foods Article An In Vitro Protocol to Study the Modulatory Effects of a Food or Biocompound on Human Gut Microbiome and Metabolome Carles Rosés 1 , Juan Antonio Nieto 2 , Blanca Viadel 2 , Elisa Gallego 2 , Ana Romo-Hualde 3 , Sergio Streitenberger 4 , Fermín I. Milagro 3,5,6 and Anna Barceló 1, * 1 Servei de Genòmica, Universitat Autònoma de Barcelona, Bellaterra, 08193 Cerdanyola del Vallés, Spain; carles.roses@uab.cat 2 Ainia, In Vitro Digestion Assays, Parque Tecnológico de Valencia, 46980 Paterna, Spain; jnieto@ainia.es (J.A.N.); bviadel@ainia.es (B.V.); egallego@ainia.es (E.G.) 3 Centre for Nutrition Research, Department of Nutrition, Food Sciences and Physiology, University of Navarra, 31008 Pamplona, Spain; aromo@unav.es (A.R.-H.); fmilagro@unav.es (F.I.M.) 4 AMC Innova, 30100 Murcia, Spain; sstreiten@amunoz.com 5 Navarra Institute for Health Research (IdISNA), 31008 Pamplona, Spain 6 Centro de Investigación Biomédica en Red de la Fisiopatología de la Obesidad y Nutrición (CIBERobn), Instituto de Salud Carlos III, 28029 Madrid, Spain * Correspondence: anna.barcelo@uab.cat Abstract: The gut microbiota plays a key role in gastrointestinal immune and metabolic functions and is influenced by dietary composition. An in vitro protocol simulating the physiological conditions  of the digestive system helps to study the effects of foods/biocompounds on gut microbiome  and metabolome. The Dynamic-Colonic Gastrointestinal Digester consists of five interconnected Citation: Rosés, C.; Nieto, J.A.; compartments, double jacket vessels that simulate the physiological conditions of the stomach, the Viadel, B.; Gallego, E.; Romo-Hualde, small intestine and the three colonic sections, which are the ascending colon, transverse colon and A.; Streitenberger, S.; Milagro, F.I.; Barceló, A. An In Vitro Protocol to descending colon. Human faeces are required to reproduce the conditions and culture medium of the Study the Modulatory Effects of a human colon, allowing the growth of the intestinal microbiota. After a stabilization period of 12 days, Food or Biocompound on Human a food/biocompound can be introduced to study its modulatory effects during the next 14 days Gut Microbiome and Metabolome. (treatment period). At the end of the stabilization and treatment period, samples taken from the Foods 2021, 10, 3020. https://doi.org/ colon compartments are analysed. The 16S rRNA gene analysis reveals the microbiota composition. 10.3390/foods10123020 The untargeted metabolomics analysis gives more than 10,000 features (metabolites/compounds). The present protocol allows in vitro testing of the modulatory effects of foods or biocompounds on Academic Editors: Elsa F. Vieira and gut microbiota composition and metabolic activity. Cristina Soares Keywords: microbiota; digestor; food compounds; colonic fermentation; metabolome Received: 3 November 2021 Accepted: 2 December 2021 Published: 5 December 2021 1. Introduction Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in The outcome of the ingested food components in the human digestive system is an published maps and institutional affil- area attracting interest among researchers because of its relation to nutrition and health. iations. Digestion of food is a complex combination of various physiochemical processes that disintegrate the food into more suitable forms for its absorption and transportation to related organs, and discarding the remaining waste [1]. In this context, the gut microbiota plays a key role in the host’s health by metabolizing dietary compounds such as fibres Copyright: © 2021 by the authors. and polyphenols that have a potential prebiotic capacity and is a determinant factor in the Licensee MDPI, Basel, Switzerland. development of obesity and other diseases [2]. The diet composition determines the gut This article is an open access article microbiota profile, and therefore the diet–microbiota interaction is crucial for synthesizing distributed under the terms and vitamins and other beneficial bioactive molecules, such as postbiotics [3]. The microbiota conditions of the Creative Commons also plays a key role in the maintenance of the intestinal functions, modulating the immuno- Attribution (CC BY) license (https:// logical response and working as a barrier against certain pathogens [4]. The composition creativecommons.org/licenses/by/ of our microbiota is influenced by host genotype, environment, and diet. A gut microbiota 4.0/). in a eubiotic status is characterized by a preponderance of potentially beneficial species, Foods 2021, 10, 3020. https://doi.org/10.3390/foods10123020 https://www.mdpi.com/journal/foods Foods 2021, 10, 3020 2 of 14 belonging mainly to the two bacterial phylum, Firmicutes and Bacteroidetes [3], while potentially pathogenic species, such as those belonging to the phylum Proteobacteria (i.e., Enterobacteriaceae) are present, but in a very low percentage. In case of dysbiosis “good bacteria” no longer control the “bad bacteria” which take over [5]. The composition of the intestinal microbiota and the metabolic activity can be modulated through diet, which opens an opportunity for intervention with dietary strategies to balance the intestinal microbiota and reverse the state of dysbiosis. Additionally, the characterization of new ben- eficial molecules that are generated by the microorganisms during the colonic fermentation of foods, which are called postbiotics [6]. Increased interest in modifying the matrix and structural characteristics of foods to optimize their digestion, absorption and particularly the microbiota profile (related to health benefits), requires implementation of many food digestion studies in the digestive tract; therefore, it is essential to design an in vitro protocol for analysing the effect of foods and dietary bioactive compounds on the microbiota profile and metabolite production. The main objective of the present study was to standardize a protocol that allows testing, in vitro, of the modulatory effects of foods or biocompounds on gut microbiota composition and metabolic activity. 2. Material and Methods 2.1. In Vitro Digestion Models In vitro models have been developed since the 1990s to be used in food digestion studies. The models can help to design novel food products by estimating the in vivo behaviour after meals [7]. Many of these models are designed to work in static conditions, and therefore cannot reproduce the dynamic conditions that occur in the digestive system. Furthermore, these models have limitations for predicting food behaviour and nutrient bioavailability [8]. The interest that has arisen in the last years about the gut microbiota physiology has obliged to design new in vitro models more centred on colonic fermentation. In this context, very few dynamic in vitro models mimic the mechanic, dynamic and chemical conditions of the human digestive system. Additionally, multi-compartmental systems usually have gastric and small intestinal compartments, but very few include the colon, which is essential to study of the gut microbiome and metabolome. Dynamic models can simulate the change in pH, enzyme secretion, peristaltic forces and microbial fermentation continuously [9]. 2.2. Description of the Dynamic Gastrointestinal and Colonic Fermentation Model The equipment simulates in vitro the entire gastrointestinal digestive process. It consists of a computer-assisted model of five interconnected compartments, double jacket vessels, which simulate the physiological conditions of the stomach (R1), the small intestine (R2) and the three colonic sections: the ascending colon (R3), transverse colon (R4) and descending colon (R5). This model was developed by AINIA (Valencia, Spain) [10] based on the work of Van de Wiele et al. [11] and Marzorati et al. [12]. R1 and R2 work semi- continuously, while the colon reactors (R3, R4 and R5) work continuously. A peristaltic bomb ensured the flow of the content from one reactor to the next. The system did not simulate water absorption. The volumes and transit times for each region of the gastrointestinal tract were: 260 mL for 2 h in R1, 410 mL for 6 h in R2 and the colon, 1000 mL for 20 h in R3, 1600 mL for 32 h in R4, and 1200 mL for 24 h in R5. [13–15]. The temperature was kept at 37 ◦ C during the entire process. An anaerobic environment was maintained, and gaseous N2 was flushed for 15 min twice a day. Gastric digestion was simulated by continuous addition of a 0.03% (w/v) pepsin solution (2100 units/mg) during 2 h (total volume of 60 mL). A typical gastric digestion pH curve (based on in vivo data) was simulated by adding a 1 M HCl solution. The gradual decrease in the pH of the stomach to pH 2 was carried out. The pH control was carried out by adding HCl. HCl secretion to control pH is based on the pH curve reported by Conway Foods 2021, 10, 3020 3 of 14 et al. (1987), which represents the pH profile in the stomach after human volunteers consumed yogurt [16]. Digestion of the small intestine was mimicked by the continuous addition of a pancreatin solution (0.9 g/L), NaHCO3 (12 g/L) and oxgall dehydrated fresh bile (6 g/L) in distilled water (total volume of 440 mL), maintaining the intestinal content at pH 6.5. 2.3. Faecal Inoculum Fresh faeces from human subjects were used to reproduce the gut conditions. A list of characteristics can be added in the recruitment procedure depending on the aim of the experiment. As the faeces profile determines the characteristics of the microbiota reproduced in the digestor, especially when a dysbiosis or normobiosis environment is the study aim, this parameter should be considered. In this case, the inoculum was prepared using faeces from four adult volunteers with pathologies associated with obesity and/or metabolic syndrome (BMI 35–40; age 30–50), non-smokers, no history of antibiotic treatment in the last three months, and no intestinal disease background [17–19]. Faecal samples were collected and maintained in special anaerobic plastic bags (BD GasPak™ systems). Faeces were diluted with thioglycolate 20% (w/v) and homogenized with a stomacher to obtain a faecal slurry. The faecal suspension was centrifuged at 3000 g for 3 min and the collected supernatant was immediately inoculated in the colon vessels (50, 80 and 60 mL for R3, R4 and R5, respectively). The reactors were filled with culture medium up to a total volume of 1000, 1600 and 1200 mL, respectively. The composition of the culture medium followed Molly et al. (1993, 1994) [20,21], providing the necessary nutritional components to simulate the conditions of the human colon and allowing the intestinal microbiota to grow. Each reactor was maintained at different optimal pH levels. The bacteria present in each region of the colon have an optimal pH of action: pH 5.5–6 in the ascending colon (R3); pH 6–6.4 in the transverse colon (R4) and pH 6.4–6.8 in the descending colon (R5). In order to regulate the pH changes that occur during fermentation and maintain them in the optimal intervals for each region, acid or base were added. 2.4. Process Description and Duration After faecal inoculation, a stabilization period of 12 days was required to allow bacteria to grow and reach stable levels [22,23]. During this period, 200 mL of cultured medium was added to the stomach (R1) three times a day. At this point, the system was ready to start the sample treatment period to study its modulation effects on the gut microbiota [10,11]. The treatment period was conducted by feeding the equipment with sample once a day (in culture medium up to 200 mL) and with 200 mL of cultured medium twice a day. The treatment period was 14 days. The maintenance of the microbial population during the stabilization (time 12) and treatment period (time 14) was checked by bacteria plate counts. The following bacterial groups were quantified by growth on specific medium, expressing the result as CFU/mL of colonic medium: Lactobacillus (MRS agar; the MALDI-TOF technique was employed to verify lactobacilli colonies), Bifodobacterium (TOS-propionate agar enriched with MUP), Enterobacteriaceae (VRBD agar), Clostridium (TSC Agar enriched with cycloserin) and total anaerobic bacteria (Agar Schaedler). Then, 10 mL of the samples was taken from each reactor (R3, R4 and R5) and serially diluted in saline solution. Plates were inoculated with 1-mL sample of four serial dilutions by duplicate and incubated at 37 ◦ C under aerobic or anaerobic conditions. In addition, samples were taken from each reactor at the end of the stabilization and treatment period and stored at −20 ◦ C to determine the short chain fatty acid content in the colonic media and to conduct the metabolomic analysis, 10 mL and 3 mL, respectively. For the metabolomic analysis, these samples were centrifuged (15,000× g, 15 min) and filtered through a 0.22-µm-Ø Millipore filter (Billerica, MA, USA) into vials for UHPLC-ESI-QqQ-MS/MS analysis. In addition, 1.5 mL of the inoculum, as well as samples from each reactor at the end of the stabilization and in the treatment period were collected at baseline using OMNIgene.GUT kits from Foods 2021, 10, 3020 4 of 14 DNA Genotek (Ottawa, ONT, Canada), according to the standard instructions provided by the company. 2.5. Description and Volume of the Product to Be Tested A vegetable drink based on oats, fruit, vitamins B2, B5, B12 and D2, iodine, calcium, beta-glucans and postbiotics, with a 6% sugar content, was pasteurized to ensure a viability of, at least, 15 days. It was stored at −20 ◦ C. The dosage administrated during the treatment was about 100 mL/day, once a day. The product was provided by the company AMC Natural Drinks, a partner of the BIOTAGUT Project (Modulation of the microbiome and postbiome by the intelligent design of food promoters of a healthy microbiota in relation to metabolic syndrome), which is supported by the Ministry of Science, Innovation and Universities of Spain, through CDTI (Centre for Industrial Technological Development, Madrid, Spain). 2.6. Short Fatty Acid Analyses Short and medium chain fatty acids were extracted from the sample using a liquid– liquid extraction with diethyl ether. The resulting extract was filtered and subsequently analysed using a AS 800 C.U. gas chromatograph (CE Instruments, Wigan, United King- dom) equipped with a HP-FFAP 25 m × 0.2 mm × 0.33 mm column (Agilent Technologies) and a flame-ionization detector (FID). The samples were quantified by interpolation in the calibration curve using capric acid as an internal standard. The concentration of the fatty acids was provided directly by the software using a 1/× linear regression. The results were expressed as mg of compound per Kg of colonic medium. 2.7. DNA Extraction The DNA was extracted with the QIAamp® DNA kit (Qiagen. Hilden, Germany) following the manufacturer’s protocol [24]. Microbiota composition according to 16S rRNA analysis with Next Generation Se- quencing (NGS). 2.8. Metagenomic Data: Library Preparation Metagenomics studies were performed by analysing the variable regions V3–V4 of the prokaryotic 16S rRNA (ribosomal Ribonucleic Acid) gene sequences, which gives 460 bp amplicons in a two-round PCR protocol. In a first step, PCR is used to amplify a template out of a DNA sample using specific primers with overhang adapters attached to the flank regions of interest. The full-length primer sequences, using standard IUPAC (International Union of Pure and Ap-plied Chem- istry) nucleotide codes, were: Forward Primer: 50 TCGTCGGCAGCGTCAGATGTGTATAAG AGACAGCCT ACGGGNGGCWGCAG; and Reverse Primer: 50 GTCTCGTGGGCTCGGAG ATGTG TATAAGAGACAGGACTACHVGGGTATCTAATCC. PCR was performed in a thermal cycler using the following conditions: 95 ◦ C for 3 min, 25 cycles of (95 ◦ C for 30 s, 55 ◦ C for 30 s, and 72 ◦ C for 30 s), and 72 ◦ C for 5 min. To verify the amplicon, 1 µL of the PCR product was checked in a Bioanalyzer DNA 1000 chip (Agilent Technologies, Santa Clara, CA, USA). The expected size on a Bioanalyzer was ~550 bp. In a second step and using a limited-cycle PCR, sequencing adapters and dual index barcodes, Nextera® XT DNA Index Kit, FC-131-1002 (Illumina, San Diego, CA, USA), were added to the amplicon, which allows up to 96 libraries pooled together for sequencing in the MiSeq sequencer with the MiSeq® Reagent Kit v2 (500 cycle) MS-102-2003 to be pooled together. The PCR was performed in a SimpliAmp thermal cycler (Applied Biosystems® , San Francisco, CA, USA) using the following conditions: 95 ◦ C for 3 min, eight cycles of (95 ◦ C for 30 s, 55 ◦ C for 30 s, and 72 ◦ C for 30 s), and 72 ◦ C for 5 min. Subsequently, the Index Foods 2021, 10, 3020 5 of 14 PCR ran a second Bioanalyzer DNA 1000 chip to validate the library. The expected size was ~630 bp. The next step consisted of quantifying the libraries using a Qubit® 2.0 fluorometer (Invitrogen by Thermo Fisher Scientific, Carlsbad, CA, USA), and dilution of the samples before pooling them. Finally, paired-end sequencing was performed in a MiSeq platform (Illumina) with a 500-cycle Miseq run and with 7 pM sample and a minimum of 25% PhiX. The mean reads obtained were 164,387. Only samples with more than 40,000 reads were used for further analysis [25]. 2.9. Data Analysis For the Short-chain fatty acid (SCFA) production and the bacterial growth analysis, a Mann–Whitney U Test was applied for differences between two groups on a single, ordinal variable with no specific distribution [26]. These analyses were carried out using GraphPad Prism version 6.0c for MAC OS X, GraphPad Software, San Diego, California USA, www.graphpad.com (accessed on 13 September 2021). 2.10. Metagenomic Data: Analysis and Processing The 16S rRNA gene sequences obtained were filtered following the quality criteria of the OTU (operational taxonomic units) processing pipeline LotuS (release 1.58) [23]. This pipeline includes UPARSE (Highly accurate OTU sequences from microbial amplicon reads) de novo sequence clustering and removal of chimeric sequences and phix contaminants for identifying OTUs and their abundance matrix generation [27,28]. The taxonomy was assigned using HITdb (Highly scalable Relational Database), achieving up to species sensitivity. BLAST (Basic Local Alignment Search Tool) was used when HITdb failed to reach a homology higher than 97% [29,30]. Thus, OTUs with a similarity of 97% or more were considered as species by themselves. However, OTUs that did not reach this percentage of similarity were checked and updated using the Basic Local Alignment Search Tool (BLASTn), comparing them with the 16S rRNA gene sequences of the bacteria and archaea database of GenBank of the National Center for Biotechnology Information to obtain an assignment to a species. The sequences in which the BLASTn tool found a new assignment were indicated using the GenBank access number and the percentage of homology following the species name. The abundance matrices were first filtered and then normalized in R/Bioconductor at each classification level: OTU, species, genus, family, order, class, and phylum. This study focused mainly on the species level. Briefly, taxa with less than 10% frequency in our population were removed from the analysis, and a global normalization was performed using the library size as a correcting factor and log2 data transformation [31]. 2.11. Richness and Evenness Richness was defined as the total of species. Evenness, defined as the alpha diversity index, was calculated using the Shannon index [32] according to the following formula: H = −sum(Pi ln[Pi]) (1) 2.12. Untargeted Metabolomics The chromatographic analysis was performed with a high-resolution liquid chro- matogram (HPLC) from Agilent (model 1100). The detector used was a TOF (Time of Flight) Mass Accuracy from Agilent, model 6220. The stationary phase was a chromato- graphic column, Zorbax SB-C18 (Agilent Technologies) of 150 × 46 mm and 5 µm pore size. The column temperature was kept at 40 ◦ C. The mobile phase was made of milliQ with 0.1% formic acid (canal A) and methanol with 0.1% formic acid (canal B). The system worked with a gradient, screening the entire polarity range from 100% of A until 100% of B. The injected volume was 15 µL. Foods 2021, 10, 3020 6 of 14 The TOF detector is made of an electrospray ionized source (ESI). The flow of gas drying was 10 L/min, at a 40 psig pressure and a temperature of 350 ◦ C. The capillary voltage was 4000 V, the fragmentor voltage was 175 V, and the skimmer voltage 65 V. The relation m/z range, for the detection, was between 100 and 2000 and the acquisition ratio was 1.03 spectre/sec. All samples coming from the digestor were analysed following the same sequence. The samples were analysed in positive polarity (POS group) and negative polarity (NEG group). To apply this process, sample duplicates were needed to perform the two analyses. To analyse the results, an alignment with XCMS Online (The Scripps Research Institute, La Jolla, CA 92037, United States) software was carried out according to the relation m/z (mass/charge) and the retention time. Raw data were normalized by logarithmic transformation followed by Pareto scaling. Compounds with the same m/z relation and the same retention (5 mDa tolerance for the m/z relation; 0.5 min for the retention time) were considered the same. Later, comparisons of two vs. two were carried out, for example: R3 T12 POS vs. R3 T14 POS and R3 T12 NEG vs. R3 T14 NEG. The same with the three reactors. These com- parisons show the impact of the chosen treatment on the microbiota of the in vitro digestor. The XCMS Online software gave features (metabolites/compounds) detected from each chromatogram, showing more than 10,000 features. Finally, the MetaboAnalyst software (Xia Lab of McGill University, Quebec, Canada) processed the list file using statistical multivariable tools, such as Partial last squares regression (PLS-DA), Random Forest and Volcano Plot. Outliers were excluded through the Random Forest model, followed by the other statistical tools mentioned above. With these tools, features with more discriminating outputs were chosen between the two groups of the polarity group: - Volcano Plot: p-value < 0.001 and Fold change >10.0 (100.0 for negative polarity). - PLSDA: Value of Variable Importance in Projection (VIP) >3.0 Subsequently, the features that passed the selection criteria were identified through the database Metlin (Scripps Research Institute). Certain conditions must be established to set the tolerance limit: 5 mDa in relation to the m/z ratio (specifically the mean m/z relation of the csv file, generated from the XCMS Online). For the positive group, the marked ions were [M+H]+ , [M+Na]+ and [M+H-H2O]+ . For the negative group, the ions were [M-H]− and [M-H2O-H]− . In both cases, those metabolites classified as toxic were taken out of the database [33]. 3. Results and Discussion In the colonic fermentation studies, two different phases exist: the stabilization part, which aims to create a stable microbiome from the faecal inoculum, and is considered as the control, and the treatment one, where the purpose is to analyse the behaviour of the stabilized microbiota under the effects of the chosen food or biocompound, added after the stabilization period is over. During both periods, samples are taken from the colonic digestors, allowing the comparation between the metabolites production by the microbiota itself (stabilization period), and due to the chosen food or biocomppound added (treatment phase). The test results showed a stabilization of the faecal microbiota during the first period (12 days) in R3, R4 and R5. The recovered levels (for each ml of cultured medium) of total anaerobic microorganisms were above 107 cfu in all three sections. During the treatment period (14 days after reaching the stabilization point), 100 mL of the vegetable drink were added every day. In this period, the total anaerobic microorganisms remained stable in the three sections. According to the total anaerobic level, it was concluded that the digestor conditions were favourable for the development of the intestinal microbiota during the two weeks while the product was being tested. R3 shows a stabilization of the anaerobic bacteria while R4 and R5 show a very significant increase (p < 0.025). Furthermore, bacteria from the Enterobacteriaceae family, including potentially pathogenic species, show a very significant (p < 0.025) reduction in all reactors. These results are shown in Table 1 and Figure 1. the three sections. According to the total anaerobic level, it was concluded that the diges- tor conditions were favourable for the development of the intestinal microbiota during the two weeks while the product was being tested. R3 shows a stabilization of the anaer- obic bacteria while R4 and R5 show a very significant increase (p < 0.025). Furthermore, bacteria from the Enterobacteriaceae family, including potentially pathogenic species, Foods 2021, 10, 3020 show a very significant (p < 0.025) reduction in all reactors. These results are shown in 7 of 14 Table 1 and Figure 1. Table 1. Microbiological count of the three colonic reactors during the fermentation of the vegetable drink. R3T12 repre- sents Table 1. the end of the stabilization Microbiological count of theperiod and R3T14 three colonic the end reactors of the the during treatment period. Results fermentation are showndrink. of the vegetable as log (CFU/mL). R3T12 represents the end of the stabilization period and Days Bifidobacterium R3T14 the end of the Lactobacillus treatment period. Results Enterobacteria are shown Clostridium as log (CFU/mL). Total Anaerobic 5 7.48 ± 0.05 6.19 ± 0.04 5.4 ± 0.01 1.00 ± 0.02 7.53 ± 0.11 Days Bifidobacterium Lactobacillus Enterobacteria Clostridium Total Anaerobic R3T12 8 5.59 ± 0.03 5.5 ± 0.57 5.48 ± 0.01 1.00 ± 0.02 8.2 ± 0.07 5 12 7.48 ± ±0.05 6.16 0.01 6.19 ±±0.04 4.31 0.01 7.49±±0.01 5.4 0.12 1.00± ± 1.00 0.02 0.01 0.09± 0.11 8.05 ±7.53 R3T12 8 5.59 ± 0.03 5.5 ± 0.57 5.48 ± 0.01 1.00 ± 0.02 8.2 ± 0.07 2 4.00 ± 0.02 3.2 ± 0.02 5.43 ± 0.07 1.00 ± 0.01 5.88 ± 0.11 12 6.16 ± 0.01 4.31 ± 0.01 7.49 ± 0.12 1.00 ± 0.01 8.05 ± 0.09 7 4.59 ± 0.11 6.55 ± 0.01 5.42 ± 0.04 1.00 ± 0.02 6.66 ± 0.19 R3T14 ± ±0.02 ± ±0.02 2 10 4.00 4.25 0.02 3.2 6.66 0.08 4.98±± 0.04 5.43 0.07 1.00 ± ± 1.00 0.01 0.01 6.62 ± 0.23± 0.11 5.88 7 14 4.59 ± ±0.11 5.45 0.01 6.55 ±±0.01 6.68 0.21 5.42 ± 0.04 6.48 ± 0.01 1.00 ± 0.02 1.00 ± 0.01 0.06± 0.19 7.97 ±6.66 R3T14 10 4.25 ± 0.02 6.66 ± 0.08 4.98 ± 0.04 1.00 ± 0.01 6.62 ± 0.23 5 7.97 ± 0.08 7.79 ± 0.07 6.04 ± 0.02 4.37 ± 0.07 8.34 ± 0.12 14 5.45 ± 0.01 6.68 ± 0.21 6.48 ± 0.01 1.00 ± 0.01 7.97 ± 0.06 R4T12 8 6.60 ± 0.06 6.37 ± 0.78 6.42 ± 0.08 3.25 ± 0.08 8.4 ± 0.09 5 12 7.97 ± ±0.08 5.93 0.05 7.79 ±±0.07 4.87 0.24 6.74±± 0.19 6.04 0.02 4.37± ± 2.25 0.07 0.05 0.08± 0.12 7.37 ±8.34 R4T12 8 2 6.60 ± ±0.06 4.30 0.02 6.37 ±±0.78 3.89 0.05 5.16±± 0.08 6.42 0.12 3.25± ± 1.93 0.08 0.09 7.65 ±8.4 ± 0.09 0.09 12 5.93 ± 0.05 4.87 ± 0.24 6.74 ± 0.19 2.25 ± 0.05 7.37 ± 0.08 7 4.60 ± 0.13 5.85 ± 0.07 4.34 ± 0.26 1.00 ± 0.02 7.9 ± 0.07 R4T14 ± ±0.02 ±±0.05 2 10 4.30 5.20 0.02 3.89 6.02 0.04 5.16±± 0.05 5.16 0.12 1.93± ± 1.00 0.09 0.01 0.05± 0.09 7.73 ±7.65 7 14 4.60 ± ±0.13 5.91 0.03 5.85 ±±0.07 5.48 0.02 4.34 ± 0.26 4.35 ± 0.07 1.00 ± 0.02 1.00 ± 0.01 7.9 8.20 ± 0.05± 0.07 R4T14 10 5.20 ± 0.02 6.02 ± 0.04 5.16 ± 0.05 1.00 ± 0.01 7.73 ± 0.05 5 7.95 ± 0.02 7.48 ± 0.02 6.85 ± 0.02 6.46 ± 0.01 8.28 ± 0.04 14 5.91 ± 0.03 5.48 ± 0.02 4.35 ± 0.07 1.00 ± 0.01 8.20 ± 0.05 R5T12 8 7.06 ± 0.02 7.14 ± 0.25 6.34 ± 0.01 5.33 ± 0.04 7.97 ± 0.02 5 12 7.95 ± ±0.02 5.66 0.07 7.48 ±±0.02 5.19 0.07 6.16±± 0.02 6.85 0.02 6.46± ± 3.88 0.01 0.05 0.07± 0.04 7.63 ±8.28 R5T12 8 2 7.06 ± ±0.02 4.00 0.03 7.14 ±±0.25 4.61 0.20 6.34 ± 5.09 ± 0.01 0.03 5.33 ± 0.04 3.46 ± 0.03 7.66 ± 0.09± 0.02 7.97 12 5.66 ± 0.07 5.19 ± 0.07 6.16 ± 0.02 3.88 ± 0.05 7.63 ± 0.07 7 4.72 ± 0.09 6.22 ± 0.01 4.27 ± 0.05 2.41 ± 0.01 7.8 ± 0.07 R514 ± ±0.03 ±±0.20 2 10 4.00 4.62 0.07 4.61 5.99 0.04 5.30±± 0.66 5.09 0.03 3.46± ± 3.06 0.03 0.02 0.03± 0.09 7.91 ±7.66 7 14 4.72 ± ±0.09 5.46 0.02 6.22 ±±0.01 6.16 0.02 4.93±± 0.16 4.27 0.05 2.41± ± 2.46 0.01 0.08 8.11 ±7.8 ± 0.07 0.05 R514 10 4.62 ± 0.07 5.99 ± 0.04 5.30 ± 0.66 3.06 ± 0.02 7.91 ± 0.03 14 5.46 ± 0.02 6.16 ± 0.02 4.93 ± 0.16 2.46 ± 0.08 8.11 ± 0.05 Foods 2021, 10, x FOR PEER REVIEW 8 of 15 Figure 1. Microbiological count of the three colonic reactors: (R3, R4 and R5) before (T12) and after the treatment (T14) (n = 2 ± SD). A Mann–Whitney U Test was applied for differences between two groups on a single, ordinal variable with no specific distribution. Different letters mean statistically significant differences: a, no significant difference (p > 0.05) and c, Figure for a very 1. Microbiological significant differencecount (p 0.05) and c, for a very significant difference (p < 0.025). Results are shown as log (CFU/mL). Foods 2021, 10, 3020 8 of 14 Short-chain fatty acid (SCFA) production showed a clear tendency towards increased levels of acetic and butyric acids in the three sections after the treatment (Table 2). Propionic acid level showed a very significant (p < 0.025) increase after the treatment period in the three reactors (Figure 2). Table 2. SCFA production in the three reactors after the stabilization period (T12) and the treatment period (T14) (mg/Kg of colonic medium). Acetic Acid Butyric Acid Propionic Acid R3T12 999 ± 98 441 ± 37 258 ± 17 R3T14 1281 ± 127 597 ± 54 1543 ± 116 Figure 1. Microbiological count of R4T12 the three colonic reactors:2157 ± 226 (R3,R4 and R5) before (T12)561and±after 52 the treatment (T14)509(n± 40 = 2 ± SD). A Mann–Whitney U TestR4T14 ± 222 two groups on a766 2267between was applied for differences ± 69ordinal variable with single, 2531no± 117 specific distribution. Different letters mean statistically significant differences: a, no significant difference (p > 0.05) and c, R5T12 2155 ± 209 646 ± 59 509 ± 42 for a very significant difference (p < 0.025). Results are shown as log (CFU/mL). R5T14 2645 ± 238 835 ± 76 2684 ± 196 Figure 2. Representation of the SCFA production on the different reactors: (R3, R4 and R5) before (T12) and after the treatment (T14) (n = 2 ± SD). A Mann–Whitney U Test was applied for differences between two groups on a single, ordinal variable with no specific distribution. Different letters mean statistically significant differences: a, no significant difference (p > 0.05) and c, a very significant difference (p < 0.025). The metagenomic analysis showed an increase in some bacterial species, (Figure 3), especially butyrate-producer species such as Alistipes putredinis and Eubacterium desmolans. Other SCFA-related species (Clostridium lactatifermantans and Phascolarctobacterium succi- natutens (propionic)) also increased their levels; these results are shown in Table 3 and Figure 3. Results on the genus rank show a growth of some genera related to SCFA pro- duction, such as Anaerotruncus [34], Cloacibacillus [35], and Parasutterella [36]. The genus Acidaminococcus [37] has attracted scientific interest due to its high resistance to antibiotics. These results are shown in Table 4. lans. Other SCFA-related species (Clostridium lactatifermantans and Phascolarctobacterium succinatutens (propionic)) also increased their levels; these results are shown in Table 3 and Figure 3. Results on the genus rank show a growth of some genera related to SCFA production, such as Anaerotruncus [34], Cloacibacillus [35], and Parasutterella [36]. The ge- nus Acidaminococcus [37] has attracted scientific interest due to its high resistance to anti- Foods 2021, 10, 3020 9 of 14 biotics. These results are shown in Table 4. Foods 2021, 10, x FOR PEER REVIEW 10 of 15 Figure 3. Representation of the bacteria species relative abundance on the different reactors: (R3) ascending colon, (R4) transversal colon, (R5) descending colon, before (T12) and after the treatment period (T14) with the biocompound. Figure3.3.Bacterial Table species abundance Representation in the of the bacteria three relative species colonic sections. abundance R3T12 represents on the the different end of the reactors: (R3)stabilization period(R4) ascending colon, and R3T14 the end transversal of the colon, treatment (R5) period. descending Values colon, represent before (T12) andrelative abundance after the %.period (T14) with the biocompound. treatment R3 R3T12 R3T14 R5 R5T12 R5T14 Table 3. Bacterial species abundance in the three colonic sections. R3T12 represents the end of the stabilization period and R3T14Acidaminococcus the end of theintestini 4.45 represent treatment period. Values Acidaminococcus 6.96relative abundance %. intestini 2.79 3.88 Bacteroides faecis 3.63 5.56 Acinetobacter septicus 0.00 0.94 Megamonas funiformis 4.68 11.17 Alistipes putredinis 5.32 6.29 R3 R3T12 R3T14 R5 R5T12 R5T14 OTU20|Bacteroides xylanisolvens|D = 96.4 9.38 10.14 Anaerotruncus colihominis 3.36 4.74 Acidaminococcus R4 intestini 4.45 R4T12 6.96 R4T14 Acidaminococcus intestini Bacteroides dorei 2.79 13.09 3.88 14.85 Bacteroides Achromobacter faecis denitrificans 3.63 0.00 5.56 1.87 Acinetobacter Desulfovibriosepticus piger 0.00 4.85 0.94 10.99 Bacteroides Megamonas dorei funiformis 12.98 4.68 14.78 11.17 Megamonas Alistipes funiformis putredinis 3.86 5.32 6.03 6.29 Desulfovibrio piger 3.56 11.21 OTU1096|Alistipes indistinctus|D = 96 2.60 3.06 OTU20|Bacteroides xylanisolvens|D = Dorea longicatena 7.32 7.60 OTU1235|Parabacteroides distasonis|D = 96.7 0.88 2.70 9.38 10.14 Anaerotruncus colihominis 3.36 4.74 Megamonas96.4funiformis 4.15 6.83 OTU1328|Melainabacter A1|D = 90.6 0.00 4.27 OTU1328|Melainabacter A1|D = 90.6 0.00 4.78 OTU1572|Parabacteroides distasonis|D = 95.3 0.88 3.47 R4 OTU221|Enterococcus hirae|D = 96.3 R4T12 0.00 R4T14 2.65 Bacteroides dorei OTU577|Megasphaera elsdenii|D = 96 13.09 0.00 14.85 1.91 Achromobacter denitrificans Parabacteroides merdae 0.00 9.95 1.87 10.03 Desulfovibrio OTU80|Eubacterium piger = 94.1 desmolans|D 4.85 5.76 10.99 6.82 Phascolarctobacterium faecium 0.00 0.91 OTU82|Clostridium lactatifermentans|D = 93.1 0.00 4.47 Bacteroides dorei 12.98 14.78 Megamonas funiformis 3.86 6.03 Ruminococcus callidus 0.00 0.91 Phascolarctobacterium faecium 2.39 7.08 Desulfovibrio piger 3.56 11.21 OTU1096|Alistipes indistinctus|D Phascolarctobacterium succinatutens = 96 2.60 4.29 3.06 5.85 OTU1235|Parabacteroides distasonis|D = Dorea longicatena 7.32 7.60 0.88 2.70 96.7 Megamonas funiformis 4.15 6.83 OTU1328|Melainabacter A1|D = 90.6 0.00 4.27 OTU1572|Parabacteroides distasonis|D = OTU1328|Melainabacter A1|D = 90.6 0.00 4.78 0.88 3.47 95.3 OTU221|Enterococcus hirae|D = 96.3 0.00 2.65 OTU577|Megasphaera elsdenii|D = 96 0.00 1.91 Parabacteroides merdae 9.95 10.03 OTU80|Eubacterium desmolans|D = 94.1 5.76 6.82 Foods 2021, 10, 3020 10 of 14 Table 4. Bacterial genus abundance in the three colonic sections. R3T12 represents the end of the stabilization period and R3T14 the end of the treatment period. Values show relative abundance %. Tax Inoculation R3T12 R3T14 R4T12 R4T14 R5T12 R5T14 Acidaminococcus 0.00 4.45 6.96 ˆ 3.03 2.65 * 3.24 3.88 ˆ Acinetobacter 0.00 0.00 0.00 0.00 0.00 0.00 0.94 ˆ Anaerotruncus 2.22 0.00 0.00 3.03 0.00 * 3.36 4.74 ˆ Bacteroides 12.83 15.16 10.62 * 14.90 14.98 ˆ 14.79 14.94 ˆ Chryseobacterium 0.00 0.00 6.77 ˆ 0.00 0.00 0.00 0.00 Cloacibacillus 0.00 0.00 0.00 0.00 0.91 ˆ 0.00 3.47 ˆ Desulfovibrio 9.04 0.00 0.00 3.56 11.21 ˆ 4.85 10.99 ˆ Dorea 8.05 0.00 0.00 7.32 7.60 ˆ 8.63 6.64 * Enterobacter 0.00 7.07 10.03 ˆ 4.64 4.95 ˆ 4.41 5.30 ˆ Enterococcus 0.00 3.10 0.00 * 0.00 3.16 ˆ 0.00 0.94 ˆ Lachnoclostridium 11.62 1.54 0.00 * 10.65 10.72 ˆ 11.07 11.69 ˆ Lachnospira 10.64 0.00 4.99 ˆ 7.65 0.91 * 8.38 3.59 * Lysinibacillus 0.00 11.20 11.20 ˆ 6.63 5.78 * 2.79 7.06 ˆ Megamonas 0.00 4.68 11.23 ˆ 4.15 6.85 ˆ 3.86 6.07 ˆ Megasphaera 0.00 5.86 8.20 ˆ 4.05 3.74 * 3.48 4.52 ˆ [Melainabacter] 7.09 0.00 0.00 1.14 10.04 ˆ 0.00 9.24 ˆ Olsenella 2.22 0.00 0.00 0.00 0.00 0.00 1.91 ˆ Parabacteroides 9.59 0.00 0.00 9.95 10.03 ˆ 10.42 8.67 * Parasutterella 4.99 0.00 0.00 1.14 3.74 ˆ 2.60 4.40 ˆ Phascolarctobacterium 8.22 0.00 0.00 0.00 0.91 ˆ 4.57 7.59 ˆ Propionibacterium 0.00 0.00 0.00 0.00 0.00 0.00 1.50 ˆ Tyzzerella 6.89 0.00 0.00 5.84 0.00 * 5.19 6.32 ˆ ˆ: Bacterial genus increase; *: Bacterial genus decrease. A total of 219 bacterial species were obtained in this experiment. The result of alpha diversity assessed using the Shannon index showed an increase at R3 with the treatment, however not at R4 and R5, where it decreases (Table 5) Table 5. Bacterial diversity numeric classification of the inoculum and the three reactors. T = 12 represents the end of the stabilization period and T = 14 the end of the treatment period. SW Div Inoculation R3 R4 R5 T = 12 3.87 2.03 3.51 3.55 T = 14 2.10 2.61 3.02 The metabolomic analysis showed a dominance of peptides consisting of up to four amino acids, phenolic compounds, phosphatidylcholines, fatty acids and terpenoids (Table 6). For example, in negative polarity, several interesting metabolites increased their levels. In R3, there are some catechin derivatives and an isoflavone; in R4, a metabo- lite related to vitamin D3; in R5, beta-carotenes or lycopene; and in R3 and R5, there is a terpenoid. In positive polarity, there is an increase in choline in R4. Figure 4 shows the PLS-DA Score Plots obtained in the comparisons among all groups in positive (A) and in negative (B) polarity. Foods 2021, 10, 3020 11 of 14 Table 6. Some metabolites whose levels changed in the three reactors. Intensity Intensity m/z Tr: (min) Reactor (Polarity) Putative Metabolites T = 12 (Days) T = 14 (Days) 415.1389 5.64 R3 (neg) 4.19 6.14 Heptamethoxyflavanone/Eleganin 367.1145 5.75 R3 (neg) 4.19 5.93 Barpisoflavone/Glisoflavone 401.3422 5.81 R4 (neg) 3.27 5.68 Hydroxy-dihydrovitamin D3 517.4152 7.22 R5 (neg) 3.54 5.62 Carotene/Lycopene Foods104.1036 2.82 2021, 10, x FOR PEER REVIEW R4 (pos) 5.60 7.13 Choline 12 of 15 Tr: retention time; intensity expressed on a logarithmic scale. Figure 4.4. Representation Figure Representation the the PLS-DA PLS-DA Score Score Plots Plots obtained obtained in in the the comparisons comparisons among among all all groups groups in in positive positive (A) (A) and and in in negative (B) polarity. negative (B) polarity. With With this this model, model, mechanic, mechanic, dynamic dynamic and and chemical chemical conditions conditionsof of the the human human digestive digestive system can be outlined, including transit times of ingested meals, system can be outlined, including transit times of ingested meals, pH profiles, pH profiles, temperature, tempera- contractions, and peristaltic ture, contractions, movements, and peristaltic digestive movements, secretion digestive rates, and secretion rates, absorption of water and absorption of and nutrients. Moreover, it also allows analysis of the microbiota water and nutrients. Moreover, it also allows analysis of the microbiota fluctuation fluctuation and and the metabolites the metabolites produced producedalong thethe along whole process. whole process.However, However,asasititisismainly mainlydesigned designed for for studying studying the effects of foods on microbiota composition and gut metabolites, itit does the effects of foods on microbiota composition and gut metabolites, does not not take take into account nutrient into account nutrient absorption absorptionandandgutgutleak. leak.TheThemain main differences differences ofof thethe intesti- intestinal nal fermentation protocol established in this article compared to other fermentation protocol established in this article compared to other similar protocols similar protocols (SHIME, (SHIME, TIM-2, TIM-2, SIMGI, SIMGI,…) . . . previously ) previouslypublished published[1,38] [1,38]are: are: The system can adapt the gastrointestinal transits and the addition of digestive secre- The system can adapt the gastrointestinal transits and the addition of digestive se- tions to the state of fasting or fed to study the behaviour of the dosage form of bioactive cretions to the state of fasting or fed to study the behaviour of the dosage form of bioactive compounds and food. compounds and food. It presents great versatility since it allows reproduction of the physiological conditions It presents great versatility since it allows reproduction of the physiological condi- of human digestion (digestive secretions, pH and gastric and intestinal transits, etc.) for tions of human digestion (digestive secretions, pH and gastric and intestinal transits, etc.) different population groups (children, adults, elderly,...) and certain pathological situations for different population groups (children, adults, elderly,...) and certain pathological situ- (obesity, etc.), as well as reproducing the gastrointestinal and colonic conditions of other ations (obesity, etc.), as well as reproducing the gastrointestinal and colonic conditions of monogastric animals (pig,...). other monogastric animals (pig,...). The intestinal absorption of the digested food can be carried out by using intestinal The intestinal absorption of the digested food can be carried out by using intestinal cell lines in combination with the colonic fermentation system. cell lines in combination with the colonic fermentation system. It allows maintenance of the anaerobic conditions required in the fermentation pro- cess, to protect the oxygen-sensitive compounds involved in the colonic fermentation. The design allows collection of samples of the luminal content of the three sections of the colon at any time during the fermentation process of the food for analysis (meta- Foods 2021, 10, 3020 12 of 14 It allows maintenance of the anaerobic conditions required in the fermentation process, to protect the oxygen-sensitive compounds involved in the colonic fermentation. The design allows collection of samples of the luminal content of the three sections of the colon at any time during the fermentation process of the food for analysis (metagenomic, metabolomic, SCFA,...) and to obtain information on the transformation of the food during digestion. It incorporates a computer program for the automated control of different physiologi- cal conditions applied in colonic fermentation assays. The characteristics of the system and the computer-control of physiological parameters open possibilities for variation of conditions that would allow the simulation of microbial dysbiosis associated to pathological conditions or due to unbalanced diets. 4. Study Limitations All the data in this article come from an industrial project formed by a consortium of food sector companies. Each in vitro digestor test takes a month to complete and every metagenomic analysis represents a large part of the budget, so there are not enough re- sources to replicate the process more than one time for each product (food or biocompound). That is why there are not enough data to perform statistical analysis regarding the bacteria species relative abundance on the different reactors, in Figure 3. 5. Conclusions Combining the in vitro colonic fermentation with 16S rRNA-based metagenomic analysis with Next Generation Sequencing (NGS) and the UHPLC-ESI-QqQ-MS/MS metabolomic analysis provides an appropriate methodology for reproducing the micro- biota environment under diverse conditions (eubiosis or dysbiosis) to study the potential modulatory effects of bioactive compounds, ingredients or foods. The in vitro colonic fermentation makes it possible to reproduce the typical microbiota under dysbiosis condi- tions, whereas the 16S rRNA protocol allows characterization of the change in microbiota composition up to species level. In addition, the deep chemical characterization of the colonic medium allowed ascertainment of the main metabolites generated among a wide range of determined compounds. The capacity of the proposed protocol was corroborated with the studied sample. The treatment with the vegetable drink produced changes in the microbiota. Although there was no clear improvement in the diversity, the population of some bacteria increased, such as some SCFA-producing bacteria that produce propionate, acetic and butyrate. The metabolomic analysis showed an increased production of some compounds that may ameliorate health status. In conclusion, we present an interesting protocol for testing of the modulatory effects of foods or biocompounds on gut microbiota composition and metabolic activity Author Contributions: Conceptualization, A.B. and F.I.M.; methodology, B.V., E.G., A.R.-H., F.I.M. and A.B.; formal analysis, C.R., B.V., E.G. and A.R.-H.; data curation, C.R.; writing—original draft preparation, C.R. and A.B.; writing—review and editing, J.A.N., S.S. and F.I.M.; supervision, A.B., J.A.N., S.S. and F.I.M.; project administration, A.B. and F.I.M. All authors have read and agreed to the published version of the manuscript. Funding: This research was funded by Ministerio de Ciencia e Innovación (CDTI (Centro para el Desarrollo Tecnológico Industrial): BIOTAGUT (CDTI strategical project 2017), CIBERobn (Centro de Inves-tigación Biomédica en Red de la Fisiopatología de la Obesidad y Nutrición) (CB12/03/30002), and Gobierno de Navarra: Obekit (PT024), Microbiota (PI035), and Nutribiota (0011-1411-2018- 000040) projects. Carles Rosés is hired for the Biotagut research project. Institutional Review Board Statement: The study was conducted according to the guidelines of the Declaration of Helsinki, and approved by the Ethics Committee of University of Navarra (protocol code 132/2015). Informed Consent Statement: Informed consent was obtained from all subjects involved in the study. Foods 2021, 10, 3020 13 of 14 Acknowledgments: The authors acknowledge Roger Lahoz (Servei de Genòmica, Universitat Autònoma de Barceona, Barcelona, Spain) for technical assistance. Conflicts of Interest: Sergio Ariel Streitenberger Jacobi is an employee at AMC Natural Drinks S.A., company. The grant obtained by the company from the Spanish Ministry of Economy, Industry and Competitiveness under the programme “Convocatoria de Programa Estratégico CIEN”, Ref. IDI-20170842, supported this research. References 1. Sensoy, I. A review on the food digestion in the digestive tract and the used in vitro models. Curr. Res. Food Sci. 2021, 4, 308–319. [CrossRef] 2. Anhê, F.F.; Varin, T.V.; Le Barz, M.; Desjardins, Y.; Levy, E.; Roy, D.; Marette, A. Gut microbiota dysbiosis in obesity-linked metabolic diseases and prebiotic potential of polyphenol-rich extracts. Curr. Obes. Rep. 2015, 4, 389–400. [CrossRef] [PubMed] 3. do Carmo Gouveia Peluzio, M.; Martinez, J.A.; Milagro, F.I. Postbiotics: Metabolites and mechanisms involved in microbiota-host interactions. Trends Food Sci. Technol. 2021, 108, 11–26. [CrossRef] 4. Schwiertz, A.; Taras, D.; Schäfer, K.; Beijer, S.; Bos, N.A.; Donus, C.; Hardt, P.D. Microbiota and SCFA in lean and overweight healthy subjects. Obesity 2010, 18, 190–195. [CrossRef] 5. Zhang, Y.J.; Li, S.; Gan, R.Y.; Zhou, T.; Xu, D.P.; Li, H.B. Impacts of gut bacteria on human health and diseases. Int. J. Mol. Sci. 2015, 16, 7493–7519. [CrossRef] [PubMed] 6. Crovesy, L.; Masterson, D.; Rosado, E.L. Profile of the gut microbiota of adults with obesity: A systematic review. Eur. J. Clin. Nutr. 2020, 74, 1251–1262. [CrossRef] [PubMed] 7. Ferrua, M.J.; Singh, R.P. Modeling the fluid dynamics in a human stomach to gain insight of food digestion. J. Food Sci. 2010, 75, R151–R162. [CrossRef] 8. Guerra, A.; Etienne-Mesmin, L.; Livrelli, V.; Denis, S.; Blanquet-Diot, S.; Alric, M. Relevance and challenges in modeling human gastric and small intestinal digestion. Trends Biotechnol. 2012, 30, 591–600. [CrossRef] [PubMed] 9. Liu, W.; Ye, A.; Han, F. Advances and challenges in liposome digestion: Surface interaction, biological fate, and GIT modeling. Adv. Colloid Interface Sci. 2019, 263, 52–67. [CrossRef] [PubMed] 10. Viadel, B.; Rivera, J.D.; Navarro, M.T.; Tenllado, I.; Carreres, J.E.; García, J.; Blasco, M.; Subirats, S. Equipo modular de digestión in vitro. Patent No ES2361983B1, 3 May 2012. 11. van de Wiele, T.; Boon, N.; Possemiers, S.; Jacobs, H.; Verstraete, W. Inulin-type fructans of longer degree of polymerization exert more pronounced in vitro prebiotic effects. J. Appl. Microbiol. 2007, 102, 452–460. [CrossRef] 12. Marzorati, M.; Verhelst, A.; Luta, G.; Sinnott, R.; Verstraete, W.; de Wiele, T.V.; Possemiers, S. In vitro modulation of the human gastrointestinal microbial community by plant-derived polysaccharide-rich dietary supplements. Int. J. Food Microbiol. 2010, 139, 168–176. [CrossRef] 13. CCummings, J.; Macfarlange, T.; Drasarb, D. The gut microflora and its significance. In Gastrointestinal Pathology; Churchill- Livingstone: Edinburgh, UK, 1989; p. 201. 14. Kontula, P.; Jaskari, J.; Nollet, L.; de Smet, I.; von Wright, A.; Poutanen, K.; Mattila-Sandholm, T. The colonization of a simulator of the human intestinal microbial ecosystem by a probiotic strain fed on a fermented oat bran product: Effects on the gastrointestinal microbiota. Appl. Microbiol. Biotechnol. 1998, 50, 246–252. [CrossRef] 15. De Boever, P.; Deplancke, B.; Verstraete, W. Fermentation by gut microbiota cultured in a simulator of the human intestinal microbial ecosystem is improved by supplementing a soygerm powder. J. Nutr. 2000, 130, 2599–2606. [CrossRef] [PubMed] 16. Mainville, I.; Arcand, Y.; Farnworth, E.R. A dynamic model that simulates the human upper gastrointestinal tract for the study of probiotics. Int. J. Food Microbiol. 2005, 99, 287–296. [CrossRef] [PubMed] 17. Dall’Asta, M.; Calani, L.; Tedeschi, M.; Jechiu, L.; Brighenti, F.; del Rio, D. Identification of microbial metabolites derived from invitro fecal fermentation of different polyphenolic food sources. Nutrition 2012, 28, 197–203. [CrossRef] [PubMed] 18. Alander, M.; Satokari, R.; Korpela, R.; Saxelin, M.; Vilpponen-Salmela, T.; Mattila-Sandholm, T.; von Wright, A. Persistence of colonization of human colonic mucosa by a probiotic strain, Lactobacillus rhamnosus GG, after oral consumption. Appl. Environ. Microbiol. 1999, 65, 351–354. [CrossRef] 19. Van Den Abbeele, P.; Grootaert, C.; Marzorati, M.; Possemiers, S.; Verstraete, W.; Gérard, P.; Rabot, S.; Bruneau, A.; El Aidy, S.; Derrien, M.; et al. Microbial community development in a dynamic gut model is reproducible, colon region specific, and selective for bacteroidetes and Clostridium cluster IX. Appl. Environ. Microbiol. 2010, 76, 5237–5246. [CrossRef] [PubMed] 20. Molly, K.; Woestyne, M.V.; Verstraete, W. Development of a 5-step multi-chamber reactor as a simulation of the human intestinal microbial ecosystem. Appl. Microbiol. Biotechnol. 1993, 39, 254–258. [CrossRef] [PubMed] 21. Molly, K.; Woestyne, M.V.; de Smet, I.; Verstraete, W. Validation of the simulator of the human intestinal microbial ecosystem (SHIME) reactor using microorganism-associated activities. Microb. Ecol. Health Dis. 1994, 7, 191–200. 22. Rosés, C.; Cuevas-Sierra, A.; Quintana, S.; Riezu-Boj, J.I.; Martínez, J.A.; Milagro, F.I.; Barceló, A. Gut Microbiota bacterial species associated with mediterranean diet-related food groups in a northern spanish population. Nutrients 2021, 13, 636. [CrossRef] 23. Hildebrand, F.; Tito, R.Y.; Voigt, A.; Bork, P.; Raes, J. Correction: LotuS: An efficient and user-friendly OTU processing pipeline. Microbiome 2014, 2, 37. [CrossRef] Foods 2021, 10, 3020 14 of 14 24. Menu, E.; Mary, C.; Toga, I.; Raoult, D.; Ranque, S.; Bittar, F. Evaluation of two DNA extraction methods for the PCR-based detection of eukaryotic enteric pathogens in fecal samples. BMC Res. Notes 2018, 11. [CrossRef] [PubMed] 25. Illumina. 16S Metagenomic Sequencing Library Preparation Guide. 2013. Available online: https://web.uri.edu/gsc/files/16s- metagenomic-library-prep-guide-15044223-b.pdf (accessed on 25 April 2019). 26. McKnight, P.E.; Najab, J. Mann-Whitney U Test. In The Corsini Encyclopedia of Psychology; Wiley: Hoboken, NJ, USA, 2010; Volume 1. [CrossRef] 27. Edgar, R.C. UPARSE: Highly accurate OTU sequences from microbial amplicon reads. Nat. Methods 2013, 10, 996–998. [CrossRef] [PubMed] 28. Edgar, R.C. UCHIME2: Improved chimera prediction for amplicon sequencing. BioRxiv 2016, 074252. [CrossRef] 29. Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [CrossRef] 30. Ritari, J.; Salojärvi, J.; Lahti, L.; de Vos, W.M. Improved taxonomic assignment of human intestinal 16S rRNA sequences by a dedicated reference database. BMC Genom. 2015, 16, 1056. [CrossRef] 31. Gentleman, R.C.; Carey, V.J.; Bates, D.M.; Bolstad, B.; Dettling, M.; Dudoit, S.; Ellis, B.; Gautier, L.; Ge, Y.; Gentry, J.; et al. Bioconductor: Open software development for computational biology and bioinformatics. Genome Biol. 2004, 5, R80. [CrossRef] 32. Spellerberg, I.F.; Fedor, P.J. A tribute to Claude Shannon (1916–2001) and a plea for more rigorous use of species richness, species diversity and the ‘Shannon–Wiener’ Index. Glob. Ecol. Biogeogr. 2003, 12, 177–179. [CrossRef] 33. Cuevas-Sierra, A.; Ramos-Lopez, O.; Riezu-Boj, J.I.; Milagro, F.I.; Martinez, J.A. Diet, Gut Microbiota, and Obesity: Links with Host Genetics and Epigenetics and Potential Applications. Adv. Nutr. 2019, 10, S17–S30. [CrossRef] 34. Lawson, P.A.; Song, Y.; Liu, C.; Molitoris, D.R.; Vaisanen, M.L.; Collins, M.D.; Finegold, S.M. Anaerotruncus colihominis gen. nov., sp. nov., from human faeces. Int. J. Syst. Evol. Microbiol. 2004, 54, 413–417. [CrossRef] 35. Looft, T.; Levine, U.Y.; Stanton, T.B. Cloacibacillus porcorum sp. nov., a mucin-degrading bacterium from the swine intestinal tract and emended description of the genus Cloacibacillus. Int. J. Syst. Evol. Microbiol. 2013, 63, 1960–1966. [CrossRef] [PubMed] 36. Nagai, F.; Morotomi, M.; Sakon, H.; Tanaka, R. Parasutterella excrementihominis gen. nov., sp. nov., a member of the family Alcaligenaceae isolated from human faeces. Int. J. Syst. Evol. Microbiol. 2009, 59, 1793–1797. [CrossRef] [PubMed] 37. Rands, C.M.; Starikova, E.V.; Brüssow, H.; Kriventseva, E.V.; Govorun, V.M.; Zdobnov, E.M. ACI-1 beta-lactamase is widespread across human gut microbiomes in Negativicutes due to transposons harboured by tailed prophages. Environ. Microbiol. 2018, 20, 2288–2300. [CrossRef] 38. Van de Wiele, T.; Abbeele, P.V.D.; Ossieur, W.; Possemiers, S.; Marzorati, M. The simulator of the human intestinal microbial ecosystem (SHIME®). Impact Food Bioact. Health 2015, 305–317. [CrossRef]