RESEARCH ARTICLE Control of protein synthesis and memory by GluN3A-­NMDA receptors through inhibition of GIT1/mTORC1 assembly María J Conde-­Dusman1,2,3†, Partha N Dey2,4†, Óscar Elía-­Zudaire1†, Luis G Rabaneda1,2,5, Carmen García-­Lira1, Teddy Grand6, Victor Briz7, Eric R Velasco8, Raül Andero9,10,11, Sergio Niñerola1, Angel Barco1, Pierre Paoletti6, John F Wesseling1, Fabrizio Gardoni12, Steven J Tavalin13, Isabel Perez-­Otaño1,2*† 1 lnstituto de Neurociencias (UMH-­CSIC), Alicante, Spain; 2Centro de Investigación Médica Aplicada (CIMA), University of Navarra, Pamplona, Spain; 3Centre for Developmental Neurobiology, Institute of Psychiatry, King’s College London, London, United Kingdom; 4National Eye Institute, National Institutes of Health, Bethesda, United States; 5Institute of Science and Technology Austria, Klosterneuburg, Austria; 6Institut de Biologie de l’Ecole Normale Supérieure/CNRS/ INSERM, Paris, France; 7Centro de Biología Molecular Severo Ochoa (UAM-­CSIC), Madrid, Spain; 8Institut de Neurociències, Universitat Autònoma de Barcelona, Bellaterra, Spain; 9Institut de Neurociències, Departament de Psicobiologia i de Metodologia de les Ciències de la Salut, Unitat de Neurociència Traslacional, Parc Taulí Hospital Universitari, Institut d’Investigació i Innovació Parc Taulí (I3PT), Universitat Autònoma de Barcelona, Bellaterra, Spain; 10Centro de Investigación Biomédica en Red de Salud Mental (CIBERSAM), Instituto de Salud Carlos III, Madrid, Spain; 11ICREA, Barcelona, Spain; 12Department of Pharmacological *For correspondence: and Biomolecular Sciences, University of Milan, Milan, Italy; 13Department of ​otano@​umh.​es † Pharmacology, Addiction Science, and Toxicology, University of Tennessee Health These authors contributed equally to this work Science Center, Memphis, United States Competing interest: The authors declare that no competing interests exist. Abstract De novo protein synthesis is required for synapse modifications underlying stable Funding: See page 24 memory encoding. Yet neurons are highly compartmentalized cells and how protein synthesis can Received: 23 June 2021 be regulated at the synapse level is unknown. Here, we characterize neuronal signaling complexes Preprinted: 05 September 2021 formed by the postsynaptic scaffold GIT1, the mechanistic target of rapamycin (mTOR) kinase, and Accepted: 13 October 2021 Raptor that couple synaptic stimuli to mTOR-­dependent protein synthesis; and identify NMDA Published: 17 November 2021 receptors containing GluN3A subunits as key negative regulators of GIT1 binding to mTOR. Disrup- Reviewing Editor: Mary B tion of GIT1/mTOR complexes by enhancing GluN3A expression or silencing GIT1 inhibits synaptic Kennedy, California Institute of mTOR activation and restricts the mTOR-­dependent translation of specific activity-­regulated Technology, United States mRNAs. Conversely, GluN3A removal enables complex formation, potentiates mTOR-­dependent ‍ ‍Copyright Conde-­Dusman protein synthesis, and facilitates the consolidation of associative and spatial memories in mice. et al. This article is distributed The memory enhancement becomes evident with light or spaced training, can be achieved by under the terms of the Creative selectively deleting GluN3A from excitatory neurons during adulthood, and does not compromise Commons Attribution License, other aspects of cognition such as memory flexibility or extinction. Our findings provide mecha- which permits unrestricted use and redistribution provided that nistic insight into synaptic translational control and reveal a potentially selective target for cognitive the original author and source enhancement. are credited. Conde-­Dusman, Dey, et al. eLife 2021;10:e71575. DOI: https://​doi.​org/​10.​7554/​eLife.​71575  1 of 29 Research article Cell Biology Introduction Memories are thought to be encoded through formation and modification of the synaptic connec- tions between neurons. Lasting memory encoding requires de novo mRNA and protein synthesis in response to neuronal activity and sensory experience. It entails the transcription of immediate-­early genes (IEGs) to mRNA, and the protein products of some IEG transcripts mediate structural and functional modifications of synapses (Yap and Greenberg, 2018). However, transcription occurs in the cell body and generates a neuron-­wide pool of mRNAs, whereas only a fraction of synapses of any individual neuron are modified by a given memory (Holtmaat and Caroni, 2016; Josselyn and Tonegawa, 2020). To ensure input specificity, transcription is coupled to local mechanisms that restrict the effects of activity-­induced gene products to selected synapses (Wang et al., 2010). One of these mechanisms is thought to be the local, synapse-­specific translation of mRNA into protein (Holt et al., 2019; Klann and Dever, 2004; Sossin and Costa-­Mattioli, 2019). The main rate-­limiting step in translation is initiation, which is regulated by the phosphorylation of two separate proteins: the eukaryotic initiation factor 2α (eIF2α) and the mTOR (‘mechanistic target of rapamycin’) serine/threonine kinase. Manipulations of eIF2α phosphorylation have been implicated in synapse plasticity and memory (Costa-­Mattioli et al., 2007; Sharma et al., 2020; Shrestha et al., 2020b), but evidence for a role in local translation is lacking. mTOR could in principle afford more selective trans- lational control. mTOR forms at least two distinct multiprotein complexes, mTORC1 and mTORC2. mTORC1 is defined by the presence of Raptor, an adaptor protein which recruits mTOR substrates to promote the translation of specific mRNAs, and compartmentalized activation has been shown to be essential for mTORC1 responses to nutrients in nonneuronal cells (Liu and Sabatini, 2020). In neurons, components of mTORC1 localize to axons, dendrites, and synapses (Poulopoulos et al., 2019; Takei et al., 2004; Tang et al., 2002), and pharmacological inhibition of mTORC1 with rapa- mycin blocks long-­lasting synaptic plasticity and memory formation (Cammalleri et al., 2003; Hou and Klann, 2004; Stoica et al., 2011; Tang et al., 2002). Moreover, dysregulated translation is a feature in diseases of cognition, from autism to intellectual disability, and many of the mutations asso- ciated with these diseases affect genes encoding negative regulators of mTORC1 (Costa-­Mattioli and Monteggia, 2013; Lipton and Sahin, 2014). However, it is currently unclear how mTOR activation might be controlled at specific synapses and linked to mechanisms that gate learning and memory. The most intensively studied mechanism gating learning and memory involves the NMDA-­type glutamate receptor (NMDAR). NMDARs contain multiple subunits, including an obligatory GluN1 subunit, various GluN2 (A–D) and, for some subtypes, one of the GluN3 (A–B) subunits (Paoletti et al., 2013). Conventional subtypes containing GluN1 and GluN2 trigger gene expression programs that mediate the strengthening and stabilization of active synapses and the persistent storage of information (Lyons and West, 2011). By contrast, nonconventional subtypes containing the GluN3A subunit (GluN3A-­NMDARs) inhibit many of these synaptic modifications (Pérez-­Otaño et al., 2016). Synapses that express GluN3A are resistant to the induction of long-­lasting functional and struc- tural plasticity, and memories fade more quickly in mutant mice with enhanced GluN3A expression (Kehoe et al., 2014; Roberts et al., 2009). In line with this work in mice, human genetic studies correlate enhanced cognitive performance with low GluN3A levels or variations in GRIN3A (human gene encoding GluN3A) (Gallinat et al., 2007; Papenberg et al., 2014; Sadat-­Shirazi et al., 2019); and GluN3A dysregulation in humans is linked to cognitive impairment in schizophrenia (Greenwood et al., 2019; Mueller and Meador-­Woodruff, 2004; Ohi et al., 2015; Takata et al., 2013), Hunting- ton’s disease (Marco et al., 2013; Marco et al., 2018), addiction, and other pathologies (Huang et al., 2017; Pérez-­Otaño et al., 2016; Sarker et al., 2019; Yang et al., 2015; Yuan et al., 2013). We reasoned that understanding the underlying mechanisms would yield insight into the brain processes that constrain long-­term memory formation and might uncover targets for therapeutic intervention. Here, we report that GluN3A-­NMDARs selectively and negatively regulate synaptic mTORC1-­ dependent translation without affecting neuron-­wide transcriptional activation. The negative regu- lation is mediated by inhibition of the assembly of mTOR complexes that contain the postsynaptic adaptor GIT1 (G-­protein-­coupled receptor kinase-­interacting protein) and Raptor. GIT1/mTORC1 complexes are located at or near synaptic sites, and couple mTORC1 kinase activity to synaptic stim- ulation. Through biochemical, mouse genetics, and behavioral approaches, we further show that GluN3A deletion increases the availability of GIT1/mTORC1 complexes, boosts mTORC1-­dependent protein synthesis, and facilitates long-­term memory formation. The advantage is selectively evident Conde-­Dusman, Dey, et al. eLife 2021;10:e71575. DOI: https://​doi.​org/​10.​7554/​eLife.​71575  2 of 29 Research article Cell Biology when mice are subjected to weak training behavioral paradigms; can be reversed by the mTORC1 inhibitor rapamycin; and unlike the memory enhancement seen after manipulations of general trans- lational regulators, is not associated with deficits in memory flexibility or extinction (Shrestha et al., 2020a). Our findings identify a novel regulatory mechanism whereby GluN3A/GIT1 interactions set local modes of protein synthesis and gate memory formation, and reveal a potentially selective target for correcting cognitive impairment in pathological contexts. Results Selective inhibition of activity-dependent gene expression by GluN3A at the post-transcriptional level GluN3A expression is pervasive during postnatal brain development, and regulated removal allows for the activity-­dependent stabilization or elimination of excess synapses (Pérez-­Otaño et al., 2016). To assess whether GluN3A-­NMDARs modulate activity-­dependent gene expression, we expressed GluN3A in cultured cortical neurons over the stage when endogenous downregulation normally occurs (days in vitro [DIV] 9–14, ~ postnatal days P8–P16 in vivo, Figure 1A; Figure 1—figure supple- ment 1; Kehoe et al., 2014). We used lentiviral vectors where expression is targeted to neurons by the synapsin 1 promoter and induced synaptic activity with bicuculline, which inhibits ɣ-aminobutyric acid (GABA) transmission and triggers bursts of action potential firing (Hardingham et al., 2002). As expected, bicuculline induced a robust expression of IEGs implicated in the consolidation of synaptic modifications and memories, including Arc, Fos, and Zif268/Egr1 (Flavell and Green- berg, 2008; Figure 1B). Enhancing GluN3A expression largely reduced the induction of Arc and Fos proteins while Zif268 induction was unaffected, indicating that GluN3A selectively inhibits specific activity-­dependent signaling pathways (Figure 1B). Analysis at the mRNA level demonstrated that modulation occurs downstream of gene transcription: Arc, Fos, and Zif268 mRNA levels were strongly induced by bicuculline in both control and GluN3A-­ infected neurons, and no differences were observed in the time-­courses or magnitude of induction (Figure 1C). Unchanged transcription was in-­line with intact activation of the phosphorylation of extracellular signal-­regulated kinase (ERK1/2) and CREB (Figure 1—figure supplement 1B), the two major pathways for activity-­dependent tran- scription (Flavell and Greenberg, 2008). By contrast, the general NMDAR antagonist D-2-­amino-­5-­ phosphonovaleric acid (APV) inhibited all signaling pathways analyzed and the induction of IEGs at both mRNA and protein levels (Figure 1—figure supplement 1C, D). An analogous dissociation between protein and transcript levels of a subset of IEGs was observed when GluN3A-­ infected neurons were stimulated with the neurotrophin BDNF (Figure 1—figure supplement 1E, F), a potent inducer of gene expression at both transcriptional and translational levels (Rao et al., 2006). Whole transcriptome RNAseq analyses confirmed that transcriptional responses to bicuculline or BDNF were unaffected by GluN3A expression (Figure 1D; Figure 1—figure supple- ment 2). Together these results indicated that GluN3A-­NMDARs repress the translation of specific activity-­regulated mRNAs without affecting global transcriptional programs of gene expression. Inhib- ited induction of IEGs by GluN3A was not rescued by pretreatment with the proteasome inhibitor MG-­132 (Figure 1E), ruling out alternative mechanisms such as enhanced proteasome-­dependent degradation (Rao et al., 2006). GluN3A inhibits mTORC1-dependent translation of IEGs We thus turned to protein synthesis pathways to search for mechanisms underlying the selective inhibition of gene expression by GluN3A. We focused on mTORC1 because it has been shown to couple synaptic signals including BDNF and NMDAR activation to translation of specific mRNAs in dendrites and synapses (Takei et al., 2004; Tang et al., 2002). mTORC1 signaling was strongly acti- vated by bicuculline in DIV14 cortical neurons, as shown by phosphorylation of mTOR on Ser2448 (a reliable readout of mTORC1 kinase activity; see Chiang and Abraham, 2005) and of its downstream effectors, the p70-­kDa ribosomal protein S6 kinase (S6K, Thr389) and the ribosomal protein S6 (Ser240–4, Figure 2A and B). The effects were blocked by APV and the NMDAR open-­channel blocker MK-­801, confirming NMDAR dependence in our model (Figure 2—figure supplement 1). The phosphorylation of mTOR, S6K, and S6 following bicuculline treatment was significantly reduced in GluN3A-­infected neurons, indicating that GluN3A interferes with synaptic mTORC1 activation Conde-­Dusman, Dey, et al. eLife 2021;10:e71575. DOI: https://​doi.​org/​10.​7554/​eLife.​71575  3 of 29 Research article Cell Biology A B C GFP GFP-GluN3A Fold induction (mRNA) 140 Arc Fos Zif268 *** Protein levels (%) 120 *** 80 15 endogenous Bic 1 h - - + + - - + + 100 GluN3A IB: GluN3A 100 60 80 80 10 GluN1 60 40 0 3 6 9 12 15 18-21 Arc 40 40 5 Fos 20 GFP infection 20 GFP-GluN3A synP GluN3A synP EGFP Zif 268 0 0 0 0 tubulin Arc Fos Zif268 0 30 60 0 30 60 0 30 60 synP EGFP Bic (min) Bic (min) Bic (min) GFP GFP-GluN3A D Bicuculline 1 h BDNF 1 h E GFP- GFP GFP-GluN3A GFP GFP-GluN3A GFP GluN3A 300 300 300 300 BDNF 1 h - + + - + + -Log10(padj) Arc Arc 200 200 Arc 200 Arc 200 MG132 1 h - - + - - + IB: GluN3A 100 Zif268 100 100 100 Arc Zif268 Fos Zif268 Zif268 Fos Fos Fos Zif268 0 0 0 0 -2.5 0.0 2.5 5.0 7.5 -2.5 0.0 2.5 5.0 7.5 -2.5 0.0 2.5 5.0 7.5 -2.5 0.0 2.5 5.0 7.5 actin Log2(Fold Change) Log2(Fold Change) Log2(Fold Change) Log2(Fold Change) Figure 1. GluN3A inhibits the activity-­dependent induction of a subset of immediate-­early genes (IEGs). (A) Timeline of endogenous GluN3A expression and downregulation and of lentiviral infections. Rat cortical neurons in primary culture were infected on days in vitro (DIV) 9 with lentiviruses where Green fluorescent protein (GFP) or GluN3A and GFP (GFP-­GluN3A) expression is driven by the human synapsin 1 promoter (synP). (B, C) DIV14 neurons were treated with bicuculline (50 μM, 1 hr) and matching samples collected for immunoblot and mRNA analyses (n = 4 from two independent cultures; ***p < 0.001, two-­tailed unpaired t-­test). (B) Left, representative western blots show that GluN3A inhibits the induction of the IEGs Arc and Fos but not Zif268. Right, signal intensities of indicated proteins as percentage of stimulated GFP-­infected neurons. (C) quantitative Reverse Transcription-­ Polymerase Chain Reaction (qRT-­PCR) analysis of IEG mRNA induction. Plotted values are fold-­induction relative to non-­stimulated neurons. (D) Volcano plots presenting the RNAseq-­based differential expression analysis in DIV14 neurons treated with bicuculline or Brain-­derived neurotrophic factor (BDNF) for 1 hr (n = 2–4 from two independent cultures). (E) DIV14 neurons were treated with MG132 (30 μM). A representative western blot probed with the indicated antibodies is shown. In immunoblot analyses, tubulin or actin was used as a loading control and GluN1 as a measure of potential effects of GluN3A on overall NMDAR numbers. Histograms in this and subsequent figures are mean ± standard error of the mean (SEM). The online version of this article includes the following figure supplement(s) for figure 1: Source data 1. Western blots for immediate-­early gene (IEG) induction in GFP and GFP-­GluN3A-­infected neurons after bicuculline treatment. Source data 2. Western blots for bicuculline induction of immediate-­early genes (IEGs) in GFP and GFP-­GluN3A-­infected neurons in the presence of MG132. Figure supplement 1. Selective versus global effects of GluN3A expression and general NMDAR blockade on activity-­dependent signaling. Figure supplement 1—source data 1. Annotated western blots and original scans. Figure supplement 1—source data 2. Annotated western blots and original scans. Figure supplement 1—source data 3. Annotated western blots and original scans. Figure supplement 1—source data 4. Annotated western blots and original scans. Figure supplement 2. RNAseq analysis of activity-­dependent gene expression. (Figure 2B). Two experiments linked mTORC1 inhibition to the altered production of IEGs. First, low concentrations of rapamycin (100 nM) that inhibit mTORC1 but not mTORC2 (Zhu et al., 2018), blocked Arc and Fos translation in response to bicuculline without affecting Zif268, demonstrating selective mTORC1 dependence (Figure 2C). By contrast, the general protein synthesis inhibitor aniso- mycin fully suppressed Arc, Fos, and Zif268 induction (Figure 2—figure supplement 1B). Second, restoring mTORC1 signaling in GluN3A-­infected neurons by expressing a constitutively active form of Rheb, the main upstream activator of mTORC1, was sufficient to normalize IEG induction (Figure 2D). Conversely, lentiviral knockdown of GluN3A in cortical neurons with a validated short hairpin RNA (Kehoe et al., 2014) enhanced mTORC1 activity (Figure 3A and B) and potentiated the induction of Arc and Fos by bicuculline or BDNF (Figure 3C and D). Increased phosphorylation of S6K and S6 was additionally detected in hippocampal lysates from mice lacking GluN3A (Grin3a−/−) relative to wild-­type littermates (Figure 3E), confirming a role of GluN3A in limiting mTORC1 signaling in vivo. Conde-­Dusman, Dey, et al. eLife 2021;10:e71575. DOI: https://​doi.​org/​10.​7554/​eLife.​71575  4 of 29 Research article Cell Biology A B Untreated Bic 1h GTP GFP-GluN3A - + - - + + 4 * 50 * GFP GFP-GluN3A (normalized to total) Rheb IB: GluN3A 3 40 Fold induction P pmTOR *** rapamycin mTOR 30 mTORC1 2 pS6K 20 P S6K S6K 1 pS6 10 P S6 S6 0 0 tubulin pmTOR pS6K pS6 (Ser2448) (Thr389) (Ser240-4) Rapamycin 100 *** C control 100 nM Control 80 Bic 1h - - + + - - + + Rapamycin 100 nM Fold induction IB: pS6 60 Arc * 40 Fos Zif268 20 GluN1 0 Arc Fos Zif268 D Untreated Bic 1h GFP GFP-GluN3A - - - - + + + + 20 *** *** 250 *** GFP-GluN3A caRheb - - - - - - + + 200 GFP-GluN3A + caRheb 15 Fold induction IB: GluN3A 150 *** GluN1 10 * 100 Rheb 5 pS6 50 Arc 0 0 pS6 Arc Figure 2. GluN3A inhibits the activation of mTORC1 signaling by synaptic stimuli. (A) Schematic of the mTORC1 signaling pathway. (B) Left, representative western blots of primary rat cortical neurons infected with GFP and GFP-­GluN3A (days in vitro [DIV] 9) and treated with bicuculline at DIV14. Right, fold-­induction of phosphorylated mTOR, S6 kinase (S6K), and S6 normalized to total protein (n = 6–8 from three to four independent cultures; *p < 0.05, ***p < 0.001, two-­tailed paired t-­test). (C) mTOR is required for activity-­dependent induction of Arc and Fos but not Zif268. Left, representative western blots of DIV14 neurons stimulated with bicuculline after preincubation with rapamycin (100 nM, 1 hr before and during bicuculline treatment). Right, fold-­induction of immediate-­early genes (IEGs) in response to bicuculline (n = 4 from two independent cultures; *p < 0.05, ***p < 0.001, two-­tailed paired t-­test). (D) Reactivation of mTOR in GFP-­GluN3A-­infected neurons by adeno-­associated virus (AAV) driven constitutively active Rheb (caRheb) rescues Arc induction. Left, representative western blots of neurons infected with lentiviral GFP-­GluN3A and AAV-­caRheb and treated with bicuculline. Right, fold-­induction by bicuculline of pS6 and Arc in the indicated conditions (n = 4 from two independent cultures; ***p < 0.001, one-­way analysis of variance [ANOVA] followed by Tukey’s test). The online version of this article includes the following figure supplement(s) for figure 2: Source data 1. Western blots for mTOR and downstream effector phosphorylation in GFP and GFP-­GluN3A-­ infected cortical neurons after bicuculline treatment. Source data 2. Western blots for rapamycin dependence of immediate-­early gene (IEG) induction in DIV14 cortical neurons by bicuculline treatment. Source data 3. Western blots for S6 phosphorylation and Arc induction by bicuculline in GFP and GFP-­GluN3A-­ infected cortical neurons in the presence of caRheb. Figure supplement 1. General inhibition of the activity induction of immediate-­early genes (IEGs) by anisomycin. Figure supplement 1—source data 1. Annotated western blots and original scans. Figure supplement 1—source data 2. Annotated western blots and original scan. mTORC1 inhibition requires GluN3A C-terminal domain interactions GluN3A subunits confer unique biophysical properties to NMDARs, including reduced channel conductance and calcium permeability, and enable distinct interactions with signaling/scaffolding proteins via their intracellular C-­terminal tail (Pérez-­Otaño et al., 2016). To dissect their contribu- tion to inhibited mTORC1 signaling, we derived primary cortical neurons from Grin3a−/− mice and reexpressed full-­length GluN3A, a mutant where the distal 33 amino acids of the GluN3A C-­terminus Conde-­Dusman, Dey, et al. eLife 2021;10:e71575. DOI: https://​doi.​org/​10.​7554/​eLife.​71575  5 of 29 Research article Cell Biology A B sh3A - + 1.5 ** * (normalized to total) Basal protein levels IB: GluN3A endogenous GluN1 1.0 GluN3A pS6K 0 3 6 9 12 15 18-21 S6K 0.5 GFP pS6 GFP-sh3A LV-sh3A infection S6 0.0 pS6K pS6 C D 300 *** Bic 1h - + - + - - - - * ** - + - + Protein levels (%) BDNF 1h - - - - * sh3A - - + + - - + + 200 IB: GluN3A GluN1 100 GFP Arc GFP-sh3A Fos 0 Arc Fos Arc Fos Bic 1 h BDNF 1 h E P8 ** P16 ** Grin3a Grin3a 3 IB: WT -/- (normalized to total) * WT -/- (normalized to total) 2 IB: GluN3A GluN3A * Protein levels Protein levels 2 pS6K pS6K S6K 1 S6K 1 WT pS6 pS6 Grin3a -/- S6 S6 tubulin 0 tubulin 0 pS6K pS6 pS6K pS6 Figure 3. GluN3A deletion potentiates synaptic mTORC1 signaling. (A) Primary rat cortical neurons were infected on days in vitro (DIV) 3 with lentiviruses expressing GFP alone or along with a small hairpin RNA (shRNA) against GluN3A (GFP-­sh3A) and collected at DIV7–9, when GluN3A expression is maximal. (B) Representative blots and quantification of phosphorylated S6 kinase (S6K) and S6 normalized to total protein (n = 6–8 from three to four independent cultures; *p < 0.05, **p < 0.01 two-­tailed paired t-­test). Arrow marks specific GluN3A band. (C, D) Representative western blots and quantification of immediate-­early gene (IEG) induction by bicuculline or BDNF (n = 6–12 from three independent cultures; *p < 0.05, **p < 0.01, ***p < 0.001, two-­tailed paired t-­test). Data plotted as percentage of stimulated control GFP-­infected neurons. (E) Immunoblots and quantification of S6K and S6 phosphorylation in lysates from wild-­type (WT) and Grin3a−/− hippocampi (n = 4–8 mice; *p < 0.05, **p < 0.01, two-­tailed unpaired t-­test). The online version of this article includes the following figure supplement(s) for figure 3: Source data 1. Western blots for S6 kinase (S6K) and S6 phosphorylation in control and sh3A-­infected days in vitro (DIV) 7 cortical neurons. Source data 2. Western blots for Arc and Fos induction by bicuculline and BDNF in control and sh3A-­infected days in vitro (DIV) 7 cortical neurons. Source data 3. Western blots for S6 kinase (S6K) and S6 phosphorylation in lysates from P8 and P16 wild-­type and Grin3a−/− hippocampi. have been deleted and lacks synapse destabilizing activity (GluN3A1082∆) (Fiuza et al., 2013; Kehoe et al., 2014), or GFP as a control (Figure 4A). While full-­length GluN3A rescued the enhanced mTOR activation and hyperinduction of Arc and Fos proteins by bicuculline or BDNF in Grin3a−/− cultures, the GluN3A1082∆ mutant failed to do so (Figure 4B–E). Neither GluN3A nor GluN3A1082∆ modified the activation of other signaling pathways such as ERK1/2 phosphorylation or the induction of Zif268 in Grin3a−/− neurons (Figure 4D). Since GluN3A and GluN3A1082∆ display similar distributions and cell surface targeting (Fiuza et al., 2013), the differences we observed are unlikely to stem from altered subcellular localization. We evaluated whether the deletion alters ion fluxes via GluN3A-­NMDARs by analyzing electrophys- iological responses to glutamate of GluN3A and GluN3A1082∆ when coexpressed with GluN1 and GluN2A in HEK293 cells. The relative calcium permeability was estimated by measuring the shift in reversal potential (∆Erev) of recombinant NMDAR currents induced by changing extracellular Ca2+ (Perez-­Otano et al., 2001). GluN3A and GluN3A1082∆ yielded similarly reduced shifts in ∆Erev relative Conde-­Dusman, Dey, et al. eLife 2021;10:e71575. DOI: https://​doi.​org/​10.​7554/​eLife.​71575  6 of 29 Research article Cell Biology A Grin3a-/- neurons M4 synP GluN3A synP EGFP GFP-GluN3A endogenous M4 GluN3A synP GluN3A synP EGFP GFP-GluN3A 1082∆ 0 3 6 9 12 15 infection aa 1082-1115 B GluN3A GFP GluN3A 1082 C 200 4 * ** Bic 1h - + - + - + ** *** 150 ** ** Protein levels (%) IB: GluN3A 3 Fold induction GluN1 2 100 pS6 S6 1 50 Arc Fos 0 0 pS6 Arc Fos GluN3A D GFP GluN3A 1082 E BDNF 1h - + - + - + 4 200 ** ** ** * ** *** IB: GluN3A 3 150 Protein levels (%) GluN1 Fold induction pS6 2 100 S6 pErk1/2 1 50 Erk1/2 Arc 0 0 Fos pS6 Arc Fos Zif268 GFP GFP-GluN3A GFP-GluN3A1082 Figure 4. mTORC1 inhibition is mediated by GluN3A C-­terminal domain interactions. (A) Cortical neurons from Grin3a−/− mice were infected on days in vitro (DIV) 6 with lentiviruses expressing GFP, GFP-­GluN3A, or GFP-­ GluN3A1082∆, and stimulated with bicuculline or BDNF at DIV12. (B, D) Representative western blots of lysates from bicuculline or BDNF-­treated neurons probed for the indicated antibodies. (C, E) Induction of phosphorylated S6 (normalized to total levels), Arc and Fos by bicuculline or BDNF (n = 3–7 from two to four independent cultures, *p < 0.05, **p < 0.01, ***p < 0.001 analysis of variance [ANOVA] followed by Tukey’s test). The online version of this article includes the following figure supplement(s) for figure 4: Source data 1. Western blots for mechanistic target of rapamycin (mTOR) effector phosphorylation and Arc and Fos induction in GFP, GFP-­GluN3A, and GFP-­GluN3A1082Δ-infected cortical neurons after bicuculline treatment. Source data 2. Western blots for mechanistic target of rapamycin (mTOR) effector phosphorylation and Arc and Fos induction in GFP, GFP-­GluN3A, and GFP-­GluN3A1082Δ-infected cortical neurons after BDNF treatment. Figure supplement 1. Electrophysiological properties of recombinant NMDA and excitatory glycine receptors containing full-­length or truncated GluN3A. to conventional GluN1/GluN2A NMDARs, confirming that the mutant incorporated into functional triheteromeric GluN3A-­NMDARs and arguing against differences in Ca2+ permeability (Figure 4— figure supplement 1). In addition, both GluN3A versions drove comparable reductions in current densities relative to conventional NMDARs (Figure 4—figure supplement 1B). Along with noncon- ventional NMDARs, GluN3A subunits can form glycine-­gated diheteromeric GluN1/GluN3 receptors (Pérez-­Otaño et al., 2016). Thus, we additionally examined whether the deletion modified responses to glycine of GluN1/GluN3 receptors taking advantage of the CGP-­78608 compound (Grand et al., 2018), but no differences were found (Figure 4—figure supplement 1C). The absence of ionotropic differences favored the hypothesis that the inhibition of mTOR signaling requires metabotropic inter- actions of GluN3A-­NMDARs, possibly modulating its association with synaptic adaptors or scaffolds. Conde-­Dusman, Dey, et al. eLife 2021;10:e71575. DOI: https://​doi.​org/​10.​7554/​eLife.​71575  7 of 29 Research article Cell Biology GluN3A expression modulates the assembly of synaptic GIT1/mTORC1 complexes A leading candidate is the multifunctional adaptor GIT1. GIT1 is enriched in postsynaptic compart- ments and binds the 33 amino acids of the GluN3A C-­terminus that we show above are required for mTORC1 inhibition (Fiuza et al., 2013). Although best known for its role in actin signaling (Zhang et al., 2003), GIT1 has been detected in mTOR immunoprecipitates from mouse astrocytes by mass spectrometry (Smithson and Gutmann, 2016) though a function for this association could not be established. Using reciprocal immunoprecipitation with GIT1 and mTOR antibodies, we isolated GIT1/ mTOR complexes from lysates of microdissected hippocampal (Figure 5A) and cortical (not shown) tissue. We chose detergent conditions that preserve mTOR interactions with Raptor and Rictor (0.3 % CHAPS) to further characterize the composition of the complex, and were able to identify Raptor (but not the mTORC2 component Rictor) in GIT1 immunoprecipitates. The mTOR antibody pulled down both, validating our assay conditions (Figure 5A). The GIT1-­binding protein and Rac1 activator βPIX was also pulled down by the mTOR antibody while the control presynaptic protein synaptophysin was not (Figure 5A). We additionally detected phosphorylated mTOR at Ser2448 in GIT1 immunoprecipi- tates, demonstrating GIT1/mTORC1 complex functionality (Figure 5B). We then examined the subcellular localization of GIT1/mTORC1 complexes using in situ prox- imity ligation assay (PLA) with antibodies against GIT1 and mTOR. PLA puncta were present along dendritic shafts often localized within or at the base of dendritic spines (Figure 5C), suggesting that GIT1 positions mTORC1 near synaptic sites to mediate dendritic translation in response to synaptic signals. To test this, we stimulated cortical neurons with bicuculline or BDNF and quantified mTOR phosphorylation in total lysates and GIT1 immunoprecipitates. Both bicuculline and BDNF induced large increases in the phosphorylation of GIT1-­bound mTOR on Ser2448 (Figure 5D and E). Importantly, the phosphorylation of GIT1-­bound mTOR was much higher than phosphorylation of the total cellular mTOR pool (BDNF: 1.98 ± 0.38- fold increase in total lysates vs. 4.2 ± 1.15 in GIT1 immunoprecipates; bicuculline: 1.42 ± 0.15 vs. 4.63 ± 1.24), consistent with a role for GIT1 in nucleating synaptic mTORC1 activation. Further evidence came from GIT1 loss-­of-­function experiments. Lentiviral knockdown of GIT1 blunted the activation of mTORC1 by BDNF, as shown by reduced phosphorylation of S6 and S6K (Figure 5F and G), and inhibited mTORC1-­dependent protein synthesis assessed using a nonra- dioactive puromycin-­labeling assay (SUnSET) (Figure 5H). Arc translation was also reduced, as judged by loss of rapamycin sensitivity relative to control neurons, while Zif268 which is mTORC1 indepen- dent was unaffected (Figure 5F and G). Collectively, these experiments demonstrated the existence of mTORC1 complexes composed of GIT1, mTOR, and Raptor that mediate mTORC1 signaling in response to synaptic stimuli. GluN3A/GIT1 interactions control the emergence of mTORC1- dependent protein synthesis We further found that the abundance of GIT1/mTORC1 complexes is regulated throughout post- natal development. GIT1/mTORC1 complexes were readily observed in P16, but not P7 or P10, hippocampus or cortex of wild-­type mice (Figure 6A; Figure 6—figure supplement 1). Because this time-­course matches the timing of synaptic GluN3A downregulation in vivo (Henson et al., 2012), we asked whether GluN3A expression influences GIT1/mTORC1 assembly. Biochemical analysis of GIT1 immunoprecipitates from hippocampi of P10 wild-­type and Grin3a−/− showed that GluN3A removal enables the formation of GIT1/mTORC1 complexes at earlier stages, as judged by enhanced GIT1/mTOR and GIT1/Raptor binding (Figure 6B). Reciprocally, reexpression of full-­length GluN3A (but not the GluN3A1082∆ mutant) in Grin3a−/− neurons was sufficient to prevent the GIT1/mTOR association, indicating that GluN3A-­bound GIT1 cannot incorporate into the complex (Figure 6C). Taken together, the results support a model where GluN3A expression regulates the abundance of synaptic GIT1/mTORC1 complexes by directly binding GIT1, impeding its association with mTOR and limiting mTORC1 activation and downstream protein synthesis of plasticity factors. Conversely, devel- opmental or genetic GluN3A downregulation enables GIT1/mTORC1 formation and primes synapses for mTORC1-­dependent translation (Figure 6D). To test this model, we asked whether genetic manipulations of GluN3A/GIT1 interactions affect the timing and magnitude of mTORC1-­dependent protein synthesis. A first set of experiments showed that protein synthesis in young cortical neurons (DIV7–9) is not dependent on mTORC1 activation, Conde-­Dusman, Dey, et al. eLife 2021;10:e71575. DOI: https://​doi.​org/​10.​7554/​eLife.​71575  8 of 29 Research article Cell Biology IP A B mTOR IP GIT1 Input IgG- IB: Raptor mTOR mTOR GIT1 Input IgG- mTOR IB: GIT1 GIT1 pmTOR BDNF Raptor (Ser 2448) Bic GIT1 Raptor Rictor mTOR β-PIX Synaptophysin1 P GIT1 Synaptophysin1 C GFP 1 mTOR:GIT1 GFP Neg. ctrl Neg.CTRL D Control BDNF 1 h Bic 1 h E 10 * # pmTOR (normalized 8 IP IP IP to GIT1 in IP) 6 Input GIT1 Input GIT1 Input GIT1 IB: IgG- IgG- IgG- 4 p-mTOR (Ser 2448) 2 GIT1 0 l l tro tro F c Bi N on on BD C C BDNF 1h F GFP shGIT1 G 8 25 *** *** - + + - + + Arc fold induction BDNF 1h 6 20 Fold induction Rapa - - + - - + # IB: GIT1 # 15 4 Arc 10 Zif268 ns pS6K 2 5 S6K pS6 0 0 S6 pS6K pS6 GFP shGIT1 actin GFP BDNF GFP-shGIT1 BDNF + Rapamycin H GFP shGIT1 Rapa - - + - + ** Puro - + + + + ** Puromycin incorporation 135 - ns 100 - 1 Vehicle 63 - Rapamycin 48 - 0.5 35 - IB: 0 GIT1 GFP GFP-shGIT1 Figure 5. GIT1/mechanistic target of rapamycin (mTOR)/Raptor complexes couple synaptic activation to mTORC1-­ dependent protein synthesis. (A, B) Protein extracts from P16 mouse hippocampus were solubilized with 0.3 % CHAPS buffer, incubated with antibodies against mTOR or GIT1 (IP), and immunoprecipitated proteins analysed by immunoblot (IB). Input: 10 % of lysate used for immunoprecipitation. IgG−: no antibody control. A cartoon of the interactions and regulation by activity (see panel D) is shown. (C) Representative images of proximity ligation assay for rat mTOR: GIT1 (magenta) in days in vitro (DIV) 17 rat hippocampal neurons transfected with GFP (green) to visualize dendritic morphology (scale bar, 5 μm). High magnification examples of spines and dendrites (scale bars, 0.5 and 1 μm) are shown. As negative control, only mTOR primary antibody was used. (D, E) Rat cortical neurons stimulated with BDNF or bicuculline were solubilized with 0.3 % CHAPS and incubated with GIT1 antibody Figure 5 continued on next page Conde-­Dusman, Dey, et al. eLife 2021;10:e71575. DOI: https://​doi.​org/​10.​7554/​eLife.​71575  9 of 29 Research article Cell Biology Figure 5 continued (IP). Representative immunoblots (D) and quantification of mTOR phosphorylation in GIT1 immunoprecipitates (E) are shown (n = 3–6 from three independent cultures; *p < 0.05, # = 0.06, two-­tailed unpaired t-­test). (F–H) Primary mouse cortical neurons were infected with lentiviruses expressing GFP or GFP-­shGIT1 on DIV7. mTOR responses to BDNF (F, G) and puromycin incorporation (H) in the presence or absence of 100 nM rapamycin were analyzed at DIV14. Quantification of phosphorylated S6K and S6 and Arc induction (#pS6K: p = 0.13, #pS6: p = 0.05, two-­tailed paired; ***p < 0.001, two-­way analysis of variance [ANOVA] followed by Tukey’s test) (G) and puromycin levels normalized to Ponceau S (n = 5–7 from four independent cultures, **p < 0.01, two-­way ANOVA followed by Tukey’s test) (H) are shown. The online version of this article includes the following figure supplement(s) for figure 5: Source data 1. Coimmunoprecipitation assays of GIT1 with mechanistic target of rapamycin (mTOR), Raptor, and Rictor in P16 mouse hippocampus. Source data 2. Coimmunoprecipitation of GIT1 with phosphorylated mechanistic target of rapamycin (mTOR) in Ser2448 in P16 mouse hippocampus. Source data 3. Coimmunoprecipitaion of GIT1 and phosphorylated mechanistic target of rapamycin (mTOR) in days in vitro (DIV) 17 hippocampal neurons after bicuculline and BDNF treatment. Source data 4. Western blots of mechanistic target of rapamycin (mTOR) effectors and immediate-­early gene (IEG) induction by BDNF in the presence or absence of rapamycin in days in vitro (DIV) 14 cortical neurons infected with control or shGIT1-­expressing lentiviruses. Source data 5. Western blots of puromycin incorporation in days in vitro (DIV) 14 cortical neurons infected with control or shGIT1-­expressing lentiviruses. with strong rapamycin sensitivity emerging at later stages (DIV14) (Figure 6—figure supplement 2). Knockdown of GluN3A resulted in a large increase in protein synthesis in DIV7–9 neurons, which exhib- ited a rapamycin dependence typical of mature neurons (Figure 6E). Robust rapamycin-­dependent protein synthesis was also observed in Grin3a−/− neurons (Figure 6F). Reexpression of GluN3A, but not GluN3A1082∆, reduced protein synthesis rates and was sufficient to block mTORC1 depen- dence, reinstating a juvenile mode of protein synthesis (Figure 6F). Thus GluN3A, via binding to GIT1, controls the age-­dependent switch between mTORC1-­independent and mTORC1-­dependent protein synthesis. Long-term memory formation is enhanced in Grin3a-deficient mice in a rapamycin-dependent manner While GluN3A expression is typical of immature synapses at early postnatal stages as illustrated in our model, electron microscopy analyses demonstrate that subsets of synapses continue to express GluN3A into adulthood in areas such as the hippocampal CA1 (Roberts et al., 2009); and a recent mRNA expression study revealed that significant GluN3A levels are retained in a variety of brain regions (Murillo et al., 2021). Previous work showed that transgenic GluN3A overexpression impairs memory consolidation in hippocampal-­dependent paradigms such as the Morris water maze (Roberts et al., 2009), but whether endogenous GluN3A expression has a physiological role in memory forma- tion is unknown. We hypothesized that GluN3A modulation of synaptic mTORC1 signaling might provide a mechanism to set modes of translational control participating in memory encoding. We reasoned that, if so, GluN3A deletion would create a permissive environment for stable memory formation and tested this by assessing mice learning in increasingly demanding tasks. Testing of Grin3a−/− mice in a standard version of the Morris water maze (four trials per day) did not reveal differences in the latencies to reach the hidden platform relative to wild-­type controls (Figure 7— figure supplement 1). Wild-­type and Grin3a−/− mice displayed similar preferences for the target quadrant in probe trials where the platform was removed from the pool at the end of training, confirming that both had learnt the platform location (PT1; Figure 7—figure supplement 1C). Differ- ences emerged with a more demanding version of the task (two trials per day): both male and female Grin3a−/− mice reached the platform significantly faster than wild types, with shorter latencies by day 3 of training and greater preference for the target quadrant in probe trials (PT1; Figure 7A and B; Figure 7—figure supplement 1B, D). No differences were observed in a visible version of the maze or in swim velocities, suggesting that motor or perceptual differences do not account for the phenotype (Figure 7—figure supplement 1E, F). Conde-­Dusman, Dey, et al. eLife 2021;10:e71575. DOI: https://​doi.​org/​10.​7554/​eLife.​71575  10 of 29 Research article Cell Biology A B WT Grin3a -/- (normalized to GIT1 in IP) IP IP 3 ** Complex abundance Input GIT1 Input GIT1 IgG- IgG- P7 P10 P16 ** IP IP IP 2 IB: mTOR * Input GIT1 Input GIT1 Input GIT1 IgG- IgG- IgG- IB: GIT1 1 mTOR * Syp1 GIT1 Raptor * 0 mTOR/ Raptor/ GIT1 β-PIX GIT1 GIT1 β -PIX Syp1 WT Grin3a -/- Rescue experiment Early Juvenile/adult C in Grin3a -/- neurons D GluN3A-synapse GluN1/2-synapse GFP-GluN3A GluN1/2A GFP GFP-GluN3A 1082 Δ GluN1/2/3A Grin3a -/- IP IP IP CTD sh3A GIT1 GIT1 GIT1 Raptor Input GIT1 Input GIT1 Input GIT1 IgG- IgG- IgG- mTOR IB: P mTOR PSD GluN3A mTOR * * (or shGIT1) GIT1 mTORC1 mTORC1 protein synthesis protein synthesis E F 3A 3A FP GluN3A FP GFP GluN3A *** *** Puromycin incorporation sh sh Puromycin incorporation G *** ** G 1082Δ CHX - + - - - 3 * ** Rapa - + - + - + Rapa - - - + + 1 135 - 180 - 2 100 - 135 - 75 - 100 - 63 - 75 - 1 48 - 63 - IB: 0 48 - 0 GFP GFP-sh3A GluN3A GFP GluN3A GluN3A pS6K 1082 Vehicle Rapamycin Vehicle Rapamycin Figure 6. GluN3A/GIT1 interactions control the age-­dependent onset of mTORC1-­dependent protein synthesis. (A) Hippocampi from P7, P10, and P16 wild-­type mice were lysed, immunoprecipitated with GIT1 antibody and probed for the indicated antibodies. Input: 10 % of the lysate used for immunoprecipitation. IgG−: negative control without antibody. Red asterisks here and other panels indicate mechanistic target of rapamycin (mTOR)- and Raptor bound to GIT1. (B) GIT1/mTORC1 complex formation is enhanced in P10 Grin3a−/− hippocampus. Representative blots of GIT1 immunoprecipitates and quantifications are shown (n = 2–4 mice; **p < 0.01 unpaired t-­test). Bound mTOR and Raptor are normalized to immunoprecipitated GIT1. Syp1: synaptophysin 1. (C) Grin3a−/− cortical neurons infected with GFP, GFP-­GluN3A, or GFP-­GluN3A1082Δ were solubilized and GIT1 immunoprecipitates blotted as indicated (IB). (D) GIT1/GluN3A control mTORC1 translation. Left: at early postnatal stages, immature synapses express GluN3A-­NMDARs, which bind the postsynaptic scaffold GIT1 via their C-­terminal tail preventing the nucleation of GIT1/mTORC1 and the mTORC1-­mediated synthesis of plasticity proteins. Right: at juvenile/adult stages, GluN3A downregulation enables GIT1/mTOR/Raptor complex assembly and primes synapses for mTORC1 translation of mRNAs involved in synapse and memory consolidation. The genetic manipulations shown here to alter the age-­dependent switch from mTORC1-­independent to mTORC1-­ dependent modes of translation are indicated. Note that GluN3A expression is retained by subsets of synapses in adult brains and might play roles in selecting synapses that will be recruited to stably encode memory traces (see Discussion). (E) Mouse cortical neurons were infected with lentiviruses expressing GFP or GFP-­sh3A on days in vitro (DIV) 3 and protein synthesis analyzed at DIV7–9. Representative blots and quantification of puromycin incorporation in infected neurons treated with rapamycin (100 nM), cycloheximide (CHX, 25 μM), or vehicle. (F) Grin3a−/− cortical neurons were infected with GFP, GFP-­GluN3A, or GFP-­GluN3A1082∆ lentiviruses, and protein synthesis analyzed at DIV12. GluN3A expression and mTOR activation were monitored with the indicated antibodies (IB). In panels D–E, n = 4–7 from three to four independent cultures (*p < 0.05, **p < 0.01, ***p < 0.001, two-­way analysis of variance [ANOVA] followed by Tukey’s test). The online version of this article includes the following figure supplement(s) for figure 6: Source data 1. Coimmunoprecipitation of GIT1 and mechanistic target of rapamycin (mTOR) in lysates from P7, P10, and P16 mouse hippocampus. Figure 6 continued on next page Conde-­Dusman, Dey, et al. eLife 2021;10:e71575. DOI: https://​doi.​org/​10.​7554/​eLife.​71575  11 of 29 Research article Cell Biology Figure 6 continued Source data 2. Coimmunoprecipitation of GIT1 with mechanistic target of rapamycin (mTOR) and Raptor in hippocampal lysates from P10 wild-­type and Grin3a−/− mice. Source data 3. Coimmunoprecipitation of GIT1 with mechanistic target of rapamycin (mTOR) in Grin3a−/− cortical neurons infected with GFP, GFP-­GluN3A, and GFP-­GluN3A1082Δ lentiviruses. Source data 4. Western blots of puromycin incorporation in neurons infected with control or sh3A-­expressing lentiviruses. Source data 5. Western blots of puromycin incorporation in the presence or absence of rapamycin in Grin3a−/− cortical neurons infected with GFP, GFP-­GluN3A, and GFP-­GluN3A1082Δ. Figure supplement 1. Postnatal regulation of GIT1/mTORC1 complexes in mouse somatosensory cortex. Figure supplement 1—source data 1. Annotated western blots and original scans. Figure supplement 2. Age-­dependent emergence of mTORC1-­dependent protein synthesis in cultured rat cortical neurons. Figure supplement 2—source data 1. Annotated western blots and original scans. Similarly reduced learning thresholds had been reported in mice with elevated activity of mTOR or other pathways controlling translation (Banko et al., 2007; Costa-­Mattioli et al., 2007; Hoeffer et al., 2008; Stern et al., 2013), often at the expense of impaired ability to respond to changed environ- ments, altered memory fidelity, or appearance of perseverant and repetitive behaviors (Banko et al., 2007; Hoeffer et al., 2008; Santini et al., 2013; Shrestha et al., 2020b; Trinh et al., 2012). Thus, we evaluated cognitive flexibility by retraining the mice to learn a new platform location (‘reversal’). Grin3a−/− mice were better at shifting their preference relative to wild-­type controls as evident in probe trials conducted 7 days after reversal (PT2; Figure 7A and B, Figure 7—figure supplement 1B, D). No perseverative behavior was observed either in a Y-­maze spontaneous alternation task (Figure 7—figure supplement 1G). These results showed that GluN3A deletion facilitates spatial learning and memory without the unwanted effects associated to other modulators of translation. We then assessed associative memory formation using two tasks that depend on new protein synthesis and can be achieved with the single pairing of a conditioned (CS) and unconditioned stim- ulus (US): conditioned taste aversion (CTA) and contextual fear conditioning (FC). In CTA, a novel taste (saccharin, CS) is associated with an aversive US (LiCl, which induces nausea). The LiCl dose (US) and temporal contiguity between CS–US can be regulated to evaluate standard memory (Figure 7C), or ‘enhanced’ memory by using a weaker paradigm (Figure 7F; Adaikkan and Rosenblum, 2015). Transgenic mice with prolonged GluN3A expression into adulthood (dt GluN3A) displayed deficits in a standard CTA paradigm (US, LiCl 0.15 M i.p.) as judged by their similar preference for saccharin 24 hr after saline or LiCl injections (Figure 7D, green bars). This result was inline with the memory deficits reported in other behavioral paradigms (Roberts et al., 2009). Control experiments ruled out the possibility that the defect was due to insensitivity to LiCl or to defects in distinguishing flavors (Figure 7—figure supplement 2). By contrast, Grin3a−/− mice did not show differences relative to wild types in a standard paradigm of CTA memory (Figure 7E). We then used a weak CTA para- digm where the strength of the US was reduced (LiCl 0.025 M), and US–CS were separated by 5 hr (Figure 7F). Under these conditions, only Grin3a−/− mice formed an association between CS–US, as shown by their significantly reduced preference for saccharin after LiCl injection but intact preference in wild-­type controls. The negative association was long-­lasting as it could be observed 24 (Figure 7G) and 48 hr after conditioning (data not shown). To determine whether it was mTOR dependent, we treated mice with a subthreshold dosing regime of rapamycin (Stoica et al., 2011) that does not affect standard CTA memory (Figure 7—figure supplement 2). Rapamycin erased the weak CTA memory in Grin3a−/− mice (Figure 7H), supporting the notion that disinhibited mTOR signaling causes the cognitive enhancement. In contextual FC, a particular environment (CS) is associated with a foot-­shock (US) (Figure 8A). Wild-­type and Grin3a−/− littermates showed similar freezing responses before the delivery of the foot-­shock (Figure 8B). However, freezing was significantly stronger in Grin3a−/− mice 24 and 48 hr after a weak training protocol (single pairing of a tone with a 0.3 mA foot-­shock, Figure 8B and C), demonstrating enhanced and lasting memory formation. No differences were observed in short-­term (1 hr) memory that is protein synthesis independent (Figure 8B). As in CTA, rapamycin occluded the Conde-­Dusman, Dey, et al. eLife 2021;10:e71575. DOI: https://​doi.​org/​10.​7554/​eLife.​71575  12 of 29 Research article Cell Biology A Platform WT (n=10) B PT1 PT2 reversal Grin3a -/- (n=10) 100 100 *** Latency to find platform (s) Quadrant occupancy (%) 80 * WT 80 80 Grin3a -/- 60 60 60 40 40 40 20 20 20 0 PT1 PT2 0 0 Target Non-target Target Non-target 1 2 3 4 5 6 7 1 2 3 4 5 6 7 H H H H H H H R R R R R R R avg. avg. Test day (2 trials per day) C D control dt GluN3A E WT Grin3a -/- 100 *** *** Saccharin Preference (%) Saccharin Preference (%) 100 *** 80 80 Saccharin LiCl 0.2 % 0.15 M 60 60 Habituation Water (CS) (US) Test 24 h 40 40 40 min 20 20 Day 1 Day 7 Day 8 0 0 15 15 e cle 5 15 e e icl .1 icl icl 0. 0. 0. hi h 0 h h Ve Ve Cl Cl Ve Ve Cl Cl Li Li Li Li G H F WT Grin3a -/- saline rapamycin Saccharin LiCl ** ** Saccharin Preference (%) Saccharin Preference (%) 100 100 vehicle or 0.1 % 0.025 M Habituation rapamycin (CS) (US) Test 24 h 80 80 (20 mg/kg i.p.) 5h 60 60 Day 11 Day 12 40 40 Day 1 Day 3 20 20 Day 5 Day 7 Day 9 0 0 cle 5 cle 5 cle 5 cle 5 02 02 02 02 hi hi hi hi 0. 0. 0. 0. Ve Ve Ve Ve Cl Cl Cl Cl Li Li Li Li Figure 7. GluN3A deletion facilitates spatial and associative learning. (A) Escape latencies of male wild-­type (WT) and Grin3a−/− mice on a weak version of the Morris water maze (two trials per day) during 7-­day training and after platform reversal on day 8. (B) Probe trials performed 24 hr after day 7 (PT1), or 24 hr after reversal training (PT2) (n = 10–13 mice per genotype; two-­way analysis of variance [ANOVA] with Bonferroni post hoc test, *p < 0.05, ***p < 0.0001). (C) Conditioned taste aversion (CTA) paradigm. (D) Saccharin preference of control and double transgenic (dt) GluN3A mice, and (E) WT and Grin3a−/− mice after vehicle or LiCl injection (n = 5–7 mice per group; ***p < 0.001, two-­way ANOVA followed by Bonferroni post hoc test). (F–H) Weak CTA paradigm and rapamycin treatment regime. Decreased saccharin preference of Grin3a−/− mice on the weak CTA (G) was reversed by rapamycin (H) (**p < 0.01, two-­way ANOVA followed by Bonferroni post hoc test). The online version of this article includes the following figure supplement(s) for figure 7: Figure supplement 1. Behavior of male and female Grin3a−/− mice in the Morris water maze. Figure supplement 2. Controls for conditioned taste aversion (CTA) experiments. difference between wild-­type and Grin3a−/− mice (Figure 8C). Taken together, our behavioral results demonstrate that GluN3A deletion lowers the threshold for stable memory storage and provide phar- macological evidence linking the enhanced learning to a relief of GluN3A constraints on mTORC1 signaling. Yet the cognitive enhancement could have been due to lack of GluN3A during development rather than adult stages. Also, GluN3A is expressed by excitatory neurons and somatostatin interneu- rons, both recently implicated in protein synthesis-­dependent memory consolidation (Sharma et al., 2020; Shrestha et al., 2020a). We therefore selectively ablated Grin3a from excitatory neurons or somatostatin-­expressing interneurons by crossing floxed Grin3a mice (Grin3af/f) with mice that express Cre recombinase under the control of the Ca2+ calmodulin kinase IIα (Camk2a-­CreERT2) or somatostatin (Sst-­Cre) promoter. The first strategy allowed conditional deletion of GluN3A at adult stages by injecting tamoxifen (Figure 8D). Biochemical analysis of adult hippocampal lysates confirmed effec- tive deletion of GluN3A, and revealed that ~70 % and ~ 20 % of GluN3A protein is expressed by excitatory and somatostatin interneurons, respectively (Figure 8—figure supplement 1). We then subjected the mice to the weak FC protocol. Adult deletion of GluN3A from excitatory neurons was Conde-­Dusman, Dey, et al. eLife 2021;10:e71575. DOI: https://​doi.​org/​10.​7554/​eLife.​71575  13 of 29 Research article Cell Biology A B C 60 100 * 100 * ** 0.3 mA Shock (2s) 80 80 Freezing (%) Context A Context A Freezing (%) 1h 40 60 60 24h 40 40 48h 20 WT 20 20 WT Grin3a-/- Grin3a-/- 0 0 0 Pre- 24h 1h 24h Rapa - + - + shock 48h D Camk2a CreERT2 TMX TMX (20mg/kg) E Sst Cre loxP Grin3a loxP P60 P62 P64 P66 P68 P90 loxP Grin3a loxP Behavior 100 80 *** * 80 100 * 60 *** * * 80 60 80 Freezing (%) Freezing (%) 60 60 40 40 40 40 20 20 20 20 0 0 0 0 Pre- 24h 48h 7d 24h 48h 7d Pre- 24h 48h 24h 48h shock shock Grin3af/f x Camk2a-CreERT2 -/- Grin3af/f x Sst-Cre-/- Grin3af/f x Camk2a-CreERT2 +/- Grin3af/f x Sst-Cre+/- F G 80 * 5x Tone (30s) 5x 0.3 mA Shock (1s) 15x Tone (30s) 60 * Freezing (%) Context A Context B 40 4 x 24 h 20 WT Grin3a -/- 0 C ck C 1 C 2 C 3 C 4 5 FE 1 FE 2 3 L 4 FE o FE AL FE S S S S S sh e- Pr Figure 8. GluN3A deletion from excitatory neurons in adult mice is sufficient for memory enhancement. (A) Contextual fear conditioning test. (B) Enhanced contextual fear conditioning in Grin3a−/− mice 24 hr but not 1 hr after training (n = 9–13 mice per group; left: repeated measures two-­way analysis of variance [ANOVA] with Bonferroni post hoc test, p = 0.004; right: two-­tailed unpaired t-­test, *p < 0.05). (C) Enhanced contextual fear conditioning in Grin3a−/− mice at 48 hr is reversed by rapamycin (2 × 20 mg/kg i.p., 24 hr apart, prior to training) (n = 10–11 mice per group; *p < 0.05; **p < 0.01, two-­way ANOVA with Bonferroni post hoc test). (D, E) Conditional deletion of GluN3A from adult excitatory neurons, but not somatostatin (Sst) interneurons, enhances long-­term contextual fear memory. The regime for tamoxifen (TMX) injection is indicated (*p < 0.05: ***p < 0.001 two-­tailed unpaired t-­test). (F, G) Cued-­fear extinction in Grin3a−/− and wild-­type littermates over a four-­day fear extinction paradigm (n = 14–13 mice per group; *p = 0.0461 between-­subjects effect, repeated measures ANOVA). Freezing levels were not different between phenotypes in FE1 (t(25) = 0.760, p = 0.455). The online version of this article includes the following figure supplement(s) for figure 8: Figure supplement 1. Expression of GluN3A and other synaptic proteins in conditional Grin3a knockout mice. Figure supplement 1—source data 1. Annotated western blots and original scans. Figure supplement 1—source data 2. Annotated western blots and original scans. sufficient to enhance long-­term memory, as shown by stronger freezing of Grin3af/f × Camk2a-­CreERT2 mice 24, 48 hr, and even 7 days after training (Figure 8D). In contrast, Grin3af/f × Sst-­Cre and control mice exhibited similar freezing levels 24 and 48 hr after training (Figure 8E). Thus, adult GluN3A expression in excitatory neurons gates long-­term memory formation. Finally, we evaluated fear extinction (FE), a form of memory where repeated presentation of a CS without reinforcement leads to the extinction of the acquired fear memory (Andero and Ressler, 2012). FE requires protein synthesis and is another indicator of behavioral flexibility that has been shown to be impaired after manipulation of general elements of translation. Mice were subjected to a strong auditory cued-­FC protocol (five pairings of a tone [CS] with a 0.3 mA foot-­shock) followed by four cued-­FE sessions (15 CS alone, no foot-­shock) (Figure 8F). Fear memory acquisition was similar between WT and Grin3a−/− littermates but FE was enhanced in Grin3a−/− mice (Figure 8G), Conde-­Dusman, Dey, et al. eLife 2021;10:e71575. DOI: https://​doi.​org/​10.​7554/​eLife.​71575  14 of 29 Research article Cell Biology demonstrating that GluN3A deletion does not compromise the updating of memories but rather facilitates the extinction of fear memories. Discussion In this study, we report a regulatory mechanism that affords spatiotemporal control of mTORC1-­ dependent translation in response to synaptic stimulation. Specifically we identify GIT1/mTORC1 complexes as key mediators of synaptic mTORC1 responses, and demonstrate that GluN3A-­ NMDARs, through direct association with GIT1, impede GIT1/mTORC1 assembly and negatively regulate synaptic mTORC1 activation and mTORC1-­dependent translation. Using in vitro and in vivo genetic approaches, we further show that negative regulation by GluN3A determines the emergence of mature mTORC1-­dependent protein synthesis in developing brains, and continues to play a role in adult life by placing boundaries on long-­term memory storage. More broadly, our findings suggest that neuronal GIT1/mTORC1 complexes might provide a central site for the regulation and dysregu- lation of synaptic translation in other physiological and disease contexts. Modulation by GluN3A of GIT1/mTORC1 complex assembly mTORC1 is a ubiquitous protein kinase complex that promotes protein synthesis and cell growth in response to a variety of signals including nutrient availability, energy levels, insulin, growth factors, and synaptic inputs. Coupling such diverse signals to mTORC1 activation requires regulated targeting to specific subcellular compartments. For instance, mTORC1 responses to amino acids require its recruit- ment by the Ragulator–Rag complex to lysosomal membranes, where interactions between positive (Rheb) and negative (Tsc1/2 complex) mTOR regulators take place (Benjamin and Hall, 2014; Sancak et al., 2010). Our observations suggest that GIT1 could play an analogous scaffolding role to position mTORC1 such that it senses synaptic signals, with negative regulation by GluN3A limiting mTORC1-­ dependent translation at specific developmental times and/or in specific subsets of synapses in adult brains. First, GIT1/mTORC1 complexes are located at dendritic/synaptic sites and respond to synaptic stimuli, as shown by phosphorylation of GIT1-­bound mTOR on Ser2448, an event that is stimulated by NMDARs (Figure 2—figure supplement 1) and is amplified by feedback from the downstream mTORC1 substrate S6K (Chiang and Abraham, 2005). Second, knocking-­down GIT1 blunts synaptic mTORC1 signaling and mTORC1-­dependent translation of specific activity-­regulated genes. Third, GIT1/mTORC1 abundance increases during postnatal development and is bidirectionally modulated by GluN3A expression. Fourth, the association of GIT1 with GluN3A is required for mTORC1 modula- tion, as demonstrated by the fact that expression in the Grin3a knockout of a GluN3A mutant lacking the GIT1-­binding site does not rescue the increased assembly of GIT1 with mTOR (Figure 6) nor the increased activation of synaptic mTORC1 (Figure 4). Given that GluN3A and mTOR bind overlapping regions in GIT1 (Fiuza et al., 2013; Smithson and Gutmann, 2016), the most parsimonious explana- tion is that GluN3A competes with mTOR for binding to GIT1. We previously reported that GluN3A modulates the formation of GIT1 complexes with βPIX (Fiuza et al., 2013), and might coordinately inhibit two central mechanism in spines that are necessary for memory consolidation —actin cytoskeletal rearrangements and protein synthesis. This action would be analogous to the translational repression by FMRP/CYFIP1 complexes (De Rubeis et al., 2013). Our results here (see Figure 6B) indicate that GluN3A exerts a more potent regulation over GIT1/ mTORC1 than GIT1/βPIX complexes and suggest that mTOR modulation might be the primary event. Of note, rare coding variants in GIT1 have been identified in schizophrenic patients (Kim et al., 2017) and GIT1 knockout mice display deficits that resemble those seen in mice with elevated GluN3A expression, including reduced spine size and poor learning and memory (Martyn et al., 2018). Addi- tional phenotypes reported in mice and flies upon GIT1 deletion, such as microcephaly, reduced neuronal size or hyperactivity, might also be related to mTOR modulation (Hong and Mah, 2015; Won et al., 2011). Our RNAseq analyses indicate that GluN3A acts at the level of translation and would thus preserve the supply of activity-­induced plasticity mRNAs but restrict their active translation to specific synapses, in contrast to classical NMDARs that work at both transcriptional and translational levels. Neverthe- less, GluN3A knockdown in cultured neurons has been shown to enhance the transcription of a subset Conde-­Dusman, Dey, et al. eLife 2021;10:e71575. DOI: https://​doi.​org/​10.​7554/​eLife.​71575  15 of 29 Research article Cell Biology of mRNAs (Chen et al., 2020) upon prolonged periods of synaptic activation (6–8 vs. 1 hr in the present study), and we cannot rule out later regulation by GluN3A of compensatory or homeostatic responses. Of note, tonic repression of mTOR-­dependent protein synthesis by GluN2B-­containing NMDARs has also been reported (Wang et al., 2011). However, the molecular determinants of stim- ulation or repression of protein synthesis were not addressed. It remains to be established whether GluN3A and GluN2B share common mechanisms. A role for GluN3A in restricting translation for precise circuit refinements and long-term memory storage GluN3A-­NMDARs are highly expressed during critical periods of experience-­dependent neural circuit refinements, when they have been proposed to determine which synapses will be maintained or elim- inated, and at lower levels in specific regions of the adult brain (Murillo et al., 2021). We propose a model whereby the lack or presence of GluN3A at postsynaptic sites contributes to spine-­specific translation by setting an enhanced or repressed biochemical environment for mTORC1 signaling that will depend on the stage of brain development (Figure 6D) and the activity history of indi- vidual synapses. This is: synaptic GluN3A levels are downregulated by sensory experience and can be controlled at the level of individual synapses by activity-­dependent endocytosis (Pérez-­Otaño et al., 2006). The removal of GluN3A-­NMDARs from active synapses would drive formation of nearby GIT1/ mTORC1 complexes. This would locally increase the potential for dendritic translation of activity-­ regulated mRNAs, giving active inputs an advantage for consolidation versus less-­active neighbors. Hence, competition for active mTORC1 would provide a means for selective synapse stabilization and memory storage. Defects in mTORC1 regulation might permit the consolidation of otherwise lost synaptic changes. Such a competition-­based model is supported by the localization of GluN3A to subsets of adult synapses (Roberts et al., 2009). It is also supported by the observations that in Grin3a−/− mice, the levels of GIT1/mTORC1 are increased and these mice exhibit enhanced capacity for memory storage, as shown by their performance in weak training protocols that are normally insufficient for stable memory formation in wild-­type mice. Importantly, the restriction of dendritic translation to sites near active synapses is thought to underlie phenomena such as the competition between spines for lasting LTP expression (Fonseca et al., 2004) or the potentiation of synapses in clusters along the dendrite (Fonseca et al., 2004; Govindarajan et al., 2011). Incorporation into these models of the molecular components unveiled here might open avenues for testing how the above phenomena determine memory capacity and efficiency and for correcting cognitive dysfunction. Our experiments using cell-­type-­specific and -inducible Grin3a knockout mice demonstrate a role of GluN3A in gating cognitive processing in the adult brain beyond its better recognized functions in postnatal neural circuit refinements, and identify excitatory neurons as the locus of GluN3A actions. In relation to memory, negative regulators are thought to provide an advantage by ensuring that only salient features are learnt and irrelevant events or associations are filtered out (Abel et al., 1998; Cho et al., 2015). For instance, temporal contiguity of events is required for many forms of associative learning; within the scale of seconds or minutes for classical conditioning paradigms, longer in other types of memory. In CTA, the CS and US can be hours apart, with temporal boundaries set by the strength of the US (Adaikkan and Rosenblum, 2015). Our results show that the absence of GluN3A broadens this temporal limit and facilitates learning of demanding tasks, i.e. where training is spaced apart or the presented stimuli are weaker. The reversal by rapamycin is consistent with the notion that the enhanced readiness of the mTORC1 translational machinery in GluN3A-­deficient mice expands the range for consolidation of memory traces. While we used a subtreshold dose of rapamycin that does not alter memory or mTOR signaling in wild-­type mice (Stoica et al., 2011), we cannot rule out potential nonsynaptic effects. Definitive proof will require the development of tools that directly disrupt GluN3A/GIT1 or GIT1/mTOR association or synaptic localization. As far as tested here, GluN3A deletion does not impair other aspects of cognition such as memory flexibility or extinction. Yet significant GluN3A levels are retained in areas of the mouse and human adult brain with strong plasticity or functional integration needs (Fulcher et al., 2019; Murillo et al., 2021), and a recent study linked adult GluN3A expression to the control of emotional states (Otsu et al., 2019). In addition, genetic variations in GRIN3A have been shown to modulate prefrontal cortex activity (Gallinat et al., 2007) and episodic memory (Papenberg et al., 2014). Future investigations Conde-­Dusman, Dey, et al. eLife 2021;10:e71575. DOI: https://​doi.​org/​10.​7554/​eLife.​71575  16 of 29 Research article Cell Biology should determine whether domains of cognition other than the ones we tested are compromised by GluN3A deletion. GluN3A and synaptic protein synthesis as selective therapeutic targets The stabilization of memories requires de novo protein expression. Nevertheless, the effects on cogni- tion of enhancing mTOR signaling or protein synthesis are perplexing. Loss of constraints on protein synthesis due to mutations in negative regulators of translation (FMR1, MECP2, or mTORC1 suppres- sors including NF1, TSC1/2, or the phosphatase PTEN) are associated with cognitive impairment and high incidence of autism spectrum disorders and intellectual disability (Kelleher and Bear, 2008), although a fraction of autistic individuals exhibit enhanced cognitive skills within specific domains (Heaton and Wallace, 2004). On the other hand, inhibiting the phosphorylation of eIF2α, which generally increases translation (Costa-­Mattioli et al., 2007; Stern et al., 2013), or enhancing mTORC1 activity by removal of FKBP12 (Hoeffer et al., 2008) have been reported to lower memory thresholds. However, the cognitive enhancement came at the cost of reduced memory fidelity and cognitive flexibility even when cell-­type-­specific modulation was attempted (Santini et al., 2013; Shrestha et al., 2020a; Trinh et al., 2012), which we did not observe here. Key differences could be that other negative regulators of mTOR such as FMRP, PTEN, or Tsc1/2 are expressed in multiple cell types and neuronal locations, as demonstrated by their linkage to altered cell growth and appearance of tumors (Lipton and Sahin, 2014). Also, in some of the above situations, translation is constitutively activated and responses to incoming signals might be obliterated. By contrast, lack of GluN3A does not occlude mTORC1 activation but rather seems to prime mTOR activation by synaptic stimuli. At present, the enhancement of learning and memory produced by loss of GluN3A suggests that targeting GluN3A expression or signaling functions might be of therapeutic benefit. For instance, small molecules that perturb the GluN3A/GIT1 association might work in subtler ways than general translation regulators by specifically modulating synaptic mTORC1 signaling. Materials and methods Animals Adult (3–6 months old) Grin3a−/−, Grin3atm1a(EUCOMM)Hmgu/H (Grin3af/f) and double-­transgenic GFP-­ GluN3A (dtGluN3A) mice backcrossed for 10–12 generations into a C57Bl6/J background were used. Single transgenic mice were used as controls for dtGluN3A mice, and wild-­type littermates from heterozygote crosses were controls for Grin3a−/− mice. Commercial C57BL6/J mice were purchased from Charles River Laboratories. For time-­specific knockout of Grin3a in excitatory neurons, tamoxifen-­ inducible CaMKIIα-CreERT2+/− mice (Erdmann et al., 2007) were crossed with Grin3af/f mice. Tamox- ifen (Sigma-­Aldrich T5648, 20 mg/ml dissolved in corn oil) was administered via oral gavage (five alternate days). For inhibitory neuron-­specific knockout of Grin3a, Sst-­IRES-­Cre+/− mice (JAX Stock No. 018973) were backcrossed with C57BL/6J mice for 12 generations and then bred with Grin3af/f mice. Male mice were used for behavioral experiments unless indicated. Animals were housed four to six per cage with ad libitum access to food and water and maintained in a temperature-­controlled envi- ronment on a 12-­hr dark/light cycle. All procedures were conducted in accordance with the European and Spanish regulations (2010/63/UE; RD 53/2013) and were approved by the Ethical Committee of the Generalitat Valenciana (2017/VSC/PEA/00196). For the cued-­FC experiments, ethic protocols were approved by the Committee of Ethics of the Universitat Autònoma de Barcelona and the Gener- alitat de Catalunya. Primary neuronal cultures Cortical and hippocampal neurons in primary culture were prepared as described (Pérez-­Otaño et al., 2006). Briefly, cortices were dissected from E19 rat pups or E17.5 mice pups and dissociated with papain (Worthington Biochemical). Mouse primary neurons were used for rescue experiments in the Grin3a-­null background shown in Figures 4 and 6, and for shGIT1 experiments in Figure 5. Neurons were plated at 75,000 cells per well on 12-­well plates, 500,000 cells per well on 6-­well plates and 1,000,000 cells/ dish on 60 mm dishes coated with laminin and poly-­D-­lysine and grown in Neurobasal Medium supplemented with B27 (Thermo Fisher). Conde-­Dusman, Dey, et al. eLife 2021;10:e71575. DOI: https://​doi.​org/​10.​7554/​eLife.​71575  17 of 29 Research article Cell Biology Neurons were infected with lentiviruses 5 days prior to collection (timing of infection is indicated in figure legends). Neurotrophic factors and other drugs were used at the following concentrations: anisomycin (0.8 μM, Sigma-­Aldrich A5892), recombinant human BDNF (100 ng/ml, PeproTech 450-­ 02), bicuculline (50 μM, Abcam Ab120108), cycloheximide (25 μM, Sigma Aldrich C7698), (D,L)-­APV (50 μM, Tocris 3693), MK801 (10 μM, Tocris 0924), rapamycin (100 nM, Alfa Aesar J62473), and puro- mycin (10 ng/ml, Sigma Aldrich P8833). Lentiviral vectors For the generation of lentiviral constructs, full-­length GluN3A and GluN3A1082∆ cDNAs were subcloned into a dual lentiviral vector Syn-­WPRE-­Syn-­GFP kindly provided by Dr. Francisco G Scholl, University of Sevilla, Spain. For knockdown experiments, 19–20 base pairs (bp)-­long small hairpin RNAs (shRNAs) directed to GluN3A (shGluN3A1185, target sequence: CTACAGCTGAGTTTAGAAA) or GIT1 (shGIT1, target sequence: T ​ GAT​CACA​AGAA​TGGG​CATTA) were cloned into the pLentilox 3.7-­GFP vector downstream the U6 promoter. The AAV encoding constitutively active human Rheb (AAV-­caRheb, S16H) was kindly provided by Dr. Beverly Davidson, Children’s Hospital of Philadelphia, University of Pennsylvania. RNA isolation, qRT-PCR, and RNAseq analyses Total RNA from cultured cortical neurons was isolated using the Nucleospin RNA (Macherey-­Nagel). RNA concentration and purity were assessed with NanoDrop. RNA quality was determined by the RNA Integrity Number (RIN) algorithm using the Agilent 2100 Bionalyzer Instrument; only samples with RIN >9 matched our standard. For qRT-­PCR experiments, first-­strand cDNA was synthesized from 1 μg of total RNA using the Invitrogen SuperScript IV First-­Strand cDNA Synthesis System (Thermo Fisher). Quantitative real-­ time PCR (qPCR) was performed using the Applied Biosystems QuantStudio 3 Real-­Time PCR system and analyzed with the QuantStudio 3 Design and Analysis software (v1.5.1, Thermo Fisher). Briefly, real-­time qPCR was assayed in a total volume of 20 μl reaction mixture containing the ready-­to-­use PyroTaq EvaGreen qPCR Mix Plus ROX (Cmb), 5 pmol of forward and reverse (rv) primers (detailed in key resource table) and cDNA. PCR thermal conditions included an initial hold stage with 5 min at 50 °C and 15 min at 95 °C followed by 40 cycles of denaturation for 30 s at 95 °C, annealing for 32 s at 60 °C and primer elongation for 32 s at 72 °C. All qPCR reactions were run in triplicates. Mean cycle threshold (Ct) values for each reaction were recorded and the relative RNA expression levels were calculated referring to Gapdh, encoding glyceraldehyde 3-­phsophate dehydrogenase: ( ) ‍∆Ct = Ct_GAPDH − Ct_ target gene .‍ The gene expression fold change normalized to GAPDH and relative to control sample was calculated as 2∆Ct. Key resources table Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cat# sc-­365084; RRID: Antibody GIT-­1 (mouse monoclonal, clone A-­1) Santa Cruz Biotechnology AB_10850059 PLA 1:150 Cat# sc-­17839; RRID: Antibody Arc (mouse monoclonal, clone C-­7) Santa Cruz Biotechnology AB_626696 WB 1:100 Cat# T8660; RRID: Antibody beta-­Tubulin III (mouse monoclonal) Sigma-­Aldrich AB_477590 WB 1:20,000 NMDAR1, all splice variants (mouse Cat# MAB1586; RRID: Antibody monoclonal, clone R1JHL) Millipore AB_11213180 WB 1:1000 Cat# 05–920; RRID: Antibody NR2B (mouse monoclonal, clone BWJHL) Millipore AB_417391 WB 1:1000 Kindly provided by Jim Antibody NR3A (mouse monoclonal) Trimmer N/A WB 1:100 Cat# 75–028 Antibody PSD-­95 (mouse monoclonal, clone K28/43) Antibodies Incorporated RRID: AB_10698024 WB 1:1000 Puromycin (mouse monoclonal, clone Cat# MABE343; RRID: Antibody 12D10) Millipore AB_2566826 WB 1:2000 Continued on next page Conde-­Dusman, Dey, et al. eLife 2021;10:e71575. DOI: https://​doi.​org/​10.​7554/​eLife.​71575  18 of 29 Research article Cell Biology Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cat# 106 011 Antibody Synapsin I (mouse monoclonal, clone 46.1) Synaptic Systems RRID: AB_2619772 WB 1:5000 Synaptophysin (mouse monoclonal, clone Cat# MAB5258-­20UG; RRID: Antibody SY38) Millipore AB_11214133 WB 1:2000 Cat# 9197; RRID: Antibody CREB (rabbit monoclonal, clone 48H2) Cell Signaling Technology AB_331277 WB 1:1000 Cat# 05–901 R; RRID: Antibody NR2A (rabbit monoclonal, clone A12W) Millipore AB_10805961 WB 1:1000 Phospho-­CamKinase II alpha (CaMKIIα) Cat# 12716; RRID: Antibody Thr286 (rabbit monoclonal, clone D21E4) Cell Signaling Technology AB_2713889 WB 1:1000 Phospho-­p70 S6 kinase Thr389 (rabbit Cat# 9234; RRID: Antibody monoclonal, clone 108D2) Cell Signaling Technology AB_2269803 WB 1:1000 Cat# 2280; RRID: Antibody Raptor (rabbit monoclonal, clone 24C12) Cell Signaling Technology AB_561245 WB 1:1000 Cat# 13879; RRID: Antibody Rheb (rabbit monoclonal, clone E1G1R) Cell Signaling Technology AB_2721022 WB 1:1000 Cat# 2114; RRID: Antibody Rictor (rabbit monoclonal, clone 53A2) Cell Signaling Technology AB_2179963 WB 1:500 S6 ribosomal protein (rabbit monoclonal, Cat# 2217; RRID: Antibody clone 5G10) Cell Signaling Technology AB_331355 WB 1:1000 Cat# 2919; RRID: Antibody GIT1 (rabbit polyclonal) Cell Signaling Technology AB_2109982 IP 1:200, WB 1:1000 Cat# sc-­110; RRID: Antibody Egr-­1/Zif268 (rabbit polyclonal) Santa Cruz Biotechnology AB_2097174 WB 1:500 Cat# 07–1450; RRID: Antibody beta-­Pix, SH3 domain (rabbit polyclonal) Millipore AB_1586904 WB 1:1000 Cat# sc-­52; RRID: Antibody c-­Fos (rabbit polyclonal) Santa Cruz Biotechnology AB_2106783 WB 1:500 Cat# C6974; RRID: Antibody CaMKIIα (rabbit polyclonal) Sigma-­Aldrich AB_258984 WB 1:1000 Cat# 2972; RRID: Antibody mTOR (rabbit polyclonal) Cell Signaling Technology AB_330978 IP 1:100, PLA 1:150, WB 1:1000 NMDAR2A&B, pan antibody (rabbit Cat# AB1548; RRID: Antibody polyclonal) Millipore AB_11212156 WB 1:1000 Cat# 07–356; RRID: Antibody NR3A (rabbit polyclonal) Millipore AB_2112620 WB 1:1000 Cat# sc-­535; RRID: Antibody p30alpha (rabbit polyclonal) Santa Cruz Biotechnology AB_632138 WB 1:1000 Cat# 9102; RRID: Antibody p44/42 MAPK (Erk1/2) (rabbit polyclonal) Cell Signaling Technology AB_330744 WB 1:1000 Cat# 9202; RRID: Antibody p70 S6 kinase (rabbit polyclonal) Cell Signaling Technology AB_331676 WB 1:1000 Cat# 06–519; RRID: Antibody Phospho-­CREB Ser133 (rabbit polyclonal) Millipore AB_310153 WB 1:1000 Phospho-­mTOR Ser2448 (rabbit Cat# 2971; RRID: Antibody polyclonal) Cell Signaling Technology AB_330970 WB 1:1000 Phospho-­p38 MAPK Thr180/Tyr182 (rabbit Cat# 9911; RRID: Antibody polyclonal) Cell Signaling Technology AB_10695905 WB 1:1000 Phospho-­p44/42 MAPK (Erk1/2) Thr202/ Cat# 9101; RRID: Antibody Tyr204 (rabbit polyclonal) Cell Signaling Technology AB_331646 WB 1:1000 Continued on next page Conde-­Dusman, Dey, et al. eLife 2021;10:e71575. DOI: https://​doi.​org/​10.​7554/​eLife.​71575  19 of 29 Research article Cell Biology Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Phospho-­S6 ribosomal protein Ser240/244 Cat# 2215; RRID: Antibody (rabbit polyclonal) Cell Signaling Technology AB_331682 WB 1:1000 Cat# CRL-­1573; RRID: Cell line (Homo sapiens) HEK293 ATCC CVCL_0045   Chemical compound, Cat# Ab120108; CAS: drug (−)-­Bicuculline methiodide Abcam 55950-­07-­7   Chemical compound, Cat# 3693; CAS: 1303993-­ drug (D,L)-­APV sodium salt Tocris 72-­7   Chemical compound, Cat# A5892; CAS: 22862-­ drug Anisomycin Sigma-­Aldrich 76-­6   Chemical compound, drug B27 supplement Thermo Fisher Scientific Cat# 17504044   Chemical compound, drug BDNF PeproTech Cat# 450-­02; AN: P23560   Chemical compound, Cat# 1493; CAS: 1135278-­ drug CGP-­78608 Tocris 54-­4   Chemical compound, drug cOmplete Protease Inhibitor Cocktail Sigma-­Aldrich Cat# 04693116001   Chemical compound, drug Cycloheximide Sigma-­Aldrich Cat# C7698; CAS: 66-­81-­9   Chemical compound, drug MK-­801 Tocris Cat# 0924; CAS: 77086-­22-­7   Chemical compound, drug Puromycin dihydrochloride Sigma-­Aldrich Cat# P8833; CAS: 58-­58-­2   Chemical compound, Cat# J62473; CAS: 53123-­ drug Rapamycin Alfa Aesar 88-­9   Chemical compound, drug Tamoxifen Sigma-­Aldrich Cat# T5648   Chemical compound, Cat# T-­550; CAS: 18660-­ drug Tetrodotoxin citrate Alomone Labs 81-­6   Duolink In Situ Red Starter Kit Mouse/ Commercial assay, kit Rabbit Sigma-­Aldrich Cat# DUO92101   Commercial assay, kit MasterMix qPCR ROx PyroTaq EvaGreen cmb Cat# 87H24   Commercial assay, kit Nucleospin RNA Macherey-­Nagel Cat# 740955.50   Commercial assay, kit Pierce BCA Protein Assay kit Thermo Fisher Scientific Cat# 23,227   SuperScript IV First-­Strand cDNA Synthesis Commercial assay, kit System Invitrogen Cat# 18-­091-­050   Genetic reagent (Mus Cat# JAX:029974; RRID: musculus) Mouse: B6;129 × 1-­Grin3atm1Nnk/J The Jackson Laboratory IMSR_JAX:029974   Genetic reagent (Mus musculus) Mouse: CaMKIIα-CreERT2+/- Erdmann et al., 2007     Genetic reagent (Mus   musculus) Mouse: Grin3atm1a(EUCOMM)Hmgu/H EUCOMM   Genetic reagent (Mus musculus) Mouse: Sst-­IRES-­Cre The Jackson Laboratory Stock: 018973   Genetic reagent (virus) LV-­hSYN-­WPRE-­hSYN-­GFP-­WPRE Gascón et al., 2008     See Materials and methods; generated/ Genetic reagent (virus) LV-­hSYN-­GluN3A-­WPRE-­hSYN-­GFP-­WPRE This paper   stored in Perez-­Otano’s lab. LV-­hSYN-­GluN3A1082Δ-WPRE-­hSYN-­GFP-­ See Materials and methods; generated/ Genetic reagent (virus) WPRE This paper   stored in Perez-­Otano’s lab. Continued on next page Conde-­Dusman, Dey, et al. eLife 2021;10:e71575. DOI: https://​doi.​org/​10.​7554/​eLife.​71575  20 of 29 Research article Cell Biology Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Kindly provided by Dr. Addgene plasmid #11795; Genetic reagent (virus) pLentiLox3.7-­GFP (pLL3.7-­GFP) Michael Ehlers RRID: Addgene_11795   pLL3.7-­shGluN3A1185-­GFP (Target Genetic reagent (virus) sequence: CTACAGCTGAGTTTAGAAA) Yuan et al., 2013     pLL3.7-­shGIT1-­GFP (Target sequence: ​ See Materials and methods; generated/ Genetic reagent (virus) TGAT​CACA​AGAA​TGGG​CATTA) This paper   stored in Perez-­Otano’s lab. Recombinant DNA reagent (plasmid) pcDNA1-­Amp-­GluN1-­1A Perez-­Otano et al., 2001     Recombinant DNA reagent (plasmid) pcDNA1-­Amp-­GluN2A Perez-­Otano et al., 2001     Recombinant DNA reagent (plasmid) pCIneo-­GFPGluN3A Perez-­Otano et al., 2001     Recombinant DNA See Materials and methods; generated/ reagent (plasmid) pCIneo-­GFPGluN3A1082Δ This paper   stored in Perez-­Otano’s lab. Recombinant DNA Kindly provided by Dr. reagent (plasmid) pRK5-­GFP Michael Ehlers     Sequence-­based reagent (oligonucleotide) Arc_fwd (mouse) This paper   ​GAGCCTACAGAGCCAGGAGA Sequence-­based reagent (oligonucleotide) Arc_rv (mouse) This paper   ​TGCCTTGAAAGTGTCTTGGA Sequence-­based reagent (oligonucleotide) c-­Fos_fwd (mouse/rat) Chen et al., 2020   ​CTGC​TCTA​CTTT​GCCC​CTTCT Sequence-­based reagent (oligonucleotide) c-­Fos_rv (mouse/rat) Chen et al., 2020;   ​TTTATCCCCACGGTGACAGC Sequence-­based reagent (oligonucleotide) GAPDH_fwd (mouse/rat) This paper   CATGGCCTTCCGTGTTCCT Sequence-­based reagent (oligonucleotide) GAPDH_rv (mouse/ rat) This paper   ​TGAT​GTCA​TCAT​ACTT​GGCAGGTT Schneider, Rasband and Software, algorithm ImageJ Eliceiri, 2012   https://​imagej.​nih.​gov/​ij/ Software, algorithm ImageQuant software version 5.2 GE Healthcare     Software, algorithm Prism software version 7.00 Graphpad     QuantStudio 3 Design and Analysis Software, algorithm software v1.5.1 Thermo Fisher Scientific     Software, algorithm SMART software for video-­tracking PanLab S.L.     For RNAseq experiments, we performed bulk mRNA sequencing single end with a length of 50 bp using the RNAseq Illumina Hiseq2500. The preparation of the polyA sequencing library, library’s quality control and quantification, sequencing run and base calling data were carried out by the Genomics Core Facility of the Centre for Genomic Regulation (CRG, Barcelona). For the analysis, adapters were trimmed using trim_galore v0.6.4_dev and reads with longer length than 40 bp were selected. Trimmed reads were aligned using star c2.6.1b to the mouse genome (mm10). Reads with mapq >30 were selected using Samtools v1.9. Mapped reads were quantified using R scripts (R version 4.0.3, 2020), Rsubread v2.4.3 and the ​Mus_​musculus.​GRCm38.​99.​gtf annotation data. Differential expres- sion analysis was performed using DESeq2 1.31.1 and limma 3.46.0; genes were annotated using biomaRt v2.46.3 and Volcano plots were performed with EnhancedVolcano 1.6.0. The tracks from the samples were performed with DeepTools v3.5.0, normalized with RPKM and visualization was done in IGV v2.6.3. Protein extraction and western blotting Cultured neurons were collected in lysis buffer containing 50 mM Tris–HCl pH 6.8, 10 % glycerol, 2 % SDS, 0.1 M (D,L)-­dithiothreitol, 0.04 % bromophenol blue, and supplemented with protease Conde-­Dusman, Dey, et al. eLife 2021;10:e71575. DOI: https://​doi.​org/​10.​7554/​eLife.​71575  21 of 29 Research article Cell Biology (cOmplete Protease Inhibitor Cocktail) and phosphatase (PhosSTOP) inhibitors. Lysates were incu- bated for 10 min at 65 °C, briefly centrifuged at maximum speed and proteins separated by SDS–PAGE. Proteins were transferred onto PVDF membranes (GE Healthcare). After incubation with primary anti- bodies, membranes were incubated with secondary HRP-­conjugated secondary antibodies (1:10,000, GE Healthcare). Signals were visualized with film autoradiograpy or the Amerham 680 Blot Imager, and nonsaturated immunoreactive bands were quantified using the ImageQuant 5.2 software. For in vivo studies on mouse tissue, hippocampi and somatosensory cortex were dissected on ice, snapped frozen in liquid nitrogen and stored at −80 °C until processing. Tissues were homogenized in 15 (wt/vol) volumes of modified ice-­cold RIPA buffer (50 mM Tris–HCl pH 7.5, 150 mM NaCl, 1% NP-­ 40, 0.05 % deoxycholate, 0.01 % SDS) supplemented with protease and phosphatase inhibitors, soni- cated and centrifuged for 20 min at 16,200 × g at 4 °C. Protein content was estimated using a Pierce BCA Assay kit (Thermo Fisher) before immunoblotting. Immunoprecipitation Cultured cortical neurons or mouse hippocampus or somatosensory cortex were solubilized for 30 min in cold lysis buffer containing 0.1 % Triton X-­100, 0.1 % SDS, 150 mM NaCl, 10 mM EDTA and 50 mM HEPES or 0.3 % CHAPS 3-[(3-­cholamidopropyl)dimethylammonio]-1-­propanesulfonic acid, 150 mM NaCl, 1 mM EDTA, and 40 mM HEPES, supplemented with protease and phosphatase inhibitors. Insoluble material was removed by centrifugation at 16,200 × g for 15 min and 100–150 μg of the resulting supernatants were incubated overnight at 4 °C with or without (IgG−) the immunoprecip- itating antibody. Lysates were then incubated with protein A/G magnetic beads (BioRad) for 2 hr at 4 °C. Beads were precipitated using a magnetic rack, washed thrice in lysis buffer and immunoprecip- itated proteins were eluted with SDS sample buffer and analyzed by western blotting. Proximity ligation assay Cultured neurons transfected with pRK5-­GFP were fixed at DIV17 with 4 % PFA, 4 % sucrose in phos- phate buffered Saline (PBS) (RT, 10 min), incubated with blocking solution and permeabilized. Cells were then incubated with rabbit polyclonal anti-­mTOR antibody and mouse monoclonal anti-­GIT1 antibody overnight at 4 °C, washed with PBS, and incubated for 1 hr with PLA secondary probes (anti-­ mouse Plus and anti-­rabbit Minus, Olink Bioscience) at 37 °C. Cells were washed twice with Duolink II Wash Buffer A (Olink Bioscience) and incubated with the ligase (1:40; Olink Bioscience) in ligase buffer for 30 min at 37 °C. After additional washes with Buffer A, cells were incubated with DNA polymerase (1:80; Olink Bioscience) in amplification buffer for 100 min at 37 °C in the dark. Cells were then washed with Duolink II Wash Buffer B (Olink Bioscience) and incubated with chicken polyclonal anti-­GFP for 1 hr at room temperature. After washing with PBS, cells were incubated with secondary goat anti-­ chicken-­Alexa Fluor 488 for 1 hr at room temperature. Finally, cells were washed in PBS and mounted on slides with Fluoroshield mounting medium (Sigma-­Aldrich). Fluorescence images were acquired by using Nikon A1 Ti2 system with a sequential acquisition setting at 1024 × 1024 pixels resolution; cells were randomly selected from different coverslips. Protein synthesis assays Basal protein synthesis was measured using a SUnSET (surface sensing of translation) assay. Briefly, primary cortical cultures were treated with 10 ng/ ml of puromycin for 30 min and lysed as described above. Untreated neurons and neurons preincubated with the protein synthesis inhibitor cyclohexi- mide (15 min before puromycin) were used as controls. Proteins were resolved by SDS–PAGE and analyzed by western blotting using an anti-­puromycin antibody. Ponceau S staining was used as protein loading control. Behavioral analysis Morris water maze Mice were trained to find a submerged platform in a circular tank (190 cm diameter) filled with opaque white water in two or four trials per day with 45 min intertrial intervals (ITIs). If mice did not find the platform in 120 s, they were kindly guided to it. The hidden platform was relocated to the opposite quadrant after 7 days of training for the reversal training phase. Sixty-­second-­long probe tests in which platform was removed were performed at the end of each phase (PT1, after initial hidden Conde-­Dusman, Dey, et al. eLife 2021;10:e71575. DOI: https://​doi.​org/​10.​7554/​eLife.​71575  22 of 29 Research article Cell Biology platform learning; PT2, after reversal learning), and time spent in the target quadrant was compared to the average time spent in all other quadrants. Mice were tracked throughout the whole protocol using the video-­tracking software SMART (Panlab S.L.). Y-maze spontaneous alternation Mice were introduced in a three-­armed Y-­shaped maze and recorded for 5 min. Correct triad scores were noted when all three arms were sequentially entered. Alternation indices were calculated as correct triads/possible triads. Maze was cleaned between animals with a water-­based soap solution. Conditioned taste aversion Test was adapted from Adaikkan and Rosenblum, 2015. In brief, mice were trained to drink from two bottles of water for 6 days. On conditioning day, water was changed for 0.2 % (regular CTA) or 0.1 % (weak CTA) saccharin for 40 min (regular) or 5 hr (weak) after the exposure, mice were injected LiCl intraperitoneally at 0.15 M (regular) or 0.025 M (weak). Saccharin preference was evaluated 24 hr after injection. For unconditioned taste preference, mice were presented two drinking bottles for 48 hr: one contained water and the other one of the following solutions: sucrose 5 % (sweet), NaCl 75 mM (salty), quinine 300 µM (bitter), and HCl 0.03 M (sour). Bottle sides were switched after 24 hr to avoid potential side bias. Solution preference was evaluated at 48 hr. For assessing sensitivity to LiCl toxicity, ‘lying on belly’ behavior was registered after injection of LiCl (0.15 M) or saline. This behavior consists in a totally general suppression of activity, and location of the mouse in the corner of a cage. The activity was measured for 20 min. Fear conditioning and extinction FC and FE procedures were carried out with a computerized Fear and Startle system (Panlab-­Harvard, Barcelona, Spain). Tones and shocks were delivered and controlled using Freezing v1.3.04 software (Panlab-­Harvard, Barcelona, Spain). The fear chambers consisted of a black methacrylate box with a transparent front door (25 × 25 × 25 cm) inside a sound-­attenuating cubicle (67 × 53 × 55 cm). Animals were habituated to the chambers for 5 min/day during two consecutive days prior to FC. The cham- bers were carefully cleaned before and after each mouse. For contextual FC, mice were placed in the fear chambers and allowed to explore a context (CS) (metal grid floor, no light source) for 2 min. Mice were then presented with a tone (30 s, 2.8 kHz, 85 dB tone) that coterminated with a foot-­shock (US) (0.3 mA, 2 s). Sixty seconds later, they were returned to their home cage. Conditioning was assessed at 1 (short-­term memory), 24, and 48 hr or 7 days (long-­term memory) by reintroducing mice in the conditioning context for 5 min. Freezing behavior, a rodent’s natural response to fear defined as the absence of movement except respiration, was scored by a high sensitivity weight transducer system located at the bottom of the experimental chambers which records and analyses the signal generated by the movement of the animal. For cued FC, mice were placed in the fear chambers for 5 min and then received five trials of a tone (CS) (30 s, 6 kHz, 75 dB) that coterminated with a foot-­shock (US) (0.3 mA, 1 s). The ITI was of 3 min, and three additional minutes followed the last trial. The FE sessions were performed four times in consecutive days (FE1, FE2, FE3, and FE4) starting 24 hr after FC. For FE, mice were placed in the fear chambers for 5 min and then exposed to 15 trials of the 30 s CS tone alone (cued-­fear) with a 30 s of ITI interval. An additional 30-­s interval followed the last trial of FE. Different contexts were used for FC and FE tests. FC context consisted of a yellow light source (~10 lux), a grid floor of 25 bars (3 mm Ø and 10 mm between bars), a background noise of 60 dB produced by a ventilation fan and soapy water in a solution of ethanol 70 % was used for cleaning between sessions. FE context consisted of a red-­light source (~10 lux), a grey plexiglass floor covering the bars, no background noise and soapy water in a solution of isopropyl alcohol 40 % was used as cleaning agent between sessions. Different routes were used to transport animals from their home cages to testing room in FC and FE days. Freezing levels were scored and averaged in 30-­s slots. Electrophysiology HEK293 cells were cultured, transfected, and recorded as previously described using GluN1A and GluN2A in pcDNA1/Amp and GFP-­tagged GluN3A or GluN3A1082Δ subcloned in pCI-­neo (Chow- dhury et al., 2013). HEK293 cells were obtained from ATCC, and no mycoplasm contamination was Conde-­Dusman, Dey, et al. eLife 2021;10:e71575. DOI: https://​doi.​org/​10.​7554/​eLife.​71575  23 of 29 Research article Cell Biology detected by regular testing. Briefly, cells were transfected with GluN1-­1A, GluN2A, and either GFP-­ GluN3A or GFP-­GluN3A1082Δ in a 1:1:3 ratio and maintained in medium with APV (250 μM). GFP was used as a transfection marker in cells where GluN3A constructs were omitted. Whole-­cell record- ings were made with on GFP-­positive cells using a Multiclamp 700 A amplifier (Molecular Devices) 24 hr following transfection. Patch pipettes (2–4 MΩ) contained (in mM): 140 Cs methanesulfonate, 10 HEPES, 5 adenosine triphosphate (Na salt), 5 MgCl2, 0.2 CaCl2, and 10 BAPTA (pH 7.4). The extra- cellular solution contained (in mM) 150 NaCl, 5 KCl, 2 or 10 CaCl2, 10 HEPES, 10 glucose (pH 7.4), and was adjusted to 330 mOsm with sucrose. Currents were digitized at 2 kHz and filtered at 1 kHz. Series resistance (90–95%) and whole-­cell capacitance compensation were employed. Experiments were performed at a holding potential of –80 mV with ramps (300 ms to +50 mV) elicited following a 3 s application of glutamate (1 mM) and glycine (100 μM) at 20 °C. The ΔErev, was calculated by subtracting the Erev obtained in 2 mM Ca2+ from the Erev measured in 10 mM Ca2+ and corrected for the junction potential between solutions. Initial peak currents were obtained from 1 s agonist applications in 2 mM Ca2+ and used to calculate the current density. Experiments on glycine-­gated diheteromeric GluN1/GluN3A receptors expressed in HEK293 cells were performed as previously described (Grand et al., 2018) using GluN1-­1a and GFP-­GluN3A or GFP-­GluN3A1082Δ subcloned in pCI-­neo (see above). Statistical analysis Statistical analyses were conducted with GraphPad Prism software. Comparison of quantitative vari- ables between two groups was performed using Student’s t-­test. One- or two-­way analysis of vari- ance (ANOVA) followed by a post hoc comparison test were used when more than two groups were compared, as indicated in the corresponding figure legend. Results are presented as mean ± standard error of the mean (SEM). Statistical methods used for behavioral studies are indicated in the corre- sponding figure legends. Acknowledgements We thank Stuart Lipton and Nobuki Nakanishi for providing the Grin3a knockout mice, Beverly Davidson for the AAV-­caRheb, Jose Esteban for help with behavioral and biochemical experiments, and Noelia Campillo, Rebeca Martínez-­Turrillas, and Ana Navarro for expert technical help. Work was funded by the UTE project CIMA; fellowships from the Fundación Tatiana Pérez de Guzmán el Bueno, FEBS, and IBRO (to M.J.C.D.), Generalitat Valenciana (to O.E.-Z.), Juan de la Cierva (to L.G.R.), FPI-­ MINECO (to E.R.V., to S.N.) and Intertalentum postdoctoral program (to V.B.); ANR (GluBrain3A) and ERC Advanced Grants (#693021) (to P.P.); Ramón y Cajal program RYC2014-­15784, RETOS-­MINECO SAF2016-­76565-­R, ERANET-­Neuron JTC 2019 ISCIII AC19/00077 FEDER funds (to R.A.); RETOS-­ MINECO SAF2017-­87928-­R (to A.B.); an NIH grant (NS76637) and UTHSC College of Medicine funds (to S.J.T.); and NARSAD Independent Investigator Award and grants from the MINECO (CSD2008-­00005, SAF2013-­48983R, SAF2016-­80895-­R), Generalitat Valenciana (PROMETEO 2019/020)(to I.P.O.) and Severo-­Ochoa Excellence Awards (SEV-­2013-­0317, SEV-­2017-­0723). Additional information Funding Funder Grant reference number Author H2020 European Research ERC 693021 Pierre Paoletti Council Ministerio de Economía, SAF2016-76565-R Raül Andero Galí Industria y Competitividad, Gobierno de España Ministerio de Economía, SAF2017-87928-R Angel Barco Industria y Competitividad, Gobierno de España Conde-­Dusman, Dey, et al. eLife 2021;10:e71575. DOI: https://​doi.​org/​10.​7554/​eLife.​71575  24 of 29 Research article Cell Biology Funder Grant reference number Author Generalitat Valenciana PROMETEO 2019/020 Isabel Perez-Otaño Ministerio de Economía, CSD2008-00005 Isabel Perez-Otaño Industria y Competitividad, Gobierno de España Ministerio de Economía, SAF2013-48983R Isabel Perez-Otaño Industria y Competitividad, Gobierno de España Ministerio de Economía, SAF2016-80895r Isabel Perez-Otaño Industria y Competitividad, Gobierno de España National Institutes of NS76637 Steven J Tavalin Health University of Tennessee UTHSC College of Steven J Tavalin Medicine Funds Agence Nationale de la GluBrain3A Pierre Paoletti Recherche Instituto de Salud Carlos III AC19/00077 Raül Andero Galí Ministerio de Economía, RYC2014-15784 Raül Andero Galí Industria y Competitividad, Gobierno de España Ministerio de Economía, SEV-2013-0317 Isabel Perez-Otaño Industria y Competitividad, Gobierno de España Ministerio de Economía, SEV-2017-0723 Isabel Perez-Otaño Industria y Competitividad, Gobierno de España Brain and Behavior NARSAD Independent Isabel Perez-Otaño Research Foundation Investigator Award Ministerio de Economía, BFU-2016-80918-R John F Wesseling Industria y Competitividad, Gobierno de España Agencia Estatal de PID2019-111112RB-I00 Isabel Perez-Otaño Investigación The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication. Author contributions María J Conde-­Dusman, Partha N Dey, Conceptualization, Investigation, Methodology, Writing – original draft, Writing – review and editing; Óscar Elía-­Zudaire, Investigation, Methodology, Writing – review and editing; Luis G Rabaneda, Conceptualization, Investigation, Methodology; Carmen García-­Lira, Teddy Grand, Victor Briz, Eric R Velasco, Raül Andero, Sergio Niñerola, Angel Barco, Pierre Paoletti, Fabrizio Gardoni, Steven J Tavalin, Investigation; John F Wesseling, Conceptualization, Investigation, Writing – original draft, Writing – review and editing; Isabel Perez-­Otaño, Conceptu- alization, Funding acquisition, Investigation, Methodology, Project administration, Writing – original draft, Writing – review and editing Author ORCIDs María J Conde-­Dusman ‍ ‍http://​orcid.​org/​0000-​0001-​6841-​2181 Óscar Elía-­Zudaire ‍ ‍http://​orcid.​org/​0000-​0002-​1396-​834X Victor Briz ‍ ‍http://​orcid.​org/​0000-​0001-​6936-​0918 Angel Barco ‍ ‍http://​orcid.​org/​0000-​0002-​0653-​3751 Pierre Paoletti ‍ ‍http://​orcid.​org/​0000-​0002-​3681-​4845 Fabrizio Gardoni ‍ ‍http://​orcid.​org/​0000-​0003-​4598-​5563 Steven J Tavalin ‍ ‍http://​orcid.​org/​0000-​0001-​7169-​0932 Isabel Perez-­Otaño ‍ ‍http://​orcid.​org/​0000-​0002-​7222-​8202 Conde-­Dusman, Dey, et al. eLife 2021;10:e71575. DOI: https://​doi.​org/​10.​7554/​eLife.​71575  25 of 29 Research article Cell Biology Ethics All procedures were conducted in accordance with the European and Spanish regulations (2010/63/ UE; RD 53/2013) and were approved by the Ethical Committee of the Generalitat Valenciana (2017/ VSC/PEA/00196). For the cued-­fear conditioning experiments, ethic protocols were approved by the Committee of Ethics of the Universitat Autónoma de Barcelona and the Generalitat de Catalunya. Decision letter and Author response Decision letter https://​doi.​org/​10.​7554/​eLife.​71575.​sa1 Author response https://​doi.​org/​10.​7554/​eLife.​71575.​sa2 Additional files Supplementary files •  Transparent reporting form Data availability RNAseq data have been deposited at GEO-­NCBI under the access code GSE175920. The following dataset was generated: Author(s) Year Dataset title Dataset URL Database and Identifier Conde-­Dusman MJ, 2021 RNAseq data in cultured https://www.​ncbi.​ NCBI Gene Expression Perez-­Otaño I nerons nlm.​nih.​gov/​geo/​ Omnibus, GSE175920 query/​acc.​cgi?​acc=​ GSE175920 References Abel T, Martin KC, Bartsch D, Kandel ER. 1998. Memory suppressor genes: inhibitory constraints on the storage of long-­term memory. Science 279: 338–341. DOI: https://​doi.​org/​10.​1126/​science.​279.​5349.​338, PMID: 9454331 Adaikkan C, Rosenblum K. 2015. A molecular mechanism underlying gustatory memory trace for an association in the insular cortex. eLife 4: e07582. DOI: https://​doi.​org/​10.​7554/​eLife.​07582, PMID: 26452094 Andero R, Ressler KJ. 2012. Fear extinction and BDNF: translating animal models of PTSD to the clinic. Genes, Brain, and Behavior 11: 503–512. DOI: https://​doi.​org/​10.​1111/​j.​1601-​183X.​2012.​00801.​x, PMID: 22530815 Banko JL, Merhav M, Stern E, Sonenberg N, Rosenblum K, Klann E. 2007. Behavioral alterations in mice lacking the translation repressor 4E-­BP2. Neurobiology of Learning and Memory 87: 248–256. DOI: https://​doi.​org/​10.​ 1016/​j.​nlm.​2006.​08.​012, PMID: 17029989 Benjamin D, Hall MN. 2014. mTORC1: turning off is just as important as turning on. Cell 156: 627–628. DOI: https://​doi.​org/​10.​1016/​j.​cell.​2014.​01.​057, PMID: 24529368 Cammalleri M, Lütjens R, Berton F, King AR, Simpson C, Francesconi W, Sanna PP. 2003. Time-­restricted role for dendritic activation of the mTOR-­p70S6K pathway in the induction of late-­phase long-­term potentiation in the CA1. PNAS 100: 14368–14373. DOI: https://​doi.​org/​10.​1073/​pnas.​2336098100, PMID: 14623952 Chen LF, Lyons MR, Liu F, Green MV, Hedrick NG, Williams AB, Narayanan A, Yasuda R, West AE. 2020. The NMDA receptor subunit GluN3A regulates synaptic activity-­induced and myocyte enhancer factor 2C (MEF2C)-­ dependent transcription. The Journal of Biological Chemistry 295: 8613–8627. DOI: https://​doi.​org/​10.​1074/​ jbc.​RA119.​010266, PMID: 32393578 Chiang GG, Abraham RT. 2005. Phosphorylation of mammalian target of rapamycin (mTOR) at Ser-­2448 is mediated by p70S6 kinase. The Journal of Biological Chemistry 280: 25485–25490. DOI: https://​doi.​org/​10.​ 1074/​jbc.​M501707200, PMID: 15899889 Cho J, Yu N-­K, Choi J-­H, Sim S-­E, Kang SJ, Kwak C, Lee S-­W, Kim J, Choi DI, Kim VN, Kaang B-­K. 2015. Multiple repressive mechanisms in the hippocampus during memory formation. Science 350: 82–87. DOI: https://​doi.​ org/​10.​1126/​science.​aac7368, PMID: 26430118 Chowdhury D, Marco S, Brooks IM, Zandueta A, Rao Y, Haucke V, Wesseling JF, Tavalin SJ, Pérez-­Otaño I. 2013. Tyrosine phosphorylation regulates the endocytosis and surface expression of GluN3A-­containing NMDA receptors. The Journal of Neuroscience 33: 4151–4164. DOI: https://​doi.​org/​10.​1523/​JNEUROSCI.​2721-​12.​ 2013, PMID: 23447623 Costa-­Mattioli M, Gobert D, Stern E, Gamache K, Colina R, Cuello C, Sossin W, Kaufman R, Pelletier J, Rosenblum K, Krnjević K, Lacaille J-­C, Nader K, Sonenberg N. 2007. eIF2alpha phosphorylation bidirectionally regulates the switch from short- to long-­term synaptic plasticity and memory. Cell 129: 195–206. DOI: https://​ doi.​org/​10.​1016/​j.​cell.​2007.​01.​050, PMID: 17418795 Conde-­Dusman, Dey, et al. eLife 2021;10:e71575. DOI: https://​doi.​org/​10.​7554/​eLife.​71575  26 of 29 Research article Cell Biology Costa-­Mattioli M, Monteggia LM. 2013. mTOR complexes in neurodevelopmental and neuropsychiatric disorders. Nature Neuroscience 16: 1537–1543. DOI: https://​doi.​org/​10.​1038/​nn.​3546, PMID: 24165680 De Rubeis S, Pasciuto E, Li KW, Fernández E, Di Marino D, Buzzi A, Ostroff LE, Klann E, Zwartkruis FJT, Komiyama NH, Grant SGN, Poujol C, Choquet D, Achsel T, Posthuma D, Smit AB, Bagni C. 2013. CYFIP1 coordinates mRNA translation and cytoskeleton remodeling to ensure proper dendritic spine formation. Neuron 79: 1169–1182. DOI: https://​doi.​org/​10.​1016/​j.​neuron.​2013.​06.​039, PMID: 24050404 Erdmann G, Schütz G, Berger S. 2007. ducible gene inactivation in neurons of the adult mouse forebrain. BMC Neuroscience 8: 63. DOI: https://​doi.​org/​10.​1186/​1471-​2202-​8-​63, PMID: 17683525 Fiuza M, González-­González I, Pérez-­Otaño I. 2013. GluN3A expression restricts spine maturation via inhibition of GIT1/Rac1 signaling. PNAS 110: 20807–20812. DOI: https://​doi.​org/​10.​1073/​pnas.​1312211110, PMID: 24297929 Flavell SW, Greenberg ME. 2008. Signaling mechanisms linking neuronal activity to gene expression and plasticity of the nervous system. Annual Review of Neuroscience 31: 563–590. DOI: https://​doi.​org/​10.​1146/​ annurev.​neuro.​31.​060407.​125631, PMID: 18558867 Fonseca R, Nägerl UV, Morris RGM, Bonhoeffer T. 2004. Competing for memory: hippocampal LTP under regimes of reduced protein synthesis. Neuron 44: 1011–1020. DOI: https://​doi.​org/​10.​1016/​j.​neuron.​2004.​10.​ 033, PMID: 15603743 Fulcher BD, Murray JD, Zerbi V, Wang XJ. 2019. Multimodal gradients across mouse cortex. PNAS 116: 4689–4695. DOI: https://​doi.​org/​10.​1073/​pnas.​1814144116, PMID: 30782826 Gallinat J, Götz T, Kalus P, Bajbouj M, Sander T, Winterer G. 2007. Genetic variations of the NR3A subunit of the NMDA receptor modulate prefrontal cerebral activity in humans. Journal of Cognitive Neuroscience 19: 59–68. DOI: https://​doi.​org/​10.​1162/​jocn.​2007.​19.​1.​59, PMID: 17214563 Gascón S, Paez-­Gomez JA, Díaz-­Guerra M, Scheiffele P, Scholl FG. 2008. Dual-­promoter lentiviral vectors for constitutive and regulated gene expression in neurons. Journal of Neuroscience Methods 168: 104–112. DOI: https://​doi.​org/​10.​1016/​j.​jneumeth.​2007.​09.​023, PMID: 17983662 Govindarajan A, Israely I, Huang SY, Tonegawa S. 2011. The dendritic branch is the preferred integrative unit for protein synthesis-­dependent LTP. Neuron 69: 132–146. DOI: https://​doi.​org/​10.​1016/​j.​neuron.​2010.​12.​008, PMID: 21220104 Grand T, Abi Gerges S, David M, Diana MA, Paoletti P. 2018. Unmasking GluN1/GluN3A excitatory glycine NMDA receptors. Nature Communications 9: 4769. DOI: https://​doi.​org/​10.​1038/​s41467-​018-​07236-​4, PMID: 30425244 Greenwood TA, Lazzeroni LC, Maihofer AX, Swerdlow NR, Calkins ME, Freedman R, Green MF, Light GA, Nievergelt CM, Nuechterlein KH, Radant AD, Siever LJ, Silverman JM, Stone WS, Sugar CA, Tsuang DW, Tsuang MT, Turetsky BI, Gur RC, Gur RE, et al. 2019. Genome-­wide Association of Endophenotypes for Schizophrenia From the Consortium on the Genetics of Schizophrenia (COGS) Study. JAMA Psychiatry 76: 1274. DOI: https://​doi.​org/​10.​1001/​jamapsychiatry.​2019.​2850 Hardingham GE, Fukunaga Y, Bading H. 2002. Extrasynaptic NMDARs oppose synaptic NMDARs by triggering CREB shut-­off and cell death pathways. Nature Neuroscience 5: 405–414. DOI: https://​doi.​org/​10.​1038/​nn835, PMID: 11953750 Heaton P, Wallace GL. 2004. Annotation: the savant syndrome. Journal of Child Psychology and Psychiatry, and Allied Disciplines 45: 899–911. DOI: https://​doi.​org/​10.​1111/​j.​1469-​7610.​2004.​t01-​1-​00284.​x, PMID: 15225334 Henson MA, Larsen RS, Lawson SN, Pérez-­Otaño I, Nakanishi N, Lipton SA, Philpot BD. 2012. Genetic deletion of NR3A accelerates glutamatergic synapse maturation. PLOS ONE 7: e42327. DOI: https://​doi.​org/​10.​1371/​ journal.​pone.​0042327, PMID: 22870318 Hoeffer CA, Tang W, Wong H, Santillan A, Patterson RJ, Martinez LA, Tejada-­Simon MV, Paylor R, Hamilton SL, Klann E. 2008. Removal of FKBP12 enhances mTOR-­Raptor interactions, LTP, memory, and perseverative/ repetitive behavior. Neuron 60: 832–845. DOI: https://​doi.​org/​10.​1016/​j.​neuron.​2008.​09.​037, PMID: 19081378 Holt CE, Martin KC, Schuman EM. 2019. Local translation in neurons: visualization and function. Nature Structural & Molecular Biology 26: 557–566. DOI: https://​doi.​org/​10.​1038/​s41594-​019-​0263-​5, PMID: 31270476 Holtmaat A, Caroni P. 2016. Functional and structural underpinnings of neuronal assembly formation in learning. Nature Neuroscience 19: 1553–1562. DOI: https://​doi.​org/​10.​1038/​nn.​4418, PMID: 27749830 Hong ST, Mah W. 2015. A Critical Role of GIT1 in Vertebrate and Invertebrate Brain Development. Experimental Neurobiology 24: 8–16. DOI: https://​doi.​org/​10.​5607/​en.​2015.​24.​1.​8, PMID: 25792865 Hou L, Klann E. 2004. Activation of the phosphoinositide 3-­kinase-­Akt-­mammalian target of rapamycin signaling pathway is required for metabotropic glutamate receptor-­dependent long-­term depression. The Journal of Neuroscience 24: 6352–6361. DOI: https://​doi.​org/​10.​1523/​JNEUROSCI.​0995-​04.​2004, PMID: 15254091 Huang X, Chen Y-­Y, Shen Y, Cao X, Li A, Liu Q, Li Z, Zhang L-­B, Dai W, Tan T, Arias-­Carrion O, Xue Y-­X, Su H, Yuan T-­F. 2017. Methamphetamine abuse impairs motor cortical plasticity and function. Molecular Psychiatry 22: 1274–1281. DOI: https://​doi.​org/​10.​1038/​mp.​2017.​143, PMID: 28831198 Josselyn SA, Tonegawa S. 2020. Memory engrams: Recalling the past and imagining the future. Science 367: eaaw4325. DOI: https://​doi.​org/​10.​1126/​science.​aaw4325, PMID: 31896692 Kehoe LA, Bellone C, De Roo M, Zandueta A, Dey PN, Pérez-­Otaño I, Muller D. 2014. GluN3A promotes dendritic spine pruning and destabilization during postnatal development. The Journal of Neuroscience 34: 9213–9221. DOI: https://​doi.​org/​10.​1523/​JNEUROSCI.​5183-​13.​2014, PMID: 25009255 Kelleher RJ, Bear MF. 2008. The autistic neuron: troubled translation? Cell 135: 401–406. DOI: https://​doi.​org/​ 10.​1016/​j.​cell.​2008.​10.​017, PMID: 18984149 Conde-­Dusman, Dey, et al. eLife 2021;10:e71575. DOI: https://​doi.​org/​10.​7554/​eLife.​71575  27 of 29 Research article Cell Biology Kim MJ, Biag J, Fass DM, Lewis MC, Zhang Q, Fleishman M, Gangwar SP, Machius M, Fromer M, Purcell SM, McCarroll SA, Rudenko G, Premont RT, Scolnick EM, Haggarty SJ. 2017. Functional analysis of rare variants found in schizophrenia implicates a critical role for GIT1-­PAK3 signaling in neuroplasticity. Molecular Psychiatry 22: 417–429. DOI: https://​doi.​org/​10.​1038/​mp.​2016.​98, PMID: 27457813 Klann E, Dever TE. 2004. Biochemical mechanisms for translational regulation in synaptic plasticity. Nature Reviews. Neuroscience 5: 931–942. DOI: https://​doi.​org/​10.​1038/​nrn1557, PMID: 15550948 Lipton JO, Sahin M. 2014. The neurology of mTOR. Neuron 84: 275–291. DOI: https://​doi.​org/​10.​1016/​j.​neuron.​ 2014.​09.​034, PMID: 25374355 Liu GY, Sabatini DM. 2020. mTOR at the nexus of nutrition, growth, ageing and disease. Nature Reviews. Molecular Cell Biology 21: 183–203. DOI: https://​doi.​org/​10.​1038/​s41580-​019-​0199-​y, PMID: 31937935 Lyons MR, West AE. 2011. Mechanisms of specificity in neuronal activity-­regulated gene transcription. Progress in Neurobiology 94: 259–295. DOI: https://​doi.​org/​10.​1016/​j.​pneurobio.​2011.​05.​003, PMID: 21620929 Marco S, Giralt A, Petrovic MM, Pouladi MA, Martínez-­Turrillas R, Martínez-­Hernández J, Kaltenbach LS, Torres-­Peraza J, Graham RK, Watanabe M, Luján R, Nakanishi N, Lipton SA, Lo DC, Hayden MR, Alberch J, Wesseling JF, Pérez-­Otaño I. 2013. Suppressing aberrant GluN3A expression rescues synaptic and behavioral impairments in Huntington’s disease models. Nature Medicine 19: 1030–1038. DOI: https://​doi.​org/​10.​1038/​ nm.​3246, PMID: 23852340 Marco S, Murillo A, Pérez-­Otaño I. 2018. RNAi-­Based GluN3A Silencing Prevents and Reverses Disease Phenotypes Induced by Mutant huntingtin. Molecular Therapy 26: 1965–1972. DOI: https://​doi.​org/​10.​1016/​j.​ ymthe.​2018.​05.​013, PMID: 29914757 Martyn AC, Toth K, Schmalzigaug R, Hedrick NG, Rodriguiz RM, Yasuda R, Wetsel WC, Premont RT. 2018. GIT1 regulates synaptic structural plasticity underlying learning. PLOS ONE 13: e0194350. DOI: https://​doi.​org/​10.​ 1371/​journal.​pone.​0194350, PMID: 29554125 Mueller HT, Meador-­Woodruff JH. 2004. NR3A NMDA receptor subunit mRNA expression in schizophrenia, depression and bipolar disorder. Schizophrenia Research 71: 361–370. DOI: https://​doi.​org/​10.​1016/​j.​schres.​ 2004.​02.​016, PMID: 15474907 Murillo A, Navarro AI, Puelles E, Zhang Y, Petros TJ, Pérez-­Otaño I. 2021. Temporal Dynamics and Neuronal Specificity of Grin3a Expression in the Mouse Forebrain. Cerebral Cortex 31: 1914–1926. DOI: https://​doi.​org/​ 10.​1093/​cercor/​bhaa330, PMID: 33290502 Ohi K, Hashimoto R, Ikeda M, Yamamori H, Yasuda Y, Fujimoto M, Umeda-­Yano S, Fukunaga M, Fujino H, Watanabe Y, Iwase M, Kazui H, Iwata N, Weinberger DR, Takeda M. 2015. Glutamate Networks Implicate Cognitive Impairments in Schizophrenia: Genome-­Wide Association Studies of 52 Cognitive Phenotypes. Schizophrenia Bulletin 41: 909–918. DOI: https://​doi.​org/​10.​1093/​schbul/​sbu171, PMID: 25537281 Otsu Y, Darcq E, Pietrajtis K, Mátyás F, Schwartz E, Bessaih T, Abi Gerges S, Rousseau CV, Grand T, Dieudonné S, Paoletti P, Acsády L, Agulhon C, Kieffer BL, Diana MA. 2019. Control of aversion by glycine-­gated GluN1/ GluN3A NMDA receptors in the adult medial habenula. Science 366: 250–254. DOI: https://​doi.​org/​10.​1126/​ science.​aax1522, PMID: 31601771 Paoletti P, Bellone C, Zhou Q. 2013. NMDA receptor subunit diversity: impact on receptor properties, synaptic plasticity and disease. Nature Reviews. Neuroscience 14: 383–400. DOI: https://​doi.​org/​10.​1038/​nrn3504, PMID: 23686171 Papenberg G, Li S-­C, Nagel IE, Nietfeld W, Schjeide B-­M, Schröder J, Bertram L, Heekeren HR, Lindenberger U, Bäckman L. 2014. Dopamine and glutamate receptor genes interactively influence episodic memory in old age. Neurobiology of Aging 35: 1213.. DOI: https://​doi.​org/​10.​1016/​j.​neurobiolaging.​2013.​11.​014 Perez-­Otano I, Schulteis CT, Contractor A, Lipton SA, Trimmer JS, Sucher NJ, Heinemann SF. 2001. Assembly with the NR1 subunit is required for surface expression of NR3A-­containing NMDA receptors. The Journal of Neuroscience 21: 1228–1237. DOI: https://​doi.​org/​10.​1523/​JNEUROSCI.​21-​04-​01228.​2001, PMID: 11160393 Pérez-­Otaño I, Luján R, Tavalin SJ, Plomann M, Modregger J, Liu X-­B, Jones EG, Heinemann SF, Lo DC, Ehlers MD. 2006. Endocytosis and synaptic removal of NR3A-­containing NMDA receptors by PACSIN1/ syndapin1. Nature Neuroscience 9: 611–621. DOI: https://​doi.​org/​10.​1038/​nn1680, PMID: 16617342 Pérez-­Otaño I, Larsen RS, Wesseling JF. 2016. Emerging roles of GluN3-­containing NMDA receptors in the CNS. Nature Reviews. Neuroscience 17: 623–635. DOI: https://​doi.​org/​10.​1038/​nrn.​2016.​92, PMID: 27558536 Poulopoulos A, Murphy AJ, Ozkan A, Davis P, Hatch J, Kirchner R, Macklis JD. 2019. Subcellular transcriptomes and proteomes of developing axon projections in the cerebral cortex. Nature 565: 356–360. DOI: https://​doi.​ org/​10.​1038/​s41586-​018-​0847-​y, PMID: 30626971 Rao VR, Pintchovski SA, Chin J, Peebles CL, Mitra S, Finkbeiner S. 2006. AMPA receptors regulate transcription of the plasticity-­related immediate-­early gene Arc. Nature Neuroscience 9: 887–895. DOI: https://​doi.​org/​10.​ 1038/​nn1708, PMID: 16732277 Roberts AC, Díez-­García J, Rodriguiz RM, López IP, Luján R, Martínez-­Turrillas R, Picó E, Henson MA, Bernardo DR, Jarrett TM, Clendeninn DJ, López-­Mascaraque L, Feng G, Lo DC, Wesseling JF, Wetsel WC, Philpot BD, Pérez-­Otaño I. 2009. Downregulation of NR3A-­containing NMDARs is required for synapse maturation and memory consolidation. Neuron 63: 342–356. DOI: https://​doi.​org/​10.​1016/​j.​neuron.​2009.​06.​ 016, PMID: 19679074 Sadat-­Shirazi MS, Ashabi G, Hessari MB, Khalifeh S, Neirizi NM, Matloub M, Safarzadeh M, Vousooghi N, Zarrindast MR. 2019. NMDA receptors of blood lymphocytes anticipate cognitive performance variations in healthy volunteers. Physiology & Behavior 201: 53–58. DOI: https://​doi.​org/​10.​1016/​j.​physbeh.​2018.​12.​015 Conde-­Dusman, Dey, et al. eLife 2021;10:e71575. DOI: https://​doi.​org/​10.​7554/​eLife.​71575  28 of 29 Research article Cell Biology Sancak Y, Bar-­Peled L, Zoncu R, Markhard AL, Nada S, Sabatini DM. 2010. Ragulator-­Rag complex targets mTORC1 to the lysosomal surface and is necessary for its activation by amino acids. Cell 141: 290–303. DOI: https://​doi.​org/​10.​1016/​j.​cell.​2010.​02.​024, PMID: 20381137 Santini E, Huynh TN, MacAskill AF, Carter AG, Pierre P, Ruggero D, Kaphzan H, Klann E. 2013. Exaggerated translation causes synaptic and behavioural aberrations associated with autism. Nature 493: 411–415. DOI: https://​doi.​org/​10.​1038/​nature11782, PMID: 23263185 Sarker G, Sun W, Rosenkranz D, Pelczar P, Opitz L, Efthymiou V, Wolfrum C, Peleg-­Raibstein D. 2019. Maternal overnutrition programs hedonic and metabolic phenotypes across generations through sperm tsRNAs. PNAS 116: 10547–10556. DOI: https://​doi.​org/​10.​1073/​pnas.​1820810116, PMID: 31061112 Sharma V, Sood R, Khlaifia A, Eslamizade MJ, Hung T-­Y, Lou D, Asgarihafshejani A, Lalzar M, Kiniry SJ, Stokes MP, Cohen N, Nelson AJ, Abell K, Possemato AP, Gal-­Ben-­Ari S, Truong VT, Wang P, Yiannakas A, Saffarzadeh F, Cuello AC, et al. 2020. eIF2α controls memory consolidation via excitatory and somatostatin neurons. Nature 586: 412–416. DOI: https://​doi.​org/​10.​1038/​s41586-​020-​2805-​8, PMID: 33029011 Shrestha P, Ayata P, Herrero-­Vidal P, Longo F, Gastone A, LeDoux JE, Heintz N, Klann E. 2020a. Cell-­type-­specific drug-­inducible protein synthesis inhibition demonstrates that memory consolidation requires rapid neuronal translation. Nature Neuroscience 23: 281–292. DOI: https://​doi.​org/​10.​1038/​s41593-​019-​0568-​z, PMID: 31959934 Shrestha P, Shan Z, Mamcarz M, Ruiz KSA, Zerihoun AT, Juan CY, Herrero-­Vidal PM, Pelletier J, Heintz N, Klann E. 2020b. Amygdala inhibitory neurons as loci for translation in emotional memories. Nature 586: 407–411. DOI: https://​doi.​org/​10.​1038/​s41586-​020-​2793-8 Smithson LJ, Gutmann DH. 2016. Proteomic analysis reveals GIT1 as a novel mTOR complex component critical for mediating astrocyte survival. Genes & Development 30: 1383–1388. DOI: https://​doi.​org/​10.​1101/​gad.​ 279661.​116 Sossin WS, Costa-­Mattioli M. 2019. Translational Control in the Brain in Health and Disease. Cold Spring Harbor Perspectives in Biology 11: a032912. DOI: https://​doi.​org/​10.​1101/​cshperspect.​a032912 Stern E, Chinnakkaruppan A, David O, Sonenberg N, Rosenblum K. 2013. Blocking the eIF2α kinase (PKR) enhances positive and negative forms of cortex-­dependent taste memory. The Journal of Neuroscience 33: 2517–2525. DOI: https://​doi.​org/​10.​1523/​JNEUROSCI.​2322-​12.​2013, PMID: 23392680 Stoica L, Zhu PJ, Huang W, Zhou H, Kozma SC, Costa-­Mattioli M. 2011. Selective pharmacogenetic inhibition of mammalian target of Rapamycin complex I (mTORC1) blocks long-­term synaptic plasticity and memory storage. PNAS 108: 3791–3796. DOI: https://​doi.​org/​10.​1073/​pnas.​1014715108, PMID: 21307309 Takata A, Iwayama Y, Fukuo Y, Ikeda M, Okochi T, Maekawa M, Toyota T, Yamada K, Hattori E, Ohnishi T, Toyoshima M, Ujike H, Inada T, Kunugi H, Ozaki N, Nanko S, Nakamura K, Mori N, Kanba S, Iwata N, et al. 2013. A population-­specific uncommon variant in GRIN3A associated with schizophrenia. Biological Psychiatry 73: 532–539. DOI: https://​doi.​org/​10.​1016/​j.​biopsych.​2012.​10.​024, PMID: 23237318 Takei N, Inamura N, Kawamura M, Namba H, Hara K, Yonezawa K, Nawa H. 2004. Brain-­derived neurotrophic factor induces mammalian target of rapamycin-­dependent local activation of translation machinery and protein synthesis in neuronal dendrites. The Journal of Neuroscience 24: 9760–9769. DOI: https://​doi.​org/​10.​1523/​ JNEUROSCI.​1427-​04.​2004, PMID: 15525761 Tang SJ, Reis G, Kang H, Gingras AC, Sonenberg N, Schuman EM. 2002. A rapamycin-­sensitive signaling pathway contributes to long-­term synaptic plasticity in the hippocampus. PNAS 99: 467–472. DOI: https://​doi.​ org/​10.​1073/​pnas.​012605299, PMID: 11756682 Trinh MA, Kaphzan H, Wek RC, Pierre P, Cavener DR, Klann E. 2012. Brain-­specific disruption of the eIF2α kinase PERK decreases ATF4 expression and impairs behavioral flexibility. Cell Reports 1: 676–688. DOI: https://​doi.​ org/​10.​1016/​j.​celrep.​2012.​04.​010, PMID: 22813743 Wang DO, Martin KC, Zukin RS. 2010. Spatially restricting gene expression by local translation at synapses. Trends in Neurosciences 33: 173–182. DOI: https://​doi.​org/​10.​1016/​j.​tins.​2010.​01.​005, PMID: 20303187 Wang CC, Held RG, Chang SC, Yang L, Delpire E, Ghosh A, Hall BJ. 2011. A critical role for GluN2B-­containing NMDA receptors in cortical development and function. Neuron 72: 789–805. DOI: https://​doi.​org/​10.​1016/​j.​ neuron.​2011.​09.​023, PMID: 22153375 Won H, Mah W, Kim E, Kim J-­W, Hahm E-­K, Kim M-­H, Cho S, Kim J, Jang H, Cho S-­C, Kim B-­N, Shin M-­S, Seo J, Jeong J, Choi S-­Y, Kim D, Kang C, Kim E. 2011. GIT1 is associated with ADHD in humans and ADHD-­like behaviors in mice. Nature Medicine 17: 566–572. DOI: https://​doi.​org/​10.​1038/​nm.​2330, PMID: 21499268 Yang J, Wang S, Yang Z, Hodgkinson CA, Iarikova P, Ma JZ, Payne TJ, Goldman D, Li MD. 2015. The contribution of rare and common variants in 30 genes to risk nicotine dependence. Molecular Psychiatry 20: 1467–1478. DOI: https://​doi.​org/​10.​1038/​mp.​2014.​156, PMID: 25450229 Yap EL, Greenberg ME. 2018. Activity-­Regulated Transcription: Bridging the Gap between Neural Activity and Behavior. Neuron 100: 330–348. DOI: https://​doi.​org/​10.​1016/​j.​neuron.​2018.​10.​013, PMID: 30359600 Yuan T, Mameli M, O’ EC, Dey PN, Verpelli C, Sala C, Perez-­Otano I, Lüscher C, Bellone C. 2013. Expression of cocaine-­evoked synaptic plasticity by GluN3A-­containing NMDA receptors. Neuron 80: 1025–1038. DOI: https://​doi.​org/​10.​1016/​j.​neuron.​2013.​07.​050, PMID: 24183704 Zhang H, Webb DJ, Asmussen H, Horwitz AF. 2003. Synapse formation is regulated by the signaling adaptor GIT1. The Journal of Cell Biology 161: 131–142. DOI: https://​doi.​org/​10.​1083/​jcb.​200211002, PMID: 12695502 Zhu PJ, Chen CJ, Mays J, Stoica L, Costa-­Mattioli M. 2018. mTORC2, but not mTORC1, is required for hippocampal mGluR-­LTD and associated behaviors. Nature Neuroscience 21: 799–802. DOI: https://​doi.​org/​ 10.​1038/​s41593-​018-​0156-​7, PMID: 29786082 Conde-­Dusman, Dey, et al. eLife 2021;10:e71575. DOI: https://​doi.​org/​10.​7554/​eLife.​71575  29 of 29