International Journal of Molecular Sciences Communication Immunomodulatory Lectin-like Peptides for Fish Erythrocytes-Targeting as Potential Antiviral Drug Delivery Platforms Maria Salvador-Mira 1,2 , Veronica Chico 1,2 , Monica Arostica 3 , Fanny Guzmán 3 , Nerea Roher 4 , Luis Perez 1,2 and Maria del Mar Ortega-Villaizan 1,2, * 1 Instituto de Biología Molecular y Celular (IBMC), Universidad Miguel Hernández (IBMC-UMH), 03202 Elche, Spain; maria.salvador04@goumh.umh.es (M.S.-M.); vchico@umh.es (V.C.); luis.perez@umh.es (L.P.) 2 Instituto de Investigación, Desarrollo e Innovación en Biotecnología Sanitaria de Elche (IDiBE), Universidad Miguel Hernández (IDiBE-UMH), 03202 Elche, Spain 3 Núcleo Biotecnológico de Curauma (NBC), Pontificia Universidad Católica de Valparaíso, Valparaíso 2373223, Chile; monica.arostica@gmail.com (M.A.); fanny.guzman@pucv.cl (F.G.) 4 Department Biologia Cellular, Fisiologia Animal i Immunologia, Institut de Biotecnologia i de Biomedicina (IBB), Universitat Autònoma de Barcelona (UAB), 08193 Cerdanyola del Vallès, Spain; nerea.roher@uab.cat * Correspondence: mortega-villaizan@umh.es  Abstract: One of the challenges of science in disease prevention is optimizing drug and vaccine  delivery. Until now, many strategies have been employed in this sector, but most are quite complex Citation: Salvador-Mira, M.; and labile. To overcome these limitations, great efforts are directed to coupling drugs to carriers, Chico, V.; Arostica, M.; Guzmán, F.; either of natural or synthetic origin. Among the most studied cell carriers are antigen-presenting Roher, N.; Perez, L.; cells (APCs), however, red blood cells (RBCs) are positioned as attractive carriers in drug delivery Ortega-Villaizan, M.d.M. due to their abundance and availability in the body. Furthermore, fish RBCs have a nucleus and Immunomodulatory Lectin-like have been shown to have a strong involvement in modulating the immune response. In this study, Peptides for Fish Erythrocytes- we evaluated the binding of three peptides to rainbow trout RBCs, two lectin-like peptides and Targeting as Potential Antiviral Drug Delivery Platforms. Int. J. Mol. Sci. another derived from Plasmodium falciparum membrane protein, in order to take advantage of this 2021, 22, 11821. https://doi.org/ peptide-RBCs binding to generate tools to improve the specificity, efficacy, immunostimulatory effect, 10.3390/ijms222111821 and safety of the antiviral therapeutic or prophylactic administration systems currently used. Academic Editor: Axel T. Neffe Keywords: peptide; red blood cells; erythrocyte; drug delivery; ligand; prophylactic; therapeutic; cell-targeting; lectin; fish Received: 1 October 2021 Accepted: 26 October 2021 Published: 30 October 2021 1. Introduction Publisher’s Note: MDPI stays neutral In recent years, a major challenge in the design, delivery, and formulation of drugs and with regard to jurisdictional claims in vaccines has been the development of more effective and safer delivery systems capable published maps and institutional affil- of enhancing immune responses. The ultimate goal of a vaccine is to induce a memory iations. immune response, a process that is well-orchestrated by antigen-presenting cells (APCs), which acquire antigens from their environment, process them, and present them to T and B lymphocytes [1]. Many immunization strategies based on antigen delivery to APCs have been directed to manipulate immune responses to facilitate antigen uptake, by means of Copyright: © 2021 by the authors. using chemokines or cytokines for APC recruitment [1,2], or even fusing antibodies or Licensee MDPI, Basel, Switzerland. ligands to antigens to target specific receptors on the surface of APCs [3,4]. Despite this, This article is an open access article there are certain limitations to consider such as the low percentage of APCs in the peripheral distributed under the terms and blood or the high cost and the difficulty in isolating and generating autologous APCs. To conditions of the Creative Commons overcome these drawbacks, great efforts are directed to the search for long-circulating Attribution (CC BY) license (https:// creativecommons.org/licenses/by/ drug carriers/vehicles that can provide sustained release of circulating therapeutic agents 4.0/). and improve the specificity, efficacy, and safety of therapeutic agents [5–7]. In this regard, Int. J. Mol. Sci. 2021, 22, 11821. https://doi.org/10.3390/ijms222111821 https://www.mdpi.com/journal/ijms Int. J. Mol. Sci. 2021, 22, 11821 2 of 14 the idea of using red blood cells (RBCs) as natural and biocompatible carriers for the delivery and distribution of drugs or vaccines has been extensively studied [8,9]. Due to the large number of RBCs present in the organism and the wide diffusion throughout the body, the possibility of using them for the delivery of therapeutic and prophylactic agents is promising. Furthermore, compared to other drug delivery systems, RBCs are the champions for their unique longevity in the bloodstream and their biocompatibility [8]. Additionally, using RBCs as vaccine or immunostimulant platforms also avoids safety issues related to viral or bacterial vectors [9]. In order to target a treatment to a specific cell population or to make the treatments more specific, several studies have been directed to identify future molecular targets for drug delivery and generation of new vaccines, using RBCs from humans [10–13] or other vertebrate species as cell targets [14,15]. Most prophylactic delivery systems have demonstrated high immunogenic potency, which can cause non-specific stimulation of the host immune system [16–18]. Therefore, using RBCs as autologous carrier cells is of great importance in the therapeutic field by targeting drugs to the surface of these cells for adhesion or internalization in vivo, as well as serving as a vehicle to target antigens to APCs to enhance and boost immunity. In fact, RBCs have been tested as antigen carriers to prevent the production of specific anti-drug antibodies after repeated administration of therapeutic proteins by inducing specific immune tolerance [19,20]. Additionally, recently, it has been shown that mouse RBCs can act as artificial APCs by anchoring characteristic APC molecules to the cell surface so that these modified RBCs are able to activate T cells and promote the secretion of inflammatory cytokines [21]. Another approach investigated to develop novel therapies is the use of nanoparticles attached to RBCs as drug delivery systems, where the binding of nanoparticles to RBCs could prolong the residence time in the blood and minimize the rapid clearance of encapsulated therapeutic agents from the circulation [22,23]. On the other hand, it is important to emphasize that, unlike mammals, the RBCs of lower vertebrates, such as fish, birds, amphibians, and reptiles, preserve the nucleus and possess organelles within the cytoplasm [24], which provides them with the intra- cellular machinery necessary to become mediators of the immune response. Recently, nucleated fish RBCs have been shown to play an active role in the response against viral infections [25–28], in phagocytosis [29], and in antigen processing and presentation via the major histocompatibility complex (MHC) classes I and II [28,30–34]. Moreover, RBCs de- velop specific responses to different pathogen-associated molecular patterns (PAMPS) [35], overexpression of toll-like receptors (TLRs) [36], and are involved in the production of interferon, inflammatory cytokines, and chemokines [27,30–32,37,38]. Within the field of rational design of new prophylactic treatments, nucleated rainbow trout RBCs have been shown to express the antigen encoded by a DNA vaccine and respond to a DNA vaccine immunization inducing exogenous peptide presentation processes [31,39]. In addition, rainbow trout RBCs have been shown to be capable to endocytose bacterial inclusion bodies made of nanostructured recombinant antigenic proteins and modulate the expression of immune system genes [30]. In view of all these characteristics and due to their ability to generate and modulate the immune response, it is of interest to use nucleated RBCs as therapeutic or prophylactics targeting and delivery systems. In relation to cell targeting, cell-binding ligands are becoming increasingly important, and their therapeutic applications have been growing. Cell type-specific ligands are powerful tools for functionalized therapeutic or prophylactic treatments since they can be easily incorporated into drug delivery platforms. Previous studies that combine protein therapeutics with ligands targeting RBCs have shown significant improvement in drug half-life and uptake in the target tissue [8,40,41]. In this article, we will focus on evaluating and analyzing the binding of three syn- thetic peptides to rainbow trout RBCs for their potential use in the development of new therapeutic or prophylactic delivery methods that can specifically target RBCs. Many of the cell-binding peptides that recognize receptors in various cell types have been identified Int. J. Mol. Sci. 2021, 22, 11821 3 of 14 by using peptide libraries [40–42]. Among them, different peptides have been found in the literature to target RBCs [43–46]. Among the identified peptides in the literature, we selected three peptides based on their reported affinity to bind nucleated RBCs or mammalian RBCs. One of the se- lected peptides is a highly active binding peptide derived from an integral membrane protein of Plasmodium falciparum (Pf25-IMP), which has been shown to bind strongly to human RBCs and block the entrance of the parasite Plasmodium falciparum into mammalian RBCs [43]. This peptide will be named in this article as 4341. Another selected peptide is a small peptide with lectin-like behavior, called odorranalectin (hereafter referred to as peptide 4342), which has been found to bind rabbit and human RBCs and has been described as a promising peptide for drug delivery [44]. Finally, the third selected peptide (hereafter referred to as peptide 4343) is a 6-amino acid lectin-like peptide derived from the S2 subunit of pertussis toxin with a high binding affinity to glycoconjugates containing sialic acid [45,46], and which has been described to bind goose nucleated RBCs [46]. In general, lectins are proteins or glycoproteins of non-immune origin that are ubiquitously distributed in plants, fungi, and animals and bind to sugar residues in the cell membrane and their binding is usually fast and strong [47]. Lectins have been attributed multiple significant biological functions, such as antiviral activities [47]. Their potential application for drug delivery and targeting has been well studied [44]. However, their participation in the modulation of the antiviral immune response has been scarcely studied. Briefly, our results show that two of these three peptides, peptides 4342 and 4343, bind to rainbow trout RBCs and they are good candidates for linking up to new delivery systems and enhancing the antiviral immune response during treatment. 2. Results 2.1. In Vitro Evaluation of Peptide Binding to Rainbow Trout RBCs In order to evaluate the binding of the peptides for RBCs, we carried out a dose- response assay using a concentration range from 25 to 100 µM. The binding of the Rho- damine (Rhd)-labeled peptides was evaluated by means of flow cytometry and calculated as the integrated median fluorescence intensity (iMFI), which is computed by multiplying the relative frequency (% positive) of cells with the median fluorescence intensity (MFI) of that population. The minimum concentration showed very low binding to RBCs, and concentrations of 50 and 100 µM showed higher and specific binding for all the peptides (Figure 1a,b). On the other hand, peptide 4342 showed the highest binding at 100 µM, followed by peptides 4343 and 4341 (Figure 1a). Besides, hemagglutination was not ob- served at the concentrations of peptides used (Supplementary Figure S1). Cell toxicity was not observed neither in vitro nor in vivo at the maximum concentration of peptides used (Supplementary Figure S2). Additionally, peptide-RBC binding was confirmed by confocal microscopy (Figure 2) which showed the presence of all the peptides inside the cell, although it was higher for peptides 4343 and 4342. Int. J. Mol. Sci. 2021, 22, 11821 4 of 14 Int. ol. Sci. 2021, 22,J.11821 Mol. Sci. 2021, 22, 11821 4 of 14 4 of 14 (a) (a) (b) (b) Figure 1. Peptide binding to rainbow trout RBCs in vitro, evaluated by means of flow cytometry. (a) Figure binding Figure 1. Peptide 1. Peptide binding rainbowtotrout toIntegrated rainbow medianRBCs trout RBCsevaluated fluorescence in vitro, inintensity vitro, evaluated by(iMFI) means(% by ofmeans positive ofcells flow ×cytometry. flow cytometry. MFI) (a) of rainbow (a) Integrated trout RBCs median Integrated median fluorescence treated with intensity different (iMFI) peptide (% positive concentrations, cells 90 min× MFI) after of rainbow incubation, fluorescence intensity (iMFI) (% positive cells × MFI) of rainbow trout RBCs treated with different peptide trout analyzedRBCs by concentra- flow cytometry. treated with different Data peptide represent concentrations, 90 min deviation after incubation, analyzed by flow cytometry. tions, 90 min after incubation, analyzed bythe flowmean ± standard cytometry. Data represent (SD), thenmean = 3. Kruskal–Wallis test with(SD), ± standard deviation Dunn’s n =multiple 3. Data represent the mean ± standard comparison test wasdeviation performed (SD),(*np=<3.0.05). Kruskal–Wallis test with Dunn’s C means untreated control multiple RBCs. (b) Representative Kruskal–Wallis test with Dunn’s multiple comparison test was performed (* p < 0.05). C means untreated control RBCs. comparison test wasimagesperformed of rainbow (* ptrout < 0.05). RBCs C treated means with untreated control the three RBCs. selected (b) Representative peptides, 90 min after incubation, with (b) Representative images ofimages of rainbow rainbow trout trout RBCswithtreated with selected the three selected 90 peptides, 90incubation, min after incubation, with 100 µMRBCs of eachtreated peptide. the three Images were takenpeptides, with the IN minCell after Analyzer with 6000 Cell Imaging system at 100 µM of each peptide. Images 100 µM of each peptide. were taken Images were 40× magnification. with the IN taken with Peptides Cell Analyzer the IN Cell are labeled 6000 withAnalyzer Cell Imaging 6000White Rhd B (red). system Cell Imaging at 40 × magnification. system at arrows indicate peptide binding to Peptides are labeled 40× with Rhd magnification. B (red). White Peptides RBCs. arrows are labeled indicate with Rhd Bpeptide binding (red). White to RBCs. arrows indicate peptide binding to RBCs. Figure 2. Figure 2. Volume Volume 3D 3D reconstruction reconstructionofofthe thevisualization visualizationofof thethe peptides peptidesbinding bindingto rainbow trout to rainbow RBCs. trout Rhd-labeled RBCs. pep- Rhd-labeled gure 2. Volumepeptides 3D reconstruction tides are are represented ofin the represented visualization red, in nuclei red, nuclei ofstained werewere thestained peptides binding with with Hoescht to rainbow and Hoescht are aretrout represented and RBCs. Rhd-labeled in blue, represented inand cell blue, pep- membrane and was stained cell membrane was des are represented inCellMask using red, nucleiGreen were stained with Hoescht inand are The represented were in blue, andatcell membrane was stained stained using CellMask and Greenis and represented is representedbeige. in beige.images taken The images were 63× taken atmagnification. Confocal 63× magnification. images Confocal were images sing CellMask Green and using processed is represented the ZEN 3.2in beige. The images (Blue edition). wererendering Volume taken at 63× wasmagnification. performed withConfocal IMARISimages wereimages represent v9.3. Upper were processed using the ZEN 3.2 (Blue edition). Volume rendering was performed with IMARIS v9.3. Upper images rocessed using the ZEN plan view3.2and (Blue edition). lower images Volume rendering represent was performed perspective view. with IMARIS v9.3. Upper images represent represent an view and lower images plan view and represent lower images perspective view.represent perspective view. Int. J.J.Mol. Int. Mol.Sci. Sci.2021, 22,11821 2021,22, 11821 5 5ofof 14 14 Moreover, Moreover, anan in in silico silico evaluation evaluation of the peptides’ physicochemical physicochemical descriptors descriptors waswas carried carried out. out. Dipole number of Dipole moment, number ofhydrogen hydrogenbond bonddonors donorsandandacceptors, acceptors, and and logP logP of of each each peptide peptide were were calculated calculated (Table (Table 1). The 1). The results results showed showed that peptide that peptide 4341a much 4341 has has a much largerlarger dipoledipole moment moment compared compared to 4342toand 4342 andNegative 4343. 4343. Negative logP values logP values indicated indicated that all that all peptides peptides are hydrophilic. are hydrophilic. On theOn thehand, other other the hand, thepeptides three three peptides showed showed close hy- close hydrogen drogen bond donor/acceptor bond donor/acceptor values values (Table (Table 1, 1, Supplementary Supplementary Figure Figure S3). S3). Additionally, Additionally, the the surface charge representations surface showedshowed charge representations higher charge higher density on the left charge density on side structure the left than on side structure the rotated than 180◦ right on the rotated side 180° structure right (Supplementary side structure Figure S4). (Supplementary BothS4). Figure results Bothindicated the results indi- peptides’ cated amphipathic the peptides’ capacity. capacity. amphipathic Table Table 1. 1. Physicochemical Physicochemical and and molecular molecular descriptors descriptors for each peptide. Dipole Moment Dipole Moment N° N◦ofofHydrogen Hydrogen NN° ◦ ofofHydrogen Hydrogen Peptide Peptide logP logP (Debye) (Debye) Bond BondDonors Donors BondAcceptors Bond Acceptors 4341 4341 90.132 90.132 18 18 1919 −−1.73 1.73 4342 4342 38.657 38.657 26 26 2424 −−0.55 0.55 4343 4343 42.921 42.921 11 11 1010 −−2.48 2.48 2.2. 2.2.In InVitro VitroAnalysis AnalysisofofGene GeneExpression Expression in in Rainbow Rainbow Trout Trout RBCs after Peptide RBCs after Peptide Treatment Treatment We We next next investigated investigated whether whether thethe treatment treatment with with the the three three Rhd-labeled Rhd-labeled peptides peptides could could generate an antiviral immune response in vitro in rainbow trout RBCs, generate an antiviral immune response in vitro in rainbow trout RBCs, byby means means of of examining examiningthe the expression expressionprofile profile of of some some genes genes characteristic characteristic of of fish fish related related toto antiviral antiviral activity, activity, such such asas ifit5: ifit5: interferon-induced interferon-induced protein protein with with tetratricopeptide tetratricopeptiderepeatsrepeats5, 5, mx1-3: mx1-3: interferon-inducible Mx, nkef: natural killer enhancement factor-like interferon-inducible Mx, nkef : natural killer enhancement factor-like protein and protein and vig1:vig1: vi- perin) by by viperin) means meansRT-qPCR RT-qPCR(Figure 3). The (Figure 3). results showed The results that ifit5 showed thatwas statistically ifit5 signif- was statistically icantly upregulated significantly by peptide upregulated 4342 and by peptide vig1and 4342 by peptide vig1 by 4343. peptideOn4343. the other hand, On the it should other hand, be noted that it should slight that be noted and slight not statistically significant significant and not statistically upregulation of mx1-3 gene upregulation expression of mx1-3 gene was induced by peptide 4342. Further, nkef gene expression was upregulated expression was induced by peptide 4342. Further, nkef gene expression was upregulated by all the peptides, and especially by peptide 4342, although not statistically significantly. by all the peptides, and especially by peptide 4342, although not statistically significantly. Figure3. Figure Antiviralimmunomodulation 3.Antiviral immunomodulationof ofthe thepeptides peptidesin inrainbow rainbowtrout troutRBCs. RBCs.Antiviral Antiviralgenegene(ifit5, (ifit5, mx1-3,nkef, mx1-3, nkef,and vig1)expression andvig1) expressionquantified quantifiedbyby RT-qPCR RT-qPCR inin RBCs RBCs at at 6 h6post-treatment h post-treatment (hpt) (hpt) with with 50 µM of each peptide. Gene expression was normalized against ef1α and relativized to 50 µM of each peptide. Gene expression was normalized against ef1α and relativized to control cellscontrol cells (RBCs (RBCs untreated) (red line). untreated) (red line).Data Datarepresent representthe themean mean±±standard standarddeviation deviation (SD), (SD), n =n 4. = 4. Mann–Whit- Mann–Whitney ney test was performed (* p test was performed (* p < 0.05). < 0.05). 2.3.In 2.3. InVivo VivoEvaluation EvaluationofofPeptide PeptideBinding Binding to to Rainbow Rainbow Trout Trout RBCs In order In ordertototrack trackininvivo vivothe thebinding binding ofofthethe peptides peptides to rainbow to rainbow trout trout RBCs, RBCs, we we ex- examined amined thethe peripheral peripheral blood blood of of rainbow rainbow trout trout individuals individuals injected injected with with the the peptides. peptides. AtAt 3 3 h post-injection (hpi), blood was analyzed by means of flow cytometry h post-injection (hpi), blood was analyzed by means of flow cytometry and fluorescent and fluorescent microscopy. Flow cytometry evaluation showed the highest iMFI for peptide 4342, followed ol. Sci. 2021, 22, 11821 6 of 14 Int. J. Mol. Sci. 2021, 22, 11821 6 of 14 microscopy. Flow cytometry evaluation showed the highest iMFI for peptide 4342, fol- lowed by peptides 4343 and4343 by peptides 4341and (Figure 4341 4a). Moreover, (Figure by means 4a). Moreover, byof fluorescence means micros-microscopy, we of fluorescence copy, we couldcould verifyverify the presence of peptides the presence in RBCs of peptides in (Figure 4b), although RBCs (Figure the number 4b), although the number of cells of cells showingshowing bound peptides was lower bound peptides wascompared to the into lower compared vitro the evaluation, as shown in vitro evaluation, as shown by the by the iMFI (Figures 1a and 4a). iMFI (Figures 1a and 4a). (a) (b) Figure binding Figure 4. Peptide 4. Peptide to binding rainbowtotrout rainbow RBCstrout RBCs in vivo, byinmeans vivo, of byflow means of flow cytometry. cytometry. (a) Integrated (a) Integrated median fluorescence median fluorescence intensity (iMFI) (% positive cells × MFI) of RBCs from blood of intensity (iMFI) (% positive cells × MFI) of RBCs from blood of rainbow trout injected intravenously with the rainbow trout three selected injected intravenously with the three selected peptides, 3 hpi with 100 µM of each peptide, analyzed peptides, 3 hpi with 100 µM of each peptide, analyzed by flow cytometry. Data represent the mean ± standard deviation by flow cytometry. Data represent the mean ± standard deviation (SD), n = 3. Kruskal–Wallis test (SD), n = 3. Kruskal–Wallis test with Dunn’s multiple comparison test was performed (p < 0.05). C means control RBCs. with Dunn´s multiple comparison test was performed (p < 0.05). C means control RBCs. (b) Repre- (b) Representative sentativeimages imagesofofRBCs RBCsfrom fromblood blood of of rainbow trout injected rainbow trout injected intravenously intravenouslywith withthe thethree threeselected selected peptides, 3 hpi withpeptides, 100 µM of 3 hpi with 100 µM of each peptide. The images were taken with the IN Cell Analyzer 6000 system at each peptide. The images were taken with the IN Cell Analyzer 6000 Cell Imaging 40× magnification. Peptides Cell Imaging are at system labeled with Rhd (red). 40× magnification. White arrows Peptides indicate are labeled withpeptide binding Rhd (red). White toarrows RBCs. indi- cate peptide binding to RBCs. 3. Discussion 3. Discussion The biological barriers between the site of drug action and drug delivery are becoming increasingly The biological important barriers between thefor theofdevelopment site drug action and of effective and safe drug delivery aretherapeutic becom- or prophy- lactics administration methods. The traditional approach ing increasingly important for the development of effective and safe therapeutic or is based on the use of vaccines as the most widely used method for the control of infectious prophylactics administration methods. The traditional approach is based on the use of and non-infectious diseases vaccines as the since most they widely induce usedboth humoral method for theand cell-mediated control of infectiousimmune responses [48]. Despite this, and non-infectious it is necessary diseases since they induce both to solve certain humoral and problems related cell-mediated to the responses immune efficacy and safety [48]. De- of vaccines, as spite this, it is well as thetooptimization necessary solve certainofproblems administration relatedusing to the low-cost efficacyandandless aggressive safety of methods. It is desirable to explore alternative molecules or a combination vaccines, as well as the optimization of administration using low-cost and less aggressive of them that can target specific cellular responses to confer protection and decrease methods. It is desirable to explore alternative molecules or a combination of them that can possible side effects. For this reason, incorporating cell-binding ligands into drug target specific cellular responses to confer protection and decrease possible side effects. delivery platforms has attracted For this reason,special interest. cell-binding ligands into drug delivery platforms has at- incorporating tracted special interest. There is a great shortage of vaccines and prophylactic methods against diseases in fish farming of There is a great shortage which demonstrates vaccines the needmethods and prophylactic to identify newdiseases against strategies. in Furthermore, many characteristics of the immune system of fish fish farming which demonstrates the need to identify new strategies. Furthermore, manyare still unknown. Nucleated RBCs characteristics of the immune system of fish are still unknown. Nucleated RBCs from fishin the immune from fish are postulated as promising cells due to their important role response [25,28,37,39]. On top of that it is the fact that RBCs are the most abundant cells Int. J. Mol. Sci. 2021, 22, 11821 7 of 14 in the bloodstream, which makes them ideal candidates for the development of new vaccination strategies to functioning as drug carriers in circulation. Combining this evidence and trying to improve current protection strategies by mak- ing them more specific to RBCs, we tested and evaluated the binding of three synthetic peptides to RBCs, in vitro and in vivo. The selection of these peptides was based on an exhaustive bibliographic search that provided us with enough information to study them in our target cells considering that the three peptides have been tested in RBCs of humans and mice [43–45], and goose nucleated RBCs [46]. Our results demonstrated the binding of Rhd-labeled peptides to rainbow trout RBCs, with a higher affinity of the peptides 4342 and 4343 in vitro. Moreover, hemagglutina- tion was not observed at the concentrations of peptides used. Both peptides have been shown to be involved in the lectin-like interactions [44–46]. Lectins are well-known and widely distributed proteins that bind to sugar residues in the cell membrane quickly and strongly because their binding involves many binding sites determined by a specific sugar code [49,50]. Furthermore, previous research has shown that lectins function as recognition molecules in cell–cell and cell–molecule interactions in many biological systems, making them excellent candidates for drug delivery and targeting [49,50]. In addition, our selected peptides were mainly found inside RBCs, instead of at the surface of the RBCs, as observed by confocal microscopy. In this regard, while negative logP values and dipolar moments indicated that structures have polar characteristics, especially peptide 4341, hydrogen bond donor/acceptors and surface charge representations indicated that peptides have amphipathic capacity, with hydrophobic and polar faces, which is typical of cell-penetrating peptides. This effect was more evident for peptides 4342 and 4343, which showed enhanced cell-penetrating activity. In this context, cell-penetrating peptides, which are particularly attractive peptides for vaccine delivery systems, have been widely used to enhance the transport of drugs of a wide range of sizes into the cells [51]. Among lectin-like peptides, the odorranalectin peptide, which is peptide 4342 in this study, has been shown to exhibit the potential of cell-penetrating peptides for targeted oligonucleotide delivery to glioblastomas across the biological barriers, with high stability in circulation [52]. The in vivo evaluation results also showed that peptides bonded to blood RBCs, although the number of RBCs with bonded peptides was very low, a result which is positive when administering a vaccine directed at RBCs since a greater binding could trigger problems at the level of the organism, like anemia. The use of adjuvants has become a key method for increasing the potency of vaccines and drugs. Interestingly, it has been documented that short peptides or ligands exert immunomodulatory effects that can be used for the control of infectious and non-infectious diseases. For example, a short antimicrobial peptide, CM11, has been shown to upregulate key genes such as interleukin 1β (il1β), interleukin 8 (il8), or tumor necrosis factor α (tnfα), boosting the immune system of zebrafish against bacterial infections [53]. The muramyl dipeptide (MDP), a peptidoglycan muropeptide that consists of N-Acetylmuramic acid (MurNAc) and two amino acids [54,55] has been shown to induce a humoral and cellular response against viruses [56] and to improve the efficacy of a vaccine [57]. All these correlations lead to the use of short peptides as adjuvants to enhance a strong immune response. However, the ability of lectin-like peptides as modulators of the antiviral immune response has been scarcely studied. Lectins such as Concanavalin A or Wheat Germ Agglutinin are known to bind and activate lymphocyte receptors and induce cytokine gene expression and protein synthesis [58,59]. On the other hand, mannan-binding lectin (MBL) has been documented to play a key role in the lectin pathway of complement activation and to influence cytokine expression by modulating lipopolysaccharide (LPS)/Toll-like Receptor (TLR) signaling pathways [60]. Our results showed that mainly peptides 4342 and 4343 were capable of modulating the expression of genes related to the antiviral immune response, such as ifit5, mx1-3, vig1, or nkef. However, the mechanisms or pathways triggered by these lectin-like peptides remain to be studied. Apart from that, peptide 4341, in comparison to lectin-like peptides 4342 and 4343, showed lower induction of interferon- Int. J. Mol. Sci. 2021, 22, 11821 8 of 14 stimulated antiviral genes ifit5, mx1-3, and vig1. The interferon signaling pathway has been reported to be induced by Plasmodium ligands in mammalian cell types [61]. However, 4341 Plasmodium-derived peptide was not able to modulate interferon related genes in rainbow trout RBCs. In summary, we identified two candidate peptides with immunomodulation capabili- ties for future vaccine delivery studies. The next step will be to attach the selected peptides to therapeutic or prophylactic tools targeted to RBCs, for the prevention of diseases with high impact on aquaculture. 4. Materials and Methods 4.1. Peptide Synthesis and Characterization The three selected peptides (Table 2) were synthesized at the laboratory of Dr. Fanny Guzman. The peptides were synthetized by Fmoc solid-phase methodology using Rink Amide resin (0.65 meq/g) (Iris Biotech GmbH, Marktredwitz, Germany) and Fmoc amino acids (Iris Biotech GmbH) in a Liberty Blue automated microwave peptide synthesizer (CEM Corp., Matthews, NC, USA). Fmoc groups removal was completed with 20% v/v of 4-methyl piperidine (4MP) (Merck KGaA, Darmstadt, Germany) in N,N-dimethylformamide (DMF) (Merck) [62]. Furthermore, the coupling of Rhd B, for its later use in microscopy, was carried out manually using 5:5:5:7.5 equivalents of Rhd B:(2-(1H-benzotriazol-1-yl)-1,1,3,3- tetramethyluronium hexafluorophosphate (HBTU) (Iris Biotech GmbH): Oxyme-Pure (Iris Biotech GmbH): N-ethyldiisopropylamine (DIEA) (Merck) [63]. Peptide cleavage was performed with a solution of 92.5% trifluoroacetic acid (TFA)/2.5% triisopropylsilane (TIS)/2.5% diethanethiol (DOT)/2.5% ultrapure water), washed with cold ether and finally purified by C18 extraction columns with acetonitrile/water gradient to a purity higher than 95%. C18 columns and reagents were acquired from Merck. Peptides were characterized by HPLC and mass spectrometry (Water Corp., Milford, MA, USA) (Jasco and Shimadzu 2020) [64]. Table 2. Peptide sequence of the selected peptides, rhodaminated (Rhd). aas is the abbreviation for amino acid residues. Name Peptide Sequence Length Source 4341 Rhd-LNKKTVVRKI 10 aas [43] 4342 Rhd-YASPKCFRYPNGVLACT 17 aas [44] 4343 Rhd-SPYGRC 6 aas [45] 4.2. Animals Juvenile rainbow trout (Oncorhynchus mykiss) were obtained from a commercial fish farm (Mundova, Río Mundo SLU Fish Farm, Albacete, Spain). Fish were maintained at the University Miguel Hernandez (UMH) facilities in a recirculating, dechlorinated, and progressively microfiltered water system, at 14 ◦ C, and fed daily with a commercial diet (Skretting, Burgos, Spain). Prior to experiments, fish were acclimatized to laboratory condi- tions for 2 weeks. The number of individuals used is indicated for each experiment/figure. All activities involving animal handling and animal care were undertaken following the Animal Welfare Body, the Research Ethics Committee at the UMH, and the competent authority of the Regional Ministry of Presidency and Agriculture, Fisheries, Food and Water supply reviewed and approved all experimental protocols, according to Spanish [Real Decreto 1201/2005] regulations. The methodology was performed in accordance with the Spanish [Real Decreto RD 53/2013] and EU [EU Directive 2010/63/EU] regulations and recommendations for animal experimentation and other scientific purposes. The permit number of the Ethics committee is UMH.IBM.MOR.01.14-3. 4.3. RBCs Purification and In Vitro Treatment with the Peptides Rainbow trout were sacrificed by overexposure to tricaine methanesulfonate (Sigma- Aldrich, Madrid, Spain) at 0.2 g/L. Peripheral blood was collected from the caudal vein Int. J. Mol. Sci. 2021, 22, 11821 9 of 14 using insulin syringes (NIPRO, Bridgewater, NJ, USA). Approximately 100 µL of blood was diluted in RPMI-1640 medium (Dutch modification) (Gibco, Thermo Fischer Scien- tific Inc., Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS) (Cultek, Madrid, Spain), 2 mM L-glutamine (Gibco), 1 mM pyruvate (Gibco), 2 µg/mL fungizone (Gibco), 50 µg/mL gentamicin (Gibco), and 100 U/mL penicillin/streptomycin (Sigma- Aldrich). Then, RBCs were purified by two consecutive density gradient centrifugations with Histopaque 1077 (7206 g, Ficoll 1.007; Sigma-Aldrich). Finally, RBCs were washed twice with RPMI 2% FBS and were cultured with RPMI 10% FBS, at 14 ◦ C, overnight. Ficoll-purified RBCs (105 cells/well) were treated with 25, 50, and 100 µM of 4341, 4342, 4343 Rhd-labeled peptides, and incubated for 90 min at 14 ◦ C. Then, RBCs were washed with 200 µL of RPMI 2% FBS and analyzed by flow cytometry, fluorescent microscopy, and confocal microscopy as described below (Figure 5). To evaluate the possible antiviral immunomodulatory effects of the peptides, ficoll- purified RBCs (106 cells/well) were incubated with 50 µM of 4341, 4342, 4343 Rhd-labeled peptides for 6 h at 14 ◦ C. After that, RBCs were washed, and samples were stored in buffer for RNA extraction and RT-qPCR analysis (Figure 5). Figure 5. Workflow of in vitro assays in rainbow trout RBCs. (A) Evaluation of peptide binding. (B) Evaluation of the immune response modulation by the peptides. Created with BioRender.com (accessed on 21 October 2021). 4.4. Peripheral Blood Sampling after In Vivo Injection with the Peptides Juvenile rainbow trout (7–10 g) were anesthetized with tricaine methanesulfonate, (Sigma-Aldrich, Madrid, Spain) (40 mg/L) and injected intravenously (i.v) with 100 µM of 4341, 4342, 4343 Rhd-labeled peptides in 50 µL of RMPI 2% FBS using insulin syringes. At 3 hpi, fish were sacrificed by overexposure to tricaine (0.2 g/L), and peripheral blood was extracted and placed on RPMI 2% FBS medium. Then, blood samples were evaluated by means of flow cytometry and fluorescent microscopy as described below (Figure 6). Figure 6. Workflow of in vivo evaluation of peptide binding to rainbow trout RBCs. Created with BioRender.com (accessed on 21 October 2021). Int. J. Mol. Sci. 2021, 22, 11821 10 of 14 4.5. RNA Isolation and Gene Expression by RT-qPCR The E.Z.N.A.® Total RNA Kit (Omega Bio-Tek Inc., Norcross, GA, USA) was used for RNA isolation according to the manufacturer’s instructions. Subsequent DNAse treatment was done using TURBO™ DNase (Ambion, Thermo Fisher Scientific, Waltham, MA USA) to eliminate possible residual genomic DNA. RNA was quantified with a NanoDrop Spec- trophotometer (Nanodrop Technologies, Wilmington, DE, USA). Then, cDNA synthesis from RNA was performed using M-MLV reverse transcriptase (Invitrogen, Thermo Fisher Scientific) as previously described [65]. To evaluate the gene expression of RBCs treated with 50 µM of the three Rhd- labeled peptides, RT-qPCR was carried out using the QUANTSTUDIO 3 System (Applied Biosystems, Thermo Fisher Scientific Inc.). Gene expression was analyzed by the 2–∆∆Ct method [66]. The ef1α gene was used as endogenous control. Primers and probes sequences are listed in Table 3. Table 3. Primers and probes sequences used in quantitative RT-qPCR. Forward Primer Reverse Primer Probe Reference or Gene (50 −30 ) (50 −30 ) (50 −30 ) Accession Number ef1α ACCCTCCTCTTGGTCGTTTC TGATGACACCAACAGCAACA GCTGTGCGTGACATGAGGCA [67] CCCTCAATGACTCTGACA CCAGCTTCGGCCTGTTTCTGTT ifit5 CCCTGCCCTCATCTTTCTTCT [38] AGCA CCA TGAAGCCCAGGATGA ACCTCATCAGCCTAGAGATTGGC mx1-3 TGGCAGGTCGATGAGTGTGA [68] AATGG TCCCC CGCTGGACTTCACCTT ACCTCACAACCGATCTTCCT nkef [28] TGTGT AAAC CTACAATCAAGGTGGTGA GTGGAAACAAAAACCGC TCTCAAGCTTCGGCAACTCCA vig1 [28] ACAATGT ACTTATA AGCA 4.6. Flow Cytometer Assays RBCs treated in vitro with the Rhd-labeled peptides and blood samples from individ- uals of rainbow trout injected with the three Rhd-labeled peptides were analyzed by flow cytometry using a FACS Canto II flow cytometer (BD Biosciences, Madrid, Spain). The PE fluorochrome filter was used to detect the Rhd-labeled peptides. A total of 25,000 events were acquired. All the parameters were settled down after recording the suitable control samples. Gating selection for in vitro and in vivo assays are indicated in Supplementary Figures S5 and S6, respectively. Then, the integrated median fluorescence intensity (iMFI) was computed by multiplying the relative frequency (% positive) of cells with the median fluorescence intensity (MFI) of that population (% positive cells × MFI). 4.7. Fluorescent Microscopy In order to track the peptide-cell binding in vitro and in vivo, the three Rhd-labeled peptides were monitored by means of fluorescent microscopy using the IN Cell Analyzer 6000 Cell Imaging system (GE Healthcare, Little Chalfont, UK). For in vitro assays, ficoll- purified RBCs were treated with Rhd-labeled peptides for 90 min, washed, and placed in 96-well plates with RPMI 2% FBS prior to visualization. For in vivo assays, 3 hpi with Rhd-labeled peptides, blood was extracted as described in Section 4.4. Then, cells were placed in 6-well plates with RPMI 2% FBS prior to visualization. dsRed channel was used to visualize Rhd B fluorescence. 4.8. Confocal Microscopy Confocal microscopy was performed to evaluate peptide-RBCs binding in vitro. After 90 min of incubation with Rhd-labeled peptides, RBCs were washed, and nuclei were stained with Hoechst (1 µg/mL) (Sigma-Aldrich) and membrane was stained with Cell- Mask Green (5 µg/mL) (Thermo Fischer Scientific). Images were taken with a Zeiss LSM900 with Airyscan 2 and analyzed with ZEN 3.2 (Blue edition) software (Zeiss, Oberkochen, Int. J. Mol. Sci. 2021, 22, 11821 11 of 14 Germany). Volume rendering was performed using IMARIS Software v9.3 (Bitplane, Zurich, Switzerland). 4.9. Software Statistical Analysis The GraphPad Prism 6 software (GraphPad Software Inc., San Diego, CA, USA) was used for statistical analysis and graphic representation. Flow cytometry data were pro- cessed and analyzed using Flowing Software 2.5.1 (www.flowingsoftware.com/ accessed on 30 August 2021). Confocal microscopy images were processed using the ZEN 3.2 (Blue edition) software and analyzed with IMARIS v9.3. Peptide structures were obtained us- ing PEP-FOLD software (https://bioserv.rpbs.univ-paris-diderot.fr/services/PEP-FOLD/ accessed on 22 October 2021) and the images were captured using the program Swiss-Pdb- Viewer (https://www.expasy.org/ accessed on 22 October 2021). Dipole moment calcu- lations were accomplished using BIOVIA Discovery Studio Visualizer (https://discover. 3ds.com/ accessed on 22 October 2021). The number of hydrogen bond donor/acceptors was calculated using MarvinSketch software (https://chemaxon.com/products.html ac- cessed on 22 October 2021). LogP calculations were accomplished using ALOGPS 2.1 (http://www.vcclab.org/lab/alogps/ accessed on 22 October 2021). Supplementary Materials: The following are available online at https://www.mdpi.com/article/10 .3390/ijms222111821/s1. Author Contributions: Conceptualization, M.S.-M. and M.d.M.O.-V.; methodology, M.S.-M., M.d.M.O.-V. and N.R.; validation, M.S.-M.; formal analysis, M.S.-M.; investigation, M.S.-M. and M.d.M.O.-V.; resources, F.G. and M.A.; writing—original draft preparation, M.S.-M.; writing—review and editing, M.S.-M., L.P., V.C. and M.d.M.O.-V.; visualization, M.S.-M. and M.d.M.O.-V.; supervision, M.d.M.O.-V.; project administration, M.d.M.O.-V.; funding acquisition, M.d.M.O.-V., L.P. and N.R. All authors have read and agreed to the published version of the manuscript. Funding: This work was supported by the European Research Council (ERC Starting Grant GA639249), the Agencia Estatal de Investigacion, Spain (Retos Investigacion: RTI2018-096957-B-C22 and Acciones de Dinamización «Europa Excelencia» EUR2020-112098). The APC was funded by the Generalitat Valenciana, Spain (Subvenciones para la captación de proyectos europeos APE/2021/022). Institutional Review Board Statement: The Animal Welfare Body, the Research Ethics Committee at the UMH, and the competent authority of the Regional Ministry of Presidency and Agriculture, Fisheries, Food and Water supply reviewed and approved all experimental protocols. The permit number of the Ethics committee is UMH.IBM.MOR.01.14-3. Animal care and all activities involving animal handling and experiments were done according to Spanish [Real Decreto 1201/2005] regula- tions. Methodology was performed in accordance with the Spanish [Real Decreto RD 53/2013] and EU [EU Directive 2010/63/EU] regulations and recommendations for animal experimentation and other scientific purposes. Informed Consent Statement: Not applicable. Data Availability Statement: Not applicable. Acknowledgments: The authors would like to thank Remedios Torres and Efren Lucas for their technical assistance. Additionally, thanks are due to Luis Mercado for his advice. Conflicts of Interest: The authors declare no conflict of interest. References 1. Somasundaram, C.; Takamatsu, H.; Andreoni, C.; Audonnet, J.C.; Fischer, L.; Lefevre, F.; Charley, B. Enhanced protective response and immuno-adjuvant effects of porcine gm-csf on DNA vaccination of pigs against aujeszky’s disease virus. Vet. Immunol. Immunopathol. 1999, 70, 277–287. [CrossRef] 2. McKay, P.F.; Barouch, D.H.; Santra, S.; Sumida, S.M.; Jackson, S.S.; Gorgone, D.A.; Lifton, M.A.; Letvin, N.L. Recruitment of different subsets of antigen-presenting cells selectively modulates DNA vaccine-elicited cd4+ and cd8+ t lymphocyte responses. Eur. J. Immunol. 2004, 34, 1011–1020. [CrossRef] 3. Tacken, P.J.; de Vries, I.J.; Torensma, R.; Figdor, C.G. Dendritic-cell immunotherapy: From ex vivo loading to in vivo targeting. Nat. Rev. Immunol. 2007, 7, 790–802. [CrossRef] Int. J. Mol. Sci. 2021, 22, 11821 12 of 14 4. Caminschi, I.; Lahoud, M.H.; Shortman, K. Enhancing immune responses by targeting antigen to dc. Eur. J. Immunol. 2009, 39, 931–938. [CrossRef] 5. Brigger, I.; Dubernet, C.; Couvreur, P. Nanoparticles in cancer therapy and diagnosis. Adv. Drug Deliv. Rev. 2002, 54, 631–651. [CrossRef] 6. Moghimi, S.M.; Hunter, A.C.; Murray, J.C. Long-circulating and target-specific nanoparticles: Theory to practice. Pharmacol. Rev. 2001, 53, 283–318. [PubMed] 7. Gref, R.; Minamitake, Y.; Peracchia, M.T.; Trubetskoy, V.; Torchilin, V.; Langer, R. Biodegradable long-circulating polymeric nanospheres. Science 1994, 263, 1600–1603. [CrossRef] [PubMed] 8. Muzykantov, V.R. Drug delivery by red blood cells: Vascular carriers designed by mother nature. Expert Opin. Drug Deliv. 2010, 7, 403–427. [CrossRef] [PubMed] 9. Murray, A.M.; Pearson, I.F.; Fairbanks, L.D.; Chalmers, R.A.; Bain, M.D.; Bax, B.E. The mouse immune response to carrier erythrocyte entrapped antigens. Vaccine 2006, 24, 6129–6139. [CrossRef] [PubMed] 10. D’Alessandro, A.; Zolla, L. Proteomic analysis of red blood cells and the potential for the clinic: What have we learned so far? Expert Rev. Proteom. 2017, 14, 243–252. [CrossRef] 11. Rossi, L.; Serafini, S.; Cenerini, L.; Picardi, F.; Bigi, L.; Panzani, I.; Magnani, M. Erythrocyte-mediated delivery of dexamethasone in patients with chronic obstructive pulmonary disease. Biotechnol. Appl. Biochem. 2001, 33, 85–89. [CrossRef] [PubMed] 12. Ktavtzoff, R.; Desbois, I.; Doinel, C.; Colombat, P.; Lamagnere, J.P.; Chassaigne, M.; Ropars, C. Immunological response to l-asparaginase loaded into red blood cells. Adv. Exp. Med. Biol. 1992, 326, 175–182. 13. Dale, G.L.; Kuhl, W.; Beutler, E. Incorporation of glucocerebrosidase into gaucher’s disease monocytes in vitro. Proc. Natl. Acad. Sci. USA 1979, 76, 473–475. [CrossRef] 14. Tonetti, M.; Astroff, B.; Satterfield, W.; De Flora, A.; Benatti, U.; DeLoach, J.R. Construction and characterization of adriamycin- loaded canine red blood cells as a potential slow delivery system. Biotechnol. Appl. Biochem. 1990, 12, 621–629. [PubMed] 15. Moreno-Perez, D.A.; Garcia-Valiente, R.; Ibarrola, N.; Muro, A.; Patarroyo, M.A. The aotus nancymaae erythrocyte proteome and its importance for biomedical research. J. Proteom. 2017, 152, 131–137. [CrossRef] 16. Gupta, R.K.; Siber, G.R. Adjuvants for human vaccines—Current status, problems and future prospects. Vaccine 1995, 13, 1263–1276. [CrossRef] 17. Del Giudice, G.; Podda, A.; Rappuoli, R. What are the limits of adjuvanticity? Vaccine 2001, 20 (Suppl. 1), S38–S41. [CrossRef] 18. Babiuk, S.; Baca-Estrada, M.; Babiuk, L.A.; Ewen, C.; Foldvari, M. Cutaneous vaccination: The skin as an immunologically active tissue and the challenge of antigen delivery. J. Control. Release Off. J. Control. Release Soc. 2000, 66, 199–214. [CrossRef] 19. Cremel, M.; Guérin, N.; Horand, F.; Banz, A.; Godfrin, Y. Red blood cells as innovative antigen carrier to induce specific immune tolerance. Int. J. Pharm. 2013, 443, 39–49. [CrossRef] [PubMed] 20. Grimm, A.J.; Kontos, S.; Diaceri, G.; Quaglia-Thermes, X.; Hubbell, J.A. Memory of tolerance and induction of regulatory t cells by erythrocyte-targeted antigens. Sci. Rep. 2015, 5, 15907. [CrossRef] 21. Sun, X.; Han, X.; Xu, L.; Gao, M.; Xu, J.; Yang, R.; Liu, Z. Surface-engineering of red blood cells as artificial antigen presenting cells promising for cancer immunotherapy. Small 2017, 13, 1701864. [CrossRef] 22. Anselmo, A.C.; Gupta, V.; Zern, B.J.; Pan, D.; Zakrewsky, M.; Muzykantov, V.; Mitragotri, S. Delivering nanoparticles to lungs while avoiding liver and spleen through adsorption on red blood cells. ACS Nano 2013, 7, 11129–11137. [CrossRef] 23. Sahoo, K.; Koralege, R.S.H.; Flynn, N.; Koteeswaran, S.; Clark, P.; Hartson, S.; Liu, J.; Ramsey, J.D.; Pope, C.; Ranjan, A. Nanoparticle attachment to erythrocyte via the glycophorin a targeted ery1 ligand enhances binding without impacting cellular function. Pharm. Res. 2016, 33, 1191–1203. [CrossRef] 24. Glomski, C.A.; Tamburlin, J.; Hard, R.; Chainani, M. The phylogenetic odyssey of the erythrocyte. Iv. The amphibians. Histol. Histopathol. 1997, 12, 147–170. [PubMed] 25. Nombela, I.; Ortega-Villaizan, M.D.M. Nucleated red blood cells: Immune cell mediators of the antiviral response. PLoS Pathog. 2018, 14, e1006910. [CrossRef] [PubMed] 26. Dahle, M.K.; Jorgensen, J.B. Antiviral defense in salmonids—mission made possible? Fish Shellfish Immunol. 2019, 87, 421–437. [CrossRef] [PubMed] 27. Workenhe, S.T.; Kibenge, M.J.; Wright, G.M.; Wadowska, D.W.; Groman, D.B.; Kibenge, F.S. Infectious salmon anaemia virus replication and induction of alpha interferon in atlantic salmon erythrocytes. Virol. J. 2008, 5, 36. [CrossRef] 28. Nombela, I.; Puente-Marin, S.; Chico, V.; Villena, A.J.; Carracedo, B.; Ciordia, S.; Mena, M.C.; Mercado, L.; Perez, L.; Coll, J.; et al. Identification of diverse defense mechanisms in rainbow trout red blood cells in response to halted replication of vhs virus. F1000Research 2017, 6, 1958. [CrossRef] 29. Passantino, L.; Altamura, M.; Cianciotta, A.; Patruno, R.; Tafaro, A.; Jirillo, E.; Passantino, G.F. Fish immunology. I. Binding and engulfment of candida albicans by erythrocytes of rainbow trout (salmo gairdneri richardson). Immunopharmacol. Immunotoxicol. 2002, 24, 665–678. [CrossRef] 30. Puente-Marin, S.; Thwaite, R.; Mercado, L.; Coll, J.; Roher, N.; Ortega-Villaizan, M.D.M. Fish red blood cells modulate immune genes in response to bacterial inclusion bodies made of tnfalpha and a g-vhsv fragment. Front. Immunol. 2019, 10, 1055. [CrossRef] 31. Puente-Marin, S.; Nombela, I.; Chico, V.; Ciordia, S.; Mena, M.C.; Coll, J.; Mercado, L.; Ortega-Villaizan, M.D.M. Rainbow trout erythrocytes ex vivo transfection with a DNA vaccine encoding vhsv glycoprotein g induces an antiviral immune response. Front. Immunol. 2018, 9, 2477. [CrossRef] [PubMed] Int. J. Mol. Sci. 2021, 22, 11821 13 of 14 32. Dahle, M.K.; Wessel, O.; Timmerhaus, G.; Nyman, I.B.; Jorgensen, S.M.; Rimstad, E.; Krasnov, A. Transcriptome analyses of atlantic salmon (salmo salar l.) erythrocytes infected with piscine orthoreovirus (prv). Fish Shellfish Immunol. 2015, 45, 780–790. [CrossRef] [PubMed] 33. Nombela, I.; Requena-Platek, R.; Morales-Lange, B.; Chico, V.; Puente-Marin, S.; Ciordia, S.; Mena, M.C.; Coll, J.; Perez, L.; Mercado, L.; et al. Rainbow trout red blood cells exposed to viral hemorrhagic septicemia virus up-regulate antigen-processing mechanisms and MHC I&II, CD86, and CD83 antigen-presenting cell markers. Cells 2019, 8, 386. 34. Puente-Marin, S.; Nombela, I.; Ciordia, S.; Mena, M.C.; Chico, V.; Coll, J.; Ortega-Villaizan, M.D.M. In silico functional networks identified in fish nucleated red blood cells by means of transcriptomic and proteomic profiling. Genes 2018, 9, 202. [CrossRef] [PubMed] 35. Morera, D.; Roher, N.; Ribas, L.; Balasch, J.C.; Donate, C.; Callol, A.; Boltana, S.; Roberts, S.; Goetz, G.; Goetz, F.W.; et al. Rna-seq reveals an integrated immune response in nucleated erythrocytes. PLoS ONE 2011, 6, e26998. [CrossRef] 36. Rodriguez, M.F.; Wiens, G.D.; Purcell, M.K.; Palti, Y. Characterization of toll-like receptor 3 gene in rainbow trout (oncorhynchus mykiss). Immunogenetics 2005, 57, 510–519. [CrossRef] 37. Nombela, I.; Carrion, A.; Puente-Marin, S.; Chico, V.; Mercado, L.; Perez, L.; Coll, J.; Ortega-Villaizan, M.D.M. Infectious pancreatic necrosis virus triggers antiviral immune response in rainbow trout red blood cells, despite not being infective. F1000Research 2017, 6, 1968. [CrossRef] 38. Chico, V.; Salvador-Mira, M.E.; Nombela, I.; Puente-Marin, S.; Ciordia, S.; Mena, M.C.; Perez, L.; Coll, J.; Guzman, F.; Encinar, J.A.; et al. Ifit5 participates in the antiviral mechanisms of rainbow trout red blood cells. Front. Immunol. 2019, 10, 613. [CrossRef] [PubMed] 39. Puente-Marin, S.; Nombela, I.; Chico, V.; Ciordia, S.; Mena, M.C.; Perez, L.G.; Coll, J.; Ortega-Villaizan, M.D.M. Potential role of rainbow trout erythrocytes as mediators in the immune response induced by a DNA vaccine in fish. Vaccines 2019, 7, 60. [CrossRef] 40. Hall, S.S.; Mitragotri, S.; Daugherty, P.S. Identification of peptide ligands facilitating nanoparticle attachment to erythrocytes. Biotechnol. Prog. 2007, 23, 749–754. [CrossRef] [PubMed] 41. Brown, C.K.; Modzelewski, R.A.; Johnson, C.S.; Wong, M.K. A novel approach for the identification of unique tumor vasculature binding peptides using an e. Coli peptide display library. Ann. Surg. Oncol. 2000, 7, 743–749. [CrossRef] [PubMed] 42. Trepel, M.; Arap, W.; Pasqualini, R. In vivo phage display and vascular heterogeneity: Implications for targeted medicine. Curr. Opin. Chem. Biol. 2002, 6, 399–404. [CrossRef] 43. Curtidor, H.; Arévalo, G.; Vanegas, M.; Vizcaíno, C.; Patarroyo, M.A.; Forero, M.; Patarroyo, M.E. Characterization of plasmodium falciparum integral membrane protein pf25-imp and identification of its red blood cell binding sequences inhibiting merozoite invasion in vitro. Protein Sci. 2008, 17, 1494–1504. [CrossRef] [PubMed] 44. Li, J.; Wu, H.; Hong, J.; Xu, X.; Yang, H.; Wu, B.; Wang, Y.; Zhu, J.; Lai, R.; Jiang, X.; et al. Odorranalectin is a small peptide lectin with potential for drug delivery and targeting. PLoS ONE 2008, 3, e2381. [CrossRef] 45. Heerze, L.D.; Chong, P.C.; Armstrong, G.D. Investigation of the lectin-like binding domains in pertussis toxin using synthetic peptide sequences. Identification of a sialic acid binding site in the s2 subunit of the toxin. J. Biol. Chem. 1992, 267, 25810–25815. [CrossRef] 46. Tyrrell, G.J.; Peppler, M.S.; Bonnah, R.A.; Clark, C.G.; Chong, P.; Armstrong, G.D. Lectinlike properties of pertussis toxin. Infect. Immunol. 1989, 57, 1854–1857. [CrossRef] 47. Xu, X.-C.; Zhang, Z.-W.; Chen, Y.-E.; Yuan, M.; Yuan, S.; Bao, J.-K. Antiviral and antitumor activities of the lectin extracted from aspidistra elatior. Z. Nat. C 2015, 70, 7–13. [CrossRef] 48. Wang, B.; Godillot, A.P.; Madaio, M.P.; Weiner, D.B.; Williams, W.V. Vaccination against pathogenic cells by DNA inoculation. Curr. Top. Microbiol. Immunol. 1998, 226, 21–35. 49. Robinson, M.A.; Charlton, S.T.; Garnier, P.; Wang, X.T.; Davis, S.S.; Perkins, A.C.; Frier, M.; Duncan, R.; Savage, T.J.; Wyatt, D.A.; et al. Leapt: Lectin-directed enzyme-activated prodrug therapy. Proc. Natl. Acad. Sci. USA 2004, 101, 14527–14532. [CrossRef] 50. Brown, G.D.; Gordon, S. Immune recognition. A new receptor for beta-glucans. Nature 2001, 413, 36–37. [CrossRef] [PubMed] 51. Yang, J.; Luo, Y.; Shibu, M.A.; Toth, I.; Skwarczynskia, M. Cell-penetrating peptides: Efficient vectors for vaccine delivery. Curr. Drug Deliv. 2019, 16, 430–443. [CrossRef] [PubMed] 52. Sajja, R.K.; Cudic, P.; Cucullo, L. In vitro characterization of odorranalectin for peptide-based drug delivery across the blood–brain barrier. BMC Neurosci. 2019, 20, 22. [CrossRef] 53. Rashidian, G.; Moosazadeh Moghaddam, M.; Mirnejad, R.; Mohammadi Azad, Z. Supplementation of zebrafish (danio rerio) diet using a short antimicrobial peptide: Evaluation of growth performance, immunomodulatory function, antioxidant activity, and disease resistance. Fish Shellfish Immunol. 2021, 119, 42–50. [CrossRef] [PubMed] 54. Traub, S.; von Aulock, S.; Hartung, T.; Hermann, C. Mdp and other muropeptides–direct and synergistic effects on the immune system. J. Endotoxin Res. 2006, 12, 69–85. [CrossRef] 55. Ogawa, C.; Liu, Y.J.; Kobayashi, K.S. Muramyl dipeptide and its derivatives: Peptide adjuvant in immunological disorders and cancer therapy. Curr. Bioact. Compd. 2011, 7, 180–197. [CrossRef] [PubMed] 56. Yoo, Y.C.; Yoshimatsu, K.; Koike, Y.; Hatsuse, R.; Yamanishi, K.; Tanishita, O.; Arikawa, J.; Azuma, I. Adjuvant activity of muramyl dipeptide derivatives to enhance immunogenicity of a hantavirus-inactivated vaccine. Vaccine 1998, 16, 216–224. [CrossRef] Int. J. Mol. Sci. 2021, 22, 11821 14 of 14 57. Patel, A.; Dong, J.C.; Trost, B.; Richardson, J.S.; Tohme, S.; Babiuk, S.; Kusalik, A.; Kung, S.K.; Kobinger, G.P. Pentamers not found in the universal proteome can enhance antigen specific immune responses and adjuvant vaccines. PLoS ONE 2012, 7, e43802. [CrossRef] 58. Reyna-Margarita, H.R.; Irais, C.M.; Mario-Alberto, R.G.; Agustina, R.M.; Luis-Benjamin, S.G.; David, P.E. Plant phenolics and lectins as vaccine adjuvants. Curr. Pharm. Biotechnol. 2019, 20, 1236–1243. [CrossRef] 59. Unitt, J.; Hornigold, D. Plant lectins are novel toll-like receptor agonists. Biochem. Pharmacol. 2011, 81, 1324–1328. [CrossRef] 60. Wang, M.; Chen, Y.; Zhang, Y.; Zhang, L.; Lu, X.; Chen, Z. Mannan-binding lectin directly interacts with toll-like receptor 4 and suppresses lipopolysaccharide-induced inflammatory cytokine secretion from thp-1 cells. Cell. Mol. Immunol. 2011, 8, 265–275. [CrossRef] 61. Gun, S.Y.; Claser, C.; Tan, K.S.W.; Rénia, L. Interferons and interferon regulatory factors in malaria. Mediat. Inflamm. 2014, 2014, 243713. [CrossRef] [PubMed] 62. Luna, O.; Gomez, J.; Cárdenas, C.; Albericio, F.; Marshall, S.; Guzmán, F. Deprotection reagents in fmoc solid phase peptide synthesis: Moving away from piperidine? Molecules 2016, 21, 1542. [CrossRef] 63. Guzmán, F.; Gauna, A.; Luna, O.; Román, T.; Álvarez, C.; Albericio, F.; Cárdenas, C. The tea-bag protocol for comparison of fmoc removal reagents in solid-phase peptide synthesis. Amino Acids 2020, 52, 1201–1205. [CrossRef] 64. Cárdenas, C.; Guzmán, F.; Carmona, M.; Muñoz, C.; Nilo, L.; Labra, A.; Marshall, S.H. Synthetic peptides as a promising alternative to control viral infections in atlantic salmon. Pathogens 2020, 9, 600. [CrossRef] [PubMed] 65. Chico, V.; Gomez, N.; Estepa, A.; Perez, L. Rapid detection and quantitation of viral hemorrhagic septicemia virus in experimen- tally challenged rainbow trout by real-time rt-pcr. J. Virol. Methods 2006, 132, 154–159. [CrossRef] 66. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-delta delta c(t)) method. Methods 2001, 25, 402–408. [CrossRef] 67. Raida, M.K.; Buchmann, K. Temperature-dependent expression of immune-relevant genes in rainbow trout following yersinia ruckeri vaccination. Dis. Aquat. Org. 2007, 77, 41–52. [CrossRef] [PubMed] 68. Ortega-Villaizan, M.; Chico, V.; Martinez-Lopez, A.; Falco, A.; Perez, L.; Coll, J.M.; Estepa, A. In vitro analysis of the factors contributing to the antiviral state induced by a plasmid encoding the viral haemorrhagic septicaemia virus glycoprotein g in transfected trout cells. Vaccine 2011, 29, 737–743. [CrossRef]