolation, Reverse Transcription, and The brooder temperature was maintained at 32◦ C during the first 3 days and was then gradually reduced to 31◦ C on days Quantitative Real-Time PCR One microgram of total RNA was extracted from chicken 4–6, 29◦ C on days 7–10, 27◦ C on days 11–14, and 25◦ C for jejunum tissues or IPEC-J2 cell line by trizol reagent (Thermo day 15 through day 28. The environmental treatments began Fisher Scientific, Rockford, IL) following the recommendations the morning of day 29 by keeping half of the chambers in a of the manufacturer. For each sample, total RNA concentration TN environment at a constant temperature of 25◦ C for the was determined using Take 3 Micro Volume Plate and the remainder of the study, whereas the remaining six chambers Synergy HT Multi-Mode Microplate Reader (BioTek, Winooski, were subjected to an 8 h daily cyclic HS (36◦ C) from 8 a.m. to VT, USA). RNA quality and integrity were assessed using the 4 p.m., until processing (Tabler et al., 2020). This design resulted ratio of absorbance (260/280) and 1% agarose gel electrophoresis. in three pens (75 birds) per line being subjected to either a TN or Afterward, RNAs were treated with DNAse and reverse HS environment. transcribed via qScript cDNA SuperMix (Quanta Biosciences, Gaithersburg, MD, USA). The cDNA was then amplified by real- Growth Performance Evaluation and time quantitative PCR (Applied Biosystems 7500 Real-Time PCR Sample Collection system) with Power SYBR Green Master Mix (Thermo Fisher Live BW and FI were recorded weekly. At the end of the Scientific, Rockford, IL, USA) as described previously (Greene experiment, six birds/line/environmental treatments were et al., 2020; Tabler et al., 2020; Emami et al., 2021). Frontiers in Physiology | www.frontiersin.org 3 October 2021 | Volume 12 | Article 733134 Abdelli et al. Heat Stress and Broiler Nutrient Transport TABLE 1 | Oligonucleotide real-time qPCR primers. Gene Accession numbera Primer sequence (5′ → 3′ ) Orientation Product size (bp) GLUT1 NM_205209.1 TCCTGATCAACCGCAATGAG Forward 60 TGCCCCGGAGCTTCTTG Reverse GLUT2 NM_207178.1 GAAGGTGGAGGAGGCCAAA Forward 61 TTTCATCGGGTCACAGTTTCC Reverse GLUT3 NM_205511.1 TTGGGCGCTTCATTATTGG Forward 68 CTCACTGATGTACATGGGAACAAAG Reverse GLUT5 XM_040689119.1 CCTCAGCATAGTGTGTGTCATCATT Forward 62 GGATCGGACTGGCTCCAA Reverse GLUT8 XM_040648927.1 GCTGCCTCAGCGTGACTTTT Forward 58 AGGGTCCGCCCTTTTGTT Reverse GLUT9 XM_040670183.1 CAGTGGATGAAAGCACCTTGAC Forward 63 CACCGATGGCAAAAATGGA Reverse GLUT10 XM_040688610.1 AACGCAGAACAAAGATTCCTGAA Forward 65 GTCATTCCACGTGCCAGCTT Reverse GLUT11 NM_001347709.1 CCCTCATCCAGCTCATGATTCT Forward 67 CCACGGTCAATCAAGAGGTATCT Reverse GLUT12 XM_040667840.1 TTTGTGGACCTGTTTCGTTCAA Forward 61 GCGTGAGCCCTACCAGCAT Reverse GLUT14 XM_040672375.1 TTGGGCGCTTCATTATTGG Forward 68 CTCACTGATGTACATGGGAACAAAG Reverse SGLT1 NM_001293240.1 AGCATTTCAGCATGGTGTGTCT Forward 64 TGCTCCTATCTCAGGGCAGTTC Reverse SLC1A4 XM_040666934.1 CGACTGATGAACAACGCAGAA Forward 119 (ASCT1) TCGCCAACCTCCGCATT Reverse SLC3A1 XM_040667709.1 CCTGGGCTGTGAGAAACCAA Forward 63 (NBAT) GGCACAAATTGAGTAGGAAGAAGAG Reverse SLC6A14 XM_040670974.1 GCTTCCGTGGTCAGATTGCT Forward 66 TCATTTACGAGGCGTGTTTTACTG Reverse SLC6A19 XM_040663289.1 CGCTGGTGTGCCTAGTTTGA Forward 64 ACAGCAATTTCTGATGGCTTTG Reverse SLC6A20 XM_418798.6 GCTGTCAAACCCCAAAACGT Forward 63 (SIT1) CCCAGACCCAGTGAGAAGAAGA Reverse SLC7A1 NM_001145490.1 AAAACTCCAGTAATTGCAACAGTGA Forward 68 (CAT1) AAGTCGAAGAGGAAGGCCATAA Reverse SLC7A2 NM_001199102.1 AGCTCTCCATCCACCATGTTG Forward 58 (CAT2) CCAGGCACCGAACAAAGGT Reverse SLC7A6 XM_040681081.1 CACGTGGGTGGCTTTGC Forward 61 (Y + LAT2) GAATTCTCCACGGCTCTGAACT Reverse SLC7A9 NM_001199133.1 GCTGTGGGTCCTTGTTTAACCA Forward 60 (BAT1) TGCACCTAGTGTTGCCAGAACT Reverse SLC7AL XM_040665181.1 GCTGAGTTGGGAGCATCCA Forward 66 ACCAAACGCTTCCAGGATGT Reverse SLC38A2 NM_001305439.1 TGGCATCCTGGGACTTTCC Forward 66 (SNAT2) AGCAGGAGTATCACAAAAAGAGCAA Reverse LAT1 NM_001030579.2 CTGCTGCCGCCTGAGAA Forward 62 CGCCGGCAGGAATTCC Reverse EAAT3 XM_424930.7 GGTGAAGGCGGACAGGAA Forward 68 TGCTGAGCAGGAGCCAGTT Reverse PepT1 NM_204365.1 GACAACTTTTCTACAGCCATCTACCA Forward 65 CCCAGGATGGGCGTCAA Reverse (Continued) Frontiers in Physiology | www.frontiersin.org 4 October 2021 | Volume 12 | Article 733134 Abdelli et al. Heat Stress and Broiler Nutrient Transport TABLE 1 | Continued Gene Accession numbera Primer sequence (5′ → 3′ ) Orientation Product size (bp) PepT2 NM_001319028.1 TGAAAAACCGCTCCCATCA Forward 61 TGTTCCGATGCCCAGTCAA Reverse iFABP NM_001007923.1 CGTACCATCGACATCGAATTCA Forward 61 TCCCGTCAGCCAGACTGTATT Reverse CD36 XM_040686380.1 ACTGCGCTTCTTCTCCTCTGA Forward 68 TCACGGTCTTACTGGTCTGGTAAA Reverse 18s AF173612 TCCCCTCCCGTTACTTGGAT Forward 60 GCGCTCGTCGGCATGTA Reverse GLUT, glucose transporter; qPCR, quantitative PCR. Oligonucleotide primers specific for chicken nutrient the FluorCHem M MultiFluor System (ProteinSimple, San Jose, transport-related genes were used as described in Table 1. CA, USA). Prestained molecular weight marker (precision plus The quantitative PCR (qPCR) cycle parameters comprised the protein dual color) was used as a standard (Bio-Rad, Hercules, following phases: 50◦ C for 2 min, 95◦ C for 10 min followed by CA, USA). Protein loading was assessed by quantification of the 40 cycles of a two-step amplification program (95◦ C for 15 s universally expressed 70 kDa band from staining with universal and 58◦ C for 1 min). At the end of the amplification, melting protein Ponceau S (PS) stain (G-Biosciences, St. Louis, MO, curve analysis was applied using the dissociation protocol from USA) (Sander et al., 2019). Image acquisition and analysis the Sequence Detection system to exclude contamination with were performed by AlphaView software (version 3.4.0, 1993– unspecific PCR products. Agarose gel was used to confirm the 2011; ProteinSimple). One representative blot was shown for PCR products, which showed only one specific band of the each protein. predicted size. For negative controls, no real-time products were used as templates in the qPCR and verified by the absence of gel-detected bands. Relative expressions of target genes were Immunofluorescence determined by the 2−11Ct method (Schmittgen and Livak, Immunofluorescence staining was performed as previously 2008). The 18S ribosomal RNA was used as an internal control described (Dridi et al., 2012; Greene et al., 2020). Briefly, IPEC- to which the fold changes in gene expression were normalized. J2 cells were grown in chamber slides, exposed to 37 or 54◦ C Samples extracted from JF at TN conditions were used as as described above and fixed with methanol for 10 min at a calibrator. −20◦ C before being permeabilized with Triton-X 100. Cells were blocked with serum-free protein block (Dako, Carpinteria, CA, USA) for 1 h at room temperature, then incubated with Western Blot Analysis anti-GLUT1, anti-GLUT2, anti-GLUT3, anti-HSP60 (Santa Cruz Jejunum samples or IPEC-J2 cell lines were homogenized Biotechnology, Dallas, TX, USA), or anti-HSP70 (Pierce Thermo in lysis buffer (10 mmol/L Tris base, pH 7.4; 150 mmol/L Scientific, Rockford, IL, USA). All antibodies were diluted at NaCl; 1 mmol/L EDTA; 1 mmol/L EGTA; 0.1% Triton 1:200, in antibody diluent (Dako, Carpinteria, CA, USA) and X-100; 0.5% Nonidet P-40; and protease and phosphatase incubated overnight at 4◦ C. Signal was visualized with DyLight inhibitors) and stainless-steel beads, using the Bullet Blender 488- or 594-conjugated secondary antibody (Thermo Fisher Storm (NextAdvance, Averill Park, NY, USA). Total protein Scientific, Grand Island, NY, USA). Slides were coverslipped concentrations were determined using a Bradford assay kit with vectashield with diamidino-2-phenylindole (DAPI; Vector (Bio-Rad, Hercules, CA, USA) and run in 4–12% gradient Laboratories, Burlingame, CA, USA), and images were obtained Bis-Tris gels (Life Technologies, Carlsbad, CA, USA) and and analyzed using Zeiss Imager M2 and AxioVision software then transferred to polyvinylidene difluoride membranes. Once (Carl Zeiss Microscopy). transferred, membranes were blocked using a Tris-buffered saline (TBS) with 5% non-fat milk and Tween 20 (TBST) at room temperature for 1 h. The membranes were washed with TBST Statistical Analysis and then incubated with primary antibodies (dilution 1:1,000) Growth performance, histology, gene expression, and protein overnight at 4◦ C. Primary antibodies used were rabbit anti- expression data from the in vivo study were analyzed using a two- GLUT1, rabbit anti-GLUT2, rabbit anti-GLUT3, rabbit anti- way ANOVA considering chicken population (JF, ACRB, 95RAN, SLC38A3, and rabbit anti-CD36 (ABClonal, Woburn, MA, USA). MRB) and environmental conditions (TN and HS) as the main After another wash, secondary antibodies diluted to 1:5,000 were effects. In case ANOVA showed significant effects, the means added to 5% non-fat milk in TBS and Tween 20 and incubated were compared by Tukey’s multiple range test. Data from the with the membranes at room temperature for 1 h. The protein in vitro study were analyzed by the Student’s t-test. Graph Pad signals were visualized using chemiluminescence (ECL Plus; GE Prism software (version 6.00 for Windows, Graph Pad Software, Healthcare, Pittsburg, PA, USA), and images were captured using La Jolla, CA, USA) was used, and data are expressed as the Frontiers in Physiology | www.frontiersin.org 5 October 2021 | Volume 12 | Article 733134 Abdelli et al. Heat Stress and Broiler Nutrient Transport FIGURE 1 | Effect of HS on feed intake (A) and body weight (B) of JF, ACRB, 95RAN, and MRB birds. Data are mean ± SEM (n = 3 pens/group for FI and n = 75 birds/group for BW). Different letters indicate a significant difference at P < 0.05. BW, body weight; FI, feed intake; HS, heat stress; TN, thermoneutral; JF, jungle fowl; ACRB, Athens Canadian Random Bred; 95RAN, 1995 random bred; MRB, modern random bred. Frontiers in Physiology | www.frontiersin.org 6 October 2021 | Volume 12 | Article 733134 Abdelli et al. Heat Stress and Broiler Nutrient Transport TABLE 2 | Effect of heat stress on the global feed conversion ratio (FCR through ratio of VH:CD when compared to JF and 95RAN (Figure 2k). day 54). The ratio of VH to CD significantly increased from TN to HS in TN HS ACRB (Figure 2k). JF 2.349 ± 0.038 2.401 ± 0.099 Effects of HS on the Expression of Jejunal ACRB 2.080 ± 0.008 2.059 ± 0.033 Carbohydrate Transporters 1995 1.890 ± 0.032 1.855 ± 0.039 Heat stress significantly upregulated the jejunal expression of 2015 1.565 ± 0.022 1.598 ± 005 GLUT1, GLUT5, GLUT10, and GLUT11 mRNA in JF, but it Main effects downregulated that of GLUT2, GLUT10, GLUT11, and GLUT12 Environmental treatment 0.8185 in MRB and GLUT6 in ACRB compared to their TN counterparts Line <0.0001 (Figures 3E,F, 4A,B,E–G). The immunoblot analysis showed Interaction 0.7188 that jejunal GLUT1 protein levels were significantly increased in heat-stressed ACRB and 95RAN and decreased in heat-stressed FCR, feed conversion ratio. JF compared to their TN counterparts (Figures 3A,B). GLUT2 protein levels were significantly increased in the jejunum of heat- stressed ACRB and decreased in heat-stressed JF compared to mean ± SEM. Means were considered statistically significant at a their TN counterparts (Figures 3A,C). Jejunal GLUT3 mRNA P ≤ 0.05. abundances and protein levels remained unchanged between all chicken populations under both environmental conditions RESULTS (Figures 3A,D). Under TN conditions, the highest mRNA abundances of Effects of HS on Growth Performances GLUT2, GLUT5, GLUT10, GLUT11, and GLUT12 were found in Performance of the four lines within TN and HS conditions the jejunum of the MRB population (Figures 3A,C, 4A,E–G). was evaluated via comparison of BW, FI, and feed conversion 95RAN broilers exhibited the lowest mRNA levels of GLUT6, ratio (FCR). Significantly higher BWs were observed for the GLUT8, and GLUT9 (Figures 4B–D). Under HS conditions, 95RAN and MRB broilers compared to JF and ACRB in both the greatest expression of GLUT1, GLUT5, GLUT8, GLUT9, TN and HS conditions, with the MRB having the highest BW GLUT10, GLUT14, and SGLT1 was found in the JF jejunum overall (Figure 1B). However, BW for the 95RAN and MRB also (Figures 3E, 4A,C–E,H,I). decreased significantly under HS conditions compared to TN of in vitro study using IPEC-J2 cell lines showed that HS the same population (Figure 1B). FI followed the same pattern exposure induced the expression of HSP60 and HSP90 as of significance with the MRB random bred broiler having the demonstrated by immunofluorescence staining (Figure 5D), highest FI under both TN and HS conditions (Figure 1A). The confirming that the cells are stressed. Both immunoblot analysis 95RAN broilers had significantly higher FI compared to JF and and immunofluorescence staining showed that HS increased ACRB, but the 95RAN had lower FI compared to the MRB, and GLUT1 and decreased GLUT3 protein levels in the IPEC-J2 cells there was no difference between the JF and ACRB in either TN (Figures 5A–D). of HS (Figure 1A). Again, under HS conditions, FI significantly decreased in both the 95RAN and the MRB (Figure 1A). For Effects of HS on the Expression of Jejunal FCR, only the main effect of the line was significant (P < Amino Acid Transporters 0.0001) while environmental treatment and interaction were Western Blot analysis of amino acid transporter showed that HS not significant (P > 0.05). Indeed, MRB averaged 33, 52, and significantly decreased SLC38A3 protein levels in the jejunum 78 points fewer in FCR compared to 95RAN, ACRB, and of JF but not in the other bird populations (Figures 6A,B). JF, respectively, confirming the tremendous effect of genetic Under TN conditions, jejunal expression of SLC38A3 protein is selection in improving feed efficiency (Table 2). higher in JF compared to the other populations (Figures 6A,B). Under HS conditions, however, the levels of SLC38A3 protein Effects of HS on Jejunum Morphometry remained unchanged between all tested birds (Figures 6A,B). Histological analysis showed that jejunal VH was affected by In IPEC-J2 cells, SLC38A3 protein expression was significantly line (P = 0.0004) and by line × environmental interaction downregulated by HS exposure (Figures 6C,D). (P = 0.0254; Figures 2a–j). Significant increased VH in MRB Heat stress significantly increased the mRNA levels of was seen compared to all other populations under TN conditions SLC6A14, SLC38A2, and PEPT2 gene in the jejunum of (P = 0.0030, Figures 2a–j). Under HS conditions, MRB had JF (Figures 7B,L,O), SLC7A9, and EAAT3 genes in 95RAN significantly greater VH compared to JF (Figures 2a–j). There (Figures 7F,M), and significantly decreased that of EAAT3 were no significant differences in CD between the lines or gene in ACRB (Figure 7M). Under TN conditions, the highest when comparing environmental conditions. However, the ratio mRNA abundances of SLC7AL and SLC7A6 were found in the of VH:CD was affected by both line (P < 0.0001) and line × jejunum of JF (Figures 7C,D), SLC6A19 and EAAT3 in ACRB environmental effect (P = 0.0030), but not temperature (P = (Figures 7G,M), SLC7A1 in 95RAN (Figure 7H) and SLC1A4 0.2018; Figures 2a–j). Under TN conditions, the ratio of VH to and SLC7A2 in MRB (Figures 7E,K). Under HS conditions, CD was significantly higher in MRB compared to all other lines however, JF jejunum exhibited greater expression of SLC6A14, (Figure 2k). Under HS conditions, MRB still retained a higher SLC7A6, SLC6A20, PEPT1, and PEPT2 (Figures 7B,D,J,N,O). Frontiers in Physiology | www.frontiersin.org 7 October 2021 | Volume 12 | Article 733134 Abdelli et al. Heat Stress and Broiler Nutrient Transport FIGURE 2 | Effect of HS on intestinal morphology of JF (a,b), ACRB (c,d), 95RAN (e,f), and MRB (g,h) birds. Tissue from the jejunum of TN (a,c,e,g) and HS (b,d,f,h) birds were processed and stained for histology. Data are mean ± SEM (n = 2/group). VH (i), CD (j), and VH:CD ratio (k) were measured and analyzed. Different letters indicate the significant difference at P < 0.05. VH, villus height; CD, crypt depth; HS, heat stress; TN, thermoneutral; JF, jungle fowl; ACRB, Athens Canadian Random Bred; 95RAN, 1995 random bred; MRB, modern random bred. 95RAN birds on the other hand contained a higher expression of both CD36 and FABP2 were significantly increased in heat- of jejunal SLC1A4, SLC7A9, and EAAT3 genes (Figures 7E,F,M). stressed JF compared to their TN counterparts (Figures 8C,D). HS significantly down regulated SLC3A1 expression in MRB HS exposure did not elicit any changes to CD36 protein compared to JF and 95RAN (Figure 7I). expression in the IPEC-J2 cell line (Figures 8E,F). Under TN conditions, jejunal CD36 and FABP2 mRNA abundances remained unchanged between all chicken Effects of HS on the Expression of Jejunal populations; however, CD36 protein levels were significantly FATs higher in JF (Figures 8A–D). Under HS exposure, jejunal Immunoblot analyses showed that HS significantly reduced CD36 protein expression did not differ between all tested bird CD36 protein levels in the jejunum of JF, but not in the other populations, however, CD36 and FABP2 gene expressions were bird populations (Figures 8A,B). However, mRNA abundances higher in JF (Figures 8A–D). Frontiers in Physiology | www.frontiersin.org 8 October 2021 | Volume 12 | Article 733134 Abdelli et al. Heat Stress and Broiler Nutrient Transport FIGURE 3 | Effect of HS on jejunal expression of GLUT1, GLUT2, and GLUT3 in JF, ACRB, 95RAN, and MRB birds. Protein and RNA were extracted from tissue and analyzed by western blot (A–D) and qPCR (E–G), respectively. Gene expression data are mean ± SEM (n = 6/group). Protein expression was normalized to loading via Ponceau stain (PS) (A). Protein was analyzed via AlphaView software and is expressed as mean ± SEM (n = 4/group) with one representative blot shown (A). Different letters indicate the significant difference at P < 0.05. GLUT, glucose transporter; HS, heat stress; TN, thermoneutral; JF, jungle fowl; ACRB, Athens Canadian Random Bred; 95RAN, 1995 random bred; MRB, modern random bred. Frontiers in Physiology | www.frontiersin.org 9 October 2021 | Volume 12 | Article 733134 Abdelli et al. Heat Stress and Broiler Nutrient Transport FIGURE 4 | Effect of HS on the carbohydrate transporter gene expression in the jejunum of JF, ACRB, 95RAN, and MRB birds. (A–I) RNA was extracted from tissue and analyzed by qPCR. Gene expression data are mean ± SEM (n = 6/group). Different letters indicate the significant difference at P < 0.05 when the interaction is significant. *indicates a significance compared to JF at P < 0.05. GLUT, glucose transporter; HS, heat stress; SGLT1: Sodium/glucose cotransporter 1; TN, thermoneutral; JF, jungle fowl; ACRB, Athens Canadian Random Bred; 95RAN, 1995 random bred; MRB, modern random bred. DISCUSSION 2017). In the current study, the performance of 54 d-old broilers represented genetics of the 1990s (95RAN) and 2015 (MRB) With the aim to fulfill the increasing demand for poultry exhibited a much higher growth rate, and lower FCR compared meat around the world, genetic selection has led to spectacular to the broilers from the 1950s (ACRB) and the ancestral wild-type achievements in terms of growth rate, feed efficiency, breast yield, JF, confirming the aforesaid advancements. However, these signs and reduction of market age (Thiruvenkadan and Prabakaran, of progress have been associated with unintended, undesirable Frontiers in Physiology | www.frontiersin.org 10 October 2021 | Volume 12 | Article 733134 Abdelli et al. Heat Stress and Broiler Nutrient Transport FIGURE 5 | Effect of HS on glucose transporter protein expression in IPEC-J2 cell line. Protein was extracted from cells exposed to HS (45◦ C) or 37◦ C (control) and analyzed by western blot (A–C) and immunofluorescence (D). Protein expression was normalized to loading via Ponceau stain (PS) (A). Protein was analyzed via AlphaView software and is expressed as mean ± SEM (n = 4/group) with one blot shown (A). *P < 0.05. GLUT, glucose transporter; HS, heat stress; TN, thermoneutral; DAPI: diamidino-2-phenylindole. consequences, including high sensitivity to HS, whose adverse nutrient absorption in broiler chickens (Goel et al., 2021). In effects on poultry production and welfare are well-documented this context, the current study aimed to evaluate the differences in the literature. These effects are expected to only get worse in in response to HS of four chicken populations representative the coming years due to the steady increase in environmental of eras in the history of a selection of the modern broilers, temperature (Wasti et al., 2020; Perini et al., 2021). Indeed, HS the JF, the ACRB, the 95RAN, and the MRB. Response to HS has been reported to compromise gut health leading to decreased was evaluated via analysis of nutrient transport machinery in Frontiers in Physiology | www.frontiersin.org 11 October 2021 | Volume 12 | Article 733134 Abdelli et al. Heat Stress and Broiler Nutrient Transport FIGURE 6 | Amino acid transporter protein expression in the jejunum of JF, ACRB, 95RAN, and MRB birds under TN and HS and in IPEC-J2 cell line. Protein was extracted from tissue and cells exposed to HS (45◦ C) or to 37◦ C (control) and analyzed by western blot (A–D). Protein expression was normalized to loading via Ponceau stain (PS) (A,C). Protein was analyzed via AlphaView software and is expressed as mean ± SEM (n = 4/group) for IPEC-J2 cells and (n = 4/group) for tissue. *indicate a significant difference compared to TN conditions for bird populations or 37◦ C for IPEC-J2 cell line at P < 0.05. HS, heat stress; TN, thermoneutral. the jejunum of broiler chickens. To the best of our knowledge, differences. The results also suggest that the expression and the current study provides the first comparison of the mRNA presence of glucose transporters in the gut may play a role in gene expression and some of the encoded proteins involved in HS intolerance or resistance among these different populations. the transport of nutrients (carbohydrates, amino acids, and fatty This is evident by the increased gene expression in MRB of acids) along with histological evaluation of the jejunum, between GLUT2, involved in the transport of carbohydrates, such as the four genetic lines. glucose, galactose, and fructose across the basolateral membrane, The uptake of carbohydrates from the intestinal lumen is GLUT5, a fructose transporter across the brush border membrane crucial to sustaining a constant energy supply and is influenced (Uldry and Thorens, 2004), GLUT10, and GLUT11 as compared by both luminal and apical membrane digestion (Sklan et al., to JF and ACRB under TN conditions. In line with these, a 2003). Results from this study suggest that differences in glucose study conducted by Miska and Fetterer (2019) showed GLUT2 transporter expression in the jejunum depend on line, or the and GLUT5 mRNA levels to be higher in modern fast-growing representative genetics over time, and therefore, these differences Ross as compared to the slow-growing ACRB chickens. The have the potential to be due to, or the result of, genetic increased gene expression of these transporters in modern birds Frontiers in Physiology | www.frontiersin.org 12 October 2021 | Volume 12 | Article 733134 Abdelli et al. Heat Stress and Broiler Nutrient Transport FIGURE 7 | Amino acid transporter gene expression in the jejunum of JF, ACRB, 95RAN, and MRB birds under TN and HS. (A–O) RNA was extracted from tissue and analyzed by qPCR. Gene expression data are mean ± SEM (n = 6/group). * and different letters indicate a significant difference at P < 0.05. LAT1, L-type amino acid transporter 1; EEAT3, excitatory amino acid transporter 3; PEPT, peptide transporter; SLC, Solute carrier family; HS, heat stress; TN, thermoneutral; JF, jungle fowl; ACRB, Athens Canadian Random Bred; 95RAN, 1995 random bred; MRB, modern random bred. Frontiers in Physiology | www.frontiersin.org 13 October 2021 | Volume 12 | Article 733134 Abdelli et al. Heat Stress and Broiler Nutrient Transport FIGURE 8 | Effect of HS on the expression of fatty acid transporters in the jejunum of JF, ACRB, 95RAN, and MRB birds and in IPEC-J2 cell line. Protein and RNA were extracted from jejunal tissue and analyzed by western blot (A,B) and qPCR (C,D), respectively. Protein from cells was also analyzed by immunoblot (E,F). Gene and protein expression data are mean ± SEM (n = 4–6/group). Protein expression was normalized to loading via Ponceau stain (PS). Protein was analyzed via AlphaView software and one representative blot is shown. Different letters indicate a significant difference at P < 0.05 when the interaction effect is significant. CD36, the cluster of differentiation 36; FABP, fatty acid-binding protein; HS, heat stress; TN, thermoneutral; JF, jungle fowl; ACRB, Athens Canadian Random Bred; 95RAN, 1995 random bred; MRB, modern random bred. Frontiers in Physiology | www.frontiersin.org 14 October 2021 | Volume 12 | Article 733134 Abdelli et al. Heat Stress and Broiler Nutrient Transport may emphasize the importance of carbohydrate transporters in vice versa, respectively. Results of the current study suggest the fast-growing chickens providing them with greater capacity amino acid transporters (AATs) to be less responsive to HS to absorb sugars. Conversely, GLUT2 protein expression was when compared to carbohydrate transporters. When comparing shown to be higher in JF compared to ACRB and MRB under significant differences seen among amino acid transporters only, TN conditions. GLUT2 significantly decreased in JF under HS the effect on gene expression seems to be more dependent on conditions while significantly increased in ACRB. The significant line than environment for populations other than the MRB. increase in protein levels of GLUT2 seen in ACRB and the Indeed, as compared to other populations under TN conditions, lack of effect on more modern populations compared to the ACRB birds exhibited greater gene expression of LAT1 and heat-tolerant JF may be a product of their propensity for better SLC38A2, which are present on the basolateral membrane, and growth performance and also contribute to their intolerance of SLC6A19, EAAT3, and PEPT2 which encode brush border AATs. HS conditions. The heat-stressed MRB chickens also showed a However, JF expressed greater SLC7A6, present on the basolateral decrease in gene expression of some GLUTs, such as GLUT10 and membrane, and PEPT1, a brush border AAT, as compared to the GLUT12 as compared to their TN counterparts, being in line with rest of TN populations. PEPT1 and EAAT3 have been previously previous studies reporting a decrease of the jejunum GLUT2 (Al- reported to be higher in the small intestine of birds selected zghoul et al., 2019) and ileum GLUT1 (Habashy et al., 2017b) by for low compared to high juvenile BW (Mott et al., 2008). applying a chronic HS of 35◦ C for 7 and 12 days, respectively. Similarly, SLC7A1, SLC7A4, SLC3A1, SLC7A6, and SLC7A7 gene These results suggest that the uptake of glucose and galactose expression was greater in the intestine of a Chinese slow-growing was compromised in heat-stressed chickens which may explain bird (Wenshi Yellow Feathered Chick; WYFC) as compared to the reduction of BW at day 54 in heat-stressed MRB chickens a commercial fast-growing broiler (White Recessive Rock Chick; as compared to their TN counterparts. However, the reduction WRRC) (Zeng et al., 2011). Moreover, a recent study conducted of BW at day 54 was not associated with a decreased VH:CD by Miska and Fetterer (2019) showed SLC1A4, SLC6A14, and ratio previously observed in heat-stressed chickens (Song et al., SLC6A19 to be greater in the intestine of ACRB as compared 2017) and considered as a measure of the absorptive capacity to ROSS broilers. The reason behind this increase is not fully of the gut. The lack of effect on intestinal histology may be a elucidated, but it is possible that AATs of slow-growing lines sign of recovery or adaptation after 26 days of cyclic HS. On are less efficient than those of fast-growing lines, such that the other hand, heat-stressed JF showed an increase of GLUT1, a higher number of AATs is required to transport a smaller GLUT5, GLUT10, and GLUT11 gene expression as compared amount of nutrients. As for HS, although its negative effects to their TN counterparts, and greater mRNA levels of GLUT1, on nutrient digestibility and absorption are well-described, only GLUT8, GLUT9, GLUT10, and SGLT1 compared to the rest of a small number of studies have reported HS effects on AATs. the lines. It is difficult to make an across study comparative In a recent study, Al-zghoul et al. (2019) reported SLC7A7 conclusion of how differences in growth capacity among chicken to be upregulated and SLC7A1 to be downregulated by HS; populations affect their response to HS due to the lack of research however, this is in contrast with other studies showing no effect comparing the ancestor JF with other lines characterized by on these AATs (Sun et al., 2015; Yi et al., 2016; Song et al., higher growth rate. However, the results obtained in the current 2017). This discrepancy may be attributed to the heterogeneity study suggest either JF to be more resistant to HS, or it is nutrient of experimental conditions, such as lines, feed, age, duration, transport machinery to present a more robust response to HS and severity of HS. Results of the current study showed differing challenging conditions. Granted, this conclusion only bears true responses to HS among lines. Although HS decreased SLC6A14 if the nutrient transporter machinery responses seen in JF in in MRB and EAAT3 in ACRB, it increased SLC6A14 and SLC38A2 this study correspond to increased absorption, which was not in JF and SLC7A9, SLC6A19, and EAAT3 in 95RAN. The measured, and if that corresponding absorption in the gut aids jejunum expression of the EAAT3 gene was also enhanced in in JF resistance to HS. ROSS broilers exposed to 35–39◦ C for 1–5 days (Santos et al., In 2013, Pearce et al. showed an increased incidence of 2019). This increase of EAAT3 may indicate a greater need for hyperglycemia and an increase in the expression of ileal GLUTs aspartate and glutamate uptake acting as the primary fuel for in heat-stressed pigs. Interestingly, the IPEC-J2 expression of enterocytes, to maintain intestinal permeability and enterocyte GLUT1 and GLUT3 protein followed the same trends as in number negatively affected by heat-induced tissue damage (Goel chickens (at least the ACRB and 95RAN for GLUT1 and et al., 2021). Another interesting finding in this study was the ACRB for GLUT2), indicating that HS had a direct effect on lack of HS effect on the expression of AAT in MRB. Indeed, jejunal carbohydrate transporters. Given that the functionality a decrease was seen only for SLC6A14 for MRB while all of these transporters is often dependent on their cellular others remained unchanged. This may suggest that MRB may location, further investigation is needed to determine the cellular retain their amino acid absorption regardless of environmental location and provide a potential explanation for possible trends stressors, such as HS, due to the effects of high-performance in expression. selection the MRB has gone through over time. However, more Several amino acid transport systems are expressed on research is needed to confirm any direct effects of selection on both the apical brush border membrane and basolateral side these AAT and the role HS plays in the dynamics of genotype of the small intestine epithelium (Dave et al., 2004) to bring and environment interactions. the amino acids from the gut lumen into the enterocytes, Protein expression of AATs showed a main effect of and from inside of the enterocyte to the vascular supply or temperature on decreasing SLC38A3, which seems to be driven Frontiers in Physiology | www.frontiersin.org 15 October 2021 | Volume 12 | Article 733134 Abdelli et al. Heat Stress and Broiler Nutrient Transport by the effects in JF. Similarly, IPEC-J2 cells subjected to CONCLUSION HS conditions also showed significantly decreased SLC38A3 protein. It is possible that an IPEC-J2 model for HS effects This study is the first to describe differences in the expression on AAT in the gut better represents ancestral JF than more of genes, and some of the encoded proteins, that play a role modern populations. However, further analysis is needed to fully in jejunal nutrient transport between three broiler populations characterize IPEC-J2 as a model for JF under HS. These results characterized by different growth (slow, moderate, and rapid) also point to the potential need for specific in vitro cell models rates and in their ancestor wild JF birds. The obtained results per population. seemingly show that chronic HS alters the jejunal carbohydrate, Heat stress did not affect protein expression of fatty acid rather than fatty acid and amino acid, transporters and that translocator CD36 in ACRB, 95RAN to MRB; however, JF differences in these transporters between the populations may be showed a decrease under HS compared to TN conditions. a result of, or mechanism behind, the phenotypic differences that This lack of response from more modern populations exist. Understanding the molecular mechanisms behind these coupled with the JF decreased expression of CD36 under differences and their potential relationship to selection is of great HS may indicate a possible role for decreased fatty acid interest; however, further in-depth investigation is needed and absorption in resistance to HS and that a lack of response warranted based on these findings. in this translocation may be a result of selection for higher growth performance. DATA AVAILABILITY STATEMENT The levels of mRNA for both FABP2 and CD36 showed a similar pattern of expression whereby there were no differences The original contributions presented in the study are included among the four populations under TN conditions. HS increased in the article/supplementary material, further inquiries can be the expression of both FATs in JF compared to the rest directed to the corresponding author/s. of the populations. However, previous studies reported that FABP, which mediates the uptake of long-chain fatty acids ETHICS STATEMENT into enterocytes, was downregulated irrespective of exposure time and intensity of stress. Indeed, FABP gene expression was The animal study was reviewed and approved by University reduced in male Arbor Acres broilers exposed to 32◦ C from of Arkansas. 35 to 42 days of age (Sun et al., 2015), and male Cobb500 subjected to 35◦ C from 14 to 26 days of age (Habashy et al., AUTHOR CONTRIBUTIONS 2017b). Similar results were reported with CD36, where jejunal expression was shown to be reduced in heat-stressed fast- SD conceived and designed the study. TT, EG, SO, NBA, and SD growing broilers (Sun et al., 2015). The inconsistency between conducted the in vivo experiments. NA and AR performed the the gene expression results for FATs obtained in the current molecular analyses and analyzed the data. LB performed the IF study and previous ones may be attributed to differences in images. NA and AR wrote the first draft. SD edited and corrected the temperature, duration of HS, and specific strains of birds the paper with a critical review by all authors. used. Moreover, CD36 gene expression did not show the same pattern as protein expression in the current study. A similar FUNDING disparity was seen in several other transporters measured and is not surprising, as the correlation between protein concentrations This study was supported by a grant from the Arkansas Division and the corresponding mRNA levels has been previously of Agriculture, Animal Health Awards (to SD and SO) and from investigated and established to be 20–40% (Pascal et al., 2008; the USDA-AFRI Sustainable Agriculture Systems (2019-69012- Zapalska-Sozoniuk et al., 2019) due to several mechanisms 29905) to SD. The Arkansas Division of Agriculture and USDA- such as the rate of mRNA degradation/turnover and efficiency AFRI had no role in conducting the research, generating the data, of translation. interpreting the results, or writing the manuscript. REFERENCES Dave, M. H., Schulz, N., Zecevic, M., Wagner, C. A., and Verrey, F. (2004). Expression of heteromeric amino acid transporters along the Al-zghoul, M. B., Ra, A., Musa, K., and Saleh, M. (2019). Expression of murine intestine. J. Physiol. 558, 597–610. doi: 10.1113/jphysiol.2004.0 digestive enzyme and intestinal transporter genes during chronic heat stress 65037 in the thermally manipulated broiler chicken. Poult. Sci. 98, 4113–4122. Dridi, S., Hirano, Y., Tarallo, V., Kim, Y., Fowler, B. J., Ambati, B. K., et al. (2012). doi: 10.3382/ps/pez249 ERK1/2 activation is a therapeutic target in age-related macular degeneration. Collins, K. E., Marks, H. L., Aggrey, S. E., Lacy, M. P., and Wilson, J. L. (2016). Proc. Natl. Acad. Sci. U.S.A. 109, 13781–13786. doi: 10.1073/pnas.1206494109 History of the athens Canadian random bred and the athens random bred Emami, N. K., Cauble, R. N., Dhamad, A. E., Greene, E. S., Coy, C. S., control populations. Poult. Sci. 95, 997–1004. doi: 10.3382/ps/pew085 Velleman, S. G., et al. (2021). Hypoxia further exacerbates woody breast Cui, Y., Hao, Y., Li, J., Bao, W., Li, G., Gao, Y., et al. (2016). Chronic heat myopathy in broilers via alteration of satellite cell fate. Poult. Sci. 100:101167. stress induces immune response, oxidative stress response, and apoptosis doi: 10.1016/j.psj.2021.101167 of finishing pig liver : a proteomic approach. Int. J. Mol. Sci. 17, 1–24. Garriga, C., Hunter, R. R., Planas, J. M., Mitchell, M. A., Moreto, M., Hunter, doi: 10.3390/ijms17050393 R. R., et al. (2006). Heat stress increases apical glucose transport in the Frontiers in Physiology | www.frontiersin.org 16 October 2021 | Volume 12 | Article 733134 Abdelli et al. Heat Stress and Broiler Nutrient Transport chicken jejunum. Am. J. Physiol. Regul. Integr. Comp. Physiol. 290, 195–201. Santos, R. R., Awati, A., van den Hil, P. J. R., Kempen, T. A. T. G., Tersteeg- doi: 10.1152/ajpregu.00393.2005 zijderveld, M. H. G., Koolmees, P. A., et al. (2019). Effects of a feed additive Goel, A., Ncho, C. M., and Choi, Y. (2021). Regulation of gene blend on broilers challenged with heat stress. Avian Pathol. 9457, 582–601. expression in chickens by heat stress. J. Anim. Sci. Biotechnol. 5, 1–13. doi: 10.1080/03079457.2019.1648750 doi: 10.1186/s40104-020-00523-5 Schierack, P., Nordhoff, M., Pollmann, M., Weyrauch, K. D., Amasheh, S., Greene, E. S., Zampiga, M., Sirri, F., Ohkubo, T., and Dridi, S. (2020). Orexin Lodemann, U., et al. (2006). Characterization of a porcine intestinal epithelial system is expressed in avian liver and regulates hepatic lipogenesis via ERK1/2 cell line for in vitro studies of microbial pathogenesis in swine. Histochem. Cell activation. Sci. Rep. 10:19191. doi: 10.1038/s41598-020-76329-2 Biol. 125, 293–305. doi: 10.1007/s00418-005-0067-z Habashy, W. S., Milfort, M. C., Adomako, K., Attia, Y. A., Rekaya, R., and Aggrey, Schmittgen, T. D., and Livak, K. J. (2008). Analyzing real-time PCR data by the S. E. (2017a). Effect of heat stress on amino acid digestibility and transporters comparative CT method. Nat. Protoc. 3, 1101–1108. doi: 10.1038/nprot.2008.73 in meat-type chickens gene expression of amino acid. Poultry_Science 96, Sklan, D., Geyra, A., Tako, E., Gal-gerber, O., and Uni, Z. (2003). Ontogeny of 2312–2319. doi: 10.3382/ps/pex027 brush border carbohydrate digestion and uptake in the chick ontogeny of brush Habashy, W. S., Milfort, M. C., Fuller, A. L., Attia, Y. A., Rekaya, R., and border carbohydrate digestion and uptake in the chick. Br. J. Nutr. 89, 747–753. Aggrey, S. E. (2017b). Effect of heat stress on protein utilization and doi: 10.1079/BJN2003853 nutrient transporters in meat-type chickens. Int. J. Biometeorol. 61, 2111–2118. Song, Z. H., Cheng, K., Zheng, X. C., Ahmad, H., Zhang, L. L., and Wang, T. (2017). doi: 10.1007/s00484-017-1414-1 Effects of dietary supplementation with enzymatically treated Artemisia annua Harford, I. D., Pavlidis, H. O., and Anthony, N. B. (2014). Divergent selection for on growth performance, intestinal morphology, digestive enzyme activities, muscle color in broilers. Poult. Sci. 93, 1059–1066. doi: 10.3382/ps.2013-03446 immunity, and antioxidant capacity of heat-stressed broilers. Poult. Sci. 97, Havenstein, G. B., Ferket, P. R., and Qureshi, M. A. (2003). Growth, livability, and 430–437. doi: 10.3382/ps/pex312 feed conversion of 1957 versus 2001 broilers when fed representative 1957 and Sun, X., Zhang, H., Sheikhahmadi, A., Wang, Y., Jiao, H., Lin, H., et al. (2015). 2001 broiler diets 1. Poult. Sci. 82, 1500–1508. doi: 10.1093/ps/82.10.1500 Effects of heat stress on the gene expression of nutrient transporters in the He, X., Lu, Z., Ma, B., Zhang, L., Li, J., and Gao, F. (2018a). Effects of chronic jejunum of broiler chickens (Gallus gallus domesticus). Int. J. Biometeorol. 59, heat exposure on growth performance, intestinal epithelial histology, appetite- 127–135. doi: 10.1007/s00484-014-0829-1 related hormones and genes expression in broilers. J. Sci. Food Agric. 98, Tabler, T. W., Greene, E. S., Orlowski, S. K., Hiltz, J. Z., Anthony, N. B., and Dridi, 4471–4478. doi: 10.1002/jsfa.8971 S. (2020). Intestinal barrier integrity in heat-stressed modern broilers and their He, X., Lu, Z., Ma, B., Zhang, L., Li, J., Jiang, Y., et al. (2018b). Chronic heat ancestor wild jungle fowl. Front. Vet. Sci. 7:249. doi: 10.3389/fvets.2020.00249 stress damages small intestinal epithelium cells associated with the adenosine Thiruvenkadan, A., and Prabakaran, R. (2017). Recent approaches 5 ′ -monophosphate-activated protein kinase pathway in broilers. J. Agric. Food in poultry breeding. Appro. Poult. Dairy Vet. Sci. 2, 124–132. Chem. 66, 7301–7309. doi: 10.1021/acs.jafc.8b02145 doi: 10.31031/APDV.2017.02.000533 Lara, L. J., and Rostagno, M. H. (2013). Impact of heat stress on poultry production. Uldry, M., and Thorens, B. (2004). The SLC2 family of facilitated hexose Animals 3, 356–369. doi: 10.3390/ani3020356 and polyol transporters. Pflugers Arch. Eur. J. Physiol. 447, 480–489. Lian, P., Braber, S., Garssen, J., Wichers, H. J., Folkerts, G., Fink-gremmels, J., et al. doi: 10.1007/s00424-003-1085-0 (2020). Beyond heat stress : Intestinal integrity disruption and mechanism- Wasti, S., Sah, N., and Mishra, B. (2020). Impact of heat stress on poultry based intervention strategies. Nutrients 12:734. doi: 10.3390/nu12030734 health and performances, and potential mitigation strategies. Animals 10:1266. Liu, L., Qin, D., Wang, X., Feng, Y., Yang, X., and Yao, J. (2015). Effect of immune doi: 10.3390/ani10081266 stress on growth performance and energy metabolism in broiler chickens. Food Yi, D., Hou, Y., Tan, L., Liao, M., Xie, J., Wang, L., et al. (2016). N - Agric. Immunol. 26, 194–203. doi: 10.1080/09540105.2014.882884 acetylcysteine improves the growth performance and intestinal function Miska, K. B., and Fetterer, R. H. (2019). Expression of amino acid and sugar in the heat-stressed broilers. Anim. Feed Sci. Technol. 220, 83–92. transporters, aminopeptidase, and the di- and tri-peptide transporter PepT1; doi: 10.1016/j.anifeedsci.2016.07.014 differences between modern fast growing broilers and broilers not selected for Zapalska-Sozoniuk, M., Chrobak, L., Kowalczyk, K., and Kankofer, M. (2019). Is it rapid growth. Poult. Sci. 98, 2272–2280. doi: 10.3382/ps/pey583 useful to use several “omics” for obtaining valuable results? Mol. Biol. Rep. 46, Mott, C. R., Siegel, P. B., Webb, K. E., and Wong, E. A. (2008). Gene expression of 3597–3606. doi: 10.1007/s11033-019-04793-9 nutrient transporters in the small intestine of chickens from lines divergently Zeng, P. L., Li, X. G., Wang, X. Q., Zhang, D. X., Shu, G., and Luo, Q. B. selected for high or low juvenile body weight. Poult. Sci. 87, 2215–2224. (2011). The relationship between gene expression of cationic and neutral amino doi: 10.3382/ps.2008-00101 acid transporters in the small intestine of chick embryos and chick breed, National Research Council (1994). Nutrient Requirements of Poultry, 9th Revised development, sex, and egg amino acid concentration. Poult. Sci. 90, 2548–2556. Edn. Washington, DC: National Research Council. doi: 10.3382/ps.2011-01458 Orhan, C., Tuzcu, M., Brice, P., Deeh, D., Sahin, N., Komorowski, J. R., et al. (2019). Organic chromium form alleviates the detrimental effects of heat stress Conflict of Interest: The authors declare that the research was conducted in the on nutrient digestibility and nutrient transporters in laying hens. Biol. Trace absence of any commercial or financial relationships that could be construed as a Elem. Res. 189, 529–537. doi: 10.1007/s12011-018-1485-9 potential conflict of interest. Orlowski, S., Flees, J., Anthony, N., and Dridi, S. (2017). Differential expression of water channel- and noncoding RNA biogenesis-related genes in three lines Publisher’s Note: All claims expressed in this article are solely those of the authors of chickens under a short-term water restriction. Poult. Sci. 96, 4172–4181. and do not necessarily represent those of their affiliated organizations, or those of doi: 10.3382/ps/pex263 the publisher, the editors and the reviewers. Any product that may be evaluated in Pascal, L. E., True, L. D., Campbell, D. S., Deutsch, E. W., Risk, M., Coleman, I. M., this article, or claim that may be made by its manufacturer, is not guaranteed or et al. (2008). Correlation of mRNA and protein levels: cell type-specific gene expression of cluster designation antigens in the prostate. BMC Genomics 9:246. endorsed by the publisher. doi: 10.1186/1471-2164-9-246 Perini, F., Cendron, F., Rovelli, G., Castellini, C., and Cassandro, M. (2021). Copyright © 2021 Abdelli, Ramser, Greene, Beer, Tabler, Orlowski, Pérez, Solà- Emerging genetic tools to investigate molecular pathways related to heat stress Oriol, Anthony and Dridi. This is an open-access article distributed under the terms in chickens : a review. Animals 11:46. doi: 10.3390/ani11010046 of the Creative Commons Attribution License (CC BY). The use, distribution or Sander, H., Wallace, S., Plouse, R., Tiwari, S., and Gomes, A. V. reproduction in other forums is permitted, provided the original author(s) and the (2019). Ponceau S waste: ponceau S staining for total protein copyright owner(s) are credited and that the original publication in this journal normalization. Anal Biochem. 575, 44–53. doi: 10.1016/j.ab.2019. is cited, in accordance with accepted academic practice. No use, distribution or 03.010 reproduction is permitted which does not comply with these terms. Frontiers in Physiology | www.frontiersin.org 17 October 2021 | Volume 12 | Article 733134