nanomaterials Article Comparative Study of Gold and Carbon Nanoparticles in Nucleic Acid Lateral Flow Assay Juan Carlos Porras 1 , Mireia Bernuz 1 , Jennifer Marfa 1 , Arnau Pallares-Rusiñol 1 , Mercè Martí 2 and María Isabel Pividori 1,2, * 1 Grup de Sensors i Biosensors, Departament de Química, Universitat Autònoma de Barcelona, 08193 Bellaterra, Spain; juancarlos.porras@e-campus.uab.cat (J.C.P.); Mireia.Bernuz@uab.cat (M.B.); Jennifer.Marfa@uab.cat (J.M.); Arnau.Pallares@uab.cat (A.P.-R.) 2 Institute of Biotechnology and Biomedicine, Universitat Autònoma de Barcelona, 08193 Bellaterra, Spain; merce.marti@uab.cat * Correspondence: Isabel.Pividori@uab.cat; Tel.: +34-93-581-1976 Abstract: A lateral flow assay (LFA) is a paper-based, point-of-need test designed to detect a specific analyte in complex samples in low-resource settings. Although LFA has been successfully used in different applications, its use is still limited when high sensitivity is required, especially in the diagnosis of an early-stage condition. The limit of detection (LOD) is clearly related to the signal-generating system used to achieve the visual readout, in many cases involving nanoparticles coupled to a biomolecule, which, when combined, provides sensitivity and specificity, respectively. While colloidal gold is currently the most-used label, other detection systems are being developed. Carbon nanoparticles (CNPs) demonstrate outstanding features to improve the sensitivity of this technology by producing an   increased contrast in the paper background. Based on the necessity of sensitivity improvement, the aim of this work is a comparative study, in terms of analytical performance, between commercial streptavidin Citation: Porras, J.C.; Bernuz, M.; Marfa, J.; Pallares-Rusiñol, A.; Martí, gold nanoparticles (streptAv-AuNPs) and avidin carbon nanoparticles (Av-CNPs) in a nucleic acid M.; Pividori, M.I. Comparative Study lateral flow assay. The visual LOD of the method was calculated by serial dilution of the DNA template, of Gold and Carbon Nanoparticles in ranging from 0.0 to 7 pg µL−1 /1.5 × 104 CFU mL−1 ). The LFA achieved visual detection of as low as Nucleic Acid Lateral Flow Assay. 2.2 × 10−2 pg µL−1 using Av-CNPs and 8.4 × 10−2 pg µL−1 using streptAv-AuNPs. These LODs could Nanomaterials 2021, 11, 741. https:// be obtained without the assistance of any instrumentation. The results demonstrate that CNPs showed doi.org/10.3390/nano11030741 an increased sensitivity, achieving the nanomolar range even by visual inspection. Furthermore, CNPs are the cheapest labels, and the suspensions are very stable and easy to modify. Academic Editors: Antonino Mazzaglia and Elena Aznar Keywords: carbon black; gold nanoparticles; rapid diagnostic tests; lateral flow assay Received: 15 January 2021 Accepted: 8 March 2021 Published: 15 March 2021 1. Introduction Publisher’s Note: MDPI stays neutral The recent outbreak of SARS-CoV-2 that spread worldwide in a matter of days due with regard to jurisdictional claims in to the globalization process highlighted the need for rapid diagnostic tests (RDTs) able to published maps and institutional affil- provide a rapid result and to help implement security and prevention measures to interrupt iations. the transmission chain. At present, and more than ever, these RDTs are a major research field of growing interest among researchers around the globe. In 2003, the World Health Organization (WHO/TDR) published a set of criteria for the ideal RDT test under the acronym ASSURED [1]: Affordable, Sensitive, Specific, User-friendly, Rapid and Robust, Copyright: © 2021 by the authors. Equipment-free, and Deliverable to end-users. Although the original features remain Licensee MDPI, Basel, Switzerland. relevant, it has been recently revised to include two additional criteria as REASSURED of R This article is an open access article (Real-time connectivity) and E (Ease of specimen collection and environmental friendliness), distributed under the terms and in order to design future devices [2]. conditions of the Creative Commons Since the presentation of the first US patents by three individual researchers in 1987 Attribution (CC BY) license (https:// (Robert Rosenstein for Becton Dickinson & Co., Keith May for Unilever, and David Charl- creativecommons.org/licenses/by/ ton for Carter Wallace), lateral flow assays (LFAs) are the most common commercially 4.0/). available RDTs. There has since been an increasing interest in the development of LFAs Nanomaterials 2021, 11, 741. https://doi.org/10.3390/nano11030741 https://www.mdpi.com/journal/nanomaterials Nanomaterials 2021, 11, 741 2 of 11 for multiple chemical and biochemical targets [3]. The LFA in its most general format is an immunochromatographic assay that separates analytes that flow across porous mem- branes and interact specifically with antibodies deposited on them. It requires a visible signal-generating system to label the analyte, or its receptor, and create a visual result that will be interpreted by the end-user. The most popular types of signal-generating systems based on nanoparticles (NPs) are metallic NPs, such as gold NPs, and polymeric NPs, such as latex or polystyrene [4]. Although LFA is one of the RDT formats that can meet the WHO criteria, its poor sensitivity in some applications [5] is a major drawback which can limit its large-scale use for the global diagnosis of major diseases. The study of alternative NPs as signal-generating systems emerges as a response to this bottleneck. Different approaches have been reported in order to address this issue, including the use of alternative nanoparticles as signal-generating systems, such as quantum dots [6], as well as other labels based on fluorescence [7], chemiluminescence readout [8,9], enzyme-like activity [10], or other readout systems [11,12]. Although these systems provide enhanced sensitivity, in most cases the addition of further reagents or substrates, or the need for instrumentation to achieve the readout, can be a barrier in some low-resource settings. The term “carbon nanoparticles” (CNPs) generically refers to several types of nanos- tructured carbon products based on the product carbon black (CB), mainly used in in- dustrial manufacturing processes, such as for rubbers and tires, plastics, inks, paints, and electrodes [13,14]. These extremely fine black powders are 97–99% elemental carbon ag- gregates ranging from tens to a few hundred nanometers. The microstructure of CNPs has been studied for many years [15–18], and it is considered to be paracrystalline and highly complex, offering a material with high surface area, high stability, low density, and high mechanical strength [13]. The carbon black aggregates are the primary units that are discrete, rigid colloidal particles formed by fused spheres of graphitic carbon layers [13]. The X-ray diffraction (XRD) patterns of CB define a 2D arrangement of the carbon hexagon layers that are superposed in random orientation with its adjacent layers. Although it cannot be considered an amorphous material, CB does not have a three-dimensional net- work structure like graphite [16–18]. CB is produced by the pyrolysis of hydrocarbons at temperatures above 1200 ◦ C, and different classifications have been proposed according to its production process, its carbon feedstock, its application field, and the properties of the end-of-use products [13]. Carbon nanoparticles and other carbon allotropes are well-known materials in the electrochemical biosensors field for transducers and are used in several applications, from the fabrication of electrodes, such as graphite/epoxy composite (GEC) [19] and screen-printed electrodes [14], to their use as labeling in dot blot and LFAs [20,21], taking advantage of the surface reactivity and high adsorption of carbon [22–26]. Their characteristics and mass-scale production for industrial applications provide a low-cost material with the appropriate reactivity and stability to be used for labeling in LFAs [20–26]. The intrinsic black color of the CNPs provides the highest possible visual contrast in a white nitrocellulose membrane, therefore enhancing the analytical parameters of LFA [27,28]. This work addresses the development of biologically modified carbon NPs, their characterization by transmission electron microscopy (TEM), and their application in lateral flow assays using Escherichia coli double-tagged DNA amplicons [29,30]. Biotin and digoxigenin were used as specific tags for labeling the PCR-amplified DNA. Thus, avidin was used to modify the CNPs’ surface and anti-digoxigenin antibody was deposited on the LFA nitrocellulose membrane. The analytical parameters and performance of biologically modified CNPs are compared with commercially available streptavidin-modified gold NPs as the standard signal-generating system in LFA. Nanomaterials 2021, 11, 741 3 of 11 2. Materials and Methods 2.1. Reagents and Equipment The carbon nanoparticles (CNPs) obtained from carbon black (CB) Spezial Schwartz 4 (Degussa AG, Essen, Germany, Ref.7088) and avidin (Thermo Scientific, Waltham, MA, USA, Ref. 21121) were used to prepare the avidin-modified carbon nanoparticles (Av- CNPs). Commercial streptavidin-modified 40 nm gold nanoparticles were obtained from Expedeon (Cambridge, UK, Ref. 250–1000). Bovine serum albumin (BSA, Ref. A5403), sucrose (Ref. S0389), and Tween® 20 (Ref. P9416) were purchased from Sigma-Aldrich (St. Louis, MO, USA). All solutions were prepared with ultrapure Milli-Q water (Millipore® System, Burlington, MA, USA, resistivity 18.2 MΩ·cm). The composition of these solutions is described in the Supplementary Materials. For the double-tagging PCR, the tagged primers were obtained from Sigma-Aldrich. Taq DNA polymerase (Ref. 18038067) and nuclease-free water (Ref. AM9937) were purchased from Thermo Fisher, Waltham, MA, USA. Standard reaction buffer 10× with MgCl2 (Ref. 20.034-4182) was purchased from Biotools, Madrid, Spain. Deoxynucleotide Mix 10 mM (Ref. D7295) was purchased from Sigma-Aldrich, St. Louis, MO, USA. For the construction of lateral flow assay (LFA) strips, adhesive backing cards were purchased from Kenosha C.V., Amstelveen, The Netherlands (Ref. KN-2211). Nitrocel- lulose membrane (Ref. FF120H) and absorbent pads (CF7) were purchased from GE Healthcare Europe, Chicago, IL, USA. The cellulose sample pads (CFSP203000) and glass fiber conjugate pads (GFCP083000) were purchased from Millipore, Burlington, MA, USA. Anti-digoxigenin Fab fragments (anti-DIG antibody) (Roche, Basilea, Switzerland, Ref. 11214667001) were used in the test line at 0.4 mg·mL−1 . As a control line, biotinylated protein was used at 0.4 mg·mL−1 (a biotin-modified rabbit polyclonal antibody) (Abcam, Cambridge, UK, Ref. ab69255). For the preparation of carbon black conjugates, an Eppendorf Thermomixer C (Eppen- dorf AG, DE, Hamburg, Germany), a microtube centrifuge Biocen 22R (Ortoalresa, ES), and a probe sonicator (Sonics Materials, Newtown, CT, USA Ref. VCX130PB220) were used. A SimpliAmp Thermal Cycler (Applied Biosystems, Foster City, CA, USA) was used for the double-tagging PCR amplification. For the immobilization of biomolecules into LFA membranes, an IsoFlow reagent dispensing system (Claremont Bio, Upland, CA, USA) coupled with a syringe bomb KDS LegatoTM 200 (KD Scientific Inc., Holliston, MA, USA) were used at a flow rate of 38 µL min−1 . 2.2. Carbon Nanoparticles Modification and Storage Briefly, 10 mg·mL−1 CNP solution was homogenized in Milli-Q water by sonication at 27 W for 5 min and 5-fold diluted in 5 mmol·L−1 borate buffer, pH 8.8. The immo- bilization was performed by physical adsorption [20]. To achieve this, 350 µL of avidin (1 mg·mL−1 ) was added to 1 mL CNP solution and incubated for 3 h at RT using a ther- momixer at 550 rpm (slight rotation). The suspension containing the avidin-modified carbon nanoparticles (Av-CNPs) was centrifuged for 15 min at 13,600× g, and the super- natant was removed to eliminate the excess avidin. Afterward, Av-CNPs were resuspended in 1 mL of 5 mmol·L−1 borate buffer, pH 8.8 with 1% (w/v) BSA, and centrifuged again under the same conditions. Finally, Av-CNPs were resuspended in 1 mL storage buffer (100 mmol·L−1 borate, pH 8.8 with 1% (w/v) BSA) to a final concentration of 0.2% (w/v) of Av-CNPs. The final conjugate solution was stored at 4 ◦ C until further use. 2.3. Characterization of CNPs by Transmission Electron Microscopy A JEOL 1400 transmission electron microscope (TEM) at an accelerating voltage of 120 kV was used for the characterization of the CNPs. For sample preparation, a micro- quantity of CNP solution was sonicated at 27 W for 5 min and dropped on a copper plate with a carbon film grid until dried. Images were further processed by the Nucleus counting plugin for ImageJ to calculate their size distribution. Before the analysis, images were transformed to 8-bit, with the contrast and brightness adjusted and binarized to make Nanomaterials 2021, 11, x 4 of 11 Nanomaterials 2021, 11, 741 4 of 11 transformed to 8‐bit, with the contrast and brightness adjusted and binarized to make them processable by the software. Moreover, before the plugin was employed, a water‐ them shed processable by the software. filter was applied Moreover, to separate them before the plugin correctly. Only was employed, aCNPs well‐separated watershed were filter was applied to separate them correctly. Only well-separated CNPs were counted and counted and measured. measured. 2.4. Bacterial Strains Culture, DNA Extraction, and Double‐Tagging PCR 2.4. Bacterial Strains Culture, DNA Extraction, and Double-Tagging PCR E.coli E. coliDH5-α DH5‐αstrainstrainwas wascultured culturedin inLuria–Bertani Luria–Bertani(LB) (LB)plates platesfor for16 16hhatat37 37◦°C. After C. After the overnight the overnight culturing, culturing, the the concentration concentrationofofbacteria bacteriawas wasfound foundto to be be approximately approximately 108 CFU∙mL 10 8 CFU·mL −1 . Lysis of bacteria −1 . Lysis and DNA of bacteria extraction and DNA were performed, extraction incubating were performed, 1 mL of incubating 1 bac‐ mL of bacteria at 99 C for 1 h at different concentrations and centrifuging at 15,500× gmin. teria at 99 °C for◦ 1 h at different concentrations and centrifuging at 15,500 × g for 2 for 2The min.lysate was washed The lysate was washed with Milli‐Q water, with Milli-Q resuspended water, withwith resuspended 200 200 μL Tris‐EDTA µL Tris-EDTA (10 mmol∙L ‐1 Tris; − 1 1 mmol∙L ‐1; pH− 18.0) for DNA extraction, and incubated (10 mmol·L Tris; 1 mmol·L ; pH 8.0) for DNA extraction, and incubated for 10 min at for 10 min at 99 °C followed 99 by 15by ◦ C followed min15 in minice.inGenomic ice. GenomicDNADNAwas centrifuged for 5for was centrifuged min at 12,000 5 min × g× at 12,000 andg resuspended at different concentrations. and resuspended at different concentrations. 2.5. Double-Tagging 2.5. Double‐TaggingPCR PCRand andQuantification Quantificationby byGel GelElectrophoresis Electrophoresis During the During thedouble-tagging double‐tagging PCRPCR procedure procedure(Figure (Figure1), 1),bacterial bacterialDNA DNAwas wasamplified amplified andlabeled and labeledwith withbiotin biotinand anddigoxigenin digoxigeninusingusingmodified modifiedprimers primers[29,30]. [29,30].PCR PCRwas wascarried carried out outinin15 μLreactions. 15µL reactions.The Theprimers primersforfor thethe double-tagging double‐taggingPCRPCRwere selected were for the selected for specific the spe‐ amplification of the E. cific amplification of coli the16SE.ribosomal coli 16S gene (NCBI gene ribosomal Reference (NCBISequence ReferenceMN661169.1, Sequence as detailed in Supplementary MN661169.1, Materials). The as detailed in Supplementary sequencesThe Materials). of the primersofwere sequences as shown the primers in were Table 1. in Table 1. as shown Figure1.1.Schematic Figure Schematicdescription descriptionofofthe thedouble-tagging double‐taggingPCR PCRfor for the the amplification amplification of of thethe Escherichia Escherichia coli coliribosomal 16S 16S ribosomal gene,gene, including including an initial an initial step atstep 95 ◦at C 95 for°C for 3followed 3 min min followed by 25 cycles by 25 cycles of 95 ◦ of 95 °C C for 30 s, for◦ C 58 30for s, 58 30°C for◦30 s, 72 s, 7230°Cs, for C for and30a s,final a final andstep of 7step minofat7 72 min at BIO ◦ C. 72 °C. is biotin marked with orange; DIG is digoxigenin marked with pink. Table 1. Sequences of the set of primers for the double‐tagging PCR amplification of E. coli. Table Strain and 1. Sequences of the set of primers Gene PrimerforSequence the double-tagging PCR amplification Type of E.5′‐Labels coli. Size (bp) Escherichia coli DH5‐α AGAGTTTGATCCTGGCTCAG Forward 0 biotin Strain and Gene Primer Sequence Type 5 -Labels Size (bp) 527 16S ribosomal gene ATTACCGCGGCTGCTGGC Reverse digoxigenin Escherichia coli DH5-α AGAGTTTGATCCTGGCTCAG Forward biotin 527 16S ribosomal gene ATTACCGCGGCTGCTGGC Further experimental details of theReverse digoxigenin double‐tagging PCR procedure are also described in the Supplementary Materials. Nanomaterials 2021, 11, 741 5 of 11 Nanomaterials 2021, 11, x 5 of 11 Further experimental details of the double-tagging PCR procedure are also described Afterward, in the amplimers Supplementary were analyzed with conventional agarose gel electrophoresis Materials. on 2%Afterward, agarose gelamplimers in TAE buffer were(40analyzed ‐1 Tris, 40 mmol∙L‐1 acetate, 1 mmol∙L‐1 EDTA, mmol∙Lwith conventional agarose gel electrophoresis containing a DNA on 2% agarose gelstain to check in TAE bufferits(40 size distribution. mmol ·L−1 Tris, 40 mmol·L−1 acetate, 1 mmol·L−1 EDTA, containing a DNA stain to check its size distribution. 2.6. Lateral Flow Assays Based on Carbon and Gold Nanoparticles as Signal‐Generating Systems 2.6. Figure Lateral 2Flow Assays shows the Based on Carbonofand configuration Gold Nanoparticles Av‐CNPs (Figure 2A)asand Signal-Generating Systems streptavidin‐modified AuNPs Figure 2 shows (Figure the configuration 2B) lateral of Av-CNPs flow immunoassays. In(Figure 2A) and streptavidin-modified both instances, the biotin tag of the AuNPs (Figureamplicon double‐tagged 2B) lateral flow with reacted immunoassays. In both instances, the signal‐generating the biotin systems, while tag of the the immobili‐ double-tagged zation of the DNA amplicon reactedby was achieved with thethe signal-generating digoxigenin tag and usingsystems, whileantibody anti‐DIG the immobi- on lization of the DNA was achieved by the digoxigenin tag and using the nitrocellulose strip in the test line. As a control line, a biotinylated macromolecule anti-DIG antibody on the (such asnitrocellulose strip in or biotinylated protein thebiotinylated test line. Asdendrimer a control line, a biotinylated as previously macromolecule reported by our re‐ (such group) search as biotinylated [31,32] can protein be usedorinbiotinylated dendrimer order to capture as previously all the remaining reported Av‐CNPs, by our as shown inresearch Figure group) [31,32] cantobehighlight 2. It is important used in order to capture that biotin alone all the remaining cannot be used, since Av-CNPs, as it is not shown inon adsorbed Figure 2. It is important nitrocellulose strips dueto highlight to its low that MWbiotin and, as alone such,cannot be used, it is washed since the during it is not adsorbed test, on nitrocellulose as previously reported by strips due to its our research low MW group [32].and, as such, In this it is washed instance, during a biotinylated the test, as previously reported by our research group protein (a biotin‐modified rabbit polyclonal antibody) was used. [32]. In this instance, a biotinylated protein (a biotin-modified rabbit polyclonal antibody) was used. Schematicprocedure Figure2.2.Schematic Figure procedureofofthe thelateral lateralflow flowassay assay(LFA) (LFA)based basedononavidin‐modified avidin-modifiedcarbon carbonnanoparticles nanoparticles(Av‐CNPs) (Av-CNPs) (A) (A)and andbased basedonon commercial commercial streptavidin streptavidingold goldnanoparticles, nanoparticles,(streptAv‐AuNPs) (streptAv-AuNPs)(B) (B)for forthe the detection detectionofof double‐tagged double-tagged amplicon amplicon labeled labeled with biotin and with biotin and digoxigenin. digoxigenin.TheThetest testline lineisisbased basedinin both both instances onon instances anti‐digoxigenin anti-digoxigenin antibody antibody (anti‐ (anti-DIG DIG antibody), antibody), while while the the control control lineline is based is based onon a biotinylatedprotein, a biotinylated protein,sosoas asto tocapture capture all all the the remaining remaining Av‐CNPs Av-CNPs (A)(A)or or streptavidin‐modified AuNPs (B). streptavidin-modified AuNPs (B). In Inthe theCNP CNPstrips, strips,5 5μLµLofof Av‐CNPs Av-CNPs was added was added to to thethe sample sample in ainfinal volume a final volume of 50 of μL 50 running µL running buffer (100 buffer mmol∙L (100 mmol−1 borate ·L− buffer, 1 borate pH buffer, pH8.8, 8.8,with with1% 1%(w/v) (w/v)BSA, BSA,0.05% 0.05% (v/v) (v/v) Tween Tween®®20),20),and and was was dropped dropped intointothe thesample samplepad padafter after2 2min minofofincubation. incubation. AA further further 200200 µL μL of running buffer was dropped into the sample pad. The readout was achieved after 10after of running buffer was dropped into the sample pad. The readout was achieved min 10 minsample from from sample deposition. deposition. For the For the semiquantitative semiquantitative plots, theplots, samplesthe samples are the dou‐ are the double-tagged ble‐tagged amplicons at amplicons at different concentrations different concentrations (from (from 0.00 to 7.09 pg0.00 − 1 µL to/1.5 7.09×pg 4 10 μL −1 CFU mL×−10 /1.5 1 ).4 CFU mL ). −1 Nanomaterials 2021, 11, 741 6 of 11 Additionally, AuNP-based lateral flow strips were performed as previously described Nanomaterials 2021, by11, x research group [31,32], and included a conjugate pad in the configuration 6asofa11 our reservoir of AuNPs. In this instance, a final readout was achieved at 15 min from sample deposition. Additionally, AuNP‐based lateral flow strips were performed as previously de‐ scribed byand 2.7. Data Interpretation ourAnalysis research group [31,32], and included a conjugate pad in the configuration as a reservoir of AuNPs. In this instance, a final readout was achieved at 15 min from In order to avoiddeposition. sample any bias in the images due to luminosity, all the strips for a single experiment were photographed in a single image and the conditions were the same in all cases. The images were 2.7. Data taken at the Interpretation andsame time for all the strips in a single image, using a Analysis portable photographic studio In order based to avoid anyonbiasLED lights in the imagesofdue 1100to lm and a color luminosity, all thetemperature of strips for a single 6000–6500 K. Theexperiment imageswere werephotographed taken at a in a single of distance image andwith 23 cm the conditions were theThe a smartphone. samerear in all camera was used,cases. Theaimages with maximumwere taken at the same resolution of 12time for all the(4032 megapixels strips × in a3024 single image, Auto- pixels). using a focus was enabled, and the flashlight was turned off during the data acquisition procedure.of portable photographic studio based on LED lights of 1100 lm and a color temperature 6000–6500 K. The images were taken at a distance of 23 cm with a smartphone. The rear Then, the images were converted to an 8-bit grey-scale format using the command Image camera was used, with a maximum resolution of 12 megapixels (4032 × 3024 pixels). Au‐ > Type > 8-bit.tofocus The test was and control enabled, lines and the were was flashlight outlined turnedusing the the off during rectangular selection data acquisition proce‐ tool, and the area dure.under Then, each peakwere the images was converted then numerically to an 8‐bit integrated usingusing grey‐scale format the the ImageJ gel command analysis toolbox. Image > Type > 8‐bit. The test and control lines were outlined using the rectangular selec‐ tion tool, and the area under each peak was then numerically integrated using the ImageJ 3. Results andgel Discussion analysis toolbox. 3.1. Characterization of CNPs by Transmission Electron Microscopy 3. Results and Discussion The structure of the CNPs in CB is composed of a system of condensed carbon 3.1. Characterization of CNPs by Transmission Electron Microscopy aromatic rings that are deposited forming sheets of different sizes and alignment. These The structure of the CNPs in CB is composed of a system of condensed carbon aro‐ sheets are placed randomly matic through rings that an axisforming are deposited and aresheets attached to eachsizes of different otherand π−π stacking, by alignment. These overlapping one another to form the primary unit of the structure, the primary sheets are placed randomly through an axis and are attached to each other by  particle stack‐ or nodule [13–18]. Besides the ing, overlapping nodules, one another toCNPs form in theCB tendunit primary to form of theaggregates structure, the(85–500 primary nm) parti‐ and agglomerates (1–100 cle or noduleµm) [13–18]. [13–18]. After Besides the the sonication nodules, CNPs in procedure CB tend tonecessary to disperse form aggregates (85–500 nm) and the CNPs in water, theagglomerates (1–100 μm) [13–18]. remaining superstructures areAfter the sonication primarily procedure necessary the aggregates, as shownto disperse the CNPs in water, the remaining superstructures in Figure 3A. The agglomerates are attached by weaker forces that can be broken are primarily the aggregates, by the as shown in Figure 3A. The agglomerates are attached by weaker forces that can be broken sonication. The mean diameter value was found to be 13 nm with a standard deviation by the sonication. The mean diameter value was found to be 13 nm with a standard devi‐ of 6 (Figure 3B). The ation of 6TEM image (Figure shows 3B). The TEMtheimagepresence ofpresence shows the aggregates withoutwithout of aggregates any regular any reg‐ structure that were, in most instances, larger than 200 nm. ular structure that were, in most instances, larger than 200 nm. Figure 3. (A) The transmission electron microscopy (TEM) images obtained with a JEOL 1400 microscope at an accelerating voltage of 120 kV at two resolution levels. (B) The histogram obtained by analyzing 4 images (displayed in Figure S1, Supplementary Materials). n = 700. Nanomaterials 2021, 11, x 7 of 11 Figure 3.2021, Nanomaterials (A) 11, The741 transmission electron microscopy (TEM) images obtained with a JEOL 1400 microscope at an accelerating 7 of 11 voltage of 120 kV at two resolution levels. (B) The histogram obtained by analyzing 4 images (displayed in Figure S1, Supplementary Materials). n = 700. 3.2. 3.2.Double‐Tagging Double-TaggingPCR PCRandandQuantification Quantification by by Gel Gel Electrophoresis Electrophoresis Figure 4 shows the results of the end‐point double‐tagging Figure 4 shows the results of the end-point double-tagging PCRPCR analyzed by gelby analyzed elec‐ gel trophoresis. As can electrophoresis. be observed, As can be observed,a unique a uniqueband bandat the expected at the expectedMWMW (527) (527)was wasobtained. obtained. Further Furtherdetail detailof ofthe theE.E.coli coli16S 16Sribosomal ribosomalRNA RNAgene (partialsequence, gene(partial sequence,region regionfromfrom11 to to 530 530nt) nt)isisshown shownin in Supplementary SupplementaryMaterials, Materials,including includingthe theposition positionofofthe theforward forwardand and reverse reverseprimer primersets setsframing framingthetheregion regiontotobe beamplified amplified(527(527bp). bp).As Asshown shownin inFigure Figure4,4,the the visual visuallimit limitofofdetection detectioncan canbe bedefined definedatatline line8, 8, corresponding corresponding to to 3.5 3.5 pg µL−1−.1 . pg μL Figure4.4.Gel Figure Gelelectrophoresis electrophoresisofofthe thedouble‐tagging double-tagging PCR PCR amplification amplification ofof E. E. thethe colicoli 16S16S ribosomal ribosomal gene, including an initial gene, including an initial step step at 95 ◦ °CC for 3 min followed by 25 cycles of 95◦ followed by 25 cycles of 95 C for 30 s, 58 °C °C for 30 s, 58 ◦ for30 C for 30s, s,7272◦ C °Cfor for3030s,s,and anda afinal finalstep step of 7 min at ◦ 72 °C. The amplification bands correspond to of 7 min at 72 C. The amplification bands correspond to the E. coli 16S the E. coli 16S ribosomal ribosomal gene gene (527(527 bp).bp). Lane Lane 1 is1the is the molecular molecular weight weight marker. marker. LaneLane 2 corresponds 2 corresponds to theto negative the negative control in which no DNA template has been added to the PCR mixture, while lanes 3–11 control in which no DNA template has been added to the PCR mixture, while lanes 3–11 show the show the amplicon corresponding to DNA template concentrations at 0.1, 0.2, 0.4, 0.9, 1.8, 3.5, 7.1, amplicon corresponding to DNA template concentrations at 0.1, 0.2, 0.4, 0.9, 1.8, 3.5, 7.1, 17.7, and 17.7, and 35.5 − 1 pg μL−1. 35.5 pg µL . 3.3. 3.3.Lateral LateralFlow FlowAssays AssaysBased Basedon onCarbon CarbonandandGold GoldNanoparticles Nanoparticles as as Signal‐Generating Signal-Generating Systems Systems The Thecomparative comparativestudy studyfor forthe thedetection detectionof ofE. E. coli coli by by double‐tagging double-tagging PCR PCR followed followed by byan anLFA LFAbased basedon ondifferent differentsignal‐generating signal-generatingsystems systemswas wasperformed, performed,as asschematically schematically shown in Figure 2. The total assay time was less than 15 min. The resultsof shown in Figure 2. The total assay time was less than 15 min. The results ofthe thetests testscan can either be estimated with the naked eye (as shown in Figure 5, the either be estimated with the naked eye (as shown in Figure 5, the upper panel for Av- upper panel for Av‐CNP and CNPthe lower and panel panel the lower for streptAv‐AuNP) for streptAv-AuNP) or with the ImageJ or with software the ImageJ by processing software by processingthe images. the images. FigureFigure 5 also 5shows the relative also shows areas for the relative eachfor areas type eachof type signal‐generating system of signal-generating after system processing the images. after processing These areas the images. Thesewere areasused were forused Figure for 6. The visual Figure 6. The LOD visualofLODthe method was calculated of the method by serialbydilution was calculated of the DNA serial dilution of the template, ranging ranging DNA template, from 0.0from to 7 pg0.0 μL −1 . The LFA− 1 achieved visual detection as low as 2.2 × 10 to 7 pg µL . The LFA achieved visual detection as low as 2.2 × 10 pg µL using−2 pg μL −1 − using 2CNPs − and1 8.4 × 10 CNPs −2 pg and μL 8.4 −1 using − 2 × 10AuNPs.pg µL − 1 These LODs using (calculated AuNPs. TheseasLODsthe concentration (calculated ascorresponding the concentration to the last positive to corresponding line visible the to the naked last positive eye, indicated line visible to the nakedby the eyeindicated eye, icon in Figure by the5)eyecanicon be in Figurewithout obtained 5) can be obtained the assistancewithout of anythe assistance of any instrumentation butinstrumentation but is prone to is prone to subjectivity. subjectivity. To further analyze the strips and to avoid subjectivity, the ImageJ analysis tool was used to extract the line intensities from the images of the strips at different concentrations by using a smartphone. The area under the peak (both the intensities of the control and the test line for each system are shown in Figure 5) was then numerically integrated using the ImageJ analysis toolbox, and the intensity of the test line for each strip was fitted using non-linear regression (Sigmoidal dose–response variable slope/Sigmoidal 4 PL) (R2 = 0.992 and 0.995 for CNPs and AuNPs, respectively); the results are shown in Figure 6A. The semiquantitative LODs were determined by processing the relative areas for each type of signal-generating system after processing the images, as shown in Figure 6. The LODs are calculated as the last concentration, in which a positive area value is obtained, as shown in Figure 5, indicated by a photo icon. Nanomaterials 2021, Nanomaterials 2021, 11, 11, 741 x 8 of 11 Nanomaterials 2021, 11, x 8 8ofof 11 5. Results Results obtained Results obtainedforforthe theLFA LFAatat attemplate templateamounts amountsranging ranging from from 0.00 0.00 to toto 7.09 7.09 pg pgpg −1 −1 μL (0toto to 1.5 ×××10 4 4CFU 10 CFUmLmL−−1 1 of Figure 5. Figure 5. obtained for the LFA template amounts ranging from 0.00 7.09 µLμL −1(0(0 1.5 1.5 10 4 CFU mL −1)) of E. coli, E. E. coli, based coli, basedon based onAv-CNPs on Av‐CNPs(upper Av‐CNPs (upperpanel) (upper panel)and panel) andstreptAv-AuNPs and streptAv‐AuNPs streptAv‐AuNPs (lower (lower (lower panel). panel). The panel). The The relative relative areas areas relative areas obtained obtained obtained after after processing processing after the processing the the images, images, images, plotted plotted in Figure in Figure plotted 6, 6, are in Figure are also also 6, are shown shown also shown for forfor both both both signal‐generating signal-generating systems. signal‐generatingsystems. systems.The The eye Theeye icon eyeicon indicates icon indicates the visual LODs, indicates the visual LODs, LODs, while the while the photo photo icon icon indicates indicates the the LOD LOD obtained obtained by by processing processingthetheimages the imagesand images anddetermining and determiningthe determining theareas. the areas. areas. Figure 6. (A) The results obtained for the LFA at template concentrations ranging from 0.00 to Figure 6. 7.09 pg6.µL −1 The (A) results 1.5 × 10 (0 toresults obtained 4 CFU mL for−the 1the LFA at template E. coli, ) ofLFA template concentrations based on concentrations carbon ranging nanoparticles from(0.00 (CNPs) 0.00 to 7.09 •) and 7.09 gold Figure (A) The obtained for at ranging from to pg pg μL −1 (0 to 1.5 × 104 CFU mL−1) of E. coli, based on carbon nanoparticles (CNPs) (‡) and gold na‐ nanoparticles (AuNPs) μL−1 (0 to 1.5 ().mL × 104 CFU (B) −1)Details of the of E. coli, relative based areas nanoparticles on carbon at low concentration. (CNPs) (‡) and gold na‐ noparticles (AuNPs) noparticles (AuNPs) (■). (■). (B) (B) Details Details of of the the relative relative areas areas at at low low concentration. concentration. The LODs obtained showed improved values compared to the visual LOD. In the case To further of CNPs, To further the LOD analyze was found analyze the strips the strips to beandand 6.0 10to−avoid to avoid 3 pg µL −1 (which corresponds subjectivity, subjectivity, the ImageJ the ImageJ analysis analysis to 10 CFU tool −1 ), was mLwas tool used to extract muchtobetter the than line intensities from the −images 2 − of the 1 strips at different concentrations used extract thethe linevisual LODfrom intensities of 2.2the10 imagespg µL of the(asstrips shown in Figureconcentrations at different 6B). Similarly, by using a smartphone. The area −2 for under the peak (both the intensities of the control and by using a smartphone. The area under the peak (both the intensities of thewas the semiquantitative LOD was 2.2 10 the AuNPs, while the visual LOD found control and to the be test 8.4 10 −2 pg line for −1 .system are shown in Figure 5) was then numerically integrated using each µL the test line for each system are shown in Figure 5) was then numerically integrated using the ImageJ the ImageJ Besides analysis toolbox,LODs the improved analysis toolbox, and the and the intensity obtained intensity of the with of the test thetest line for CNPs, line for each theeach valid strip was fitted analysis strip was fitted using rangeusingwas non‐linear also found regression to be wider (Sigmoidal (from 0 to dose–response at least 7.09 pg µL −1 ), since variable slope/Sigmoidal valid tests 4 PL) (with (R a 2 = 0.992 positive non‐linear regression (Sigmoidal dose–response variable slope/Sigmoidal 4 PL) (R2 = 0.992 and 0.995 control and forwere line) 0.995 for CNPsobtained CNPs and AuNPs, and AuNPs, respectively); in allrespectively); instances, at least the results the results up to this are shown are shown in in Figure Figure concentration. 6A. As6A.shown in Figure The5, semiquantitative a clear control lineLODs was were obtained determined with CNPs by The semiquantitative LODs were determined by processing the relative areas atprocessing this the concentration.relative areas for Whereas, for at each 7.09 type pg µL −1signal‐generating of , a non-valid test system was after observed processing by the AuNPsthe images, system as shown since the in Figure control line6. each type of signal‐generating system after processing the images, as shown in Figure 6. was The negative. LODs are calculated as the last concentration, in which The LODs are calculated as the last concentration, in which a positive area value is ob‐ a positive area value is ob‐ tained, tained,Theasstability as shown in shown and in repeatability Figure Figure 5, indicated 5, indicatedstudy byofaaAv-CNPs by photo icon. photo is shown in Figure 7. This study was icon. performed The LODs The with the LODs obtained strips obtained showedprepared showed improvedon day 0 improved valuesand stored values compared at roomto compared temperature. to the visual the Moreover, visual LOD. LOD. In the In thea batch of Av-CNPs was also prepared on day 0 and stored at 4 ◦ C. This study was conducted case of case of CNPs, CNPs, the the LOD LOD was was found found to to be be 6.0 6.0 1010−3 pg −3 pg μLμL−1 (which −1 (which corresponds corresponds to to 10 10 CFU CFU for 35 days (Figure 7C). The results show a mean relative intensity value of 4179, a standard Figure 5, a clear control line was obtained with CNPs at this concentration. Whereas, at 7.09 pg μL−1, a non‐valid test was observed by the AuNPs system since the control line was negative. The stability and repeatability study of Av‐CNPs is shown in Figure 7. This study was performed with the strips prepared on day 0 and stored at room temperature. More‐ Nanomaterials 2021, 11, 741 9 of 11 over, a batch of Av‐CNPs was also prepared on day 0 and stored at 4 °C. This study was conducted for 35 days (Figure 7C). The results show a mean relative intensity value of 4179, a standard deviation of 389, and a relative standard deviation (RSD) of 9.3% (as shown in Figure deviation of 389,7D). andThis error standard a relative shows thedeviation repeatability (RSD)study, including of 9.3% the in (as shown construction Figure 7D). of theerror This strips,shows the deposition of the line, the repeatability study,andincluding the stability the of the Av‐CNPs. construction As strips, of the shown the in Figure 7, theofAv‐CNPs deposition were the line, and theable to produce stability a clear control of the Av-CNPs. line until As shown day 35, in Figure 7, demonstrat‐ the Av-CNPs ing wereoutstanding stability able to produce at least a clear a month control afterday line until preparation. 35, demonstrating outstanding stability at least a month after preparation. Figure 7. (A) The stability and repeatability study of the strips based on Av-CNP, performed with the control line for 35 days. The signal values for the relative areas are also shown in (B). (C) The plot of the signal intensities along with times of Figure 7. days, up to 35 (A) The stability while and repeatability the mean study intensities’ value of the signal of the stripsareas based is on Av‐CNP, displayed inperformed withbar (D). The error theshows control theline for 35 standard days. The signal values deviation for n = 14. for the relative areas are also shown in (B). (C) The plot of the signal intensities along with times of up to 35 days, while the mean value of the signal intensities’ areas is displayed in (D). The error bar shows the standard deviation for n = 14. 4. Conclusions In this paper, the conjugation of avidin to carbon black nanoparticles and the design of 4.LFAs Conclusions for the detection of PCR products are presented in order to compare the performance In this paper, of Av-CNP to the the conjugation well-known of avidin to commercial carbon gold black nanoparticles nanoparticles in optimaland the design conditions for both of LFAscases. for the detection of PCR products are presented in order to compare the perfor‐ manceThe of results Av‐CNP of to thethe TEM characterization well‐known of the gold commercial CNPsnanoparticles revealed the in existence optimalofcondi‐ aggre- gates and some primary tions for both cases. particles following sonication. The sonication is necessary in order to dissolve the particles. The conjugated CNPs showed good sensitivity and specificity for biotinylated am- plicons, as confirmed also by the control line using an adsorbed biotinylated protein. Moreover, the conjugated CNPs showed non-detectable non-specific adsorption, since no signal was observed in the negative test, as in the case of the commercial streptAv-AuNP. The performance of Av-CNPs in this LFA format reveals promising features for use in other applications, enabling a rapid visual readout at an impressive LOD. The comparative results of Av-CNPs and the commercial streptAv-AuNPs indicated improved LODs for Av-CNPs under the experimental conditions of this work, which can be attributed to the higher signal background contrasts, considering the intensity of the black color. All these features make the CNPs an attractive option to work with and to improve the sensitivity, cost, and simplicity of lateral flow tests. Supplementary Materials: The following are available online at https://www.mdpi.com/2079-499 1/11/3/741/s1, Figure S1: The four transmission Electron Microscopy images used to perform the histogram shown in Figure 3. Nanomaterials 2021, 11, 741 10 of 11 Author Contributions: M.I.P. conceived of the presented idea. J.C.P. verified the analytical methods. M.I.P. and M.M. encouraged J.C.P. to investigate and supervised the findings of this work. All authors discussed the results and contributed to the final manuscript. J.C.P., M.B., J.M., and A.P.-R. carried out the experiment. J.M. created the graphics and figures. M.I.P. wrote the manuscript with support from all the authors. All authors have read and agreed to the published version of the manuscript. Funding: This research was funded by the Ministry of Economy and Competitiveness (MINECO) Madrid (Project BIO2016-75751-R) and the Ministry of Science and Innovation (Project PID2019- 106625RB-I00). Data Availability Statement: No new data were created or analyzed in this study. Data sharing is not applicable to this article. Conflicts of Interest: The authors declare no conflict of interest. References 1. Mabey, D.; Peeling, R.W.; Ustianowski, A.; Perkins, M.D. Diagnostics for the developing world. Nat. Rev. Microbiol. 2004, 2, 231–240. [CrossRef] 2. Land, K.J.; Boeras, D.I.; Chen, X.S.; Ramsay, A.R.; Peeling, R.W. REASSURED diagnostics to inform disease control strategies, strengthen health systems and improve patient outcomes. Nat. Microbiol. 2019, 4, 46–54. [CrossRef] [PubMed] 3. Rosen S Market. Trends in Lateral Flow Immunoassays. In Lateral Flow Immunoassay; Wong, R., Tse, H., Eds.; Humana Press: Totowa, NJ, USA, 2009. 4. Bishop, J.D.; Hsieh, H.V.; Gasperino, D.J.; Weigl, B.H. Sensitivity enhancement in lateral flow assays: A systems perspective. Lab Chip. 2019, 19, 2486–2499. [CrossRef] [PubMed] 5. Liu, L.; Yang, D.; Liu, G. Signal amplification strategies for paper-based analytical devices. Biosens. Bioelectron. 2019, 136, 60–75. [CrossRef] [PubMed] 6. Foubert, A.; Beloglazova, N.V.; De Saeger, S. Comparative study of colloidal gold and quantum dots as labels for multiplex screening tests for multi-mycotoxin detection. Anal. Chim. Acta 2017, 955, 48–57. [CrossRef] [PubMed] 7. Suryoprabowo, S.; Liu, L.; Kuang, H.; Cui, G.; Xu, C. Fluorescence based immunochromatographic sensor for rapid and sensitive detection of tadalafil and comparison with a gold lateral flow immunoassay. Food Chem. 2021, 342, 128255. [CrossRef] [PubMed] 8. Roda, A.; Cavalera, S.; Di Nardo, F.; Calabria, D.; Rosati, S.; Simoni, P.; Colitti, B.; Baggiani, C.; Roda, M.; Anfossi, L. Dual lateral flow optical/chemiluminescence immunosensors for the rapid detection of salivary and serum IgA in patients with COVID-19 disease. Biosens. Bioelectron. 2021, 172, 112765. [CrossRef] [PubMed] 9. Park, J.-M.; Jung, H.-W.; Chang, Y.W.; Kim, H.-S.; Kang, M.-J.; Pyun, J.-C. Chemiluminescence lateral flow immunoassay based on Pt nanoparticle with peroxidase activity. Anal. Chim. Acta 2015, 853, 360–367. [CrossRef] 10. Wei, D.; Zhang, X.; Chen, B.; Zeng, K. Using bimetallic Au@Pt nanozymes as a visual tag and as an enzyme mimic in enhanced sensitive lateral-flow immunoassays: Application for the detection of streptomycin. Anal. Chim. Acta 2020, 1126, 106–113. [CrossRef] 11. Martiskainen, I.; Talha, S.M.; Vuorenpää, K.; Salminen, T.; Juntunen, E.; Chattopadhyay, S.; Kumar, D.; Vuorinen, T.; Pettersson, K.; Khanna, N.; et al. Upconverting nanoparticle reporter-based highly sensitive rapid lateral flow immunoassay for hepatitis B virus surface antigen. Anal. Bioanal. Chem. 2021, 413, 967–978. [CrossRef] 12. Matsumura, Y.; Enomoto, Y.; Takahashi, M.; Maenosono, S. Metal (Au, Pt) Nanoparticle-Latex Nanocomposites as Probes for Immunochromatographic Test Strips with Enhanced Sensitivity. ACS Appl. Mater. Interfaces 2018, 10, 31977–31987. [CrossRef] [PubMed] 13. Wang, M.-J.; Gray, C.A.; Reznek, S.A.; Mahmud, K.; Kutsovsky, Y. Kirk-Othmer Encyclopedia of Chemical Technology; John Wiley & Sons, Inc.: Hoboken, NJ, USA, 2003. 14. Wissler, M. Graphite and carbon powders for electrochemical applications. J. Power Sources 2006, 156, 142–150. [CrossRef] 15. Ban, S.; Malek, K.; Huang, C.; Liu, Z. A molecular model for carbon black primary particles with internal nanoporosity. Carbon 2011, 49, 3362–3370. [CrossRef] 16. Ungár, T.; Gubicza, J.; Ribárik, G.; Pantea, C.; Zerda, T.W. Microstructure of carbon blacks determined by X-ray diffraction profile analysis. Carbon 2002, 40, 929–937. [CrossRef] 17. Fan, C.; Liu, Y.; Zhu, J.; Wang, L.; Chen, X.; Zhang, S.; Song, H.; Jia, D. Understanding the structural transformation of carbon black from solid spheres to hollow polyhedra during high temperature treatment. RSC Adv. 2019, 9, 29779–29783. [CrossRef] 18. Jawhari, T.; Roid, A.; Casado, J. Raman spectroscopic characterization of some commercially available carbon black materials. Carbon 1995, 33, 1561–1565. [CrossRef] 19. Pividori, M.I.; Merkoçi, A.; Alegret, S. Graphite-epoxy composites as a new transducing material for electrochemical genosensing. Biosens. Bioelectron. 2003, 19, 473–484. [CrossRef] 20. Van Amerongen, A.; Wichers, J.H.; Berendsen, L.B.; Timmermans, A.J.; Keizer, G.D.; van Doorn, A.W.; Bantjes, A.; van Gelder, W.M. Colloidal carbon particles as a new label for rapid immunochemical test methods: Quantitative computer image analysis of results. J. Biotechnol. 1993, 30, 185–195. [CrossRef] Nanomaterials 2021, 11, 741 11 of 11 21. Posthuma-Trumpie, G.A.; Korf, J.; Van Amerongen, A. Lateral flow (immuno) assay: Its strengths, weaknesses, opportunities and threats. A literature survey. Anal. Bioanal. Chem. 2009, 393, 569–582. [CrossRef] 22. Posthuma-Trumpie, G.A.; Korf, J.; Van Amerongen, A. Development of a competitive lateral flow immunoassay for progesterone: Influence of coating conjugates and buffer components. Anal. Bioanal. Chem. 2008, 392, 1215–1223. [CrossRef] [PubMed] 23. Pividori, M.I.; Alegret, S. Graphite-epoxy platforms for electrochemical genosensing. Anal. Lett. 2003, 36, 1669–1695. [CrossRef] 24. Pividori, M.I.; Alegret, S. DNA adsorption on carbonaceous materials. In Immobilisation of DNA on Chips I; Wittmann, C., Ed.; Springer: Berlin, Germany, 2005; pp. 1–36. 25. Noguera, P.; Posthuma-Trumpie, G.A.; van Tuil, M.; van der Wal, F.J.; de Boer, A.; Moers, A.P.; van Amerongen, A. Carbon nanoparticles in lateral flow methods to detect genes encoding virulence factors of Shiga toxin-producing Escherichia coli. Anal. Bioanal. Chem. 2011, 399, 831–838. [CrossRef] 26. Oliveira-Rodríguez, M.; Serrano-Pertierra, E.; García, A.C.; Martín, S.L.; Mo, M.Y.; Cernuda-Morollón, E.; Blanco-López, M.C. Point-of-care detection of extracellular vesicles: Sensitivity optimization and multiple-target detection. Biosens. Bioelectron. 2017, 87, 38–45. [CrossRef] [PubMed] 27. Linares, E.M.; Kubota, L.T.; Michaelis, J.; Thalhammer, S. Enhancement of the detection limit for lateral flow immunoassays: Evaluation and comparison of bioconjugates. J. Immunol. Methods 2012, 375, 264–270. [CrossRef] [PubMed] 28. Posthuma-Trumpie, G.A.; Wichers, J.H.; Koets, M.; Berendsen, L.B.; Van Amerongen, A. Amorphous carbon nanoparticles: A versatile label for rapid diagnostic (immuno)assays. Anal. Bioanal. Chem. 2012, 402, 593–600. [CrossRef] [PubMed] 29. Lermo, A.; Campoy, S.; Barbe, J.; Hernandez, S.; Alegret, S.; Pividori, M.I. In situ DNA amplification with magnetic primers for the electrochemical detection of food pathogens. Biosens. Bioelectron. 2007, 22, 2010–2017. [CrossRef] [PubMed] 30. Lermo, A.; Zacco, E.; Barak, J.; Delwiche, M.; Campoy, S.; Barbe, J.; Alegret, S.; Pividori, M.I. Towards Q-PCR of pathogenic bacteria with improved electrochemical double-tagged genosensing detection. Biosens. Bioelectron. 2008, 23, 1805–1811. [CrossRef] [PubMed] 31. Ben Aissa, A.; Jara, J.J.; Sebastián, R.M.; Vallribera, A.; Campoy, S.; Pividori, M.I. Comparing nucleic acid lateral flow and electrochemical genosensing for the simultaneous detection of foodborne pathogens. Biosens. Bioelectron. 2017, 88, 265–272. [CrossRef] 32. Vidal, L.; Ben Aissa, A.; Salabert, J.; Jara, J.J.; Vallribera, A.; Pividori, M.I.; Sebastián, R.M. Biotinylated phosphorus dendrimers as control line in nucleic acid lateral flow tests. Biomacromolecules 2020, 21, 1315–1323. [CrossRef]