ORIGINAL RESEARCH published: 04 March 2021 doi: 10.3389/fimmu.2021.625297 Diet, Immunity, and Microbiota Interactions: An Integrative Analysis of the Intestine Transcriptional Response and Microbiota Modulation in Gilthead Seabream (Sparus aurata) Fed an Essential Edited by: Oils-Based Functional Diet Michiko Oyoshi, Boston Children’s Hospital and Joana P. Firmino 1,2,3 , Eva Vallejos-Vidal 4 , M. Carmen Balebona 5 , Yuliaxis Ramayo-Caldas 6 , Harvard Medical School, United States Isabel M. Cerezo 5 , Ricardo Salomón 1,3 , Lluis Tort 7 , Alicia Estevez 1 , Miguel Ángel Moriñigo 5 , Felipe E. Reyes-López 7,8,9* and Enric Gisbert 1* Reviewed by: Yue Zhang, 1 IRTA, Centre de Sant Carles de la Ràpita (IRTA-SCR), Aquaculture Program, Sant Carles de la Ràpita, Spain, Johns Hopkins Medicine, 2 TECNOVIT–FARMFAES, S.L. Alforja, Spain, 3 Ph.D. Program in Aquaculture, Universitat Autònoma de Barcelona, Barcelona, United States Spain, 4 Departamento de Biología, Facultad de Química y Biología, Centro de Biotecnología Acuícola, Universidad de Martha Reyes-Becerril, Santiago de Chile, Santiago, Chile, 5 Department of Microbiology, Faculty of Science, University of Malaga, Málaga, Spain, Centro de Investigación Biológica del 6 Animal Breeding and Genetics Program, Institute of Agrifood Research and Technology, Torre Marimon, Caldes de Montbui, Noroeste (CIBNOR), Mexico Spain, 7 Department of Cell Biology, Physiology and Immunology, Universitat Autònoma de Barcelona, Barcelona, Spain, Francisco Guardiola, 8 Facultad de Medicina Veterinaria y Agronomía, Universidad de Las Américas, Santiago, Chile, 9 Consorcio Tecnológico de University of Murcia, Spain Sanidad Acuícola, Ictio Biotechnologies S. A., Santiago, Chile *Correspondence: Enric Gisbert Enric.Gisbert@irta.cat Essential oils (EOs) are promising alternatives to chemotherapeutics in animal production Felipe E. Reyes-López due to their immunostimulant, antimicrobial, and antioxidant properties, without Felipe.Reyes@uab.cat associated environmental or hazardous side effects. In the present study, the modulation of the transcriptional immune response (microarray analysis) and microbiota [16S Specialty section: This article was submitted to Ribosomal RNA (rRNA) sequencing] in the intestine of the euryhaline fish gilthead Nutritional Immunology, seabream (Sparus aurata) fed a dietary supplementation of garlic, carvacrol, and thymol a section of the journal Frontiers in Immunology EOs was evaluated. The transcriptomic functional analysis showed the regulation of Received: 02 November 2020 genes related to processes of proteolysis and inflammatory modulation, immunity, Accepted: 28 January 2021 transport and secretion, response to cyclic compounds, symbiosis, and RNA metabolism Published: 04 March 2021 in fish fed the EOs-supplemented diet. Particularly, the activation of leukocytes, such Citation: as acidophilic granulocytes, was suggested to be the primary actors of the innate Firmino JP, Vallejos-Vidal E, Balebona MC, Ramayo-Caldas Y, immune response promoted by the tested functional feed additive in the gut. Fish Cerezo IM, Salomón R, Tort L, growth performance and gut microbiota alpha diversity indices were not affected, Estevez A, Moriñigo MÁ, Reyes-López FE and Gisbert E (2021) while dietary EOs promoted alterations in bacterial abundances in terms of phylum, Diet, Immunity, and Microbiota class, and genus. Subtle, but significant alterations in microbiota composition, such Interactions: An Integrative Analysis of as the decrease in Bacteroidia and Clostridia classes, were suggested to participate the Intestine Transcriptional Response and Microbiota Modulation in Gilthead in the modulation of the intestine transcriptional immune profile observed in fish fed the Seabream (Sparus aurata) Fed an EOs diet. Moreover, regarding microbiota functionality, increased bacterial sequences Essential Oils-Based Functional Diet. Front. Immunol. 12:625297. associated with glutathione and lipid metabolisms, among others, detected in fish fed doi: 10.3389/fimmu.2021.625297 the EOs supported the metabolic alterations suggested to potentially affect the observed Frontiers in Immunology | www.frontiersin.org 1 March 2021 | Volume 12 | Article 625297 Firmino et al. Diet, Immunity, and Microbiota Crosstalk immune-related transcriptional response. The overall results indicated that the tested dietary EOs may promote intestinal local immunity through the impact of the EOs on the host-microbial co-metabolism and consequent regulation of significant biological processes, evidencing the crosstalk between gut and microbiota in the inflammatory regulation upon administration of immunostimulant feed additives. Keywords: gut-associated lymphoid tissue, microbiota, additive, functional feed, aquaculture, oral immmunization, teleost, gut immune crosstalk INTRODUCTION During the last years, the concept of “gut health” has become a trending topic due to its significance on the nutrition, In the post-antibiotics era, concerns about the potential loss of metabolism, immunity, pathogen control, welfare, behavior, and productivity due to an increase of infectious diseases are a reality performance of the host. Despite the term not being well-defined within the animal production sector. The production of aquatic in the literature and perhaps having a subjective definition, protein through aquaculture is not an exception. Regarding the key components of this term in animal production are: (i) the aquaculture industry, the increasing pathogen resistance the diet, (ii) the functional structure of the mucosal barrier, to chemotherapeutic treatments and their use restrictions, (iii) an effective digestion and absorption of nutrients, (iv) along with the rising public awareness regarding food safety, an appropriate and stable microbiota, and (v) an effective environmental impact, and animal welfare, have encouraged immunity (6). Similar to higher vertebrates, teleost fish have the development of alternative dietary treatments, such as a specialized and sophisticated gut immune system, although functional feeds (1). Similarly, to livestock, functional feed a significant variation is observed in the gastrointestinal tract additives may benefit farmed fish through the regulation of of different species according to their nutritional requirements the host metabolism, nutrient absorption, and enhancement of (7). The intestinal mucosal layer (including the mucus and the host performance. Furthermore, it may activate the immunity epithelial cells) form an important physical and biochemical of the host either by direct stimulation of the innate immune defense barrier against exogenous substances, such as bacteria, system or through the sustenance of commensal microorganisms toxins, and allergens. It also participates in the local immune and inhibition of pathogens in the intestinal tract (2). These response through the recognition and processing of antigens, factors, either individually or combined, may have a profound the recruitment of innate and adaptive immune cells, and the impact on key performance indicators. For instance, fish farmers secretion of cytokines, chemokines, antimicrobial peptides, and recognize the direct effect of health promotion through feed in mucins through the gut-associated lymphoid tissue (GALT) (2). their economic gain by the improvement of key performance A key actor in gut integrity and functionality is the microbial indicators (i.e., improving somatic growth, reducing feed community that colonizes it. In this sense, the gut commensal conversion rates, promoting host welfare, and diminishing microbiota, besides protecting the host against pathogenic morbidity, among others). The wide array of potential benefits bacteria invasion, are able to modulate the gene expression of derived from functional feed additives and nutraceuticals has processes involved in the stimulation of epithelial proliferation, focused the light on their study and validation in aquafeeds. nutrient metabolism, and innate immune responses, promoting Among functional feed additives, phytogenics consist of a intestinal homeostasis (3). Under this context, any interference heterogeneous group of plant-derived products widely used on the intestinal mucosal barrier integrity and/or the microbiota in animal nutrition. Essential oils (EOs), a blend of organic composition may impair gut condition and health, leading to substances synthesized by aromatic plants during secondary disease-related dysbiosis (8). An increasing body of evidence metabolism, whose chemical composition may vary according supports the general assumption that feed additives can influence to plant and environment characteristics and/or extraction considerably the fish gut condition, affecting the intestinal procedures, are the most common class of phytogenics used epithelium, microbiota, and mucosal immunity (2). There is in livestock nutrition as well as in aquafeeds. EOs have been also evidence that fish innate and adaptive immune system may increasingly studied as promising chemotherapeutic alternatives influence the regulation and composition of the gut microbiota due to their antimicrobial, immunostimulant, antioxidant, anti- and vice versa. Such interactions are not clearly deciphered so stress, and growth-promoting properties, without associated far, especially in lower vertebrates (8). In this way, functional environmental or hazardous side effects. In addition, there genomics studies provide a wide range of applications that is also evidence that EOs may exert a positive impact on allows an increased and better understanding of the mechanisms the gut health of livestock, including aquaculture relevant fish underlying this symbiosis. Consequently, this information is of species (3). Particularly, some studies have recently reported the paramount importance for deciphering the mode of action of advantageous outcomes of the dietary administration of garlic feed additives and their proper dietary administration. (4), carvacrol, and/or thymol (5) in the gut health of aquatic Under this context, the present study aimed to evaluate the species, which suggest them as interesting phytogenic targets for intestinal tissue transcriptional activity and microbiota responses aquafeed additive development. in the gut of the euryhaline fish gilthead seabream (Sparus aurata) Frontiers in Immunology | www.frontiersin.org 2 March 2021 | Volume 12 | Article 625297 Firmino et al. Diet, Immunity, and Microbiota Crosstalk fed a functional feed additive consisting of a microencapsulated daily rate of 3.0% of the stocked biomass, which approached blend of garlic, carvacrol, and thymol EOs. Additionally, the apparent satiation. At the end of the trial, all the fish in each tank authors also sought to provide new insights about the shared role were netted, anesthetized (buffered 150 mg/L MS-222, Sigma- of host-microbial co-metabolism in building-up a local immune Aldrich, Spain), and measured for BW and SL. We calculated response promoted by the tested feed additive. different performance parameters: specific growth rate (SGR; % BW/day) = 100 × (ln BWf – ln BWi)/days (where BWf and BWi MATERIALS AND METHODS represented the final and the initial body weights, respectively). Fulton’s condition factor (K) = (BWf/SLf 3 ) × 100 (where SLf Rearing Conditions was the final SL). This is a morphometric index that estimates Gilthead seabream fry (body weight, BW = 5.0 ± 0.2 g; mean the body condition of fish, assuming that heavier fish of a given ± SD) were purchased from Piscicultura Marina Mediterránea length are in better condition (11). S.L. (Andromeda Group, Valencia, Spain) and transported to In addition, four fish were randomly selected from each the research facilities of the Institute of Agrifood Research and tank, euthanized with an overdose of the abovementioned Technology (IRTA) in Sant Carles de La Ràpita (Tarragona, anesthetic, and their gut removed. For transcriptional analysis Spain). Fish were randomly distributed among six tanks (450 L purposes, a small section of the mid-anterior intestine from capacity) connected to the IRTAmar R recirculation system (5– each fish was dissected, placed in RNAlaterTM (Invitrogen, 10% water replacement per day for compensating evaporation Thermo Fisher Scientific, Lithuania), incubated overnight (4◦ C), and siphoning losses) in order to keep water quality through and stored at −80◦ C until further RNA extraction. There is UV, biological, and mechanical filtration. At the beginning of evidence that the mid-anterior section of the fish intestine has the trial, 150 juveniles (25 fish per tank; initial density = a specialized immunological functionality when compared with 2 kg m−3 ) were individually measured in body weight (BW, other intestinal sections (12). The remaining sections of the g) and standard length (SL, mm) to the nearest 0.1 g and anterior and posterior intestine were frozen separately in dry ice 1 mm, respectively (BW = 40.3 ± 0.1 g; SL = 12.0 ± 0.2 mm). and stored at −80◦ C for further microbiota analysis. This assay took place under natural photoperiod, with daily monitoring of the water temperature (25.1 ± 1.5◦ C), oxygen (6.8 Transcriptional Analysis ± 1.7 mg/L; >80% saturation) (OXI330, Crison Instruments, RNA Isolation and Quality Control Barcelona, Spain), and pH (7.5 ± 0.01) (pHmeter 507, Crison Gilthead seabream mid-anterior intestine samples were Instruments), whereas salinity (35‰) (MASTER-20 T; ATAGO randomly selected per dietary treatment. Total RNA was Co. Ltd), ammonia (0.13 ± 0.1 mg NH+ 4 /L), and nitrite (0.18 extracted individually using the RNeasy R Mini Kit (Qiagen, ± 0.1 mg NO− 2 /L) levels (HACH DR9000 Colorimeter, Hach R , Germany) and eluted (final volume = 35 µl) in nuclease-free Spain) were weekly controlled. water and treated with DNAse (DNA-freeTM DNA Removal Kit; Invitrogen, Lithuania). Total RNA concentration and purity Diets and Feeding Trial were quantified using a Nanodrop-2000 R spectrophotometer Diets were manufactured by Sparos Lda. (Olhão, Portugal) as (Thermo Scientific, USA) and stored at −80◦ C. Prior to follows: main ingredients were ground (below 250 µm) in a hybridization with microarrays, RNA samples were checked for micropulverizer hammer mill (SH1; Hosokawa Micron, B.V., RNA integrity (Agilent 2100 Bioanalyzer; Agilent Technologies, Doetinchem, The Netherlands). Powder ingredients and oils Spain) and selected by the criteria of a RIN value >8.5. Three were then mixed according to the target formulation in a paddle different pools of samples per dietary treatment were established mixer (RM90; Mainca, S.L., Granollers, Spain). After extrusion (n = 4 fish each). (2 mm pellet size), all feed batches were dried in a convection oven (OP 750-UF; LTE Scientifics, Oldham, UK) for 4 h at 45◦ C. Microarrays A basal (control) diet was formulated with high levels of A transcriptional analysis for the intestine from both marine-derived protein sources to contain 46% crude protein, experimental groups was carried out using the Aquagenomics 18% crude fat, and 21.5 MJ/kg gross energy (Table 1) as described S. aurata oligonucleotide microarray v2.0 (4 × 44 K) (SAQ) in Firmino et al. (9). The second experimental diet was the platform. Detailed information and transcriptomic raw data control diet supplemented with 0.5% of the functional additive are available at the Gene Expression Omnibus (GEO) public composed of a blend of microencapsulated garlic, carvacrol, and repository at the U.S. National Center for Biotechnology thymol synthetic EOs (AROTEC-G R , TECNOVIT-FARMFAES, Information (NCBI), accession numbers GPL13442 and S.L., Spain). When dealing with feed additives, especially GSE159643, respectively. The sampling labeling, hybridization, EOs, their proper and controlled administration is of special washes, and scanning were performed as described before (9). importance. Thus, encapsulation technology was used for EOs For this purpose, a one-color RNA labeling was used (Agilent incorporation into the experimental diet in order to improve One-Color RNA Spike-In Kit; Agilent Technologies, USA). RNA its bioavailability and efficacy, as well as the standardization of from each sample pool (200 ng) was reverse-transcribed together its dosing in order to avoid variability and discrepancies among with the RNA spike-in. Then, total RNA was used as a template studies (10). for Cyanine-3 (Cy3) labeled cRNA synthesis and amplification Diets were tested for 65 days in a feeding trial carried out with the Quick Amp Labeling Kit (Agilent Technologies). cRNA in triplicate tanks. Fish were hand-fed two times per day at the samples were purified using the RNeasy Micro Kit (Qiagen). Dye Frontiers in Immunology | www.frontiersin.org 3 March 2021 | Volume 12 | Article 625297 Firmino et al. Diet, Immunity, and Microbiota Crosstalk TABLE 1 | Formulation and proximate composition of the basal diet. between both H. sapiens and gilthead seabream species, protein BLAST was run, and the GeneCards (www.genecards.org) and Ingredients Basal diet (%) UniProt (www.uniprot.org) databases were accessed as described Fishmeal 70 LT FF Skagen 20.0 in Firmino et al. (9). Fishmeal CORPESCA Super Prime 10.0 CPSP 90 2.5 Intestinal Microbiota Squid meal 2.5 DNA Extraction Soy protein concentrate (Soycomil) 5.0 Samples were thawed gradually on ice, and the intestinal Wheat gluten 5.0 contents were extracted by pressing toward the ends with Corn gluten 8.0 a sterile object. After homogenizing the content, a sample Korfeed 60 4.5 (50 mg) was taken for DNA extraction following the protocol Soybean meal 48 8.0 based on saline precipitation (13). DNA concentration was Rapeseed meal 4.0 quantified fluorometrically with the QubitTM dsDNA HS Assay Sunflower meal 3.0 Kit (Thermo Fisher Scientific, Waltham, MA, USA) and its Wheat meal 7.0 purity and integrity assessed using a NanoDropTM One UV-Vis Whole peas 2.5 Spectrophotometer WiFi (Thermo Scientific, USA) and through Fish oil—COPPENS 9.0 an agarose gel electrophoresis. Soybean oil 1.5 Amplicon Sequencing of 16S Ribosomal RNA and Rapeseed oil 2.5 Sequence Data Processing Vitamin and mineral Premix PV01 2.0 The 16S rRNA of samples were sequenced on an Illumina R Soy lecithin—powder 2.0 MiSeq platform (Illumina, San Diego, CA, USA) with 2 × 300 Antioxidant powder (Paramega) 0.4 bp paired-end sequencing in the Ultrasequencing Service of the Dicalcium phosphate 0.6 Bioinnovation Center of University of Málaga (Málaga, Spain). TOTAL 100.0 Sequencing was carried out using the sense forward 5′ TCGTCG Proximate composition, % in dry basis GCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGG Crude protein 46.2 CWGCAG 3′ and 5′ GTCTCGTGGGCTCGGAGATGTGTAT Crude fat 18.4 AAGAGACAGGACTACHVGGGTATCTAATCC 3′ reverse Gross Energy 21.5 primers directed to the variable regions V3–V4 of the 16S rRNA gene. All Illumina reads were analyzed using the FastaQC software in order to assess sequence quality. Further data processing including trimming and 16S rRNA analysis and incorporation and cRNA yield were checked (NanoDrop ND- visualization was performed with a workflow based on the 2000 R spectrophotometer). Then, Cy3-labeled cRNA (1.5 mg) mothur software package (1.39.5 version). Briefly, chimeras were with specific activity > 6.0 pmol Cy3/mg cRNA was fragmented detected using the software UCHIME version 4.2 (https://drive5. at 60◦ C for 30 min, and hybridized with the array in presence com/uchime, effective tags obtained) and sequences were aligned of a hybridization buffer (Gene Expression Hybridization Kit, and clustered into operational taxonomic units (OTUs) with an Agilent Technologies) at 65◦ C for 17 h. For washes, microarrays identity cut of 80%. The total count threshold was set at 0.005% were incubated with Gene Expression wash buffers and using the Greengenes database (13). stabilization and drying solution according to the manufacturer’s instructions (Agilent Technologies). Microarray slides were then Microbial Functional Analysis: PICRUSt scanned (Agilent G2505B Microarray Scanner System), and Within the metagenomic study, the analysis of the most spot intensities and other quality control features were extracted represented functions of the microbial community was (Agilent Feature Extraction software version 10.4.0.0). conducted. For this purpose, PICRUSt (version 1.1.3) was used for comparing the predicted functional profiles from Intestine Functional Analysis: The Search Tool for the the anterior and posterior intestines of gilthead seabream Retrieval of Interacting Genes fed both administered diets. PICRUSt is a bioinformatics The Search Tool for the Retrieval of Interacting Genes (STRING) software designed to predict the functional profile of a microbial public repository version 11.0 (https://string-db.org) was used to community based on the study of the 16S rRNA. Reads generate the transcripteractome that takes place in the intestine from 12 samples (three samples from intestine sample and of fish fed the EOs-supplemented diet. A Protein–Protein treatment) were filtered by rarefaction curves from 46,331 reads, interaction (PPI) Networks Functional Enrichment Analysis for and singletons were removed. A total of 45,844 sequences, all the differentially expressed genes (DEGs) was conducted which clustered into 103 OTUs identified in the Greengenes with a high-confidence interaction score (0.9) using Homo database, were used for additional bioinformatics analysis sapiens as model organism. Gene ontology (GO) enrichment (Supplementary Figure 1). Sequencing data were introduced analysis (p < 0.05) was also assessed including all the DEGs into the PICRUSt bioinformatics software, and samples were obtained. To confirm gene orthologs and match gene acronyms normalized to the number of copies of the 16S rRNA. Functional Frontiers in Immunology | www.frontiersin.org 4 March 2021 | Volume 12 | Article 625297 Firmino et al. Diet, Immunity, and Microbiota Crosstalk metagenomes for each sample were predicted from the Kyoto gene FC revealed that genes were mostly upregulated in the Encyclopedia of Genes and Genomes (KEGG) catalog and fish fed the diet containing the functional additive (70.2% of collapsed to specified KEGG levels. DEGs), although its modulation was moderate in terms of FC intensity. In particular, 408 of the abovementioned DEGs were Statistics upregulated, with 404 of them within the 1.0 < FC < 1.5 Differences between biometrical parameters of both experimental interval. The remaining four DEGs were grouped within the 2.0 dietary groups were analyzed through an unpaired t- ≤ FC ≤ 3.0 interval. In addition, 173 DEGs were downregulated test assuming data homoscedasticity (GraphPad PRISM (29.8% of DEGs; p < 0.05) and all of them were grouped 7.00; p < 0.05). within the −1.5 ≤ FC ≤ −1.0 interval (Figure 1A). Common Raw data extracted from microarrays were imported and segregation among the pool samples within the same dietary analyzed using GeneSpring version 14.5 GX software (Agilent treatment was observed in the hierarchical clustering of the Technologies). The 75th percentile normalization was used to intestine transcriptomic response based on correlation patterns standardize the arrays for comparisons, and data were filtered from the DEGs response (p < 0.05) (Figure 1B). PCA analysis by expression. The DEGs were obtained from a gene-level confirmed the differential transcriptomic profile among dietary differential expression analysis. An unpaired t-test was conducted treatments. The first component (Y-axis) accounted for 79.03% without correction (p < 0.05) to identify DEGs between dietary of variation; the second and third components (X-Axis and Z- treatments. The DEGs were grouped according to their fold- axis, respectively) accounted for 6.26 and 6.03% of the variation; change value (FC, p < 0.05) and represented using the GraphPad these three components show the perfect separation between the PRISM software. The Principal Component Analysis (PCA) control diet and the fish fed with the additive (Figure 1C). on conditions was carried out using GeneSpring software; From the whole set of DEGs, a functional network analysis was four eigenvectors were calculated using a covariance matrix to performed. The transcripteractome showed 252 coding proteins describe the aggrupation of the control and EOs groups in a 3D (nodes) with 473 interactions (edges). The remaining 329 DEGs plot. The gene expression values (log2-expression ratios) were (annotated as unknown genes) were excluded from the analysis. represented by a hierarchical clustering heatmap analysis (MeV Based on the 70 GO terms obtained from the enrichment analysis software v4.0), with Pearson distance and average linkage (9). (Supplementary Table 2), 6 main representative groups for the All data analysis of the intestinal microbiota was processed biological processes were identified in the transcripteractome: using Phyloseq and Vegan libraries in R statistical package. (1) proteolysis; (2) immunity; (3) transport and secretion; (4) Readings were normalized based on rarefaction curves (46,331 response to cyclic compounds; (5) symbiosis; and (6) gene reads) and singletons were removed. In addition, it was expression (Figure 2). calculated the coverage using the Good’s coverage coefficient, The tested functional feed additive resulted in the positive as well as the ecological indexes. Alpha diversity was estimated regulation of biological processes related to the proteolysis using the Chao1, Shannon, and Simpson indices, to assess category (32 upregulated genes and 16 downregulated taxonomic wealth, diversity, and dominance, respectively. For genes; Supplementary Figure 2; Supplementary Table 3). statistical analyses between diversity indices, the t-test (p < Several biological processes were considered, namely, 0.05) was used; while the taxonomic comparison was carried “proteolysis,” “regulation of proteolysis,” “regulation of out using the R package DESeq2 (p < 0.01). Differences in the peptidase activity,” “regulation of endopeptidase activity,” functional prediction between diets were made using the ANOVA and “protein deubiquitination.” In addition, biological processes multiple comparison test with the Tukey-Kramer correction associated with immunity showed a more balanced regulation in (corrected p < 0.05). fish fed the EOs-supplemented diet (17 upregulated genes and 14 downregulated genes; Supplementary Figure 3; RESULTS Supplementary Table 4). Several relevant GOs related to immunity were obtained, such as “cell activation,” “leukocyte Growth Performance activation,” “leukocyte activation involved in immune response,” At the end of the study, no significant differences were observed “neutrophil activation,” “neutrophil degranulation,” and between fish fed the EOs-supplemented diet and the control diet “regulated exocytosis.” The tested functional feed additive in terms of somatic growth (BWf = 150.8 ± 14.9 vs. 157.8 ± also favored biological processes associated with transport and 14.2 g; SLf = 17.1 ± 0.6 vs. 17.3 ± 0.6 mm), daily growth rates in secretion (50 upregulated genes and 26 downregulated genes; terms of BW (SGRBW = 2.03 ± 0.01 vs. 2.12 ± 0.07% BW/day) Supplementary Figure 4; Supplementary Table 5). Among and Fulton’s condition factor (K = 3.0 ± 0.1 vs. 3.1 ± 0.1), them, “transport,” “intracellular transport,” “vesicle-mediated respectively (Unpaired t-test, p > 0.05). A survival rate of 96 transport,” and “secretion” processes were identified in the and 92% was recorded for the EOs-supplemented and control functional network. Moreover, some biological processes in the diets, respectively. category of the response to cyclic compounds were positively affected by the dietary inclusion of EOs (25 upregulated genes Microarrays and Gut Transcripteractome and 11 downregulated genes; Supplementary Figures 5, 6; A total of 581 DEGs were found when comparing the Supplementary Table 6). In particular, the following processes transcriptomic profiling of the intestine from fish fed both diets were evidenced, such as the “response to organic cyclic (p < 0.05; Supplementary Table 1). The detailed analysis of compound,” “cellular response to organic cyclic compound,” Frontiers in Immunology | www.frontiersin.org 5 March 2021 | Volume 12 | Article 625297 Firmino et al. Diet, Immunity, and Microbiota Crosstalk organisms,” and “multi-organism process,” were positively modulated (33 upregulated genes and 13 downregulated genes) in the intestine of fish fed the diet containing the functional feed additive (Supplementary Figure 7; Supplementary Table 7). Finally, the biological processes associated with gene expression and RNA processing (62 upregulated genes and 10 downregulated genes; Supplementary Figure 8; Supplementary Table 8), among them “gene expression,” “RNA processing,” “RNA splicing,” “messenger RNA (mRNA) processing,” “mRNA metabolic process,” “mRNA export from nucleus,” and “ribonucleoprotein complex export from nucleus” were observed to be much more upregulated in the intestine of fish fed the EOs-supplemented diet than in the control group. A reasonable number of genes were observed to be shared among the immunity category and the other categories of gene expression/RNA processing (16%), proteolysis (29%), transport/secretion (77%), response to cyclic compounds (32%), and symbiosis (32%), suggesting a strong relationship between these biological processes that favors the host mucosal tissue immunity in response to the dietary EOs. Additionally, from the total DEGs obtained from the transcriptomic profile of the fish fed the EOs-supplemented diet, a set of genes was selected based on their expression and biological relevance (Table 2) in order to assess the participation of the intestine transcriptional regulation upon the observed microbiota modulation. Intestine Microbiota Analysis No variation was registered on the alpha diversity indices of the intestinal microbiota, regardless of the region of the intestine considered (Table 3; p > 0.05). However, the coefficient of variation (CV) for the Chao1 index was higher in the anterior FIGURE 1 | Differential expression analysis of the gilthead seabream (Sparus (CV = 18.7 vs. 5.2%) and posterior (CV = 23.9 vs. 12.3%) aurata) mid-anterior intestine transcriptomic response to the garlic, carvacrol, and thymol essential oils (EOs)-supplemented diet. (A) Comparing both intestinal segments of fish fed the diet containing the functional groups, 581 differentially expressed genes (DEGs) (p < 0.05) were found. feed additive (Supplementary Figure 9). Similarly, the Shannon From these, 408 genes were upregulated: 404 mainly concentrated in the and Simpson diversity indexes were neither affected by the 1.0–1.5-fold change (FC) interval; and 4 DEGs were grouped in the 2.0 ≤ FC inclusion of the functional feed additive in the diet. Library ≤ 3.0 interval. Additionally, 173 genes were downregulated (p < 0.05) and coverage was calculated using Good’s coverage index with a result grouped in the range −1.5 ≤ FC ≤ −1.0. (B) Hierarchical clustering of the gilthead seabream mid-anterior intestine transcriptomic response for the of 99.98 ± 0.01. control diet and EOs-supplemented diet, based on similitude patterns of the The relative abundance of microbial taxa at the phylum DEGs detected from three sample pools per dietary group. Data of the six level is shown in Figure 3A. Proteobacteria, Firmicutes, and microarrays are depicted, one for each represented pool. Both increased and Actinobacteria were commonly found in all samples regardless decreased gene expression patterns are shown in green and red, respectively. All transcripts represented are statistically significant (p < 0.05). (C) Principal of the dietary condition and region of the intestine considered. component analysis (PCA) of the DEGs of gilthead seabream intestine However, only the phylum Spirochaetes showed significantly response to the control diet (yellow) and EOs-supplemented diet (red). PC1, lower abundances in the posterior intestine in fish fed the diet PC2, and PC3 components loadings (Y-axis = component 1, 79.03% of supplemented with the functional feed additive (p < 0.05). variation; X-axis = component 2, 6.26% of variation; Z-axis = component 3, At class level, γ -Protebacteria were the dominant group (60– 6.03% variation). For DEGs details, please see also Supplementary Table 1. 73%; p < 0.05) in all samples assayed, whereas the abundance of Clostridia in the anterior intestine, and Brevinematae and Bacteroidia in the posterior intestine significantly decreased in fish fed the diet containing the blend of EOs (t-test, “response to lipid,” “cellular response to lipid,” “response to p < 0.05; Figure 3B). hormone,” “response to steroid hormone,” “cellular response to At the genus taxonomic level, bacterial abundance (relative hormone stimulus,” “cellular response to steroid hormone abundance > 1%) was significantly affected by the functional stimulus,” “response to alkaloid,” “response to nitrogen feed additive tested (t-test, p < 0.05). In particular, the anterior compound,” and “response to organonitrogen compound.” intestine of gilthead seabream fed the EOs-supplemented diet Furthermore, symbiosis correlated biological processes, such showed a significant increase (t-test, p < 0.05) in Photobacterium as “symbiont process,” “interspecies interaction between (γ-Proteobacteria, Vibronaceae) and Corynebacterium Frontiers in Immunology | www.frontiersin.org 6 March 2021 | Volume 12 | Article 625297 Firmino et al. Diet, Immunity, and Microbiota Crosstalk FIGURE 2 | Transcripteractome of the differentially expressed genes (DEGs) in the mid-anterior intestine of juvenile gilthead seabream (S. aurata) fed the garlic, carvacrol, and thymol essential oils (EOs)-supplemented diet (see also Supplementary Tables and Supplementary Figures 2–8). Protein–Protein Interactions Network (PPI) network nodes colors indicate the six representative processes identified from the functional enrichment analysis for each DEG represented—proteolysis, immunity, transport, and secretion, response to cyclic compounds, symbiosis, and gene expression. N nodes represent upregulated genes and H nodes represent downregulated genes. Graphic keys and network stats are indicated in the graphical figure legend. (Actinobacteria, Corynebacteriaceae) abundance whereas a genera Paracoccus (Proteobacteria, Rhodobacteraceae), Prevotella reduction in Comamonas (Proteobacteria, Comamonadaceae) (Bacteroidetes, Bacteroidaceae), and Rothia (Actinobacteria, was also found (t-test, p < 0.05; Figure 4). Regarding the Micrococcaceae) was also detected in fish fed the functional feed posterior intestine, a significant decrease in the abundance of the additive (t-test, p < 0.05; Figure 5). Frontiers in Immunology | www.frontiersin.org 7 March 2021 | Volume 12 | Article 625297 Firmino et al. Diet, Immunity, and Microbiota Crosstalk TABLE 2 | List of selected differentially expressed genes (DEGs) of the TABLE 2 | Continued mid-anterior intestine of juvenile gilthead seabream (Sparus aurata) fed a diet supplemented with a blend of garlic, carvacrol, and thymol essential oils (EOs). Gene name Acronym FC P-value Gene name Acronym FC P-value GENE EXPRESSION Zinc Finger Protein 572 znf572 1.389 0.019 PROTEOLYSIS AND DEUBIQUITINATION CDK5 Regulatory Subunit Associated cdk5rap3 1.341 0.014 UFM1 Specific Peptidase 2 ufsp2 1.621 0.012 Protein 3 Proteasome 20S Subunit Alpha 6 psma6 1.491 0.014 Zinc Finger E-Box Binding Homeobox 2 zeb2 1.315 0.003 Ubiquitin Specific Peptidase 10 usp10 1.490 0.026 Heterogeneous Nuclear hnrnpu 1.284 0.012 Proteasome 26S Subunit, ATPase 3 psmc3 1.413 0.040 Ribonucleoprotein U Ubiquitin Specific Peptidase 48 usp48 1.359 0.036 Cellular Communication Network wisp1 1.280 0.040 Proteasome 20S Subunit Alpha 4 psma4 1.289 0.027 Factor 4 OTU Deubiquitinase 3 otud3 1.256 0.035 NOP53 Ribosome Biogenesis Factor gltscr2 1.263 0.034 Ubiquitin Specific Peptidase 4 usp4 1.103 0.007 Zinc Finger Protein 74 znf74 1.256 0.038 Interleukin 1 Beta il-1β −1.167 0.025 Pre-MRNA Processing Factor 8 prpf8 1.214 0.005 NFKB Inhibitor Alpha nfkbia −1.327 0.047 Zinc Finger CCCH-Type Containing 11A zc3h11a 1.207 0.023 Proteasome 20S Subunit Beta 6 psmb6 −1.495 0.048 Zinc Finger Protein 214 znf214 1.201 0.008 IMMUNITY Small Nuclear Ribonucleoprotein U5 snrnp200 1.192 0.008 Subunit 200 Leukocyte Elastase Inhibitor serpinb1 1.561 0.024 F-Box Protein 31 fbxo31 1.178 0.021 Adenosine Deaminase ada 1.517 0.025 Spliceosome Associated Factor 1, sart1 1.155 0.005 Phosphatidylinositol-3,4,5- prex1 1.478 0.018 Recruiter Of U4/U6.U5 Tri-SnRNP Trisphosphate Dependent Rac Exchange Factor 1 Zinc Finger Protein 133 znf133 −1.127 0.006 CD9 Molecule cd9 1.283 0.033 Zinc Finger Protein 551 znf551 −1.168 0.001 CD81 Molecule cd81 1.279 0.018 Nibrin nbn −1.238 0.031 Perforin 1 prf1 1.181 0.034 Genes were arranged according to six representative processes identified from the Cathepsin B ctsb −1.340 0.031 functional enrichment analysis. Gene description, respective acronym, fold-change TRANSPORT AND SECRETION intensity (FC), modulation (green: upregulation; red: downregulation), and p-value are described. Fatty Acid Binding Protein 6 fabp6 2.659 0.044 Serine Protease 3 prss3 1.824 0.002 RAB5A, Member RAS Oncogene rab5a 1.668 0.023 TABLE 3 | Alpha diversity of bacterial communities in the anterior and posterior Family intestinal tract sections of gilthead seabream (Sparus aurata) fed a control and the RAB10, Member RAS Oncogene Family rab10 1.456 0.030 diet supplemented with a blend of garlic, carvacrol, and thymol essential oils (EOs). Rho GTPase Activating Protein 1 arhgap1 1.363 0.048 Chao1 Shannon Simpson NRAS Proto-Oncogene, GTPase nras 1.257 0.010 RAB1A, Member RAS Oncogene rab1a 1.238 0.025 Anterior Control 64.583 ± 3.357 2.513 ± 0.231 0.863 ± 0.046 Intestine Family EOs diet 69.437 ± 13.013 2.288 ± 0.470 0.838 ± 0.093 Hypoxia Inducible Factor 1 Subunit hif1a −1.259 0.002 Posterior Control 58.167 ± 7.182 2.401 ± 0.550 0.807 ± 0.164 Alpha EOs diet 62.770 ± 14.983 2.363 ± 0.220 0.863 ± 0.039 RESPONSE TO CYCLIC COMPOUNDS Carbonic Anhydrase 2 ca2 2.089 0.046 Tribbles Pseudokinase 1 trib1 1.740 0.011 Glutathione S-Transferase Theta 2B gstt2b 1.456 0.018 The PICRUSt analysis enabled the prediction of the functional Cytochrome P450 Family 2 Subfamily J cyp2j2 1.284 0.045 capacities of the microbial communities detected in the gilthead Member 2 seabream intestine based on the treatment applied. The low Growth Hormone 2 gh2 1.283 0.032 Nearest Sequenced Taxon Index (NSTI) value (0.04 ± 0.02) ATPase Na+/K+ Transporting Subunit atp1a1 1.271 0.022 Alpha 1 from the PICRUSt analysis indicated a good prediction accuracy. Peroxiredoxin 3 prdx3 −1.220 0.009 The functional analysis of KEGG pathways revealed significant Glutamic-Oxaloacetic Transaminase 2 got2 −1.254 0.008 differences at second- and third-level classification KEGG Adiponectin Receptor 1 adipor1 −1.262 0.041 pathways in both sections of the intestine (ANOVA, p < Cathepsin B ctsb −1.340 0.031 0.05). Regarding the anterior intestine and considering the SYMBIOSIS second-level classification of KEGG pathways, a reduction in Retinoic Acid Receptor Alpha rara 1.164 0.003 carbohydrate metabolism in fish fed the diet supplemented with Retinoid X Receptor Beta rxrb −1.172 0.030 the functional feed additive was obtained (ANOVA, p < 0.05) (Figure 6A). When considering the third-level classification of (Continued) KEGG pathways in the anterior intestine, a larger proportion Frontiers in Immunology | www.frontiersin.org 8 March 2021 | Volume 12 | Article 625297 Firmino et al. Diet, Immunity, and Microbiota Crosstalk FIGURE 3 | Microbiota composition at phylum (A) and class (B) level of the anterior and posterior sections of the intestinal tract of gilthead seabream (S. aurata) fed control and garlic, carvacrol, and thymol essential oils (EOs)-supplemented diet. Asterisk (*) indicate significant differences among diets (p > 0.05). of sequences associated with glutathione and lipid metabolism, FIGURE 4 | Average abundances of genera showing significant differences (p < 0.01) in the anterior intestine of gilthead seabream (S. aurata) fed the garlic, and a reduction of sequences related to drug metabolism carvacrol, and thymol essential oils (EOs)-supplemented diet in comparison was found in fish fed the EOs-supplemented diet (Figure 6B). with fish receiving the control diet. Regarding the posterior intestine, processes related to membrane transport at the second-level classification of KEGG pathways were significantly reduced in fish fed the EOs-supplemented diet tissue that allows microbial colonization, the intestine of farmed (Figure 6C), while processes related to the sulfur relay system fish is a target tissue for dietary manipulations (2, 7). We and naphthalene degradation at the third-level classification of aimed to describe the effect of the dietary combination of KEGG pathways were significantly enhanced in fish fed the garlic, carvacrol, and thymol EOs in the intestinal mucosa of EOs-supplemented diet (Figure 6D). gilthead seabream at a transcriptional level and its impact on gut microbiota modulation. DISCUSSION Effect of Garlic, Carvacrol, and Thymol The fish intestine is a complex multifunctional organ. In addition to diet digestion and nutrient absorption functions, EOs Additive on Proteolysis, Protein this organ is critical for other key physiological mechanisms Deubiquitination, and Inflammatory including water and electrolyte balance, endocrine regulation Regulation upon digestion and metabolism, and immunity (7), as well as The dietary supplementation of EOs affected the regulation of for the establishment of commensal microbiota (2, 14). As one several genes associated with proteolytic pathways, peptidases of the main portals of pathogens’ entry into the organism, and activity, and protein deubiquitination. In particular, several due to its intricate immune system associated to a lymphoid genes coding for proteasomes (psma6, psmc3, psma4, and Frontiers in Immunology | www.frontiersin.org 9 March 2021 | Volume 12 | Article 625297 Firmino et al. Diet, Immunity, and Microbiota Crosstalk psmb6) and ubiquitin peptidases (usp4, usp10, usp48, otud3, and ufsp2) were activated by the dietary supplementation of EOs. Protein ubiquitination and subsequent proteolysis and degradation by the proteasome are important mechanisms in the regulation of the cell cycle, cell growth and differentiation, gene transcription, signal transduction, and apoptosis, including tissue regeneration (15). As important factors for the maintenance of intestinal epithelial integrity and immune homeostasis, the ubiquitin-proteasome proteolytic system plays a pivotal role in the activation of the nuclear factor kB (NF-kB) pathway. The NF-kB pathway is involved in the transcriptional regulation of several proinflammatory genes, playing a critical role in regulating the survival, activation, and differentiation of innate and adaptive immune cells (16). As an important feedback regulatory mechanism following NF-kB activation, the NFKB inhibitor alpha (nfkbia), also known as IkBα, is one of the first genes to be activated (16). In our transcriptional analysis, nfkbia was downregulated. In regard to the NF- kB signaling pathway, we also registered the upregulation of several deubiquitination-related genes, such as the referred ubiquitin peptidases, that could be blocking the ubiquitination and degradation of the NF-kB inhibitors. This mechanism might be accompanied by commensal γ-Protebacteria strains, the dominant class in our study, that prevent or limit epithelial gut inflammation (17); thus, evidencing the close cooperation between gut and microbiota in the inflammatory regulation in response to dietary shifts. Accordingly, the proinflammatory cytokine interleukin-1 beta (il-1β) was downregulated in the fish fed the EOs-supplemented diet, corroborating the reduction of the transcription of proinflammatory genes mediated by the NF-kB pathway. Collectively, these data suggest a direct and selective regulation of the NF-kB and ubiquitin-proteasome pathways established through the interaction between the transcriptome response and their commensal bacteria in the gut of sea bream fed the EOs- FIGURE 5 | Average abundance of genera showing significant differences (p supplemented diet. < 0.01) in the posterior intestine of gilthead seabream (S. aurata) fed the garlic, carvacrol, and thymol essential oils (EOs)-supplemented diet in comparison with fish receiving the control diet. Effect of Garlic, Carvacrol, and Thymol EOs Additive on Immune Effector Processes The dietary administration of EOs showed the modulation of white blood cells and other immune parameters in several several biological processes related to innate immune effector cultivated fish species. Similarly to our results, the activation cells, such as “leukocyte activation,” “leukocyte activation of the degranulation transcriptional response of the neutrophils involved in immune response,” “neutrophil activation,” and was previously observed in the gills of gilthead seabream fed “neutrophil degranulation.” In the case of neutrophils, their the same EOs-supplemented diet and attributed to its increased main function is the control of microorganisms that cross defense capacity against a monogenean helminth parasite the epithelium barrier to invade the mucosa. Contrarily to infection (9). mammals, fish neutrophils are not so abundantly present in the Further analyses on immune-related processes modulated by bloodstream, whereas they are stored in hematopoietic reservoirs the tested EOs also showed an increase of the expression in prex1, instead, which could signify a disadvantage for rapid migration a gene coding for the phosphatidylinositol 3,4,5-trisphosphate- and effective resolution of infection and inflammation events (7). dependent Rac exchanger 1 that regulates adhesion, migration, Thus, the results of our functional analysis regarding leukocyte tissue recruitment, and reactive oxygen species (ROS) formation activation, and granulocytes, in particular, might suggest an in the neutrophils (20). In addition, the leukocyte elastase increased intestinal specific immune capacity promoted by the inhibitor gene (serpinb1) was also upregulated in the intestine of tested functional diet. In fact, the dietary supplementation fish fed the EOs-supplemented diet. This gene encodes a serine of garlic or its bioactive compounds (18), carvacrol, and/or protease inhibitor that specifically inhibits neutrophil elastase, thymol (19) have been reported to increase the number of cathepsin G, and proteinase-3 present in the neutrophil granules; Frontiers in Immunology | www.frontiersin.org 10 March 2021 | Volume 12 | Article 625297 Firmino et al. Diet, Immunity, and Microbiota Crosstalk The expression of several genes associated with adaptive immunity was modulated by the EOs-supplemented diet as well. For instance, perforin-1 (prf1) was upregulated in the intestine of fish fed the EOs-diet. Perforin is a pore-forming cytolytic protein found in the granules of cytotoxic T lymphocytes (CTLs) and natural killer (NK) cells, playing a key role in killing other cells that are recognized as non-self by the immune system (23). In fish, studies have reported the upregulation of prf1 in response to viral stimulation (24). Furthermore, the upregulation of adenosine deaminase (ada) was also promoted by the tested EOs-supplemented diet. In particular, ada acts as a positive regulator of T-cell co-activation, participates in the regulation of lymphocyte-epithelial cell adhesion, and enhances dendritic cell immunogenicity (25, 26). Additionally, cd9 and cd81 were both upregulated in the fish fed the EOs-supplemented diet. These genes encode tetraspanins, key players in the processes of adhesion, extravasation, and recruitment of leukocytes into inflammation sites, regulating several steps of the immune response (27). CD9 and CD81 were found to be extensively present in Atlantic salmon (Salmo salar) IgM+ B-cells (28). Last but not least, tetraspanins were considered to be required for bacteria adhesion to the epithelial cells (29); which may be in agreement with the presence of both DEGs in the symbiosis- related processes from our transcriptional analysis, as discussed below. Therefore, the regulation of genes involved in both B and T lymphocytes activity may suggest the stimulation of not only the innate, but also the adaptive immune response as well, although further research is needed to confirm this hypothesis. The proportion of up to downregulated genes related to an immune response was not as marked as the observed for the remaining biological processes activated by the inclusion of EOs in diet, indicating an effective and balanced proinflammatory and anti-inflammatory regulation of the induced immune response, as previously suggested. Nonetheless, it is legitimate to assume that due to its immunostimulatory characteristics, the EOs-based FIGURE 6 | Comparison of the relative abundance of PICRUSt generated functions profile in the anterior (A,B) and posterior (C,D) intestinal microbiota functional feed might have an impact on the composition of of gilthead seabream (S. aurata) fed the control and the garlic, carvacrol, and the gilthead seabream intestinal microbiota, which in turn may thymol essential oils (EOs)-supplemented diet. Box plots show the relative also have played a critical role in mediating the abovementioned abundances of significant changes in level 2 Kyoto Encyclopedia of Genes and immune response. In fact, numerous studies have indicated Genomes (KEGG) pathways in the anterior (A) and posterior (C) intestinal microbiota. Box plot central lines indicate the median and star symbols that diet is an important factor in the modulation of the indicate the mean of the data. Significant KEGG pathways at level 3 pathways gut microbiome composition in vertebrates, dictating also the in the anterior (B) and posterior (D) intestinal microbiota, by ANOVA with a role of that microbiome in fish health status (2). Regarding post-hoc Tukey–Kramer multiple-comparison test (p < 0.05). the EOs tested, garlic (4), carvacrol, and/or thymol (5) were previously reported to modulate fish microbiota composition, exerting beneficial effects (30), and improving significantly its resistance to Vibrio anguillarum after intestinal infection and stress challenge (31). The administration of similar functional thus, protecting not only tissues from damage at inflammatory diets with immunostimulatory and/or antimicrobial properties sites during stress or infection, but also the neutrophil itself have been also reported to reduce gut microbial diversity (30); (21). SERPINB1 also limits the activity of inflammatory caspases however, in our study, alpha diversity was not significantly during inflammation by suppressing their caspase-recruitment altered by the dietary EOs, which may be associated with the domain oligomerization and enzymatic activation, representing heterogeneity of analyzed samples, as observed in CV values an important regulator of tissue inflammation (22). Under for the Chao1 index. Under present experimental conditions, current experimental conditions, these results may indicate the only phylum that showed significant differences among a well-balanced intestinal immunity, where both immune dietary treatments was the Spirochaetes. This phylum contains effector cells activation and an anti-inflammatory response important gut pathogenic species, such as Brachyspira species, were promoted. for livestock and humans (32). Nonetheless, the impact of Frontiers in Immunology | www.frontiersin.org 11 March 2021 | Volume 12 | Article 625297 Firmino et al. Diet, Immunity, and Microbiota Crosstalk this phylum modulation upon gilthead seabream intestine in ileal enterocytes (40). Besides, the influence of the intestinal homeostasis is not clear yet, and further studies should be microbiota on the activity of FABP6 was suggested in zebrafish, performed in order to assess which members of the phylum could since fabp6 expression decreased significantly after antibiotic be participating in the immune response observed. treatment (41). Interestingly, in our study, the abundance of Bacteroidia class (Bacteroidetes) decreased significantly in the posterior intestine of fish fed the EOs-supplemented diet. Within Effect of Garlic, Carvacrol, and Thymol the Bacteroidia class, Bacteroides genus bacterial metabolism of EOs Additive on Immune-Related bile acids was observed to modulate gut T-cells homeostasis Transport and Secretion Processes (42). Particularly, shifts toward the phylum Bacteroidetes The obtained immune-related biological processes were observed including the Bacteroidia class coincides with mucosal CD4+ to share 77% of DEGs with the transport and secretion category, T-cell depletion and enterocyte damage (43). Therefore, the which genes were observed to be positively affected, in its upregulation of fabp6 and the decrease of Bacteroidia class might majority, by the dietary EOs. The substantial amount of DEGs indicate a modulation of the bile acids secretion by the tested shared among the two categories clearly indicates a common role EOs, potentially affecting lipids metabolism. Since bile acids are in the overall observed transcriptional response. In this sense, recognized as signaling molecules between the host microbiota similar vesicle-mediated transport processes associated with and the innate immunity (44), alterations in its secretion could active biogenesis and neutrophil-mediated immune response have a role in our observed immune-related transcriptional were observed in the gills of gilthead seabream fed the same EOs- response previously discussed. Nevertheless, further studies need supplemented diet (9), which seemed to indicate a similar action to be addressed in order to evaluate the impact of the EOs- of this functional additive on different mucosal tissues. Epithelial based feed additive in the digestive secretions and metabolism of cells are also directly involved in the initiation of the immune gilthead seabream. response, such as the one mediated by neutrophils. Accordingly, Under the transport and secretion context, gut microbiota several genes encoding RAS-related GTPases (nras, rab1a, mediate the metabolism and transport of dietary xenobiotics rab5a, rab10, and arhgap1), recognized as leading regulators through the modulation of metabolites of the host or through of membrane trafficking directing immunity and inflammation microbial secretion (45). Accordingly, our functional analysis cellular responses (33), were upregulated in the intestine of fish of KEGG pathways of the posterior intestine microbiota of fed the functional feed additive. On the other hand, the hypoxia individuals fed the EOs-supplemented diet showed a decrease in inducible factor 1 subunit alpha (hif1a) was downregulated in the bacterial sequences related to membrane transport. Considering fish fed the EOs-supplemented diet. HIF1a functions as a master that membrane transport in prokaryotes is associated with transcriptional regulator of the adaptive response to hypoxia bacterial secretion, this decrease could indicate a lower export of and it was observed to be transcriptionally induced by ROS enzymes and bacterial toxins, commonly present in the intestinal through NF-kB (34), contributing in the intestinal mucosa to tract of different fish species (2), representing a potential inflammatory resolution. The decrease in hif1a expression by beneficial effect of the EOs administration in the gut health. the EOs dietary administration corroborated once again, that although neutrophil activation and vesicle-mediated transport processes were stimulated in the intestine of fish, inflammation Effect of Garlic, Carvacrol, and Thymol derived from ROS release was probably not occurring. EOs Additive on the Response to Lipids Furthermore, the serine protease 3 (prss3) was another and Hormones gene positively regulated in the intestine of fish fed the Under a complex neuroendocrine regulation, the gut microbiota EOs-supplemented diet. This protease is involved in the also regulate the metabolism of carbohydrates, lipids, and amino synthesis of antibacterial substances (35); thus, we hypothesized acids, whose composition, in turn, is susceptible to diet, health that prss3 may be involved in the regulation of intestinal status, and drugs (46). Formerly, we suggested that the dietary immunity. PRSS3 is also a digestive protease specialized for administration of the EOs might affect the secretion of bile the degradation of trypsin inhibitors (36). Trypsin inhibitors acids. If right, this could be inducing a response that could be are anti-nutritional factors found in plant-protein sources that affecting lipid metabolism and/or steroid hormone signaling. impair diet digestibility and generate digestive and metabolic In accordance with this hypothesis, some biological processes disorders (37). Although the substitution of fishmeal by plant- related to responses to cyclic compounds, such as lipids and derived protein sources was not in the scope of our study, prss3 hormones, were positively affected by the inclusion of the EOs- upregulation in the EOs-supplemented might indicate that the based feed additive in the intestinal mucosa of gilthead seabream. tested EOs could enhance diet digestibility. For instance, the ATPase Na+ /K+ transporting subunit alpha Moreover, the expression of the gene coding for the fatty acid 1 (atp1a1) was significantly upregulated in the intestine of binding protein 6 (fabp6) was the most positively affected gene by fish fed the EOs-supplemented diet. In other studies, diet- the dietary EOs. Similarly, FABP6 was significantly increased in induced lipid alterations dramatically affected enterocytes lipid the intestine of gilthead seabream fed a combination of carvacrol, profile in gilthead seabream, reducing significantly Na+ /K+ thymol, and a prebiotic (38), while this gene was downregulated ATPase specific activity, suggesting a regulatory role of the lipid in response to enteritis induced by a parasitic pathogen (39). microenvironment on the enzyme activity (47). Additionally, Furthermore, FABP6 is involved in the transport of bile acids tribbles pseudokinase 1 (trib1) gene expression was upregulated Frontiers in Immunology | www.frontiersin.org 12 March 2021 | Volume 12 | Article 625297 Firmino et al. Diet, Immunity, and Microbiota Crosstalk in the gilthead seabream fed the EOs-supplemented diet. This regulation of processes related with a response to hormone gene is known to beneficially affect plasma lipid concentration, stimulus. Changes in hormone secretion, such as cortisol, may playing also major roles in myeloid cells, improving macrophage interfere with the gut immune response (57) and microbiome lipid metabolism, and counteracting inflammation (48). On (58), which could explain the obtained immunity activation the other hand, the glutamic-oxaloacetic transaminase 2 (got2) and regulation of hormone-sensitive bacteria, such as those gene was downregulated in the fish fed the EOs-supplemented belonging to Rothia (14). Moreover, stress and stress-related diet. A study in rats suggested that leptin downregulates hormones are known to affect carbohydrate, protein, and lipid got2 in adipocytes (49). Likewise, the adiponectin receptor 1 metabolisms in fish (59), which in turn are also regulated in the (adipor1) was also downregulated in the fish fed the EOs diet. host by the gut microbiota. In this sense, a similar feed additive Adiponectin is an essential hormone predominantly secreted by containing garlic and labiatae plant EOs (0.02% inclusion) was adipocytes that regulates glucose and lipid metabolism, which demonstrated to reduce significantly plasma cortisol levels in along with leptin are considered to be potential proinflammatory European seabass (Dicentrarchus labrax) (60); thus, the potential adipocytokines (50). Under current experimental conditions, regulation of stress-related hormones by the tested EOs could the regulation of genes involved in the cellular response to explain the response to steroid hormones processes obtained in lipids might suggest the modulation of lipid-related intracellular our functional analysis. signaling pathways in the fish fed the EOs-supplemented In the present study, the administration of the garlic, diet, with a potential role on the immune-inflammatory carvacrol, and thymol EOs positively affected the expression of profile obtained. growth hormone 2 (gh2), although no significant differences in Lipids affect the gut microbiota both as substrates for bacterial somatic growth were observed at the end of the 65 days of feeding metabolic processes and by inhibiting bacterial growth by toxic trial. However, GH is not only involved in somatic growth; influence (51). In turn, gut microbiota are also pointed as this hormone also directly stimulates several fish immune one of the key elements affecting inflammation associated with factors (61), and participates in the epithelial osmoregulation lipid metabolism dysfunction (2). In fish, the gut microbiota of euryhaline fish, interacting with cortisol to increase secretory are also recognized to affect considerably the lipid metabolism chloride cells and ion transporters involved in salt secretion, such of the host (41). In agreement to our transcriptional analysis Na+ /K+ ATPase (62). As a matter of fact, besides immunity and to the abovementioned findings, the PICRUSt analysis of and digestion, the gastrointestinal tract of marine teleost fish the microbiota from the anterior intestine of fish fed the EOs- also plays an important role in osmoregulation. Under this supplemented diet showed a higher abundance of sequences context, the carbonic anhydrase 2 (ca2) was the second most associated with lipid metabolism when compared to the control positively affected gene by the EOs inclusion in the diet, playing group. In fact, garlic and its derivatives are widely recognized an active role in acid–base regulation through bicarbonate for their hypolipidemic effect. For instance, one of the primary secretion and facilitating epithelial water transport (63). In fact, components of garlic, diallyl disulfide, was suggested to affect osmoregulation has been linked to endocrine secretory factors both lipid metabolism and gut microbiota in mice through the with a significant impact on the fish immune system and regulation of the expression of genes associated with lipogenesis microbiota (64). and lipid metabolism (52). In other studies, the combined dietary As previously referred, the Bacteroidia class (Bacteroidetes) administration of thymol and carvacrol have demonstrated to decreased significantly in the posterior intestine of fish fed modulate the intestinal microbiota in piglets, changes that were the EOs diet. Kan et al. (65) demonstrated that within the correlated with an increase in lipid metabolism, among others Bacteroidia class, Bacteroides genus abundance increased metabolic effects (53). In this context, our taxonomical analysis in goldfish (Carassius auratus) when exposed to a toxic at the genus level showed a significant increase in the abundance environment. Interestingly, our microbiota analysis showed a of Corynebacterium (Actinobacteria) in the anterior intestine of higher abundance of bacterial 16S rRNA sequences associated fish fed the EOs-supplemented diet. This genus has been reported with the metabolism of glutathione in the anterior intestine. as a predominant one along the whole digestive tract of gilthead Glutathione is one of the most important intracellular seabream, while its abundance may be modulated by functional antioxidant and antitoxin enzymes, whereas its metabolism diets (54) and dietary lipid levels (55). These results are of is regulated by the gut microbiota through the modulation of the special relevance since Corynebacterium species are reputed for amino acid metabolism of the host (66) and tissue oxidative stress contributing to manganese acquisition and producing superoxide (67). Furthermore, glutathione plays important roles in nutrient dismutase and lipases to form organic fatty acids and thioalcohols metabolism and in the regulation of cellular events, such as gene (56). This genus also showed a higher presence in rainbow trout expression, DNA and protein synthesis, cell proliferation and (Oncorhynchus mykiss) intestinal microbiota when the fish were apoptosis, immune response, among others (67). Glutathione fed high lipid diets (55), evidencing the impact of the tested EOs S-transferase is one of the key enzymes involved in the second on the host and microbial lipid metabolism. phase of xenobiotics’ metabolism and cellular detoxification, Furthermore, a decrease in the abundance of Rothia was catalyzing the conjugation of reduced glutathione to various also detected in the posterior intestine of fish fed the EOs- substances; thus, suggesting a key role in the host immune supplemented diet. Rothia abundance was observed to be affected response modulation (68). Accordingly, in our transcriptional by fish age and sex hormones in gilthead sea bream (14). In effect, analysis, the glutathione S-transferase theta 2B (gstt2b) gene was the results from our transcriptional analysis revealed a positive observed to be upregulated in the intestine of gilthead seabream Frontiers in Immunology | www.frontiersin.org 13 March 2021 | Volume 12 | Article 625297 Firmino et al. Diet, Immunity, and Microbiota Crosstalk following the administration of dietary EOs. The differences Furthermore, some Comamonas strains are also known to observed regarding both transcriptional and microbiota analysis have genes for naphthalene degradation (76). The posterior between our experimental diets suggested an improvement of intestine of fish fed the EOs-supplemented diet showed the enterocytes’ lipid metabolism and detoxification potential an increase in bacterial sequences related to naphthalene promoted by the additive. degradation. Naphthalene is an aromatic hydrocarbon present The microbiota analysis also showed a reduction in the in many EOs with antibacterial, antioxidant, and antiparasitic proportion of bacterial sequences related to drug metabolism. properties (77). Although suggested to have a positive impact Accordingly, the EOs-supplemented diet promoted the increase at low concentrations by decreasing DNA damage in some of the cytochrome P450 2J2 (cyp2j2) gene transcripts in the fish species (78), an enhancement in naphthalene and similar intestine of the gilthead seabream. In fish, the cytochrome P450 compounds degradation is crucial in order to avoid a potential proteins, and CYP2 family members, in particular, participate toxicity of the EOs for the host. in the metabolism of steroidal hormones and other lipids, The transcriptional analysis showed the positive regulation besides their role in the metabolism of exogenous compounds of the response to alkaloids biological process in the fish fed like drugs and pharmaceuticals (69). Several garlic organosulfur the EOs-supplemented diet. Alkaloids are versatile heterocyclic compounds, as well as carvacrol, have been described to nitrogen compounds produced by plants, that along with selectively modulate the levels of cytochrome P450 genes and EOs and phenolic compounds, provide antipathogenic and proteins (70, 71). Moreover, the mitochondrial peroxiredoxin antioxidant protection (79). This response may not only 3 (prdx3) and cathepsin B (ctsb) genes were downregulated. be associated with the previously referred alteration in the Both prdx3 and ctsb are biomarkers of fish stressors (72), whose metabolism of nitrogen and carbohydrates induced by the downregulation might indicate a decrease of the oxidative stress microbiota reshaping, but also with the direct response of the in the fish intestine and a positive impact of the tested additive on intestinal mucosa to the phenolic monoterpenes carvacrol and fish welfare. Overall, our results indicate that the administrated thymol (80) and other cyclic compounds derived from garlic EOs promotes the enhancement of the antioxidative status in the (81) with recognized immunomodulatory properties. Moreover, fish intestine, supporting the gut homeostasis under an immune allicin, the main antimicrobial compound in garlic, is also stimulation scenario. a sulfoxide that bacteria can use in the sulfur-relay system (82). This is in agreement with the observed increase in sequences associated with genes of the sulfur-relay system in the posterior intestine of fish fed the EOs-supplemented diet. Effect of Garlic, Carvacrol, and Thymol Thereafter, considering the complexity of the EOs biochemistry, EOs Additive on the Response to Organic the transcriptional and bacterial response to those compounds Nitrogen and Aromatic Compounds is equally multifaceted. Further studies should be addressed in In our transcriptional analysis, several genes comprising a order to clarify the impact of these potential metabolic alterations response to nitrogenous compounds related processes were in the gilthead seabream gut immune status. also observed to be positively regulated by the presence of garlic, carvacrol, and thymol EOs in the diet. Interestingly, the inclusion of the EOs in the gilthead seabream diet showed a Effect of Garlic, Carvacrol, and Thymol significant decrease in the abundance of the genera Paracoccus EOs Additive on Symbiosis Processes (Proteobacteria), Prevotella (Bacteroidetes) in the posterior The intricate host-microbiota symbiosis in the fish is still intestine, and Comamonas (Proteobacteria) in the anterior substantially unexplored when compared with mammals, intestine of fish. All these bacteria are reputed for their capacity and considering its complex challenges to define an “ideal” for nitrate reduction, as well as being potentially involved in microbiome for each species since microbiota are strongly the metabolism of nitrogenous compounds (73). In particular, modulated by environmental and dietary factors (2). Even though Prevotella, are members of the anaerobic, hydrogen sulfide both transcriptional and microbiota modulations by the EOs producing bacterial community (73) that have been previously supplementation were observed, our results fit within the farmed detected in the intestine of gilthead seabream (54). In humans, an gilthead seabream gut microbiome profile in terms of dominant increase in Pretovella species at mucosal sites is often associated phyla bacterial composition (14), discarding warnings of a with chronic inflammation (74). In our study, the PICRUSt diet-induced dysbiosis. The transcriptomic functional analysis analysis showed a lower abundance of predicted carbohydrate was able to particularly detect such interactions through the degradation pathway in the anterior intestine of fish fed the EOs- expression of several genes related to symbiotic, multi-organism supplemented diet, which may be associated with a reduction processes, and interspecies interaction between organisms. in Prevotella abundance. Paracoccus is a genus in the family For instance, the microbiota taxonomical analysis at the genus Rhodobacteraceae previously reported in gilthead seabream gut level showed an increase in the abundance of Photobacterium and described as a potential probiotic for this species (75). (Proteobacteria, Vibrionaceae) in the anterior intestine of fish The relevance of the decrease in the abundance of Paracoccus fed the EOs diet. Although some members of this genus, such genus needs further investigations in terms of its impact on the as Photobacterium damselae subsp piscicida and P. damselae condition of the host as no negative effects on gut conditions were subsp damselae have been reported as important pathogens observed under present nutritional conditions. for gilthead seabream (83), they are generally detected in the Frontiers in Immunology | www.frontiersin.org 14 March 2021 | Volume 12 | Article 625297 Firmino et al. Diet, Immunity, and Microbiota Crosstalk intestine of healthy specimens (84, 85). Most species of the Effect of Garlic, Carvacrol, and Thymol Photobacterium genus are non-pathogenic and are usually in EOs Additive on Gene Expression and RNA a symbiotic relationship with marine organisms as enteric Processing commensals. In fact, Photobacterium spp. have been even found Dietary manipulations are widely recognized to directly or to be beneficial as a member of the fish intestinal microbiota indirectly influence the regulation of the fish gut gene expression, by its ability to aid with digestion of compounds, such as in order to reshape its metabolic and physiological responses to chitin (86), to produce polyunsaturated fatty acids or even different requirements. Indeed, the utmost upregulated biological antibacterial secondary metabolites that could inhibit the growth processes in the intestine of fish fed the functional feed additive of other pathogenic bacteria (87). This genus has been reported tested in our study, in terms of the number of DEGs, were as a member of the intestinal microbiota of marine farmed those related to gene expression and processes involved in fish, including gilthead seabream (54, 85), and it has been RNA processing, RNA splicing, mRNA metabolism, and mRNA demonstrated that this genus is one of the most modulated genera and ribonucleoprotein export from nucleus. The regulation of in the fish when applying functional diets (88). Regarding the gene expression comprises diverse cell mechanisms in order to antimicrobial effect of the EOs-supplemented diet, an in vitro increase or decrease the production of a specific gene product, study demonstrated that the ethanolic extracts of oregano leaves, either RNA or a protein. For instance, several zinc finger predominantly composed of carvacrol and thymol, presented a proteins were up (znf572, zeb2, znf74, zc3h11a, and znf214) and strong bactericidal activity against several pathogens including down (znf133, znf551) regulated in our transcriptional analysis. Photobacterium damselae, besides its immunostimulatory effect Besides the stimulation of the transcriptional machinery (93), on gilthead seabream head kidney leukocytes (89). Therefore, several genes involved in the spliceosome-mediated splicing our results might suggest a selective antimicrobial effect of the (snrnp200, sart1, hnrnpu, and prpf8) were also observed to compounds administrated, evidencing the importance of the be upregulated by dietary EOs. The spliceosome splicing host-microbiota symbiotic relationship in the modulation of the complex removes intronic non-coding sequences from pre- response to a dietary change. mRNA to form mature mRNA that can be translated into Additionally, in our transcriptional analysis, the retinoic acid protein (94). receptor alpha (rara) and the retinoic X receptor beta (rxrb) In another hand, the intestine is per se a highly regenerative genes were both up and downregulated, respectively, in the organ characterized by its continual cell renewal, allowing the gut of fish fed the EOs-supplemented diet. The retinoic acid epithelium to bear the constant exertion of food digestion, (RA) is the most important transcriptionally active component nutrient absorption, and waste elimination (6). Either tissue of the vitamin A, an essential dietary nutrient for fish that damage or microbial invasion promotes inflammation and plays a significant role in a range of physiological processes possible DNA damage, so its repair plays a vital role in including the differentiation and maintenance of epithelial maintaining genomic integrity during the cell cycle. For instance, cells and immunity (90). Under this context, another case DNA damage responses may be induced by proinflammatory of symbiotic interaction between organisms is the relation cytokines (95), in which transcriptional response appeared between vitamin A metabolism of the host and its commensal not to be promoted by the EOs in our study, as previously microbiota. Remarkably, Clostridia (Firmicutes) abundance was discussed. However, genes coding DNA damage checkpoint significantly reduced in gilthead seabream fed the EOs diet, proteins were up (fbxo31, gltscr2, wisp1, usp10, and cdk5rap3) which could then be positively affecting the RA availability and down (nbn) regulated by the EOs-supplemented diet, and the observed regulation of the nuclear receptors (90), evidencing a regulation of the cell turnover independent from potentially participating in the local immunity boost observed inflammatory stimuli. This hypothesis is reinforced by the in our study. In fact, dietary garlic powder was demonstrated upregulation of cdk5rap3, the gene encoding CDK5 regulatory to have an antimicrobial effect on Clostridium human bacteria, subunit associated protein 3, an interactor controlling cell being suggested to temporarily modulate the gut microbiota (91). proliferation that among other functions negatively regulates In rainbow trout, different levels of garlic extract (1%, 1.5%, NF-kB mediated gene transcription (96), as initially suggested. and 2%) positively affected the abundance of this genus (4). Our results also evidence the tight functional connection Curiously, a similar dietary additive composed of garlic and and coordination between DNA damage responses and labiatae plants oils was observed to enrich the Clostridia class immunity, a link that is recognized by its involvement in in European seabass fed a low fishmeal and fish oil diet (30). However, carvacrol and thymol, in particular, were numerously the protection of the host from infectious microorganisms observed to exert an antimicrobial effect on Clostridium species, and surveillance against malignant diseases (97). Therefore, proving beneficial for the gut health of several organisms (92); the upregulation of a substantial number of genes that thus, attributing to carvacrol and thymol the main role in the modulates others’ expression and that has an implication observed reduction of the genus. Given the significance of this in transcriptional, translational and DNA repair processes symbiosis, the manipulation of RA signaling derived from dietary validates the effect of the EOs-supplemented diet on the components acting directly on nuclear receptors and/or on the direct transcriptional regulation of several intestinal cellular intestinal microbiota might represent a strategy to promote processes, including the modulation of the inflammatory and gut immunostimulation. immune response. Frontiers in Immunology | www.frontiersin.org 15 March 2021 | Volume 12 | Article 625297 Firmino et al. Diet, Immunity, and Microbiota Crosstalk CONCLUSIONS Committee of Ethics and Animal Experimentation and in accordance with the Guidelines of the European Union Council The present complementary analysis of the intestinal (86/609/EU) for the use of laboratory animals. transcriptomic profiling and microbiota response to a diet supplemented with garlic, carvacrol, and thymol EOs aimed AUTHOR CONTRIBUTIONS to take a further step in the evaluation of functional feeds in an attempt to understand how diet-induced shifts can AE and EG designed and carried out the experiments. Biological affect the overall gut status of farmed fish from an integrative samplings were performed by EG, AE, RS, and JF. The perspective. This kind of integrative analysis can lead to the transcriptomic data analysis and interpretation were performed “chicken or egg” causality dilemma, and exact mechanisms by JF, RS, EV-V, and FER-L. MB, IC, and MM carried out are still elusive. Nevertheless, the present work suggested that the microbiota analyses. YR-C reviewed and validated the the dietary administration of garlic, carvacrol, and thymol methodology used in the study. The study was supervised by EOs modulated the immune transcriptional response of the EG, FER-L, and LT. JF wrote the original draft. All the authors mid-anterior intestinal mucosa per se, but also its microbiota provided the critical feedback, read, and agreed to the published composition, resulting in complex interactions that resulted version of the manuscript. in the activation of significant biological processes. Taken together, the combined regulation of the referred pathways FUNDING could suggest the promotion of an immune reinforcement by the EOs dietary administration in situ, most probably This work has been supported by the project Nutritional induced by host-microbial co-metabolism, which could further strategies for the improvement of productive performance: attenuate the processes of pathogenesis, putting in evidence the use of functional feeds and health diets in aquaculture the re-adaptation response of the intestinal mucosa to the (DIETAplus), funded by JACUMAR [Ministry of Agriculture, changes observed in the microbiota composition, and vice Fisheries and Environment of Spain, Ministerio de Agricultura y versa. Moreover, no indications of an inflammation associated Pesca, Alimentación y Medio Ambiente (MAPAMA)] and Fondo with the immunostimulation, which could compromise the Europeo Marítimo y de Pesca (FEMP, EU), as well as the project intestine integrity, were observed. Since no interference ADIPOQUIZ (RTI2018-095653-R-I00) funded by the Ministerio with fish growth was observed, promoted changes in both de Ciencia, Innovación y Universidades (Spain). FER-L was the intestine mucosa and microbiota were assumed to not supported by Fondecyt Regular grant (Nb. 1211841; ANID; significantly affect the gut overall metabolism and nutritional Goverment of Chile). JF has been subsidized by the Industrial status. Thus, the use of the tested EOs is suggested as a Ph.D. program of Generalitat de Catalunya and TECNOVIT- promising alternative to chemotherapeutics to be further FARMFAES S.L. (Nb. 2017 DI 017). EV-V was granted with evaluated in functional diets under the presence of biotic or DICYT-USACH post-doctoral fellowship (Nb.022043IB). RS was abiotic stressors. supported by a Ph.D. grant from the government of Paraguay (BECAL). Collaboration between Ibero-American researchers DATA AVAILABILITY STATEMENT has been done under the framework of the network LARVAplus Strategies for the development and improvement of fish larvae The datasets presented in this study can be found in online production in Ibero-America (117RT0521) funded by the Ibero- repositories. The names of the repository/repositories American Program of Science and Technology for Development and accession number(s) can be found in the article/ (CYTED, Spain). Supplementary Material. SUPPLEMENTARY MATERIAL ETHICS STATEMENT The Supplementary Material for this article can be found All animal experimental procedures were conducted in online at: https://www.frontiersin.org/articles/10.3389/fimmu. compliance with the research protocol approved by the IRTA’s 2021.625297/full#supplementary-material REFERENCES Productivity and Sustainability. Cham: Springer International Publishing (2019). p. 121–42. 1. Asif MB, Hai FI, Price WE, Nghiem LD. Impact of pharmaceutically active 3. Sutili FJ, Gatlin DM, Heinzmann BM, Baldisserotto B. Plant compounds in marine environment on aquaculture. In: Hai F, Visvanathan essential oils as fish diet additives: benefits on fish health and C, Boopathy R, editors. Sustainable Aquaculture. Applied Environmental stability in feed. Rev Aquac. (2017) 10:716–26. doi: 10.1111/raq. Science and Engineering for a Sustainable Future. Cham: Springer (2018) 12197 p. 265–99. 4. Büyükdeveci ME, Balcázar JL, Demirkale I, Dikel S. Effects of garlic- 2. Hoseinifar SH, Van Doan H, Dadar M, Ringø E, Harikrishnan R. Feed supplemented diet on growth performance and intestinal microbiota of additives, gut microbiota, and health in finfish aquaculture. In: Derome rainbow trout (Oncorhynchus mykiss). Aquaculture. (2018) 486:170–4. N, editor. Microbial Communities in Aquaculture Ecosystems: Improving doi: 10.1016/j.aquaculture.2017.12.022 Frontiers in Immunology | www.frontiersin.org 16 March 2021 | Volume 12 | Article 625297 Firmino et al. Diet, Immunity, and Microbiota Crosstalk 5. Zhang R, Wang XW, Liu LL, Cao YC, Zhu H. Dietary oregano essential oil 24. Leal E, Ordás MC, Soleto I, Zarza C, McGurk C, Tafalla C. Functional improved the immune response, activity of digestive enzymes, and intestinal nutrition modulates the early immune response against viral haemorrhagic microbiota of the koi carp, Cyprinus carpio. Aquaculture. (2020) 518:734781. septicaemia virus (VHSV) in rainbow trout. Fish Shellfish Immunol. (2019) doi: 10.1016/j.aquaculture.2019.734781 94:769–79. doi: 10.1016/j.fsi.2019.09.070 6. Celi P, Cowieson AJ, Fru-Nji F, Steinert RE, Kluenter AM, Verlhac 25. Ginés S, Mariño M, Mallol J, Canela EI, Morimoto C, Callebaut V. Gastrointestinal functionality in animal nutrition and health: new C, et al. Regulation of epithelial and lymphocyte cell adhesion by opportunities for sustainable animal production. Anim Feed Sci Technol. adenosine deaminase-CD26 interaction. Biochem J. (2002) 361:203–9. (2017) 234:88–100. doi: 10.1016/j.anifeedsci.2017.09.012 doi: 10.1042/0264-6021:3610203 7. Salinas I, Parra D. 6–fish mucosal immunity: intestine. In: Beck BH, Peatman 26. Casanova V, Naval-Macabuhay I, Massanella M, Rodríguez-García M, Blanco E, editor. Mucosal Health in Aquaculture. San Diego, CA: Academic Press J, Gatell JM, et al. Adenosine deaminase enhances the immunogenicity of (2015). p. 135–70. human dendritic cells from healthy and HIV-infected individuals. PLoS ONE. 8. Nadal AL, Ikeda-Ohtsubo W, Sipkema D, Peggs D, McGurk C, Forlenza (2012) 7:e51287. doi: 10.1371/journal.pone.0051287 M, et al. Feed, microbiota, and gut immunity: using the zebrafish 27. Saiz ML, Rocha-Perugini V, Sánchez-Madrid F. Tetraspanins as organizers model to understand fish health. Front Immunol. (2020) 11:114. of antigen-presenting cell function. Front Immunol. (2018) 9:1074. doi: 10.3389/fimmu.2020.00114 doi: 10.3389/fimmu.2018.01074 9. Firmino JP, Vallejos-Vidal E, Sarasquete C, Ortiz-Delgado JB, Balasch JC, Tort 28. Peñaranda MMD, Jensen I, Tollersrud LG, Bruun JA, Jørgensen JB. Profiling L, et al. Unveiling the effect of dietary essential oils supplementation in Sparus the Atlantic salmon IgM+ B cell surface proteome: novel information on aurata gills and its efficiency against the infestation by Sparicotyle chrysophrii. teleost fish B cell protein repertoire and identification of potential B cell Sci Rep. (2020) 10:17764. doi: 10.1038/s41598-020-74625-5 markers. Front Immunol. (2019) 10:37. doi: 10.3389/fimmu.2019.00037 10. Dezfooli SM, Gutierrez-Maddox N, Alfaro A, Seyfoddin A. Encapsulation 29. Green LR, Monk PN, Partridge LJ, Morris P, Gorringe AR, Read RC. for delivering bioactives in aquaculture. Rev Aquac. (2019) 11:631–60. Cooperative role for tetraspanins in adhesin-mediated attachment of doi: 10.1111/raq.12250 bacterial species to human epithelial cells. Infect Immun. (2011) 79:2241–9. 11. Sutton SG, Bult TP, Haedrich RL. Relationships among fat doi: 10.1128/iai.01354-10 weight, body weight, water weight, and condition factors in wild 30. Rimoldi S, Torrecillas S, Montero D, Gini E, Makol A, Valdenegro VV, et al. atlantic salmon parr. Trans Am Fish Soc. (2000) 129:527–38. Assessment of dietary supplementation with galactomannan oligosaccharides doi: 10.1577/1548-8659(2000)129<0527:RAFWBW>2.0.CO;2 and phytogenics on gut microbiota of European sea bass (Dicentrarchus 12. Calduch-Giner JA, Sitjà-Bobadilla A, Pérez-Sánchez J. Gene expression Labrax) fed low fishmeal and fish oil based diet. PLoS ONE. (2020) profiling reveals functional specialization along the intestinal tract of a 15:e0231494. doi: 10.1371/journal.pone.0231494 carnivorous teleostean fish (Dicentrarchus labrax). Front Physiol. (2016) 7:359. 31. Torrecillas S, Terova G, Makol A, Serradell A, Valdenegro V, Gini E, et al. doi: 10.3389/fphys.2016.00359 Dietary phytogenics and galactomannan oligosaccharides in low fish meal and 13. Tapia-Paniagua ST, Chabrillón M, Díaz-Rosales P, de la Banda IG, Lobo fish oil-based diets for European sea bass (Dicentrarchus labrax) juveniles: C, Balebona MC, et al. Intestinal microbiota diversity of the flat fish Solea Effects on gut health and implications on in vivo gut bacterial translocation. senegalensis (Kaup, 1858) following probiotic administration. Microb Ecol. PLoS ONE. (2019) 14:e0222063. doi: 10.1371/journal.pone.0222063 (2010) 60:310–9. doi: 10.1007/s00248-010-9680-z 32. Hampson DJ, Ahmed N. Spirochaetes as intestinal pathogens: lessons from a 14. Piazzon MC, Naya-Català F, Simó-Mirabet P, Picard-Sánchez A, Roig FJ, Brachyspira genome. Gut Pathogens. (2009) 1:10. doi: 10.1186/1757-4749-1-10 Calduch-Giner JA, et al. Sex, age, and bacteria: how the intestinal microbiota 33. Prashar A, Schnettger L, Bernard EM, Gutierrez MG. Rab GTPases in is modulated in a protandrous hermaphrodite fish. Front Microbiol. 10:2512. immunity and inflammation. Front Cell Infect Microbiol. (2017) 7:435. doi: 10.3389/fmicb.2019.02512 doi: 10.3389/fcimb.2017.00435 15. Glickman MH, Ciechanover A. The ubiquitin-proteasome proteolytic 34. Bonello S, Zähringer C, BelAiba RS, Djordjevic T, Hess J, Michiels C, pathway: destruction for the sake of construction. Physiol Rev. (2002) 82:373– et al. Reactive oxygen species activate the HIF-1alpha promoter via a 428. doi: 10.1152/physrev.00027.2001 functional NFkappaB site. Arterioscler Thromb Vasc Biol. (2007) 27:755–61. 16. Dorrington MG, Fraser IDC. NF-κB signaling in macrophages: dynamics, doi: 10.1161/01.ATV.0000258979.92828.bc crosstalk, and signal integration. Front Immunol. (2019) 10:705. 35. Sveinbjornsson B, Olsen R, Paulsen S. Immunocytochemical localization doi: 10.3389/fimmu.2019.00705 of lysozyme in intestinal eosinophilic granule cells (EGCs) of 17. Neish AS, Gewirtz AT, Zeng H, Young AN, Hobert ME, Karmali Atlantic salmon, Salmo salar L. J Fish Dis. (1996) 19:349–55. V, et al. Prokaryotic regulation of epithelial responses by inhibition doi: 10.1046/j.1365-2761.1996.d01-87.x of IkappaB-alpha ubiquitination. Science. (2000) 289:1560–3. 36. Szmola R, Kukor Z, Sahin-Tóth M. Human mesotrypsin is a unique digestive doi: 10.1126/science.289.5484.1560 protease specialized for the degradation of trypsin inhibitors. J Biol Chem. 18. Nya EJ, Dawood Z, Austin B. The garlic component, allicin, (2003) 278:48580–9. doi: 10.1074/jbc.M310301200 prevents disease caused by Aeromonas hydrophila in rainbow trout, 37. Kokou F, Fountoulaki E. Aquaculture waste production associated with Oncorhynchus mykiss (Walbaum). J Fish Dis. (2010) 33:293–300. antinutrient presence in common fish feed plant ingredients. Aquaculture. doi: 10.1111/j.1365-2761.2009.01121.x (2018) 495:295–310. doi: 10.1016/j.aquaculture.2018.06.003 19. Ahmadifar E, Razeghi Mansour M, Keramat Amirkolaie A, Fadaii Rayeni 38. Perez-Sanchez J, Benedito-Palos L, Estensoro I, Petropoulos Y, Calduch-Giner M. Growth efficiency, survival and haematological changes in great sturgeon JA, Browdy CL, et al. Effects of dietary NEXT ENHANCE R 150 on growth (Huso huso Linnaeus, 1758) juveniles fed diets supplemented with different performance and expression of immune and intestinal integrity related genes levels of thymol–carvacrol. Anim Feed Sci Technol. (2014) 198:304–8. in gilthead sea bream (Sparus aurata L.). Fish Shellfish Immunol. (2015) doi: 10.1016/j.anifeedsci.2014.08.012 44:117–28. doi: 10.1016/j.fsi.2015.01.039 20. Welch HC. Regulation and function of P-Rex family Rac-GEFs. Small 39. Calduch-Giner JA, Sitjà-Bobadilla A, Davey GC, Cairns MT, Kaushik S, Pérez- GTPases. (2015) 6:49–70. doi: 10.4161/21541248.2014.973770 Sánchez J. Dietary vegetable oils do not alter the intestine transcriptome 21. Baumann M, Pham CT, Benarafa C. SerpinB1 is critical for neutrophil survival of gilthead sea bream (Sparus aurata), but modulate the transcriptomic through cell-autonomous inhibition of cathepsin G. Blood. (2013) 121:3900–7. response to infection with Enteromyxum leei. BMC Genomics. (2012) 13:470. doi: 10.1182/blood-2012-09-455022 doi: 10.1186/1471-2164-13-470 22. Choi YJ, Kim S, Choi Y, Nielsen TB, Yan J, Lu A, et al. SERPINB1-mediated 40. Dawson PA, Karpen SJ. Intestinal transport and metabolism of bile acids. J checkpoint of inflammatory caspase activation. Nat Immunol. (2019) 20:276– Lipid Res. (2015) 56:1085–99. doi: 10.1194/jlr.R054114 87. doi: 10.1038/s41590-018-0303-z 41. Sheng Y, Ren H, Limbu SM, Sun Y, Qiao F, Zhai W, et al. The presence 23. Spicer BA, Conroy PJ, Law RHP, Voskoboinik I, Whisstock JC. Perforin-A key or absence of intestinal microbiota affects lipid deposition and related (shaped) weapon in the immunological arsenal. Semin Cell Dev Biol. (2017) genes expression in zebrafish (Danio rerio). Front Microbiol. (2018) 9:1124. 72:117–23. doi: 10.1016/j.semcdb.2017.07.033 doi: 10.3389/fmicb.2018.01124 Frontiers in Immunology | www.frontiersin.org 17 March 2021 | Volume 12 | Article 625297 Firmino et al. Diet, Immunity, and Microbiota Crosstalk 42. Campbell C, McKenney PT, Konstantinovsky D, Isaeva O, Schizas M, Verter 61. Yada T. Growth hormone and fish immune system. Gen Compar Endocrinol. J, et al. Bacterial metabolism of bile acids promotes generation of peripheral (2007) 152:353–8. doi: 10.1016/j.ygcen.2007.01.045 regulatory T cells. Nature. (2020) 581:475–9. doi: 10.1038/s41586-020-2193-0 62. McCormick SD. Endocrine control of osmoregulation in teleost fish. Am Zool. 43. Allers K, Stahl-Hennig C, Fiedler T, Wibberg D, Hofmann J, Kunkel D, et al. (2015) 41:781–94. doi: 10.1093/icb/41.4.781 The colonic mucosa-associated microbiome in SIV infection: shift towards 63. Lin TY, Liao BK, Horng JL, Yan JJ, Hsiao CD, Hwang PP. Carbonic anhydrase bacteroidetes coincides with mucosal CD4+ T cell depletion and enterocyte 2-like a and 15a are involved in acid-base regulation and Na+ uptake in damage. Sci Rep. (2020) 10:10887. doi: 10.1038/s41598-020-67843-4 zebrafish H+ -ATPase-rich cells. Am J Physiol Cell Physiol. (2008) 294:C1250– 44. Fiorucci S, Biagioli M, Zampella A, Distrutti E. Bile acids activated 60. doi: 10.1152/ajpcell.00021.2008 receptors regulate innate immunity. Front Immunol. (2018) 9:1853. 64. Lin G, Zheng M, Li S, Xie J, Fang W, Gao D, et al. Response of gut doi: 10.3389/fimmu.2018.01853 microbiota and immune function to hypoosmotic stress in the yellowfin 45. Spanogiannopoulos P, Bess EN, Carmody RN, Turnbaugh PJ. The microbial seabream (Acanthopagrus latus). Sci Total Environ. (2020) 745:140976. pharmacists within us: a metagenomic view of xenobiotic metabolism. Nat Rev doi: 10.1016/j.scitotenv.2020.140976 Microbiol. (2016) 14:273–87. doi: 10.1038/nrmicro.2016.17 65. Kan H, Zhao F, Zhang XX, Ren H, Gao S. Correlations of gut microbial 46. Wang S-Z, Yu Y-J, Adeli K. Role of gut microbiota in neuroendocrine community shift with hepatic damage and growth inhibition of Carassius regulation of carbohydrate and lipid metabolism via the auratus induced by pentachlorophenol exposure. Environ Sci Technol. (2015) microbiota-gut-brain-liver axis. Microorganisms. (2020) 8:527. 49:11894–902. doi: 10.1021/acs.est.5b02990 doi: 10.3390/microorganisms8040527 66. Mardinoglu A, Shoaie S, Bergentall M, Ghaffari P, Zhang C, Larsson E, et al. 47. Diaz M, Dopido R, Gomez T, Rodriguez C. Membrane lipid The gut microbiota modulates host amino acid and glutathione metabolism microenvironment modulates thermodynamic properties of the Na+ - in mice. Mol Syst Biol. (2015) 11:834. doi: 10.15252/msb.20156487 K+ -ATPase in branchial and intestinal epithelia in euryhaline fish in vivo. 67. Wu G, Fang YZ, Yang S, Lupton JR, Turner ND. Glutathione Front Physiol. (2016) 7:589. doi: 10.3389/fphys.2016.00589 metabolism and its implications for health. J Nutr. (2004) 134:489–92. 48. Niespolo C, Salamanca Viloria J, Deshmukh S, Villacanas Perez O, doi: 10.1093/jn/134.3.489 Sudbery I, Wilson H, et al. BS25 Investigating the MIR-101-3P/TRIB1 68. Vallejos-Vidal E, Reyes-Cerpa S, Rivas-Pardo JA, Maisey K, Yáñez JM, axis in macrophage immunometabolism. Heart. (2019) 105:A156. Valenzuela H, et al. Single-nucleotide polymorphisms (SNP) mining and their doi: 10.1136/heartjnl-2019-BCS.188 effect on the tridimensional protein structure prediction in a set of immunity- 49. Berk PD, Zhou S, Kiang C, Stump DD, Fan X, Bradbury MW. Selective related expressed sequence tags (EST) in Atlantic salmon (Salmo salar). Front upregulation of fatty acid uptake by adipocytes characterizes both genetic Genet. (2020) 10:1406. doi: 10.3389/fgene.2019.01406 and diet-induced obesity in rodents. J Biol Chem. (1999) 274:28626–31. 69. Schlenk D, Celander M, Gallagher E, George S, James M, Kullman S, et al. doi: 10.1074/jbc.274.40.28626 Biotransformation in fishes. In: Di Giulio RT, Hinton DE, editors. The 50. Sanz Y., Moya-Pérez A. Microbiota, Inflammation and obesity. In: Lyte M., Toxicology of Fishes. Boca Raton, FL: CRC Press (2008). p. 153–234. Cryan J. editors. Microbial Endocrinology: The Microbiota-Gut-Brain Axis in 70. Gao C, Jiang X, Wang H, Zhao Z, Wang W. Drug metabolism and Health and Disease. Advances in Experimental Medicine and Biology, New pharmacokinetics of organosulfur compounds from garlic. J Drug Metab York, NY: Springer (2014) 817. doi: 10.1007/978-1-4939-0897-4_14 Toxicol. (2013) 4:159. doi: 10.4172/2157-7609.1000159 51. Schoeler M, Caesar R. Dietary lipids, gut microbiota and lipid metabolism. Rev 71. Khan I, Bhardwaj M, Shukla S, Min SH, Choi DK, Bajpai VK, Endocr Metab Disord. (2019) 20:461–72. doi: 10.1007/s11154-019-09512-0 et al. Carvacrol inhibits cytochrome P450 and protects against binge 52. Yang Y, Yang F, Huang M, Wu H, Yang C, Zhang X, et al. Fatty liver and alcohol-induced liver toxicity. Food Chem Toxicol. (2019) 131:110582. alteration of the gut microbiome induced by diallyl disulfide. Int J Mol Med. doi: 10.1016/j.fct.2019.110582 (2019) 44:1908–20. doi: 10.3892/ijmm.2019.4350 72. Espinosa C, Cuesta A, Esteban M. Effects of dietary polyvinylchloride 53. Li Y, Fu X, Ma X, Geng S, Jiang X, Huang Q, et al. Intestinal microbiome- microparticles on general health, immune status and expression of several metabolome responses to essential oils in piglets. Front Microbiol. (2018) genes related to stress in gilthead seabream (Sparus aurata L.). Fish Shellfish 9:1988. doi: 10.3389/fmicb.2018.01988 Immunol. (2017) 68:251–9. doi: 10.1016/j.fsi.2017.07.006 54. Estruch G, Collado MC, Peñaranda DS, Tomás Vidal A, Jover Cerdá M, 73. Purushe J, Fouts DE, Morrison M, White BA, Mackie RI, Coutinho PM, Pérez Martínez G, Martinez-Llorens S. Impact of fishmeal replacement in et al. Comparative genome analysis of Prevotella ruminicola and Prevotella diets for gilthead sea bream (Sparus aurata) on the gastrointestinal microbiota bryantii: insights into their environmental niche. Microb Ecol. (2010) 60:721– determined by pyrosequencing the 16S rRNA gene. PLoS ONE. (2015) 9. doi: 10.1007/s00248-010-9692-8 10:e0136389. doi: 10.1371/journal.pone.0136389 74. Larsen JM. The immune response to Prevotella bacteria in 55. Huyben D, Vidaković A, Werner Hallgren S, Langeland M. High-throughput chronic inflammatory disease. Immunology. (2017) 151:363–74. sequencing of gut microbiota in rainbow trout (Oncorhynchus mykiss) doi: 10.1111/imm.12760 fed larval and pre-pupae stages of black soldier fly (Hermetia illucens). 75. Makridis P, Martins S, Vercauteren T, Van Driessche K, Decamp O, Dinis MT. Aquaculture. (2019) 500:485–91. doi: 10.1016/j.aquaculture.2018.10.034 Evaluation of candidate probiotic strains for gilthead sea bream larvae (Sparus 56. Johnson DI. Corynebacterium spp. In: Johnson DI, editor. Bacterial Pathogens aurata) using an in vivo approach. Lett Appl Microbiol. (2005) 40:274–7. and Their Virulence Factors. Cham: Springer International Publishing (2018). doi: 10.1111/j.1472-765X.2005.01676.x p. 73–9. 76. Goyal AK, Zylstra GJ. Genetics of naphthalene and phenanthrene degradation 57. Kvamme BO, Gadan K, Finne-Fridell F, Niklasson L, Sundh H, Sundell by Comamonas testosteroni. J Ind Microbiol Biotechnol. (1997) 19:401–7. K, et al. Modulation of innate immune responses in Atlantic salmon by doi: 10.1038/sj.jim.2900476 chronic hypoxia-induced stress. Fish Shellfish Immunol. (2013) 34:55–65. 77. Igwaran A, Iweriebor BC, Ofuzim Okoh S, Nwodo UU, Obi LC, Okoh doi: 10.1016/j.fsi.2012.10.006 AI. Chemical constituents, antibacterial and antioxidant properties of 58. Webster TMU, Rodriguez-Barreto D, Consuegra S, Garcia de Leaniz C. the essential oil flower of Tagetes minuta grown in Cala community Cortisol-induced signatures of stress in the fish microbiome. bioRxiv. (2019) Eastern Cape, South Africa. BMC Complement Altern Med. (2017) 17:351. 826503. doi: 10.1101/826503 doi: 10.1186/s12906-017-1861-6 59. Mommsen TP, Vijayan MM, Moon TW. Cortisol in teleosts: dynamics, 78. Disner GR, Calado SL, Assis CS, Cestari MM. Toxicity of naphthalene mechanisms of action, and metabolic regulation. Rev Fish Biol Fish. (1999) in the neotropical fish Astyanax lacustris (Characiformes: Characidae) and 9:211–68. doi: 10.1023/A:1008924418720 Geophagus brasiliensis (Perciformes: Cichlidae). Evidência. (2017) 17:e12976. 60. Serradell A, Torrecillas S, Makol A, Valdenegro V, Fernández-Montero A, doi: 10.18593/eba.v17i1.12976 Acosta F, et al. Prebiotics and phytogenics functional additives in low fish meal 79. Fialová SB, Rendekova K, Mucaji P, Slobodnikova L. Plant natural and fish oil based diets for European sea bass (Dicentrarchus labrax): Effects agents: polyphenols, alkaloids and essential oils as perspective solution on stress and immune responses. Fish Shellfish Immunol. (2020) 100:219–29. of microbial resistance. Curr Organ Chem. (2017) 21:1875–84. doi: 10.1016/j.fsi.2020.03.016 doi: 10.2174/1385272821666170127161321 Frontiers in Immunology | www.frontiersin.org 18 March 2021 | Volume 12 | Article 625297 Firmino et al. Diet, Immunity, and Microbiota Crosstalk 80. Daferera DJ, Tarantilis PA, Polissiou MG. Characterization of essential oils 91. Filocamo A, Nueno-Palop C, Bisignano C, Mandalari G, Narbad A. Effect of from lamiaceae species by fourier transform Raman spectroscopy. J Agric Food garlic powder on the growth of commensal bacteria from the gastrointestinal Chem. (2002) 50:5503–7. doi: 10.1021/jf0203489 tract. Phytomedicine. (2012) 19:707–11. doi: 10.1016/j.phymed.2012.02.018 81. Dziri S, Casabianca H, Hanchi B, Hosni K. Composition of garlic essential oil 92. Yin D, Du E, Yuan J, Gao J, Wang Y, Aggrey SE, et al. Supplemental thymol (Allium sativum L.) as influenced by drying method. J Essent Oil Res. (2014) and carvacrol increases ileum Lactobacillus population and reduces effect of 26:91–6. doi: 10.1080/10412905.2013.868329 necrotic enteritis caused by Clostridium perfringes in chickens. Sci Rep. (2017) 82. Leimkühler S, Bühning M, Beilschmidt L. Shared sulfur mobilization routes 7:7334. doi: 10.1038/s41598-017-07420-4 for tRNA thiolation and molybdenum cofactor biosynthesis in prokaryotes 93. Laity J, Lee B, Wright P. Zinc finger proteins: new insights into and eukaryotes. Biomolecules. (2017) 7:5. doi: 10.3390/biom7010005 structural and functional diversity. Curr Opin Struct Biol. (2001) 11:39–46. 83. Magariños B, Romalde JL, Santos Y, Casal JF, Barja JL, Toranzo AE. doi: 10.1016/S0959-440X(00)00167-6 Vaccination trials on gilthead seabream (Sparus aurata) against Pasteurella 94. Will CL, Lührmann R. Spliceosomal UsnRNP biogenesis, piscicida. Aquaculture. (1994) 120:201–8. doi: 10.1016/0044-8486(94)90078-7 structure and function. Curr Opin Cell Biol. (2001) 13:290–301. 84. Pujalte MJ, Sitjà-Bobadilla A, Álvarez-Pellitero P, Garay E. Carriage doi: 10.1016/S0955-0674(00)00211-8 of potentially fish-pathogenic bacteria in Sparus aurata cultured 95. Zeng H, Nanayakkara GK, Shao Y, Fu H, Sun Y, Cueto R, et al. DNA in Mediterranean fish farms. Dis Aquat Organ. (2003) 54:119–26. checkpoint and repair factors are nuclear sensors for intracellular organelle doi: 10.3354/dao054119 stresses—inflammations and cancers can have high genomic risks. Front 85. Silva FC, Nicoli JR, Zambonino-Infante JL, Kaushik S, Gatesoupe FJ. Physiol. (2018) 9:516. doi: 10.3389/fphys.2018.00516 Influence of the diet on the microbial diversity of faecal and gastrointestinal 96. Wang J, An H, Mayo MW, Baldwin AS, Yarbrough WG. LZAP, a putative contents in gilthead sea bream (Sparus aurata) and intestinal contents tumor suppressor, selectively inhibits NF-kappaB. Cancer Cell. (2007) 12:239– in goldfish (Carassius auratus). FEMS Microbiol Ecol. (2011) 78:285–96. 51. doi: 10.1016/j.ccr.2007.07.002 doi: 10.1111/j.1574-6941.2011.01155.x 97. Nakad R, Schumacher B. DNA damage response and immune defense: links 86. Itoi S, Okamura T, Koyama Y, Sugita H. Chitinolytic bacteria in the and mechanisms. Front Genet. (2016) 7:147. doi: 10.3389/fgene.2016.00147 intestinal tract of Japanese coastal fishes. Can J Microbiol. (2006) 52:1158–63. doi: 10.1139/w06-082 Conflict of Interest: JF is a current TECNOVIT-FARMFAES S.L. employee 87. Moi IM, Roslan NN, Leow ATC, Ali MSM, Rahman RNZRA, Rahimpour conducting an Industrial Ph.D. A, et al. The biology and the importance of Photobacterium species. Appl Microbiol Biotechnol. (2017) 101:4371–85. doi: 10.1007/s00253-017-8300-y The remaining authors declare that the research was conducted in the absence of 88. Rico RM, Tejedor-Junco MT, Tapia-Paniagua ST, Alarcón FJ, Mancera any commercial or financial relationships that could be construed as a potential JM, López-Figueroa F, et al. Influence of the dietary inclusion of conflict of interest. Gracilaria cornea and Ulva rigida on the biodiversity of the intestinal microbiota of Sparus aurata juveniles. Aquac Int. (2016) 24:965–84. Copyright © 2021 Firmino, Vallejos-Vidal, Balebona, Ramayo-Caldas, Cerezo, doi: 10.1007/s10499-015-9964-x Salomón, Tort, Estevez, Moriñigo, Reyes-López and Gisbert. This is an open-access 89. Beltrán JMG, Silvera DG, Ruiz CE, Campo V, Chupani L, Faggio C, et al. article distributed under the terms of the Creative Commons Attribution License (CC Effects of dietary Origanum vulgare on gilthead seabream (Sparus aurata L.) BY). The use, distribution or reproduction in other forums is permitted, provided immune and antioxidant status. Fish Shellfish Immunol. (2020) 99:452–61. the original author(s) and the copyright owner(s) are credited and that the original doi: 10.1016/j.fsi.2020.02.040 publication in this journal is cited, in accordance with accepted academic practice. 90. Hernandez LH, Hardy RW. Vitamin A functions and requirements in fish. No use, distribution or reproduction is permitted which does not comply with these Aquac Res. (2020) 51:3061–71. doi: 10.1111/are.14667 terms. Frontiers in Immunology | www.frontiersin.org 19 March 2021 | Volume 12 | Article 625297