viruses Article Identification of African Swine Fever Virus Transcription within Peripheral Blood Mononuclear Cells of Acutely Infected Pigs Ann Sofie Olesen 1,2,† , Miyako Kodama 3,† , Louise Lohse 2 , Francesc Accensi 4,5 , Thomas Bruun Rasmussen 2 , Christina M. Lazov 1 , Morten T. Limborg 3 , M. Thomas P. Gilbert 3 , Anette Bøtner 1,2 and Graham J. Belsham 1, * 1 Section of Veterinary Clinical Microbiology, Department of Veterinary and Animal Sciences, University of Copenhagen, 1870 Frederiksberg, Denmark; asjo@ssi.dk (A.S.O.); cml@sund.ku.dk (C.M.L.); aneb@sund.ku.dk (A.B.) 2 Section for Veterinary Virology, Department of Virus & Microbiological Special Diagnostics, Statens Serum Institut, 2300 Copenhagen, Denmark; lolo@ssi.dk (L.L.); tbru@ssi.dk (T.B.R.) 3 Center for Evolutionary Hologenomics, The Globe Institute, University of Copenhagen, 1350 Copenhagen, Denmark; miyako.kodama@sund.ku.dk (M.K.); morten.limborg@sund.ku.dk (M.T.L.); tgilbert@sund.ku.dk (M.T.P.G.) 4 Centre de Recerca en Sanitat Animal (IRTA-CReSA), Campus de la Universitat Autònoma de Barcelona, 08193 Bellaterra, Spain; francesc.accensi@uab.cat 5 Departament de Sanitat i d’Anatomia Animals, Facultat de Veterinària, Universitat Autònoma de Barcelona, 08193 Bellaterra, Spain * Correspondence: grbe@sund.ku.dk † These authors contributed equally.   Abstract: African swine fever virus (ASFV) has become widespread in Europe, Asia and elsewhere, Citation: Olesen, A.S.; Kodama, M.; thereby causing extensive economic losses. The viral genome includes nearly 200 genes, but their Lohse, L.; Accensi, F.; Rasmussen, expression within infected pigs has not been well characterized previously. In this study, four pigs T.B.; Lazov, C.M.; Limborg, M.T.; were infected with a genotype II strain (ASFV POL/2015/Podlaskie); blood samples were collected Gilbert, M.T.P.; Bøtner, A.; Belsham, before inoculation and at both 3 and 6 days later. During this period, a range of clinical signs of G.J. Identification of African Swine infection became apparent in the pigs. From the blood, peripheral blood mononuclear cells (PBMCs) Fever Virus Transcription within Peripheral Blood Mononuclear Cells were isolated. The transcription of the ASFV genes was determined using RNAseq on poly(A)+ of Acutely Infected Pigs. Viruses 2021, mRNAs isolated from these cells. Only very low levels of virus transcription were detected in the 13, 2333. https://doi.org/10.3390/ PBMCs at 3 days post-inoculation (dpi) but, at 6 dpi, extensive transcription was apparent. This was v13112333 co-incident with a large increase in the level of ASFV DNA within these cells. The pattern of the virus gene expression was very reproducible between the individual pigs. Many highly expressed genes Academic Editor: Elisa Crisci have undefined roles. Surprisingly, some genes with key roles in virus replication were expressed at only low levels. As the functions of individual genes are identified, information about their Received: 26 October 2021 expression becomes important for understanding their contribution to virus biology. Accepted: 18 November 2021 Published: 22 November 2021 Keywords: African swine fever virus; transcriptomics; gene expression; PBMCs; RNAseq Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affil- 1. Introduction iations. African swine fever virus (ASFV) is the sole member of the Asfarviridae family. The virus has a large, linear dsDNA genome (ca. 170–190 kbp, depending on the strain) that includes nearly 200 genes (reviewed in [1]). This virus infects domestic pigs together with a range of wildlife species (family Suidae), including bush pigs and warthogs in Copyright: © 2021 by the authors. Africa, while wild boar are important hosts in Europe and Asia [2]. In addition, ASFV Licensee MDPI, Basel, Switzerland. can replicate within soft ticks (genus Ornithodoros) and is unique in being the only known This article is an open access article distributed under the terms and DNA arbovirus. A sylvatic cycle involving replication in soft ticks and warthogs occurs conditions of the Creative Commons in Africa [2]; the infection is largely asymptomatic in the warthogs but becomes apparent Attribution (CC BY) license (https:// when domestic pigs become involved. Outside of Africa, the transmission of the virus is creativecommons.org/licenses/by/ believed to occur mainly by the direct or indirect contact between infected pigs, generally 4.0/). Viruses 2021, 13, 2333. https://doi.org/10.3390/v13112333 https://www.mdpi.com/journal/viruses Viruses 2021, 13, 2333 2 of 15 without the involvement of soft ticks; however, some aspects of its transmission are poorly understood [3]. Many (at least 24) different genotypes of the virus exist in Africa; these are distin- guished based on the sequence of the VP72 gene [4–8]. In 1957 and 1960, excursions of a genotype I ASFV from Africa into Europe (Portugal) occurred, and the virus (e.g., the Ba71 strain) was present in the Iberian peninsula until the 1990s [9]. In 2007, a genotype II virus entered into Georgia (in the Caucasus region), and, subsequently, African swine fever (ASF) has become widespread within neighboring countries, such as Russia and those in Eastern Europe. It has also spread into Western Europe, including Belgium and, during 2020, Germany [10]. Furthermore, in 2018, essentially the same virus was reported from China, the world’s largest pig producer [10,11], and quickly moved into many countries in the vicinity (e.g., Vietnam, Korea and Cambodia) and to the Philippines. In 2021, the virus has been introduced into pigs in the Dominican Republic and Haiti [10]; thus, this virus is a global concern. Infection with ASFV can result in very high levels of case fatality and, thus, has major economic importance. There are no commercially available approved vaccines or antiviral agents to control the disease, so the control measures rely on the culling of infected animals, restrictions on animal movement and high biosecurity [12,13]. Highly virulent isolates of ASFV often cause a peracute to acute disease progression with high fever (>41 ◦ C) and a range of clinical signs, including anorexia and lethargy, which occur within a few days of infection [14–16]. ASFV replicates within the cytoplasm of infected cells and encodes its own RNA polymerase and transcription factors. Genes can be expressed at different stages of the virus life cycle, e.g., early (prior to DNA replication) or late (following DNA replication). The open reading frames (ORFs) are closely spaced on the viral genome and are transcribed from the two different strands of the DNA [17,18]. The mRNA transcripts are capped at their 50 -termini and are post-transcriptionally modified at their 30 -termini to generate a poly(A) tail by a virus encoded capping enzyme and poly(A) polymerase, respectively (reviewed in [1]). An initial analysis of the virus gene expression, using the total RNA extracted from the whole blood of pigs infected with the ASFV Georgia 2007/1 virus, has been performed [19] but showed very variable levels of gene expression between animals. Furthermore, a detailed analysis of the ASFV transcription has been undertaken using the cell culture adapted Ba71V strain (genotype I) of ASFV within Vero cells (derived from the African green monkey kidney) [18]. Analyses of the transcription within porcine peripheral blood macrophages and porcine pulmonary alveolar macrophages (PPAM), infected in vitro with isolates of ASFV, have also been reported previously [20,21]. In the pig, the initial sites of virus replication during a natural infection include the pharyngeal tonsils, and the secondary sites include the spleen, lymph nodes and liver (reviewed in [1]). More specifically, the virus primarily replicates in the cells of the monocyte macrophage lineage [22]. In a virus-infected animal, it is not possible to achieve the synchronous infection of all the cells within the animal (c.f. all the cells within a flask). However, in order to follow the time course of infection, in this study, we have examined the expression of virus genes from within the peripheral blood mononuclear cell (PBMC) population (including lymphocytes, monocytes and macrophages) harvested from individual animals at 3 and 6 days post-inoculation (dpi) with ASFV/POL/2015/Podlaskie. This has allowed the transcription of the ASFV genes to be assessed within key target cells of the natural host animal during the progression of individual pigs from being uninfected to being diseased. As the functions of the ASFV genes become known, then information about their expression should assist in the understanding of their contribution to virus biology. Viruses 2021, 13, 2333 3 of 15 2. Materials and Methods 2.1. Pigs Four male pigs, eight weeks of age, were included in this study. The pigs were obtained from a conventional Spanish swine herd (Landrace × Large White). On arrival at the research facility, one week before the start of the experiment, all pigs were found to be healthy by veterinary inspection. Water and a commercial diet for weaned pigs were provided ad libitum. Animal care and maintenance, experimental procedures and euthanasia were conducted in accordance with EU legislation on animal experimentation (EU Directive 2010/63/EU). The experiment was performed within high containment facilities at the Centre de Recerca en Sanitat Animal (IRTA-CReSA, Barcelona, Spain). 2.2. Challenge Virus For the experimental infection, ASFV was isolated from spleen material obtained from a dead wild boar in 2015 in the Podlaskie voivodeship (province), Poland, as previously described [16]. This virus is designated here as ASFV POL/2015/Podlaskie, the genome has been sequenced [23] and it is very closely related to the updated ASFV Georgia_2007/1 sequence (GenBank Accession no. FR682468.2, [24]). Briefly, clarified spleen suspension was passaged twice in PPAM and the titer of the second passage was then determined by end-point titration in PPAM [16]. For intranasal inoculation of pigs, the second passage virus was diluted in phosphate buffered saline (PBS) to a final concentration of 4 log10 50% tissue culture infectious doses (TCID50 ) per 2 mL, as used previously [16]. Back titration of the inoculum was carried out in PPAM to confirm the administered dose. 2.3. Study Design Upon arrival at the research facility, the four pigs were housed together in a high containment stable unit (BSL-3). After an acclimatization period of one week, the pigs were inoculated intranasally with 2 mL virus suspension containing 4 log10 TCID50 of the ASFV POL/2015/Podlaskie (see [16]). The time course of the infection in the pigs was followed from their clinical signs, rectal temperatures and using laboratory analyses as described in the following sections. 2.4. Clinical Examination and Euthanasia Clinical scores and rectal temperatures were recorded from individual pigs on each day. A total clinical score was calculated per day based on a modified system from that described previously [16], omitting food intake as it was available ad libitum; also, the rectal temperatures were recorded separately and were not used as part of the clinical score. The total clinical scores were calculated as the sum of scores given in eight categories (see Table 1). This allowed a maximum total clinical score of 31. The pigs were euthanized after they reached the humane end-points set in the study, which occurred at 6 days post-infection (dpi), by intravascular injection of Pentobarbital following deep anesthesia. 2.5. Sampling from the Inoculated Pigs EDTA-stabilized blood (EDTA blood) samples were collected prior to inoculation at 0 dpi, at 3 dpi and at 6 dpi, just prior to euthanasia. EDTA blood samples were processed directly for isolation of PBMCs (see below). Viruses 2021, 13, 2333 4 of 15 Table 1. Description of clinical score system. Feature Score Description Alertness and 0 Alert recumbency 1 Depressed/lethargic 2 Only gets up when touched 4 Gets up slowly when touched 6 Remains recumbent when touched Body condition 0 Normal, full stomach 1 Empty stomach, sunken flanks 2 Empty stomach, sunken flanks, loss of muscle mass 3 Emaciated Skin 0 Normal Minimal area of the skin with observed bleeding (<10% of 1 the body) Moderate area of the skin with observed bleeding (10–25% 2 of the body) 3 Generalized skin bleeding (>25% of the body) Joints 0 No joint swelling 1 Swelling 4 Severe swelling and lameness Respiration 0 Normal 1 Mildly labored 2 Labored +/− cough 3 Severely labored Eyes 0 Normal 1 Small amount of exudate 2 Moderate amount of exudate Gastrointestinal and 0 No diarrhea urinary tracts 1 Mild diarrhea for less than 24 h 3 Diarrhea for more than 24 h or vomiting 4 Bloody diarrhea or blood in urine Neurology 0 No symptoms Hesitant, unsteady walk, crossing-over of legs is corrected 3 slowly 4 Pronounced ataxia 6 Paralysis or convulsions This is modified from the system described previously [16] since feed was available ad libitum and rectal temperatures were recorded separately. 2.6. PBMC Isolation and Processing Using fresh EDTA blood samples (4 mL) from each pig, PBMCs were isolated using the Histopaque® system (Sigma-Aldrich, St. Louis, MO, USA). The PBMC fraction samples were lysed by addition of TrizolTM Reagent (ThermoFisher Scientific, Waltham, MA, USA), and the samples were stored frozen at −80 ◦ C until further processing. 2.7. RNA Purification Total RNA was extracted from the PBMCs in TrizolTM Reagent, (ThermoFisher Scien- tific) using the Direct-zolTM RNA MiniPrep kit (Zymo Research, Irvine, CA, USA). This purification system includes a DNAse I digestion to remove host and viral DNA. Analysis of the RNA transcripts was performed using poly(A)+ selected mRNAs. These samples include both viral and host mRNAs, but the selection removes most ribosomal RNA, which were then sequenced (following reverse transcription using random primers, second strand synthesis, adaptor ligation and PCR-amplification) by BGI Europe Genome Center (Copenhagen, Denmark) (termed RNA-T on DNBseq with ca. 40 million reads per sample). Viruses 2021, 13, 2333 5 of 15 2.8. ASFV DNA Detection by Quantitative Real-Time Polymerase Chain Reaction (qPCR) Following chloroform-mediated phase separation of the remaining volume of PBMCs lysed in TrizolTM Reagent (ThermoFisher Scientific), DNA purification was performed on the interphase material using the MagNA Pure 96 system (Roche, Basel, Switzer- land). The presence of ASFV DNA was determined by qPCR assays employing 45 cy- cles [16,25]. Results are presented as viral genome copy numbers/per mL EDTA blood calculated by reference to a standard curve based on a 10-fold dilution series of a pVP72 plasmid (prepared from a cloned PCR product amplified with primers dCCCGGTCC- GAAGCGCGCTTTCCCGGGATGGCATCAGGAGGAGCTTTTTG and dCGAAAGCGGC- CGCGGGATCGACTAGTCTATTAGGTACTGTAACGCAGCAC; the sequences in italics match exactly to the ASFV p72 coding sequence from GenBank Accession no. MH681419.1) using as the template DNA extracted from a spleen sample of a pig infected with ASFV POL/2015/Podlaskie [16]). 2.9. Data Analysis Mapping of Sequence Reads to the Pig Genome and to the ASFV Genome Sequence reads (27–47 million per sample) were initially mapped using STAR v. 2.7.0 [26] to the USMARCv1.0 pig genome assembly (Accession no. PRJNA392765), which was derived from a male pig within a population that was approximately one-half Lan- drace, one-quarter Duroc and one-quarter Yorkshire (see [27]). The analysis of changes in expression of the pig genes within these infected pigs will be reported separately. The unmapped reads were then mapped to the updated ASFV Georgia_2007/1 genome (Gen- Bank Accession no. FR682468.2) using BWA v.0.7.10 [28]; note that one correction to the annotation for the D205R gene was made (using the coding sequence as nt 138482 to 139234). Reads were mapped to individual virus genes using featureCounts, which is a part of the Subread package, v.2.0.3 [29]. The counts were then standardized, when indicated, to take account of the library size and the length of each gene from each sample (gene length corrected trimmed mean of M-values (GeTMM)) [30]. The reads that did not map to the pig genome were also examined using Kaiju [31] to determine the origin of the reads. The parameters used were: minimum match length (11), minimum match score (75), allowed mismatches (5) and maximum E-value (0.01). 3. Results 3.1. Course of Infection in the Inoculated Pigs Following intranasal inoculation on day 0, three out of the four pigs (numbers 10, 11 and 12), at 4 dpi, had high fever (rectal temperature above 41 ◦ C; see Figure 1A). Furthermore, at 5 and 6 dpi, all four pigs had high fever. Clinical signs of infection also became apparent and included depression, anorexia, mildly labored breathing, hyperemia of the skin and cyanosis on the ears and distal limbs, plus blood in feces (pig 10). At 6 dpi, all the inoculated pigs were euthanized since pigs 10, 11 and 12 had reached the pre- determined humane endpoint and the remaining animal, pig 9, was euthanized to avoid having a solitary animal. The clinical scores for the four inoculated pigs through the course of the infection are depicted in Figure 1B. All four pigs showed at least some clinical signs of disease, in addition to the elevated temperature by 5 dpi, which had become much more apparent in pigs 10, 11 and 12 at 6 dpi, just prior to euthanasia. Viruses 2021, 13, 2333 6 of 15 Figure 1. Time course of infection of pigs with ASFV. Pigs were inoculated intranasally with ASFV/POL/2015/Podlaskie at 0 dpi, and then their rectal temperatures were taken on a daily basis (A) and clinical signs of disease (for 8 parameters) were also scored (B). Blood samples were collected at 0 dpi (prior to inoculation), at 3 dpi and at 6 dpi; the animals were euthanized at 6 dpi. PBMCs were purified from the blood samples (4 mL). The presence of ASFV DNA in the PBMCs (C) was quantified by qPCR and values converted to gene copy numbers/mL blood by reference to a standard curve. Levels below 103 ASFV genomes/mL (indicated by dashed line) were outside of the linear range of the assay. Viruses 2021, 13, 2333 7 of 15 3.2. Virus Derived RNA Transcript Analysis from PBMCs of ASFV-Inoculated Pigs Blood samples (12 in total) were collected separately from the four pigs on day 0 (prior to inoculation), at 3 dpi and 6 dpi (on the day of euthanasia). The PBMC fraction was isolated from the EDTA blood samples, and the level of ASFV DNA in the nucleic acids isolated from the aliquots of the PBMCs was determined by qPCR (Figure 1C). Only low levels of ASFV DNA were detectable in the PBMCs at 3 dpi, but much higher levels (>1000-fold) were present at 6 dpi in all four pigs (Figure 1C). The total RNA was also extracted from the PBMC samples and freed of most of the DNA from the host and the virus. The poly(A)+ RNA (mRNAs) was then selected, reverse transcribed and sequenced (as described in Materials and Methods). The reads (ca. 27–47 million per sample) were initially mapped to the pig genome (resulting in 81–92% of the reads being uniquely mapped, see Table 2), and the unmapped reads were then mapped to the ASFV Georgia_2007/1 sequence (see Table 2). As expected, no reads mapping to the ASFV genome were present in any of the samples collected on day 0, prior to inoculation. At 3 dpi, the PBMCs from pigs 10, 11 and 12 each only generated between 600–850 reads (less than 0.0025% of the total reads) mapping to the ASFV genome, with no ASFV-derived reads detected in pig 9 (Table 2). However, in contrast, at 6 dpi, between 871,681 and 1,945,879 reads (ca. 2–4% of the total reads) from the PBMCs mapped to the ASFV genome from each of the four pigs (Table 2); the lowest numbers of ASFV reads were found in pigs 9 and 10. For pigs 11 and 12, about 40% of the reads that did not map to the pig genome did map to the ASFV genome. Thus, in parallel with the appearance of clinical signs between 3 and 6 dpi and the large increase in the levels of ASFV DNA in the PBMCs of the inoculated pigs (see Figure 1), a huge increase (>1000-fold) in the level of ASFV RNA transcripts within the PBMCs was apparent during this time period. Table 2. Poly(A)+ mRNA derived sequence reads from PBMCs of pigs infected with ASFV. Number of Reads Uniquely Mapped Number of Reads Proportion of Pig Number Number of Uniquely Mapped Reads (%) on Pig Mapped to ASFV ASFV Reads/Total (Sampling Day) Input Reads on Pig Genome Genome Genome Reads (%) Pig 9 (0 dpi) 31979021 28863826 90.26 0 0 Pig 9 (3 dpi) 31807126 29207238 91.83 0 0 Pig 9 (6 dpi) 40093403 35472115 88.47 871681 2.17 Pig 10 (0 dpi) 32617753 29668789 90.96 0 0 Pig 10 (3 dpi) 46764030 43095231 92.15 638 0.0014 Pig 10 (6 dpi) 27095889 24288166 89.64 915507 3.38 Pig 11 (0 dpi) 45953582 39771420 86.55 0 0 Pig 11 (3 dpi) 46561959 41696207 89.55 616 0.0013 Pig 11 (6 dpi) 45970436 40372979 87.82 1939287 4.21 Pig 12 (0 dpi) 46326924 37609952 81.18 0 0 Pig 12 (3 dpi) 41406744 36549318 88.27 851 0.0021 Pig 12 (6 dpi) 45915279 41203225 89.74 1945879 4.23 3.3. Transcription of Individual ASFV Genes In general, there was a very good agreement between the pattern of expression of the individual ASFV genes obtained for the PBMCs from each of the different pigs, although the actual levels varied to some extent (see Supplementary Table S1). In particular, the highest levels of virus gene expression were observed in pigs 11 and 12, and the levels of ASFV transcripts present in these cells from pigs 9 and 10 were, on average, about 50% lower. The most highly expressed genes were C312R, CP204L, MGF 100-1L and A151R (see Table 3), while some genes were expressed at a much lower level, i.e., less than 1% of these most highly expressed genes (see Table 4 and Supplementary Table S1). Interestingly, all the identified ASFV coding genes, with ORFs > 180 nt in length, were expressed to some extent (see Figure 2 and Supplementary Tables S1 and S2). Note that there are some very short Viruses 2021, 13, 2333 8 of 15 genes, designated pNG1-7, that were recently identified [18] from the Ba71V genome that were not specifically included here, but several of them correspond to features annotated in the ASFV Georgia_2007/1 genome as ASFV G ACD 00xx0 (see [18]). Some of these genes (e.g., ASFV G ACD 00350 and ASFV G ACD 00600) were expressed (see Supplementary Table S1). The gene designated as pNG4 (in the Ba71V genome) does not seem to have a corresponding gene in the ASFV Georgia_2007/1 genome. Some annotated features within the ASFV Georgia/2007 genome were present within the reads derived from other annotated gene transcripts (e.g., “polyC regions” (nt 14225 to 14237 (within the MGF 110-10-L-MGF110-14L fusion ORF) and nt 15666 to 15682 (within the MGF 110-13Lb ORF) plus a “polyG region” (nt 19993 to 20008, within the ASFV G ACD 00350 ORF)). However, another “polyG region” (nt 17624 to 17632) was expressed at quite high levels (even in the list of total reads not adjusted for the length of the transcript, see Supplementary Table S1). This sequence is present within a very short open reading frame (encoding a 15-residue peptide, MFDLSSILIRGGGPY) that was not annotated previously. The two genes flanking this polyG region were detected at lower levels (see Supplementary Table S1) and, hence, it does not seem possible to account for these reads as read-through from adjacent genes. Three so-called “hypothetical” genes (nt 19411 to 19506, nt 51223 to 51337 and nt 182044 to 182151, see Supplementary Table S1) were detected with many reads. However, the genes annotated as “ASFV G ACD 01760 no indication” (nt 175922 to 176006) and “DP63R no indication” (nt 178506 to 178652) were present within the transcripts from the I177L and MGF 360-16R genes, respectively, and are not listed separately. Table 3. Total numbers of reads for annotated ASFV genome features that are highly expressed in PBMCs from infected pigs at 6 dpi. CDS 1 Mean Gene or Feature CDS Start Pig9- Pig10- Pig11- Pig12- End Name (nt) 6 dpi 6 dpi 6 dpi 6 dpi Pigs 11–12 (nt) CP312R 128277 129200 66398 78462 138910 144010 141460 CP204L 125783 126367 59137 50204 128247 133890 131069 MGF 100-1L 180479 180904 50566 30183 108077 98680 103379 A151R 49652 50107 45198 45603 96565 89945 93255 K205R 64174 64791 29906 34834 64872 65805 65339 I73R 173088 173306 23887 24501 59167 54809 56988 MGF 360-15R 50346 51215 24275 23647 47350 49844 48597 MGF 110-5L-6L 9490 10107 18740 20840 42820 46048 44434 A240L 48633 49343 18353 15318 41882 45882 43882 MGF 110-7L 10314 10727 20780 20790 43090 42632 42861 E165R 167468 167965 17095 20759 40914 41374 41144 MGF 100-3L 181269 181577 15716 18157 36029 42209 39119 F334L 56956 57960 17153 17920 38103 39044 38574 MGF 110-3L 8239 8613 16201 22633 35842 34045 34944 285L 11042 11326 17175 14716 34762 32868 33815 I215L 174794 175432 16341 14199 32361 32736 32549 MGF 505-3R 35760 36602 13836 11627 25567 30317 27942 DP96R 185339 185629 12107 10550 27516 28141 27829 ASFV G ACD 48000 48152 9902 7709 22675 22563 22619 00600 K196R 65113 65703 9812 14044 22163 22183 22173 1: Average number of reads from pigs 11 and 12 at 6 dpi were used to place genes into order. The values given are the total number of sequence reads mapped per annotated region (not standardized for gene length or total number of reads) in the updated ASFV Georgia_2007/1 genome sequence (GenBank Acc. No. FR682468.2). Note that the start and end of the CDS are indicated by their position in the genome independently of the orientation of the gene. Viruses 2021, 13, 2333 9 of 15 Table 4. Total number of reads for annotated ASFV genome features expressed at low levels in PBMC from infected pigs at 6 dpi. Gene or Feature CDS CDS Pig9- Pig10- Pig11- Pig12- 1Mean Gene Product Name Start (nt) End (nt) 6 dpi 6 dpi 6 dpi 6 dpi Pigs 11–12 Properties (If Known) ASFV G ACD 187401 187532 141 114 292 254 273 01960 ASFV G ACD 12456 12581 81 122 265 276 271 00190 E423R 163803 165074 93 126 240 285 263 H171R 153250 153765 100 117 264 245 255 ASFV G ACD 7647 7760 107 150 229 236 233 00090 L11L 183821 184102 75 79 233 204 219 B407L 107261 108499 52 119 189 185 187 O61R 129795 129980 60 126 197 177 187 P12 attachment protein B117L 106907 107254 66 81 196 165 181 TR containing protein MGF 505-2R 34093 35673 66 100 197 155 176 B318L 96276 97232 51 69 152 182 167 Prenyltransferase Proliferating cell nuclear E301R 165225 166130 34 74 146 159 153 antigen-like protein EP153R 73808 74284 77 38 139 129 134 C-type lectin-like ASFV G ACD 92901 93059 47 37 140 88 114 01020 FAD-dependent thiol B119L 95936 96295 38 39 75 109 92 oxidase B175L 108527 109054 28 47 82 100 91 Late TF VLTF-2 S273R 147670 148491 20 37 70 89 80 SUMO-1-like protease E183L 163218 163772 28 46 84 69 77 P54, Virus entry ASFV G ACD 182604 182741 20 12 85 66 76 01870 S183L 147058 147609 18 44 55 76 66 E146L 166164 166604 25 45 69 56 63 PSP ASFV G ACD 20169 20285 14 14 56 48 52 00360 ASFV G ACD 13461 13652 18 17 29 51 40 00210 ASFV G ACD 14570 14680 13 11 26 40 33 00240 EP84R 71306 71560 7 13 13 26 20 PSP 1: The values given are the total number of sequence reads mapped per annotated feature (not standardized for gene length or total number of reads) in the updated ASFV Georgia 2007/1 genome sequence (Acc. No. FR682468.2). Gene product functions (where known) are taken from Dixon et al. [17] and Cackett et al. [18]. PSP = putative signal peptide, TR = transmembrane region. Potentially, some sequence reads could be derived from residual ASFV DNA in the samples, even after the DNAseI treatment and purification of the poly(A)+ RNA. However, it appears that the number of such reads should be very low since a number of genes are only included in a small number of reads (<50, see Table 4); this should be compared to >100,000 reads for some of the highly expressed genes (Table 3). The reads derived from genomic DNA should be derived similarly from all the regions of the genome. We have also “standardized” the number of reads to take into account the size differ- ences between the libraries generated prior to sequencing and the lengths of the different genes. This process had little overall effect on the pattern of highly expressed genes (see Supplementary Table S2). The most highly expressed genes, based on the total reads as listed in Table 3, are also high on the list of the ASFV genes expressed that is shown in Supplementary Table S2, following standardization, e.g., CP312R, CP204L, MGF 100-1L, A151R, K205R and I73R (see also Table 5). Viruses 2021, 13, 2333 10 of 15 Figure 2. Analysis of ASFV gene transcription within PBMCs of ASFV-infected pigs at 6 dpi. The number of ASFV mRNA derived reads from PBMCs of infected pigs collected at 6 dpi were standardized according to the size of the library and the length of the ORFs (for ORFs >180 nt) and plotted (as GeTMM values) along the entire ASFV genome for the two separate strands of the ASFV genome (panel (A), genes transcribed from left to right and panel (B), genes transcribed from right to left). The ASFV genes with the highest GeTMM values are indicated. The distribution of RNA transcripts across the genome, derived from the two different strands of the genomic DNA, is shown in Figure 2. Most of the highly expressed transcripts are derived from genes that are well-separated across the genome, and the highly expressed transcripts are copied from each of the strands of the genome. As may be expected, the different strands of the genome are either read in one direction or the other; this prevents the production of mRNAs that are complementary to each other and would form dsRNAs. Two genes, A151R and MGF360-15R, which are highly expressed (see Table 3) are adjacent to each other and transcribed in the same direction (see [17]). However, it is noteworthy that, after the standardization of the number of reads, to take account of the gene length, the apparent level of MGF360-15R expression is less markedly high (Table 5) and does not feature among the most highly expressed genes shown in Figure 2. The small number of ASFV reads detected in the pigs at 3 dpi (Supplementary Table S1) precludes the accurate quantification of their relative gene expression. However, it is ap- parent that the few reads that were observed at 3 dpi corresponded to transcripts that were highly expressed at 6 dpi (e.g., see Table 5). It seems most likely that the viral RNA reads observed in the PBMCs at 3 dpi represent the infection of a very small proportion of the cells, consistent with the low levels of ASFV DNA present within the PBMCs at this stage of the infection. It is not possible to differentiate “early” and “late” transcription within the pigs (c.f. in cell culture, [18]) as it cannot be expected that a synchronous state of infection can be achieved. In the RNAseq analysis performed here, the use of alternative transcription start sites has not yet been explored. Viruses 2021, 13, 2333 11 of 15 Table 5. Most highly expressed ASFV genes (>180 nt) following standardization. Gene Product Mean 1. Pig11- Pig12- Pig9- Pig10- Pig11- Pig12- Gene Name Properties Start End Pigs 3 dpi 3 dpi 6 dpi 6 dpi 6 dpi 6 dpi (If Known) 11 and 12 Tandem repeat I73R 173088 173306 9 13 15236 22260 37512 29371 33441 sequence MGF 100-1L 180479 180904 9 16 16544 14066 35147 27124 31136 P32 (P30) CP204L 125783 126367 9 16 14080 17027 30351 26783 28567 phosphoprotein A151R Redox pathway 49652 50107 8 13 13812 19851 29333 23093 26213 Immunodominant CP312R 128277 129200 6 8 10003 16837 20801 18227 19514 protein MGF 100-3L 181269 181577 4 7 7095 11676 16168 16009 16088 285L 11042 11326 3 8 8409 10263 16917 13520 15219 K205R In virus factories 64174 64791 3 8 6740 11182 14532 12459 13495 MGF 110-7L 10314 10727 7 3 6996 9970 14420 12059 13239 DP96R 185339 185629 6 4 5805 7205 13114 11336 12225 MGF 110-3L 8239 8613 4 4 6023 11986 13245 10634 11940 E165R dUTPase 167468 167965 3 5 4783 8273 11378 9725 10551 MGF 110-5L-6L 9490 10107 3 4 4223 6690 9592 8719 9155 Thymidylate A240L 48633 49343 1 3 3594 4273 8153 7549 7851 kinase MGF 360-15R 50346 51215 2 3 3884 5390 7531 6701 7116 Ubiquitin I215L conjugating 174794 175432 2 3 3561 4408 7010 5994 6502 enzyme L83L 4878 5123 3 5 2775 2009 6343 5185 5764 Has KDEL-like MGF 110-4L 8927 9301 2 3 2689 4421 6542 4684 5613 domain A104R Histone-like 48322 48636 2 4 2532 3481 6119 4943 5531 Ribonucleotide F334L 56956 57960 2 2 2376 3535 5245 4543 4894 reductase subunit K196R Thymidine kinase 65113 65703 1 2 2312 4715 5192 4392 4792 MGF 110-2L 7828 8142 2 1 2486 3884 4694 4298 4496 1: The total numbers of reads per gene were standardized according to the length of the open reading frame and for the size of the library. Only genes with a coding sequence > 180 nt (encoding > 60 amino acids) were included. The genes are listed according to the mean value for the reads from pigs 11 and 12 at 6 dpi. For comparison, the number of reads generated from the PBMCs at 3 dpi are also indicated for pigs 11 and 12 (for pigs 9 and 10, there were zero (0) or between 0 and 8 reads for each of these genes on this day, respectively). A complete listing of the ASFV genes expressed at 3 and 6 dpi is given in the Supplementary Tables S1 and S2. Gene product properties are from Dixon et al. [17] and Jaing et al. [19]. 4. Discussion The intranasal inoculation of pigs with ASFV is an efficient and consistent means of initiating infection (as seen previously [16]). Each of the inoculated pigs became infected and followed a similar course of disease. Pig 9 was slightly delayed in showing clinical signs, and both pigs 9 and 10 had slightly lower levels of the ASFV derived transcripts within their PBMCs, but it is expected that there will be some differences between animals. Overall, we have obtained very consistent results among the four pigs infected with the ASFV POL/2015/Podlaskie strain for the expression of each ASFV gene within the PBMCs; this cell population includes the major target cell types (monocytes and macrophages) for this virus. The virus strain used here is very similar to the other closely related genotype II viruses currently circulating in Europe and Asia. A complete listing of the standardized gene expression data is provided in Supple- mentary Table S2. In studies described previously by Jaing et al. [19], three pigs were infected (by intranasal instillation) with the ASFV Georgia 2007/1 strain using 104 TCID50 . The pigs were euthanized on days 7–10 after infection; each of the pigs were shown to have ASFV DNA in the blood from 7 dpi and displayed clinical signs of infection from that time. Total RNA was extracted from whole blood and used for the transcriptomic analysis; only Viruses 2021, 13, 2333 12 of 15 about 0.1% of the reads mapped to the ASFV genome. This is a much lower level than observed here (up to 4.2%, see Table 1); presumably, the much higher proportion of ASFV derived reads that we obtained is largely due to the selection of poly(A)+ mRNAs from the PBMC fraction prior to the sequencing (thus removing many reads derived from other RNAs (e.g., ribosomal RNA). About 1–2 million reads that mapped to the ASFV genome were analyzed here from each of the inoculated pigs at 6 dpi. Another advantage obtained from selecting the poly(A)+ mRNA is that reads derived from residual ASFV DNA should be further diminished beyond that achieved by DNAseI treatment alone, which may not be completely effective [32]. However, some reads may be derived from residual ASFV DNA (there are only short regions of the genome that are not included in any reads), along with other incompletely digested host DNA, e.g., pig mitochondrial DNA. In addition, it is worth noting that <1% of the reads (about 250,000 per sample) do not map to the pig genome nor to ASFV but map to bacterial genome sequences, as determined using Kaiju [31]. It seems likely that this results from bacteria being engulfed by the porcine macrophages and then residual DNA being present within these cells. A key feature of the data presented here is the close correspondence between the results observed for each of the four pigs. Thus, the most highly expressed ASFV genes observed in one pig were also highly expressed in the other three pigs (Table 3). Indeed, the relative order of expression of the top 20 genes was very similar in each of the four pigs. Furthermore, genes that were expressed in one pig at a low level were also expressed at a low level in the other animals (Table 4). This consistency in the gene expression contrasts with the much more variable results reported previously by Jaing et al. [19]. For example, surprisingly, for nine of the seventeen genes indicated in their study as being highly expressed overall, in one of the three pigs examined, apparently no reads corresponding to these highly expressed genes were detected. Indeed, for the most abun- dantly expressed transcript overall, encoding MGF-360-15R (an inhibitor of interferon-β induction, [33]), the fragments per kilobase per million mapped fragments (FPKM) values obtained for the three pigs were: 1,190,000; 0 (zero) and 19,979, respectively, showing great variation. This gene was the sixth or seventh most highly expressed gene in each of the four pigs studied here (see Table 3), with the total reads ranging from 23,647 to 49,844 (see Supplementary Table S1). Following the standardization (to account for differences in library size and for the lengths of the genes), this gene was fifteenth in the list of highly expressed genes (Table 5) and, thus, it does not feature among the most highly expressed genes (see Figure 2). The highly expressed genes of ASFV are mainly located in different regions across the genome and are derived from each strand. There can be a concern that, if the transcription termination signals are not 100% efficient, then read-through into the adjacent genes could affect the apparent level of transcription of the genes adjacent to the highly expressed genes. For the most highly expressed genes that we have analyzed, this could only be an issue for the A151R gene (fourth most highly expressed) and the adjacent MGF360- 15R gene (sixth or seventh most highly expressed, see Table 3) since these genes are both transcribed in the same direction. However, after the normalization of the gene reads to take into account the length of the ORF, the expression of the MGF360-15R gene does not appear to be very high (see Table 5 and Figure 2). It seems unlikely that the reads corresponding to the MGF 360-15R gene were greatly affected by the read-through from the higher number of reads derived from the A151R gene unless the transcription termination process was very inefficient. Furthermore, the studies by Cackett et al. [18] indicated a good correlation beyond the transcription measured by RNA-seq (as used here) and the 50 -end cap analysis gene expression sequencing (CAGE-seq). The latter methodology is independent of any read-through transcription. Finally, there was a good correspondence between the genes found to be highly expressed in the pigs, as shown here (see Tables 3 and 5 and Supplementary Table S1), and those found to be highly expressed during both the early (at 5 h post-infection, prior to DNA replication) and late (at 16 h, after DNA replication) stages of infection in Ba71V-infected Vero cells [18]. Thus, the genes Viruses 2021, 13, 2333 13 of 15 CP312R, CP204L, A151R, K205R and I73R were all found to be highly expressed in both studies. There was also good overall correspondence to the results from Jaing et al. [19] within the pigs, although the higher degree of variability of the signal (as mentioned above) makes for less precise quantification. Many of the ASFV genes are poorly characterized [17], and this applies to the highly expressed genes as well as those expressed at a lower level. As the functions of the various ASFV genes become known, information about the expression of the genes in different cell types will be important for understanding the biology of the virus. Interestingly, most of the major components of ASF virions (as described previously [34]) are not translated from among the most highly expressed genes. Only the dUTPase component of the virion (from the E165R gene) is produced from among the top 20 expressed transcripts (see Table 3). The genes encoding the major capsid protein (p72 expressed from B646L), the outer envelope protein CD2v (from E402R) plus the two polyproteins pp220 (from CP2475L) and pp65 (from CP530R) do not appear in the list of the top 20 expressed genes. It is noteworthy that the S273R gene, which expresses a protease that processes the two polyproteins (pp220 and pp65) to major components of the virion [34], is expressed at very low levels (Table 4). Clearly, the level of protein expression does not only reflect the level of the mRNA; it will also depend on the stability of the proteins and the translational efficiency of the individual mRNAs. It can be expected that proteins with catalytic functions, e.g., the ASFV protease (S273R), may be required at a lower level than the structural protein precursor substrates. Overall, it seems that all open reading frames encoding products longer than 60 amino acids (i.e., >180 nt, as annotated in Accession no. FR682468.2) are expressed within the pigs. It could have been possible that some ASFV genes were only expressed in soft ticks as part of its sylvatic cycle, but this does not appear to be the case. However, for the genes that are expressed at very low levels (see Table 3), it is formally possible that these reads are due to the presence of residual ASFV DNA. Clearly, there could be quantitative differences in the pattern of gene expression from the virus when it replicates in the ticks compared to that observed in pigs. It is apparent that the ASFV must have replicated somewhere in the pigs during the time period from inoculation until after 3 dpi since the virus must have spread to the PBMCs to enable their infection. Following the intranasal infection, it is believed that the primary ASFV replication occurs within the tonsil and regional lymph nodes before being spread, through the lymphatic system and the blood, to other replication sites (e.g., the spleen and liver (see [22]). Further studies should focus on these primary sites of infection and also other sites of subsequent infection. Furthermore, the host responses to the ASFV infection can also be addressed using the PBMCs (as here) and other cells that become infected. Supplementary Materials: The following are available online at https://www.mdpi.com/article/ 10.3390/v13112333/s1, Supplementary Table S1: Total numbers of reads for all annotated features in the ASFV genome throughout the course of infection; Supplementary Table S2: Ordered list of standardized number of reads for genes with ORFs > 180 nt expressed in PBMCs at 3 and 6 dpi. Author Contributions: Conceptualization, A.S.O., M.T.P.G., A.B. and G.J.B.; methodology, A.S.O., M.K., L.L, F.A., M.T.L., A.B. and G.J.B.; formal analysis, A.S.O., M.K. and C.M.L.; investigation, A.S.O., L.L. and A.B.; data curation, A.S.O. and M.K.; writing—original draft preparation, G.J.B.; writing— review and editing, all authors; visualization, M.K. and G.J.B.; supervision, L.L, F.A., T.B.R., M.T.P.G., A.B. and G.J.B.; funding acquisition, M.T.L. All authors have read and agreed to the published version of the manuscript. Funding: This study was funded in part through the University of Copenhagen and the Statens Serum Institut and also by a ‘Danish National Research Foundation 143 Award’. Institutional Review Board Statement: This study was approved by the Ethical and Animal Welfare Committee of the Generalitat de Catalunya (Autonomous Government of Catalonia; permit number: CEA-OH/10869/1). Informed Consent Statement: Not applicable. Viruses 2021, 13, 2333 14 of 15 Data Availability Statement: The data analyzed in this study are included within the paper and its Supplementary Information (Tables S1 and S2). Acknowledgments: We are very grateful to the staff at IRTA-CReSA who were involved in this study. Especially, we owe great thanks to Guillermo Cantero, Iván Cordon, Joanna Wiacek, María Jesús Navas, Marta Muñoz, Samanta Giler, Xavier Abad and also to Preben Normann (U. of C.) for their technical assistance. Conflicts of Interest: The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript or in the decision to publish the results. References 1. Understanding and Combatting African Swine Fever. 2021, pp. 25–61. Available online: https://agritrop.cirad.fr/598144/7/ID5 98144.pdf (accessed on 26 October 2021). 2. Dixon, L.; Sun, H.; Roberts, H. African swine fever. Antivir. Res. 2019, 165, 34–41. [CrossRef] [PubMed] 3. Olesen, A.S.; Belsham, G.J.; Rasmussen, T.B.; Lohse, L.; Bødker, R.; Halasa, T.; Boklund, A.; Bøtner, A. Potential routes for indirect transmission of African swine fever virus into domestic pig herds. Transbound. Emerg. Dis. 2020, 67, 1472–1484. [CrossRef] 4. Achenbach, J.E.; Gallardo, C.; Pelegrin, E.N.; Rivera-Arroyo, B.; Degefa-Negi, T.; Arias, M.; Jenberie, S.; Mulisa, D.D.; Gizaw, D.; Gelaye, E.; et al. Identification of a New Genotype of African Swine Fever Virus in Domestic Pigs from Ethiopia. Transbound. Emerg. Dis. 2017, 64, 1393–1404. [CrossRef] [PubMed] 5. Bastos, A.D.S.; Penrith, M.-L.; Crucière, C.; Edrich, J.L.; Hutchings, G.; Roger, F.; Couacy-Hymann, E.; Thomson, G.R. Genotyping field strains of African swine fever virus by partial p72 gene characterisation. Arch. Virol. 2003, 148, 693–706. [CrossRef] [PubMed] 6. Boshoff, C.; Bastos, A.; Gerber, L.; Vosloo, W. Genetic characterisation of African swine fever viruses from outbreaks in southern Africa (1973–1999). Vet. Microbiol. 2007, 121, 45–55. [CrossRef] 7. Lubisi, B.A.; Bastos, A.; Dwarka, R.M.; Vosloo, W. Molecular epidemiology of African swine fever in East Africa. Arch. Virol. 2005, 150, 2439–2452. [CrossRef] 8. Quembo, C.J.; Jori, F.; Vosloo, W.; Heath, L. Genetic characterization of African swine fever virus isolates from soft ticks at the wildlife/domestic interface in Mozambique and identification of a novel genotype. Transbound. Emerg. Dis. 2018, 65, 420–431. [CrossRef] 9. Costard, S.; Wieland, B.; De Glanville, W.; Jori, F.; Rowlands, R.; Vosloo, W.; Roger, F.; Pfeiffer, D.; Dixon, L.K. African swine fever: How can global spread be prevented? Philos. Trans. R. Soc. B Biol. Sci. 2009, 364, 2683–2696. [CrossRef] 10. OIE WAHIS Interface. 2021. Available online: https://wahis.oie.int/#/dashboards/country-or-disease-dashboard (accessed on 19 August 2021). 11. FAO. ASF Situation in Asia Update. Available online: http://www.fao.org/ag/againfo/programmes/en/empres/ASF/ situation_update.html (accessed on 1 June 2020). 12. Busch, F.; Haumont, C.; Penrith, M.-L.; Laddomada, A.; Dietze, K.; Globig, A.; Guberti, V.; Zani, L.; Depner, K. Evidence-Based African Swine Fever Policies: Do We Address Virus and Host Adequately? Front. Vet. Sci. 2021, 8, 224. [CrossRef] 13. Sánchez-Cordón, P.J.; Montoya, M.; Reis, A.L.; Dixon, L.K. African swine fever: A re-emerging viral disease threatening the global pig industry. Vet. J. 2018, 233, 41–48. [CrossRef] 14. Gallardo, C.; Soler, A.; Nieto, R.; Cano, C.; Pelayo, V.; Sánchez, M.A.; Pridotkas, G.; Fernandez-Pinero, J.; Briones, V.; Arias, M. Experimental Infection of Domestic Pigs with African Swine Fever Virus Lithuania 2014 Genotype II Field Isolate. Transbound. Emerg. Dis. 2015, 64, 300–304. [CrossRef] [PubMed] 15. Guinat, C.; Reis, A.L.; Netherton, C.L.; Goatley, L.; Pfeiffer, D.U.; Dixon, L. Dynamics of African swine fever virus shedding and excretion in domestic pigs infected by intramuscular inoculation and contact transmission. Vet. Res. 2014, 45, 1–9. [CrossRef] 16. Olesen, A.S.; Lohse, L.; Boklund, A.; Halasa, T.; Gallardo, C.; Pejsak, Z.; Belsham, G.; Rasmussen, T.B.; Bøtner, A. Transmission of African swine fever virus from infected pigs by direct contact and aerosol routes. Vet. Microbiol. 2017, 211, 92–102. [CrossRef] 17. Dixon, L.K.; Chapman, D.A.; Netherton, C.L.; Upton, C. African swine fever virus replication and genomics. Virus Res. 2013, 173, 3–14. [CrossRef] [PubMed] 18. Cackett, G.; Matelska, D.; Sýkora, M.; Portugal, R.; Malecki, M.; Bähler, J.; Dixon, L.; Werner, F. The African Swine Fever Virus Transcriptome. J. Virol. 2020, 94, e00119-20. [CrossRef] 19. Jaing, C.; Rowland, R.R.R.; Allen, J.; Certoma, A.; Thissen, J.B.; Bingham, J.; Rowe, B.; White, J.; Wynne, J.; Johnson, D.; et al. Gene expression analysis of whole blood RNA from pigs infected with low and high pathogenic African swine fever viruses. Sci. Rep. 2017, 7, 1–14. [CrossRef] 20. Zhu, J.J.; Ramanathan, P.; Bishop, E.A.; O’Donnell, V.; Gladue, D.P.; Borca, M.V. Mechanisms of African swine fever virus pathogenesis and immune evasion inferred from gene expression changes in infected swine macrophages. PLoS ONE 2019, 14, e0223955. [CrossRef] 21. Ju, X.; Li, F.; Li, J.; Wu, C.; Xiang, G.; Zhao, X.; Nan, Y.; Zhao, D.; Ding, Q. Genome-wide transcriptomic analysis of highly virulent African swine fever virus infection reveals complex and unique virus host interaction. Vet. Microbiol. 2021, 261, 109211. [CrossRef] [PubMed] Viruses 2021, 13, 2333 15 of 15 22. Gómez-Villamandos, J.; Bautista, M.; Cordón, P.S.; Carrasco, L. Pathology of African swine fever: The role of monocyte- macrophage. Virus Res. 2013, 173, 140–149. [CrossRef] [PubMed] 23. Olesen, A.S.; Lohse, L.; Dalgaard, M.D.; Woźniakowski, G.; Belsham, G.J.; Bøtner, A.; Rasmussen, T.B. Complete genome sequence of an African swine fever virus (ASFV POL/2015/Podlaskie) determined directly from pig erythrocyte-associated nucleic acid. J. Virol. Methods 2018, 261, 14–16. [CrossRef] [PubMed] 24. Forth, J.H.; Forth, L.F.; King, J.; Groza, O.; Hübner, A.; Olesen, A.S.; Höper, D.; Dixon, L.K.; Netherton, C.L.; Rasmussen, T.B.; et al. A Deep-Sequencing Workflow for the Fast and Efficient Generation of High-Quality African Swine Fever Virus Whole-Genome Sequences. Viruses 2019, 11, 846. [CrossRef] [PubMed] 25. Tignon, M.; Gallardo, C.; Iscaro, C.; Hutet, E.; Van der Stede, Y.; Kolbasov, D.; De Mia, G.M.; Le Potier, M.-F.; Bishop, R.P.; Arias, M.; et al. Development and inter-laboratory validation study of an improved new real-time PCR assay with internal control for detection and laboratory diagnosis of African swine fever virus. J. Virol. Methods 2011, 178, 161–170. [CrossRef] [PubMed] 26. Dobin, A.; Davis, C.A.; Schlesinger, F.; Drenkow, J.; Zaleski, C.; Jha, S.; Batut, P.; Chaisson, M.; Gingeras, T.R. STAR: Ultrafast universal RNA-seq aligner. Bioinformatics 2013, 29, 15–21. [CrossRef] [PubMed] 27. Warr, A.; Affara, N.; Aken, B.; Beiki, H.; Bickhart, D.M.; Billis, K.; Chow, W.; Eory, L.; Finlayson, H.A.; Flicek, P.; et al. An improved pig reference genome sequence to enable pig genetics and genomics research. GigaScience 2020, 9, giaa051. [CrossRef] [PubMed] 28. Li, H. Aligning sequence reads, clone sequences and assembly contigs with BWA-MEM. arXiv 2013, arXiv:1303.3997. 29. Liao, Y.; Smyth, G.K.; Shi, W. The R package Rsubread is easier, faster, cheaper and better for alignment and quantification of RNA sequencing reads. Nucleic Acids Res. 2019, 47, e47. [CrossRef] 30. Smid, M.; van de Werken, H.J.G.; van Riet, J.; van Galen, A.; de Weerd, V.; van der Vlugt-Daane, M.; Bril, S.I.; Lalmahomed, Z.S.; Kloosterman, W.P.; Wilting, S.M.; et al. Gene length corrected trimmed mean of M-values (GeTMM) processing of RNA-seq data performs similarly in intersample analyses while improving intrasample comparisons. BMC Bioinform. 2018, 19, 236. [CrossRef] 31. Menzel, P.; Ng, K.; Krogh, A. Fast and sensitive taxonomic classification for metagenomics with Kaiju. Nat. Commun. 2016, 7, 11257. [CrossRef] 32. Lazov, C.; Belsham, G.; Bøtner, A.; Rasmussen, T. Full-Genome Sequences of Alphacoronaviruses and Astroviruses from Myotis and Pipistrelle Bats in Denmark. Viruses 2021, 13, 1073. [CrossRef] 33. Correia, S.; Ventura, S.; Parkhouse, R.M. Identification and utility of innate immune system evasion mechanisms of ASFV. Virus Res. 2013, 173, 87–100. [CrossRef] 34. Alejo, A.; Matamoros, T.; Guerra, M.; Andrés, G. A Proteomic Atlas of the African Swine Fever Virus Particle. J. Virol. 2018, 92, e01293-18. [CrossRef] [PubMed]