Review Delivery of oligonucleotide-based therapeutics: challenges and opportunities Suzan M Hammond1,† , Annemieke Aartsma-Rus2 , Sandra Alves3 , Sven E Borgos4 , Ronald A M Buijsen2 , Rob W J Collin5 , Giuseppina Covello6,7 , Michela A Denti7 , Lourdes R Desviat8,† , Lucıa Echevarrıa9,† , Camilla Foged10,† , Gisela Gaina11,12 , Alejandro Garanto5,13,† , Aurelie T Goyenvalle14,† , Magdalena Guzowska15,†, Irina Holodnuka16 , David R Jones17, Sabine Krause18 , Taavi Lehto19,20,† , Marisol Montolio21,22 , Willeke Van Roon-Mom2,† & Virginia Arechavala-Gomeza23,24,*,† Abstract discuss important safety considerations and regulatory require- ments for synthetic oligonucleotide chemistries and the hurdles for Nucleic acid-based therapeutics that regulate gene expression have translating laboratory breakthroughs to the clinic. Recent advances been developed towards clinical use at a steady pace for several in the delivery of nucleic acid-based therapeutics and in the devel- decades, but in recent years the field has been accelerating. To opment of model systems, as well as safety considerations and date, there are 11 marketed products based on antisense oligonu- regulatory requirements for synthetic oligonucleotide chemistries cleotides, aptamers and small interfering RNAs, and many others are discussed in this review on oligonucleotide-based therapeutics. are in the pipeline for both academia and industry. A major tech- nology trigger for this development has been progress in oligonu- Keywords delivery; oligonucleotides; preclinical models; RNA therapeutics; cleotide chemistry to improve the drug properties and reduce cost safety of goods, but the main hurdle for the application to a wider range Subject Categories Biotechnology & Synthetic Biology; Pharmacology & of disorders is delivery to target tissues. The adoption of delivery Drug Discovery; RNA Biology technologies, such as conjugates or nanoparticles, has been a game DOI 10.15252/emmm.202013243 | Received 6 August 2020 | Revised 27 changer for many therapeutic indications, but many others are still November 2020 | Accepted 30 November 2020 awaiting their eureka moment. Here, we cover the variety of meth- EMBO Mol Med (2021) 13: e13243 ods developed to deliver nucleic acid-based therapeutics across biological barriers and the model systems used to test them. We See the Glossary for abbreviations used in this article. 1 Department of Paediatrics, University of Oxford, Oxford, UK 2 Department of Human Genetics, Leiden University Medical Center, Leiden, The Netherlands 3 Department of Human Genetics, Research and Development Unit, National Health Institute Doutor Ricardo Jorge, Porto, Portugal 4 Department of Biotechnology and Nanomedicine, SINTEF AS, Trondheim, Norway 5 Department of Human Genetics and Donders Institute for Brain, Cognition and Behaviour, Radboud University Medical Center, Nijmegen, The Netherlands 6 Department of Biology, University of Padova, Padova, Italy 7 Department of Cellular, Computational and Integrative Biology - CIBIO, University of Trento, Trento, Italy 8 Centro de Biologıa Molecular Severo Ochoa UAM-CSIC, CIBERER, IdiPaz, Universidad Autonoma de Madrid, Madrid, Spain 9 SQY Therapeutics, Montigny-le-Bretonneux, France 10 Department of Pharmacy, Faculty of Health and Medical Sciences, University of Copenhagen, Copenhagen Ø, Denmark 11 Victor Babes National Institute of Pathology, Bucharest, Romania 12 Department of Biochemistry and Molecular Biology, University of Bucharest, Bucharest, Romania 13 Department of Pediatrics, Radboud University Medical Center, Nijmegen, The Netherlands 14 Universite Paris-Saclay, UVSQ, Inserm, END-ICAP, Versailles, France 15 Department of Physiological Sciences, Faculty of Veterinary Medicine, Warsaw University of Life Sciences – SGGW, Warsaw, Poland 16 Institute of Microbiology and Virology, Riga Stradins University, Riga, Latvia 17 MHRA 10 South Colonnade, London, UK 18 Department of Neurology, Friedrich-Baur-Institute, Ludwig-Maximilians-University of Munich, Munich, Germany 19 Institute of Technology, University of Tartu, Tartu, Estonia 20 Division of Biomolecular and Cellular Medicine, Department of Laboratory Medicine, Karolinska Institutet, Huddinge, Sweden 21 Duchenne Parent Project Espan ~a, Madrid, Spain 22 Department of Cell Biology, Fisiology and Immunology, Faculty of Biology, University of Barcelona, Barcelona, Spain 23 Neuromuscular Disorders Group, Biocruces Bizkaia Health Research Institute, Barakaldo, Spain 24 Ikerbasque, Basque Foundation for Science, Bilbao, Spain *Corresponding author. Tel: +34 946007967; E-mail: virginia.arechavalagomeza@osakidetza.eus † Middle authors are listed in alphabetical order, particularly engaged authors are highlighted with the symbol. ª 2021 The Authors. Published under the terms of the CC BY 4.0 license EMBO Molecular Medicine 13: e13243 | 2021 1 of 23 EMBO Molecular Medicine Suzan M Hammond et al Glossary Anti-drug antibodies (ADAs) Lipid nanoparticles (LNPs) Antibody-mediated immunogenicity elicited in vivo to a given Delivery systems based on LNPs are composed of one or drug. Drug-specific antibodies can reduce the efficacy of the several lipid components, often an ionisable cationic lipid used treatment and even fully inactivate the drug, and/or they can for complexation of polyanionic DNA/RNA and stabilising induce adverse effects. helper lipids such as distearoylphosphatidylcholine (DSPC) and Antisense oligonucleotides (ASOs) cholesterol. In addition, LNPs may be stabilised sterically by Single-stranded oligonucleotides complementary to RNA target surface coating with polyethylene glycol (PEG). LNPs have a sequences. complex internal lipid architecture that is well suited for Aptamers stable and efficient encapsulation of DNA/RNA cargoes. Single-stranded oligonucleotides (20-100 nucleotides) which MicroRNAs (miRNAs) adopt three-dimensional structures that allow them to bind Small noncoding RNAs (  22 nt), which regulate gene very specifically to protein target sites. expression at the post-transcriptional level by degrading target Blood–brain barrier (BBB) and blood–spinal cord barrier (BSCB) mRNAs, when complementary to the sequence, or inhibiting Selectively permeable membranes of the central nervous their translation when not fully complementary. Each miRNA system (CNS) vasculature. Only small molecules (molecular can influence the expression of hundreds of mRNAs. weight below 400-500 Da) and high lipid solubility (logP Pharmacodynamics (PD) value of approximately 2.1) can cross these vascular barriers. The relationship between the drug concentration at the site of Generally, oligonucleotides display a molecular weight of action and the observed biochemical response and its efficacy. approximately 10 kDa and are hydrophilic; hence, they are Pharmacokinetics (PK) too large and hydrophilic to cross biological barriers by The time course of drug absorption, distribution, metabolism, passive diffusion. excretion and toxicity (ADMET), as well as the liberation of a Cell-penetrating peptides (CPPs) drug from its formulation. Short cationic and/or amphipathic peptides (usually less Phosphorodiamidate morpholino oligonucleotides (PMOs) than 30 amino acids) capable of translocating different Oligonucleotides containing uncharged chemistry. The nucleic types of cargoes across biological barriers and cell acid backbone has been replaced with 6-membered membranes. CPPs can be directly conjugated to morpholino rings and phosphorodiamidate linkages, while oligonucleotides (ONs) or used to encapsulate ONs into retaining standard nucleobases. nanoparticles. Peptide nucleic acid (PNA) European Medicines Agency (EMA) Uncharged oligonucleotide chemistry with amide bond Agency of the European Union in charge of the evaluation and linkages between the nucleobases. PNAs are manufactured by supervision of medicinal products. The EMA facilitates peptide synthesis. development and access to medicines, evaluates applications RNAse H cleavage for marketing authorisation and monitors the safety of human RNAse H hydrolyses the phosphodiester bonds of RNA when and veterinary medicines. hybridised to DNA. Food and Drug Administration (FDA) Small interfering RNA (siRNA) The federal agency of the United States Department of Health Double-stranded RNA (~21 nt) composed of a guide strand and Human Services, responsible for protecting public health complementary to the target mRNA and a passenger strand. by ensuring the safety, efficacy and security of human and siRNAs act within the endogenous RNA-induced silencing veterinary drugs. complex (RISC) to degrade mRNA. Gapmer Toll-like receptors (TLRs) Chimeric antisense oligonucleotides (ASOs) that contain a Pattern-recognition receptors usually found on the plasma or central block of DNA nucleotides, flanked by modified endosomal membranes of sentinel cells such as macrophages sequences, usually containing 20 -O-modified or locked nucleic and dendritic cells (DCs). Activation of TLRs can promote an acid (LNA) chemistries. Gapmers are used for gene silencing inflammatory response. For example, TLR9 is activated by by stimulating RNA cleavage through the recruitment of unmethylated cytidine-phosphate-guanosine (CpG) RNase H. dinucleotides present in bacterial and viral DNA. Introduction approval by the US Food and Drug Administration (FDA), the Euro- pean Medicines Agency (EMA) and/or the Japanese Ministry of Synthetic oligonucleotides (ONs) are small, single- or double- Health, Labour and Welfare. However, further therapeutic develop- stranded pieces of modified nucleic acids that have been exploited ment is challenged by unfavourable absorption, distribution, meta- as therapeutic modalities in different ways (Table 1). The unique bolism, excretion and toxicity (ADMET) properties for most clinical characteristic of ONs is that they bind to their target via Watson– applications (Godfrey et al, 2017). This review mainly focuses on Crick base pairing, enabling intervention at a genetic level by target- the development of single-stranded ONs and covers (i) the numer- ing RNA in a specific manner (Zamecnik & Stephenson, 1978). ONs ous methods developed to date to deliver ONs across biological encompass many types of nucleic acid-based therapeutics, including barriers, (ii) the model systems used to test ONs and (iii) the antisense oligonucleotides (ASOs), small interfering RNA (siRNA), hurdles existing for translating laboratory breakthroughs to the anti-miRNA (antagomirs), miRNA mimics (agomirs), aptamers and clinic. The content represents the joint efforts of members of the EU unmethylated CpG-containing ONs. Depending on their mechanism Cooperation of Science and Technology (COST) network Delivery of of action, treatment with therapeutic nucleic acids may cause RNA Therapeutics (DARTER, COST Action 17103, www.antisense decreased, increased or restored protein expression. Currently, 11 rna.eu), which aims to facilitate RNA-targeting nucleic acid-based ON-based drugs across many disease areas have received regulatory drugs to reach their full potential. 2 of 23 EMBO Molecular Medicine 13: e13243 | 2021 ª 2021 The Authors Suzan M Hammond et al EMBO Molecular Medicine Table 1. Mechanisms of action of therapeutic oligonucleotides. Chemistry dictates the drug properties of oligonucleotides Modality Mechanism Example(s) RNase H RNase H-mediated cleavage of Gapmers Therapeutic nucleic acids are chemically modified in several ways target transcript to endow them with properties such as increased resistance to Steric Interference with post- 2nd and 3rd nucleases and improved target binding affinity (Jarver et al, 2014) Blockage transcriptional RNA-binding generation ASOs and (Fig 1). Each modification confers the ON different properties, and elements, e.g. splicing modulation antagomirs some may be combined, but other modifications are not compatible and blocking endogenous miRNA or may modify the ON in ways that complicate their synthesis or Protein Bind target proteins in a structure- Aptamer interfere with the mechanisms by which they exert their effect. Binding specific manner First-generation chemistries include the widely used phosphate Innate Inhibits protein expression via Unmethylated backbone modifications, e.g. phosphorothioate (PS), which imparts Immunity target-specific mRNA CpG-containing ONs resistance to endonucleases and improves bioavailability by reduc- degradation ing renal clearance due to increased affinity for serum proteins (Eck- RNAi Inhibition of gene expression via siRNAs, microRNAs stein, 2014). However, this modification also reduces the affinity for target-specific mRNA degradation the target RNA. Second-generation chemistries include ribose Backbone chemistry Ribose modifications or 2'-ribose substitutions PS modifications provide greater resistance and improved bioavailability Increase the binding affinity to RNA and further improve the nuclease resistance but reduce the affinity for target RNA O PS O PO O 2'-OMe O 2'-MOE O 2'-F – Stereoisomers – – – – S P O S and P O P O O P O O P O O P O Chiral O O O O O centre O O O O NB NB O NB NB NB H/OH H/OH O O F O O O O O O CH3 2'-ribose substitutions O O P O– RNA Conformationally constrained analogues Alternative chemistries Modify the ON charge and flexibility O Modify the ON charge and flexibility O NB O cEt O LNA PNA PMO NH O O P O– O P O– O OH O NB O O NB O NB O NB N N tcDNA O O O P N O P O– O NH O O O O O O O NB NB N O N O O © EMBO NB NH O Figure 1. Oligonucleotide chemistries. Commonly used nucleic acid chemistries. The often used phophorothioate (PS) backbone replaces the natural phosphodiester (PO). Modifications to the ribose at the 2ʹ-O position of RNA and 2ʹ-position of DNA include the 2ʹ-O-methyl (2ʹ-OMe), 2ʹ-O-methoxy-ethyl (2ʹ-MOE) and 2ʹ-fluoro (2ʹ-F) are the most commonly used. Conformationally constrained DNA analogues, locked nucleic acid (LNA), constrained 20 -O-ethyl (cEt) and tricyclo-DNA (tcDNA), provide greater binding affinity. LNA and cEt are constrained by a methyl bridged from the 20 -O and 40 position of the ribose. tcDNA introduces of an ethylene bridge with a cyclopropane ring between the 30 and 50 carbon positions of ribose. Alternative chemistries include changes in the nucleobase, e.g. phosphorodiamidate morpholino oligomers (PMO) and peptide nucleic acid (PNA). ª 2021 The Authors EMBO Molecular Medicine 13: e13243 | 2021 3 of 23 EMBO Molecular Medicine Suzan M Hammond et al modifications at the 20 -O position of RNA and 20 position of DNA, of (Summerton & Weller, 1997) and peptide nucleic acid (PNA) which the 2ʹ-O-methyl (2ʹ-OMe), 2ʹ-O-methoxy-ethyl (2ʹ-MOE) and (Nielsen et al, 1991; Hanvey et al, 1992). For PMOs, the nucleic acid 2ʹ-fluoro (2ʹ-F) modifications are the most commonly used types. backbone has been replaced with a 6-membered morpholino ring These modifications increase the binding affinity to RNA and further and phosphorodiamidate linkages, while retaining standard nucle- improve the nuclease resistance. An even greater binding affinity obases. The nucleobases of PNAs are linked by amide bonds, which chemistry is the conformationally constrained DNA analogues are synthesised similarly to peptides. Both PMO and PNA are locked nucleic acid (LNA) and tricyclo-DNA (tcDNA). LNA contains uncharged, very resistant to nucleases, and display variable affinity a methyl bridge between the 20 -O and 40 position of the ribose ring for the target RNA (Smulevitch et al, 1996; Summerton & Weller, (Koshkin et al, 1998; Obika et al, 1998). The backbone considerably 1997). The choice of chemical modifications is largely dictated by changed for tcDNA via introduction of an ethylene bridge with a the modality and the target tissue. cyclopropane ring between the ribose 3’ and 5’ carbon positions Single-stranded ASOs complementary to target RNA were first (Renneberg & Leumann, 2002). The bridge imposes a locked confor- utilised therapeutically by exploiting RNase H cleavage of DNA/ mation on the ribose ring, which is ideal for binding to RNA. All RNA hybrids (Stein & Hausen, 1969; Wu et al, 2004) (Fig 2). RNase first- and second-generation chemistries are compatible with nucleic H-inducible ASOs are designed as gapmers, where central DNA acid synthesis and can easily be mixed with DNA and RNA in ON nucleotides are flanked by RNase H-resistant modified nucleotides chimeras. Third-generation chemistries include changes in the (Wahlestedt et al, 2000). The modified sequences improve target nucleobase, e.g. phosphorodiamidate morpholino oligomers (PMO) affinity while the central DNA sequence forms the DNA/RNA hybrid Cellular uptake ON Gapmer siRNA Aptamer 5 Agomir TLR 2 mRNA Unmethylated RISC ASO miRNA Antagomir 7 mRNA Protein CpG-containing function ON 1a alteration me o Ri b os 6 Innate RNase H immunity Steric block Translational RNase H-mediated inhibition cleavage in cytosol 8 RISC Translational 3 upregulation Gapmer pre-mRNA mRNA cleavage 1b SSO-induced 4 and degradation splicing modulation RNase H RNase H-mediated pre-mRNA cleavage in nucleus Repeat expansion © EMBO Block assembly of RNA-binding factors Figure 2. Mechanisms and location of action for oligonucleotides. Representative mechanisms of action and intracellular localisation for (1) gapmer and mRNA degradation, (2) aptamer, (3) nuclear steric blockage for splice switching, (4) blockage the assembly of RNA-binding factors, (5) TLR activation of innate immunity, (6) miRNA and antagomir, steric block, translational upregulation, (7) agomir, translational inhibition, and (8) siRNA, RISC, RNAi silencing ONs. 4 of 23 EMBO Molecular Medicine 13: e13243 | 2021 ª 2021 The Authors Suzan M Hammond et al EMBO Molecular Medicine for RNase H recognition and cleavage (Monia et al, 1993). Fully affinities to their receptor targets which are comparable to those of modified second- and third-generation ASO chemistries act through monoclonal antibodies (Jayasena, 1999). Unmethylated CpG- RNase H-independent mechanisms (Fig 2) (Jarver et al, 2014). containing ONs include a cytosine-guanine motif coupled with a Steric blocking ASOs can inhibit or activate translation through the phosphodiester (PO) or PS backbone. Unmethylated CpG motifs are binding to regulatory elements, e.g. upstream open reading frames commonly found in bacterial DNA and activate the immune system (Liang et al, 2016b; Liang et al, 2017). A common therapeutic through Toll-like receptor 9 (TLR9). Unmethylated CpG-containing modality is the modulation of pre-mRNA splicing (Arechavala- ONs have been tested clinically as vaccine adjuvants and for cancer Gomeza et al, 2014), which is used to induce or suppress exon immunotherapy (Krieg & Davis, 2001; Krieg, 2006, 2007). inclusion. In Duchenne muscular dystrophy (DMD) patients, ASO- induced exon skipping of mutated dystrophin pre-mRNA restores the reading frame and allows for the production of partially func- Delivery systems for oligonucleotides tional, rather than non-functional, dystrophin protein (Mitrpant et al, 2009). In contrast, for spinal muscular atrophy (SMA) patients, The sites of action for ONs lay within the intracellular space. Conse- ASOs increase the level of exon 7 inclusion in survival motor quently, they need to overcome several biological barriers to reach neuron 2 (SMN2) mRNA, leading to increased levels of SMN protein their pharmacological targets in vivo. PS-modified ONs bind rever- (Singh et al, 2006). Similarly, ASOs can also induce the skipping of sibly to plasma proteins, e.g. albumin, which increases their plasma pseudoexons (Collin et al, 2012) or block RNA-splicing factors from half-life and facilitates their distribution and accumulation in the recognising cryptic splice sites (Rivera-Barahona et al, 2015). ASOs liver, kidneys, spleen, lymph nodes and bone marrow (Geary, can also sterically block the union of RNA-binding factors to repeat 2009). Targeting tissues beyond these organs has had clinical expansion regions of pathogenic mRNAs (Fig 2). In myotonic success for local delivery to the eye, brain and spinal cord via dystrophy 1, expanded microsatellite repeats sequester RNA-binding intravitreal (IVT) and intrathecal (IT) administration, respectively factors within nuclear expansion RNA foci (Miller et al, 2000). ASOs (Hache et al, 2016; Cideciyan et al, 2019) (Fig 3). Both routes targeting the CUG repeat expansion mRNA release the sequestered bypass renal clearance and maintain high ON exposure to the cellu- RNA-binding factors and reverse the phenotype (Klein et al, 2019). lar microenvironment for efficient uptake. Additionally, significant RNA interference (RNAi)-based therapies, i.e. double-stranded advances for pulmonary delivery of RNA therapies have been exten- siRNA and single-stranded microRNA (miRNA), exploit the endoge- sively reviewed elsewhere (Chow et al, 2020; Shaffer, 2020). nous RNAi pathway in the cytosol (Fire et al, 1998) to silence or However, systemic administration of ONs has been less successful modulate the expression of specific proteins (Fig 2). Commonly due to poor tissue uptake. Cellular uptake of ONs occurs predomi- used chemical modifications for siRNA, including 2ʹ-OMe and 2ʹ-F nantly via different types of endocytosis. ONs are subsequently traf- modifications, decrease RNase recognition and are well tolerated ficked into the endolysosomal system, from where they need to throughout the entire siRNA duplex (Watts et al, 2008). In addition, escape to avoid degradation in the lysosomal environment (Crooke these modifications are widely used to decrease immune stimulation et al, 2017). Only a very small ON dose fraction escapes the endo- (Judge et al, 2006). ASOs can influence miRNA function, either by somes and becomes available at the site of action (Gilleron et al, sequestering a miRNA (antagomir) or by generating a miRNA mimic 2013). Single-stranded ONs, such as PS ASOs, which are relatively (agomir). Notably, a single miRNA generally regulates the expres- small, uncharged and/or hydrophobic, can productively enter cells sion of multiple genes in a given pathway; hence, antagomirs and and escape the endosomes into the cytoplasm and nucleus without agomirs have the potential to mediate increased or decreased the need for a delivery agent (Liang et al, 2016a) in a process expression of multiple genes, respectively (Friedman et al, 2009). referred to as gymnosis (Stein et al, 2010), but relatively high ON Finally, two types of ONs which do not work through Watson–Crick doses are required for this process to take place. However, most of base pairing are aptamers and unmethylated CpG-containing ONs. RNA-based therapeutics, e.g. double-stranded siRNA, are too large Aptamers are single-stranded ONs (20–100 nucleotides) selected and charged to enter cells unassisted and require a delivery agent. from randomised libraries based on their high-avidity binding to Accelerating the rate of cellular uptake, intracellular trafficking and specific targets (Ellington & Szostak, 1990; Tuerk & Gold, 1990). endosomal escape has been a driving force behind advances in They adopt three-dimensional structures that bind to protein target many chemical modifications and delivery agents (Juliano et al, sites through attractive electrostatic interactions and pocket-like 2018; Biscans et al, 2020). A wide variety of delivery approaches structures (Ellington & Szostak, 1990), and they display binding improve the transport and bioavailability of ONs (Fig 4) (Roberts Figure 3. Delivery of oligonucleotides to the brain and eye. (A) ONs are prevented from passive diffusion into the central nervous system (CNS) by the vascular BBB. (B) ONs without a delivery reagent require direct administration into the brain or spinal cord. The most frequently used CNS administration route in humans is intrathecal (IT) administration, where ONs are administered into the ▸ subarachnoid space of the spinal cord to pass the pia mater and enter the parenchyma. This results in an immediate high ON concentration in the cerebral spinal fluid, meaning that a lower dose can be used, which reduces side effects. Also, the BBB prevents transport of ONs into the peripheral circulation resulting in long-lasting high ON concentrations. (C) The eye is a contained and immune-privileged organ of the CNS that allows local delivery. ONs are effective and well tolerated when administered directly by intravitreal injection. Subretinal delivery is also possible, but the treated area will be reduced. (D) Certain macromolecules can cross the vascular barriers via receptor-mediated endocytosis after systemic administration (Pardridge, 2007). The transferrin transport pathway has been exploited in several rodent studies to carry ONs into the brain parenchyma (Lee et al, 2002; Kozlu et al, 2014). Systemically delivered ONs covalently conjugated to arginine-rich CPPs have been shown to cross the BBB in mice (Du et al, 2011) and have been used for ON delivery in mouse models of SMA (Hammond et al, 2016). Several studies have shown exosome-mediated delivery of small RNAs across the vascular barriers into the CNS (Alvarez-Erviti et al, 2011; Yang et al, 2017). (E) Drugs dosed by intranasal administration can be transported into the brain along the olfactory, trigeminal nerve and rostral migratory stream (Curtis et al, 2007). ª 2021 The Authors EMBO Molecular Medicine 13: e13243 | 2021 5 of 23 EMBO Molecular Medicine Suzan M Hammond et al RVG CD9 Capillary lumen Astrocytic feet CP TJs P Capillary 2 CPP 3 lumen 1 EC Pericyte Brain parenchyma A Outline of the blood brain barrier (BBB) D 1 | Receptor-mediated passage of the BBB The BBB surrounding the capillaries is made up Macromolecules can cross the vascular of endothelial cells (EC) forming tight junctions barriers of the BBB via receptor-mediated (TJs, purple), pericytes (blue) embedded into the endocytosis. The transferrin transport basement membrane and astrocytic feet (grey). pathway is one example whereby transferrin receptor-targeting nanoparticles ONs are too large to passively cross the BBB. or antibodies are combined with ONs. 2 | CPP-mediated crossing of the BBB CPPs can carry a wide range of Direct administration into the brain Intraventricular (ICV) B molecules and use different cellular and spinal cord circumvents the BBB and translocation pathways, depending on results in immediate high drug concentrations the cell type and the cargo. Systemically in the cerebral spinal fluid, meaning that a administered ONs conjugated to lower dose can be used eventually increasing arginine-rich CPPs crossed the BBB of safety. Also, the BBB prevents transport of the adult mice and have been used for ON ONs into the peripheral circulation resulting in delivery in mouse models of SMA. long-lasting high drug concentrations. 3 | Exosome-mediated crossing of the BBB lntraventricular (ICV) Exosomes are naturally forming hetero- By ICV injection, drugs are directly adminis- geneous extracellular vesicles. High tered into the cerebrospinal fluid in cerebral expression of tetraspanin CD9 on the ventricles. surface of exosomes facilitated direct lntrathecal (IT) membrane fusion, and exosomes modified The most frequently used route of administra- to display rabies virus glycoprotein (RVG) tion in humans is IT delivery whereby ONs are on the surface enhanced delivery across administered into the subarachnoid space of the BBB for effective ON delivery. the spinal cord to pass the pia mater and enter the parenchyma. Via olfactory bulb Intravitreal L. propria Subretinal C Direct administration to the eye The eye is part of the CNS and is a model Intrathecal (IT) organ for therapeutics due to the fact that it is contained, immune-privileged and Intranasal easily accessible. The most frequently used Nasal cavity administration methods are: lntravitreal administration consists of delivering the therapeutic molecule to the E Intranasal ON transport to the CNS humor vitreous allowing the targeting of a occurs intracellularly via the olfactory or significant proportion of the retina. This is trigeminal nerves. Molecules can also be the preferred option to administer relatively transported intercellularly through the small molecules like ONs. lamina propria, the perineural space and ultimately the subarachnoid space. Subretinal administration is performed by administrating the therapeutic molecule Intranasal delivery has the advantages of between the photoreceptor cell layer and circumventing the BBB and minimum the retinal pigment epithelium. By using drug-related side effects. this technique, only part of the retina is However, the nasal epithelium is covered by © EMBO targeted, and it is currently used to deliver a mucus layer, which entraps and clears viral-based therapies such as voretigene particles. Furthermore, several metabolising neparvovec-rzyl. enzymes are present in the nasal cavity. Figure 3. 6 of 23 EMBO Molecular Medicine 13: e13243 | 2021 ª 2021 The Authors Suzan M Hammond et al EMBO Molecular Medicine CHEMICAL CONJUGATES CARRIER-BASED • CPPs are only compatible with uncharged ONs, e.g. PNA and PMO • Compatible with negatively charged ONs • Fatty acids and GalNAc are compatible with all types of ONs • Heterogeneity of formulation • Conjugates display defined stoichiometry • Delivery of plasmid DNA, mRNA, siRNA, and CRISPR/Cas9 ribonucleoproteins • Not applicable for plasmid DNA and mRNA delivery • Reduced need for chemical stabilisation of the charge • Full chemical modification required Passively targeted Lipid nanoparticles (LNPs) Fatty acids Cell-penetrating peptides (CPPs) Lipid polymer NPs Ionisable LNPs CPP Linker Cholesterol | C27H46O HO HO O Tocopherol | C29H50O Polyethylene glycol (PEG) Peptide complexes O H H O Therapeutic n oligonucleotide Actively targeted Antibodies Specific ligands Glucagon-like peptide-1 (Glucagon-like peptide-1 receptor) Linker Polymer-based GLP1 Polyphosphazenes Dendrimers GLP-1R Aptamers R Linker P N Trimeric GalNAc (Asialoglycoprotein receptor) R n GalNAc ASGR © EMBO Figure 4. Delivery technologies for oligonucleotides. Delivery technologies used to improve the ADMET properties of ONs, including chemical conjugates (left) and nanoparticulate carriers (right). Polymers, cell-penetrating peptides (CPPs) and lipids represent examples of molecules used for covalent conjugation to ONs for passive targeting, whereas covalent conjugation of ONs to antibodies, receptor ligands and aptamers are applied for active targeting. Drug conjugates display a defined stoichiometry. CPP conjugation is only compatible with uncharged ONs, e.g. PMOs and PNAs, whereas lipids and GalNAc are compatible with all types of ONs. Nanoparticulate carriers can be used to encapsulate negatively charged ONs and can be based on lipids, e.g. lipid nanoparticles (LNPs) and exosomes, polymers, e.g. dendrimers, poly(lactide-co-glycolic acid) (PLGA) and polyphosphazenes, and peptides, or on hybrid systems composed of several different types of compounds. The complexity of these systems poses new challenges in the development with respect to cost, manufacturability, safety, quality assurance and quality control. et al, 2020). These include (i) direct conjugation to carriers and (ii) modification of ONs is needed to protect them from degradation. incorporation into nanoparticulate carriers, both with the aim of Polymers, peptides, lipids, receptor ligands and aptamers represent improving the ADMET properties. examples of molecules used for conjugation (Fig 4). Chemical conjugates Polymers Chemical conjugation of molecules to therapeutic ONs is an attrac- Covalent conjugation of polyethylene glycol (PEG) improves the tive strategy for improving ADMET properties. As chemical conju- ADMET properties of drugs. PEGylation has been applied mainly for gates, ONs are exposed to serum, and therefore, full chemical therapeutic proteins, but more recently also for ONs, e.g. the marketed ª 2021 The Authors EMBO Molecular Medicine 13: e13243 | 2021 7 of 23 EMBO Molecular Medicine Suzan M Hammond et al aptamer-PEG conjugate pegaptanib directed against vascular endothe- Perhaps the most successful tissue targeting ligand is trimeric N- lial growth factor (VEGF) (Ng et al, 2006). PEG is a highly flexible, acetyl galactosamine (GalNAc) (Lee et al, 1984). GalNAc binds to non-charged and hydrophilic polymer with end groups available for the asialoglycoprotein receptor (AGPR), which is abundantly functionalisation. PEG shields the conjugated drug cargo via formation expressed in the liver (Schwartz et al, 1980). This high affinity-bind- of a hydration shell, which sterically blocks other biomacromolecules ing ligand has been directly conjugated to ONs and siRNA and from binding to the drug. Also, PEGylation prolongs the circulation provides highly specific and effective delivery to hepatocytes (Mat- time by reducing renal excretion and increasing ON stability. The suda et al, 2015; Janas et al, 2018; Debacker et al, 2020). Another ADMET properties of PEGylated ONs are dependent on the physico- striking example is the glucagon-like peptide-1 (GLP1) receptor chemical properties of the PEG moiety, including the molecular (GLPR1) system for specific targeting of pancreatic b cells (Muller weight, the type of end group modification and the PEG architecture et al, 2019). Recent studies showed that GLP1-ON conjugates are (linear or branched). For example, pegaptanib contains a 40 kDa Y- specifically taken up by GLPR1-expressing cells in the pancreas, shaped PEG, which causes the aptamer binding affinity to decrease including isolated pancreatic islets, and induce strong accumulation fourfold compared with the parent aptamer, whereas the antiangio- and activity in pancreatic b cells in a ligand-dependent manner upon genic efficacy is increased, which is attributed to prolonged tissue resi- systemic delivery in mice (Ammala et al, 2018). dence time due to increased half-life (Ng et al, 2006). Antibodies Peptides A promising recent development in chemical conjugates is anti- Cell-penetrating peptides (CPPs) are short cationic and/or amphi- body–RNA conjugates (ARCs). ARCs typically include monoclonal pathic peptides, usually less than 30 amino acids long, capable of antibodies, or antibody fragments, with functional ONs, and they translocating different types of cargoes across biological barriers have been used for imaging and protein detection. However, anti- and cell membranes (Foged & Nielsen, 2008; Pooga & Langel, 2015; bodies can also be used as a delivery agent for therapeutic ONs. An Lehto et al, 2016). CPPs can be used as direct conjugates or to antibody fragment specific for the transferrin receptor, which is encapsulate oligonucleotides into nanoparticles, which is discussed involved in intracellular transport of iron-laden transferrin, has been further in the next section. Once inside the cells, CPPs may used to target siRNA towards skeletal and cardiac muscle tissues also improve endosomal escape (Cleal et al, 2013). However, the (Sugo et al, 2016). Companies are taking this technology forward cationic charge often restricts their covalent conjugation to charge- for diseases such as myotonic dystrophy and Duchenne muscular neutral ON chemistries (PNAs and PMOs) due to electrostatic disease. interactions between anionic ONs and cationic CPPs that result in aggregation. For systemic diseases, CPP-ONs circumvent cell-specific Aptamers receptors, allowing for pharmacological activity across multiple Aptamers have been shown to mediate delivery of therapeutic ONs tissues, and they have been developed for uptake into particularly as aptamer-ON conjugates, or within nanoparticle formulations impervious tissues, e.g. skeletal muscle, heart and CNS (Hammond (Catuogno et al, 2016; Soldevilla et al, 2018). The first aptamer- et al, 2016; Betts et al, 2019), as well as targeting viral and bacterial siRNA chimeras targeted prostate-specific membrane antigen- infections (Burrer et al, 2007; Geller et al, 2013; Geller et al, 2018). expressing cancer cells to deliver apoptosis-inducing siRNAs (McNa- At the time of this review, a phase I clinical trial for safety and mara et al, 2006). Further development of aptamer-ONs involved tolerability of an arginine-rich CPP-ASO conjugate for DMD (SRP- chemical modifications to protect the ONs from nuclease degrada- 5051) has been completed and a phase II is recruiting to determine tion and increase their plasma half-life. Aptamer-ONs have since the optimal dose. shown effective in vivo delivery of miRNAs, antagomirs, ASOs and bi-modular miRNA-antagomirs within preclinical cancer models Lipids (Catuogno et al, 2015; Esposito et al, 2016; Soldevilla et al, 2018). Conjugation of hydrophobic compounds such as cholesterol to ONs can improve delivery in vitro by promoting endosomal release Carrier-based delivery systems (Wang et al, 2019) and results in longer plasma half-life and accu- The pharmacological properties of carrier-based delivery systems mulation in the liver upon systemic administration (Osborn et al, are largely independent of the physicochemical properties of the ON 2019). Such modifications may enhance delivery, mainly to the cargo, and instead depend on the properties of the delivery system. liver, but also to peripheral tissues such as muscle (Prakash et al, Therefore, the desired properties can be built into them via formula- 2019), via passive targeting by increasing the binding affinity of tion design, resulting in multifunctional advanced drug delivery ONs to plasma proteins and/or via active targeting by hijacking systems. These delivery systems may serve (often simultaneously) endogenous lipid transport pathways (Osborn et al, 2019). many different purposes, including (i) protecting the ON cargo from premature degradation, (ii) increasing the effect duration and (iii) Receptor ligands enhancing the targeting. This improved targeting can either occur Tissue-specific active targeting may be achieved through conjuga- via passive or active targeting. Passive targeting exploits the tion of ONs to receptor ligands that facilitate specific binding to microanatomical features of tissues, for instance, tissues with receptors on the target cells and mediate tissue-specific delivery. A enhanced permeability and retention, or tissues with discontinuous/ wide variety of receptor ligands have been investigated, including fenestrated epithelium. For active targeting, delivery systems are carbohydrates, peptides/proteins, aptamers, antibodies/antibody decorated with active targeting ligands. Particulate carrier-based fragments and small molecules), and several feasible receptor-ligand delivery systems also facilitate intracellular delivery by enhancing systems have been identified. cellular uptake, intracellular trafficking and endosomal escape. In 8 of 23 EMBO Molecular Medicine 13: e13243 | 2021 ª 2021 The Authors Suzan M Hammond et al EMBO Molecular Medicine that way, the dose reaching non-target tissues and/or the toxicologi- Exosomes are particular lipid-based nanocarriers (Barile & cal targets may be reduced, whereas the dose reaching the pharmaco- Vassalli, 2017). These nanosized vesicles are shed from the cells, logical target may be increased. The net result is an improved drug encapsulating part of the cellular cytoplasm in the process (Pathan therapeutic index. The complexity of these systems leads to new chal- et al, 2019). They are remarkable in their biocompatibility and lenges in the development, for example with respect to cost, manu- potential for highly specific active targeting through surface display facturability, safety, quality assurance and quality control. of endogenous cellular ligands. The main challenges for using Reflecting the immense interest in delivery of therapeutic ONs, a exosomes as delivery systems are (i) reproducible, large-scale plethora of nanocarrier types have been investigated for delivery production and (ii) effective loading of drugs. Additionally, exosome purposes, such as gold nanoparticles (Ding et al, 2014; Morgan heterogeneity is caused by their natural content of proteins and et al, 2019), mesoporous silica (Steinbacher & Landry, 2014; Cha nucleic acids derived from the host cell (Willms et al, 2018; Jeppe- et al, 2017) and other inorganic nanocarriers (Malmsten, 2013). Yet, sen et al, 2019). This complicates their use as therapeutic delivery the current focus seems to be on lipid-, polymer- and peptide-based agents. The therapeutic promise of exosomes has been extensively delivery systems and hybrids of these, which are described further reviewed elsewhere (Wiklander et al, 2019). below (Fig 4). Polymer-based delivery systems Lipid-based delivery systems Although less clinically advanced, polymer-based systems are also The recent approval of patisiran (Table 3) (Suhr et al, 2015), interesting carriers for ON delivery, largely due to the chemical together with improvements in manufacturability brought about by flexibility of polymers, in particular synthetic polymers (Fig 4) the introduction of microfluidics, has reinforced interest in lipid- (Freitag & Wagner, 2020). Both monomer sequence and side/end based delivery systems to the scientific community and pharmaceu- group functionalities can be engineered. Additionally, polymeric tical industry. The term lipid nanoparticles (LNPs) is used generi- nanocarriers exhibit high structural integrity and stability during cally below to describe ON-loaded lipid-based delivery systems, storage. because the structural complexity of most lipid-based nanocarriers One polymer with high biocompatibility that has been studied complicates their further classification into, for example, liposomes and used extensively is the copolymer poly(lactic-co-glycolic acid) and solid lipid nanoparticles. (PLGA) (Rezvantalab et al, 2018). For small-molecule drugs, highly Cationic lipids entrap ONs via attractive electrostatic interactions efficient encapsulation in polymeric nanoparticles can be achieved, (Felgner et al, 1987), and highly efficient commercial in vitro trans- e.g. through miniemulsion-based synthesis, followed by in situ poly- fection reagents are based on cationic lipids. However, as systemic merisation (Fusser et al, 2019). However, due to their negative toxicity of cationic lipids is often dose-limiting for in vivo application, charge, anionic ONs cannot be encapsulated using this approach. ionisable lipids that are positively charged at low pH, e.g. during LNP Instead, encapsulation can be achieved through attractive electro- manufacture, and typically neutral at physiological pH, are favoured static interactions between the anionic ONs and polycationic poly- (Semple et al, 2001). Today, a vast number of ionisable lipids have mers. Dendrimers are hyperbranched polymers, which are well been developed covering a wide range of different structures. These suited for this purpose because they can complex many ON mole- include, among others, lipidoids (Akinc et al, 2008; Dong et al, 2014) cules. Several cationic polymers have been used, including poly and the ionisable lipid DLin-MC3-DMA (Jayaraman et al, 2012), (amidoamine), poly(propyleneimine) and poly(L-lysine) [reviewed which is considered the gold standard of ionisable cationic lipids. In by (Mignani et al, 2019)]. general, they display headgroups containing tertiary amines, which Among the synthetic polymers, polyphosphazenes are notable in are protonated under acidic conditions and uncharged at neutral pH. their high biocompatibility and chemical flexibility, and they have The hydrophobic lipid tails stabilise the LNP structure during forma- successfully been used to deliver therapeutic ONs (Peng et al, 2016; tion and in formulation via hydrophobic interactions. Hsu et al, 2020). Polyphosphazenes can be tailored to exhibit respon- Clinically approved patisiran contains DLin-MC3-DMA, helper sivity to external (bio)chemical stimuli (Teasdale, 2019), e.g. local lipids (Kulkarni et al, 2019) and PEG-lipid encapsulating siRNA pH. This allows for a targeted release of the cargo at the desired site directed against transthyretin (TTR) mRNA (Adams et al, 2018). of action. Complementing the use of synthetic polymers, there is The PEG lipid stabilises the LNPs during manufacturing and storage, long-standing interest in the use of naturally occurring biopolymers and it increases the circulation half-life. However, PEG lipids inhibit for ON encapsulation; the most notable example is the use of the cellular transfection; hence, they are designed to rapidly diffuse polycation chitosan, often in complex with another, anionic poly- from the LNPs after IV administration (Chen et al, 2016). The LNPs mer, e.g. PLGA (Taetz et al, 2009) or alginate (Lee & Mooney, 2012). are passively targeted to the liver (Shi et al, 2011), and the size of Recently, there has been significant interest in lipid–polymer the LNPs permits delivery through the fenestrated endothelium in hybrid nanoparticles (Thanki et al, 2017). These hybrids combine the liver to the underlying hepatocytes (Chen et al, 2016). In addi- desirable properties from both nanoparticle types, i.e. the serum tion, active hepatocyte targeting has been shown to occur via stability of PLGA-based matrix system with the biocompatibility surface adsorption of apolipoprotein E, which targets the LNPs to and high loading capacity of ONs in delivery systems based on the internalising low-density lipoprotein receptor expressed on cationic lipids. hepatocytes (Akinc et al, 2010; Chen et al, 2016). After cellular uptake, endosomal escape of siRNA into the cytosol may be facili- Peptide-based delivery systems tated via interactions between the re-protonated ionisable cationic CPPs represent another group of compounds that have been also lipid in the acidic endosomal environment and anionic endogenous successfully used as a carrier-based drug delivery system (Lehto lipids in the endosomal membrane (Habrant et al, 2016). et al, 2016). In this context, formation of CPP/ON nanoparticles is ª 2021 The Authors EMBO Molecular Medicine 13: e13243 | 2021 9 of 23 EMBO Molecular Medicine Suzan M Hammond et al driven by electrostatic and hydrophobic interactions between Table 2. Comparison of different disease models. cationic CPPs and anionic ONs. Compared with directly conjugated In In 3D Organs- CPP-ONs, peptide-based vectors are more amphipathic and usually vivo vitro Organoids on-chips carry additional chemical modifications that make them compatible Human-derived tissue No Yes Yes Yes with encapsulating ONs. Commonly, such modifications include Personalised medicine No Yes Yes Yes incorporation of various hydrophobic modifications, such as fatty Realistic Yes No Yes Yes acid derivatives, to the CPP sequences, which increase the stability microenvironment of the formulation and enhance their cellular uptake and endosomal Organ-level function Yes Limited Potentially/ Potentially escape. Various types of CPPs have demonstrated considerable Limited potential for ON delivery in a nanoparticle-based format, including MPG and PepFect peptide derivatives [reviewed in (Boisguerin et al, Real-time readouts No Limited Limited Yes 2015; Lehto et al, 2016)]. High-throughput No Yes Limited Possibly testing Antibody complexation delivery systems Pharmacodynamics / Yes No No/Limited Potentially Antibodies are another promising form of carrier delivery system -kinetics used both as direct conjugates or unconjugated carriers. As unconju- gated carriers, antibodies or antibody fragments have been fused with either avidin or protamine peptide. Taking advantage of the congenital amaurosis (LCA) (Collin et al, 2012; den Hollander et al, natural avidin–biotin complexation system, antibody–avidin fusion 2006). Combining patient-derived retinal organoids with toxicity molecules bind to biotinylated ONs (Penichet et al, 1999). The studies in non-human primates (NHPs) was sufficient to initiate a peptide protamine is a positively charged RNA-binding peptide, phase I/II clinical trial (NCT03140969, NCT03913143) (Cideciyan which binds to siRNA and condenses it into antibody–siRNA et al, 2019). The eye is an exceptional target organ, given its isolated complex (Song et al, 2005). This system has been used to link cyto- and immune-privileged status, which allows for translation of toxic siRNAs with Her2-positive cancer cell-targeted antibodies (Yao results from organoids in culture to the human eye. However, for et al, 2012). Like all complexation systems, these two systems have other (multi-)organ diseases, establishing predictive cellular models the advantage of an established target-specific antibody carrier, to mimic the functions of entire organs remains a challenge. which can easily be complexed with any siRNA. An interesting alternative to 2D and 3D tissue culture techniques is the microfluidics-based organ-on-chip technology (van der Meer & van den Berg, 2012), which consists of micro-engineered iPSC- Model systems for oligonucleotide development derived models that combine the advantages of current in vitro and in vivo models. The technology breaks down organs into the most Successful development of ON-based drugs depends on detailed essential components, including biological barriers, for drug deliv- knowledge about pharmacokinetic (PK) and pharmacodynamic (PD) ery, efficacy, toxicity and PK/PD studies. Organ-on-chips reproduce properties. PK/PD analyses describe the relationship between PK the interaction between cultures of multiple tissue types using (drug concentration in the organism) and PD (the organism’s biolog- microfluidic channels and chambers (Huh et al, 2010; Kim et al, ical response to the drugs) in a time-dependent manner (Negus & 2012; Westein et al, 2013). This interaction can be monitored in real Banks, 2018). PK/PD modelling and simulations are used to rapidly time to study the PK/PD of a specific drug as well as drug–drug characterise the efficacy and safety of drugs, and PK/PD simulation interactions (Lee et al, 2017; Shinha et al, 2020). For instance, the models containing in vitro and in vivo preclinical studies can antici- PK/PD evaluation of terfenadine (a type of antihistamine) has been pate potential risks in humans (Li et al, 2016). The use of predictive assessed by using a cellular model combining heart and liver cells in model systems for PK/PD analyses save time, costs and minimise two interconnected chambers. This model, combined with micro- the need for in vivo studies, facilitating the translation from bench to electrode arrays, also contributed to predict the potential cardiotoxi- bedside. city of the drug (McAleer et al, 2019). Interestingly, recent drug permeability studies in blood–brain barrier (BBB)-on-chip models Methodologies for in vitro testing of oligonucleotides were found to be more predictive compared with existing in vitro In vitro models can be implemented to test pharmacological activity, models (van der Helm et al, 2016). Other cellular models under transfection efficiency, hepatotoxicity and intracellular half-life. development include retina-on-chip (Achberger et al, 2019; Seo However, it is usually difficult to correlate in vitro findings to et al, 2019) and lung-on-chip (Huh et al, 2010) models. Mimicking preclinical and clinical in vivo findings (Table 2). Novel technolo- the function of entire organ(s) in a dish by combining several cell gies, such as reprogramming patient-derived cells into induced types in a single device may have valuable potential for drug screen- pluripotent stem cells (iPSCs) (Takahashi & Yamanaka, 2006; Taka- ing and development, as well as PK/PD and toxicity studies. In the hashi et al, 2007) and genome editing techniques to make isogenic future, organ-on-chip models might, to some extent, replace experi- cell lines, have revolutionised the field (Ran et al, 2013). Two- mental animal models. dimensional (2D) and three-dimensional (3D) cell cultures, includ- ing organoids, are used to improve the understanding of pathologi- Investigation of PK/PD properties in vivo cal disease mechanisms, as well as ON efficacy studies. One In vivo models have been extensively used for dose-finding studies. example of successful translation from a 3D-model to a clinical trial PK properties are largely comparable across multiple species includ- is sepofarsen for the treatment of the inherited retinal disease Leber ing mouse, rat, NHP and human (Yu et al, 2009; Geary et al, 2015). 10 of 23 EMBO Molecular Medicine 13: e13243 | 2021 ª 2021 The Authors Suzan M Hammond et al EMBO Molecular Medicine Hence, cross-species PK/PD relationships are very valuable for the However, due to the sequence-specific action of ON-based drugs, prediction of human dosing. Animal models have been vital for target sequences may not be conserved across species. Therefore, determining in vivo efficacy of ONs, tissue-specific delivery, and human sequences might not display efficacy in rodents or NHPs; optimising the route of administration for systemic and neurological hence, species-specific surrogates are needed for on-target risk diseases (Schoch & Miller, 2017; Buijsen et al, 2019). Preclinical assessment (Levin & Henry, 2008). in vivo testing in a transgenic mouse model for SMA predicted the Off-target effects correspond to the potential toxicities associated enhanced benefit of treating pre-symptomatic stages of the disease, with ON hybridisation to unintended RNA targets (complete or which was later validated in the clinic. partial complementarity). They have increased with the develop- However, detailed knowledge of the disease model is vital for ment of high-affinity chemistries, e.g. LNA, tcDNA and constrained interpreting data: A study in the mdx mouse model for DMD of the ethyl (cEt), which allow the use of much shorter sequences. Off- PK/PD of 2ʹ-OMe ONs for DMD revealed higher ON levels in target effects are of particular concern for gapmer ONs and siRNA, dystrophin-deficient muscle fibres than in healthy fibres, as well as which aim at downregulating their targets, as they could downregu- an enhanced exon skipping efficiency (Heemskerk et al, 2010). late the expression of unintended ones (Fedorov et al, 2006; Burel However, ON efficiency was lower in clinical trials in DMD et al, 2016). Several studies have characterised off-target effect-asso- patients, potentially due to a better regenerative capacity in mice. ciated mechanisms and described elegant ways to reduce risks and Also, animal models may not always reciprocate the human condi- improve the design of specific gapmers and siRNAs (Hagedorn et al, tion due to the different genomic context of the mutations, even 2017; Janas et al, 2018). In contrast, splice-switching ASOs must when using humanised animal models. This is evident for pre- bind specific splicing regulatory elements to be efficacious, and they mRNA splicing, which is differentially regulated between tissues, are therefore less likely to induce off-target effects. With the devel- organs and species (Rivera-Barahona et al, 2015). Between tissues, opment of more stable ONs and efficient delivery systems, systemic DNA variants have been observed to affect pre-mRNA splicing, administrations might distribute to target but also non-target tissues; complicating the interpretation of in vitro studies. An example is hence, off-target effects should be carefully evaluated during the aforementioned deep-intronic change underlying LCA: while preclinical development. The guidelines published by the OSWG for lymphoblastoid and fibroblast cells derived from patients suggested assessing off-target effects recommend (i) in silico evaluation, (ii) a hypomorphic effect (Garanto et al, 2016), reprogrammed patient- interpretation of in silico hits using auxiliary data (e.g. time- and derived iPSCs differentiated towards a retinal fate revealed that the spatiotemporal-dependent expression of off-target RNA) and (iii) percentage of aberrantly spliced mRNA was highly increased in in vivo evaluation of ON drugs (Lindow et al, 2012). photoreceptor cells, explaining the retinal phenotype observed in LCA patients (Parfitt et al, 2016). Follow-up studies revealed that a Hybridisation-independent effects pseudoexon present in humans was differentially recognised in cell Most ON-mediated toxicities are not caused by Watson–Crick base lines derived from other species (Garanto et al, 2015). Thus, care is pairing to RNA, but are rather a result of ON–protein interactions warranted when selecting a model system for assessing the effects and therefore depend on the chemistry and/or the delivery system. of a certain genetic variant, as well as for the development of Single-stranded PS-modified ON display particularly high protein splice-modulation therapies. binding affinities, and the majority of the hybridisation-independent effects have thus been reported for this class of ON, as opposed to siRNA containing less PS-modified residues. Safety assessment of oligonucleotide-based therapeutics Inhibition of blood coagulation While new chemistries and delivery technologies might lead to Inhibition of the intrinsic blood coagulation pathway is a well-docu- higher efficacy, it is important to screen for potential side effects in mented side effect of the PS chemistry (Henry et al, 1997b; Echevar- early phases of preclinical development to avoid subsequent failure. ria et al, 2019). It is considered a class effect, modulated by Toxicological aspects of therapeutic ONs have been comprehen- interactions of the ON with plasma proteins in a sequence-indepen- sively summarised previously (Andersson & den Besten, 2019). The dent way. The PS modification selectively prolongs the partial Oligonucleotide Safety Working Group (OSWG) has also published thromboplastin time at low plasma concentrations by inhibiting the extensive guidelines for assessing the various aspects of ON safety. tenase complex. However, at high plasma concentrations, both the Our understanding of ON-mediated toxicity increases as more intrinsic and extrinsic pathways are affected, suggesting additional preclinical and clinical data become available. While the concept of inhibitory effects (Sheehan & Lan, 1998). Prolongation of clotting class toxicity appears nuanced in the light of the expanding knowl- times is correlated with the maximal plasma concentration (Cmax) of edge on various chemistries, ON-related side effects still falls under circulating ONs, and it has not been associated to relevant clinical two main categories: (i) hybridisation-dependent effects, including signs, as it can be controlled by dose reduction or by extending infu- on- and off-target effects, and (ii) hybridisation-independent effects, sion times. Nevertheless, it should be included in screening studies, mostly caused by protein-binding properties (Fig 5). which can be performed both in vivo and in vitro in mouse, NHP and human serum, respectively, since results can be extrapolated Hybridisation-dependent effects across species (Andersson & den Besten, 2019). On-target safety, also referred to as exaggerated pharmacology, relates to the possible toxicities induced by excessive or prolonged Complement activation activity of the ON in target or non-target organs. These effects are Systemic administration of PS-modified ONs has been reported to considered rare and are generally discovered in preclinical studies. activate the alternative complement pathway as a consequence of ª 2021 The Authors EMBO Molecular Medicine 13: e13243 | 2021 11 of 23 EMBO Molecular Medicine Suzan M Hammond et al ON-mediated Hybridisation ON-target • Exaggerated pharmacodynamic effect toxicities dependent Sequence dependent • Target and species-specific Watson-Crick hybridisation OFF-target • In silico evaluation/in vitro validation Sequence dependent • Guidelines published by the OSWG in 2012 PREDICTIVE ASSAYS Hybridisation Inhibition of coagulation • Measurement of PT and aPTT in vitro in independent Sequence independent human plasma and/ or in NHP studies • Tissue accumulation • Quantification of split products of APC • Proinflammatory Complement activation (C3a, Bb and CSa) in vitro in human plasma mechanisms Sequence independent (or whole blood) and in vivo NHP studies • Protein binding effects lmmunostimulation • Cytokine /chemokine levels in e sequence Can be influenced by the human PBMC or whole blood • Chronic dosing studies in NHP Thrombocytopenia Sequence dependent • Evaluation of platelet activation in human platelet-rich plasma or whole blood • A growing number of predictive in silico and in vitro models have been established to filter out liver-toxic candidates • Evaluation of liver enzymes in High exposure organs mice /NHP preclinical studies Can be influenced by the sequence • In vitro EGF-based assays • Evaluation of urinary biomarkers such as © EMBO protenuria, β2-microglobulin and KIM-1 in preclinical mouse and/ or NHP studies Figure 5. ASO mediated toxicities. Schematic representation of the most common ON-mediated toxicities, which are mainly classified as hybridisation-dependent (Watson–Crick hybridisation) or hybridisation-independent effects (tissue accumulation, proinflammatory mechanisms and/ or protein binding effects). Some of them are strictly class specific (sequence independent), while others can be influenced by the sequence (sequence specific). plasma protein binding (Henry et al, 2002). Although this hybridisa- Complement activation can be assessed in vitro in NHP or tion-independent effect is mainly related to the ON chemistry (class human serum, or whole blood, to measure split products of the effect), unexpected complement activation has been observed with alternative complement pathway (Bb, C3a and C5a). Nevertheless, some sequence specificity, as in the case of tcDNA (Aupy et al, one should be cautious when interpreting the results, as it is difficult 2020). Activation of the alternative complement pathway has been to extrapolate and predict dose–response relationships (Andersson thoroughly studied in NHP models, which are particularly sensitive & den Besten, 2019). (Henry et al, 2016). The effect is dependent on the plasma concen- tration and can be controlled by increasing the IV infusion time to Immunostimulation reduce the Cmax. PS-modified ONs have been shown to interact ON-induced immunostimulation is a complex side effect that depends directly with plasma factor H, which is a negative regulator of the on several aspects, including chemistry and nucleotide sequence complement cascade that reduces the free levels of inhibitor, permit- (Krieg, 1998; Agrawal & Kandimalla, 2004). ONs can activate the ting uncontrolled amplification of the cascade and release of split innate immune system through binding to pattern-recognition recep- products such as Bb and anaphylotoxins C3a and C5a (Henry et al, tors (PRRs) such as the Toll-like receptors (TLRs). Activation of the 1997a). Complement can be activated similarly at every dose; innate immune system by CpG-containing ONs is comparable to that hence, chronic administration of toxic ONs can result in C3 deple- observed for bacterial DNA and CpG-containing ONs are used for tion, eventually leading to altered complement function, secondary cancer and autoimmune disease therapies as well as vaccine adjuvants inflammation and vasculitis (Engelhardt et al, 2015; Shen et al, (Krieg & Davis, 2001; Krieg, 2006; Kline & Krieg, 2008). However, the 2016; Andersson & den Besten, 2019). Although humans appear less immunostimulatory activity of ONs designed for antisense purposes sensitive to complement activation, it is recommended to routinely constitutes a potential side effect. In this regard, modified ONs with 2ʹ- evaluate complement activation in preclinical safety studies of new ribose modifications, 5-methyl cytosine residues, or without CpG ON-drug candidates in NHPs. motifs, have been designed to avoid TLR9 activation. Additional 12 of 23 EMBO Molecular Medicine 13: e13243 | 2021 ª 2021 The Authors Suzan M Hammond et al EMBO Molecular Medicine studies have demonstrated that CpG-free, PS-modified ONs can also induced thrombocytopenia-like mechanism through the induction of elicit proinflammatory responses, although the molecular mechanism anti-platelet factor 4 IgG antibodies has also been proposed, based on is still debated (Vollmer et al, 2004; Senn et al, 2005; Younis et al, the binding of nucleic acids to platelet factor 4 (Jaax et al, 2013), 2006). Of note, immunostimulatory effects have never been reported although contradictory results have been reported. A recent study for ONs with neutral backbones, e.g. PMOs (Zhang et al, 2015). suggests that sequestration of platelets in the liver and spleen occurs Rodents are particularly sensitive to immune stimulation. Mice treated through the activation of monocytes, but not platelets, and is accom- with high doses of PS-ONs display increased levels of circulating panied by increased serum IgM levels (Narayanan et al, 2018). In most cytokines (IL-1b, IL-6, interferon, tumour necrosis factor-a) and cases, thrombocytopenia after treatment with ONs is mild to moderate chemokines, as well as proliferation of B-lymphocytes (Monteith et al, and reversible. The number of platelets does not drop below the 1997). Although generally less critical, some significant inflammatory normal limit during treatment and normalises after withdrawal from responses, e.g. vasculitis, related to complement activation mediated treatment. However, a concerning and severe decline (< 50,000 plate- by PS-ONs, have been described in NHP studies (Levin & Henry, 2008; lets/µl) has been observed in NHP studies after repeated dosing Engelhardt et al, 2015; Frazier, 2015; EMA, 2016). Differences in (Henry et al, 2017). To date, severe thrombocytopenia has not been immune response between species have been attributed to the dif- reported for siRNA drugs, neither in preclinical studies nor in clinical ferential sequence, expression and function of the germline-encoded trials, but encapsulation of siRNA to LNPs has been shown to cause PRRs (Barchet et al, 2008). thrombocytopenia in rats, presumably induced by the cationic lipid In clinical trials, inflammatory adverse effects may manifest as molecules themselves (Chi et al, 2017). flu-like symptoms and injection site reactions following subcuta- neous (SC) administration (Rudin et al, 2001; Thomas et al, 2013; High-exposure organs Voit et al, 2014). Understanding the underlying mechanisms of ther- Following IV administration and independently of the chemistry, apeutic ON-mediated induction of proinflammatory adverse effects the highest concentrations of ONs are found in the liver and the has facilitated the design of safer and more potent sequences that kidneys, which are considered high-exposure organs (Fig 5). The are efficacious at lower doses. Nevertheless, some sequences still toxicities observed in these organs are not necessarily associated display unexpected toxicity, and specific screening for immunostim- with the accumulation of ONs per se but can also be due to ulatory adverse effects is recommended. In addition to in vivo stud- sequence-specific effects. Accumulated ONs are often apparent as ies in rodents and NHPs, proinflammatory evaluation is usually basophilic granules (ONs in lysosomal compartments) in tissue performed in vitro using human peripheral blood mononuclear cells sections. However, these effects are regarded as non-adverse or whole blood (Apter et al, 1990; Lankveld et al, 2010). because of their reversible nature upon termination of treatment. In The potential immunogenicity of ONs is poorly documented but contrast, acute toxicities characterised by large areas of necrosis, recent data show that anti-drug antibodies (ADAs) are present in pronounced elevation of liver enzyme levels, morbidity and mortal- NHPs and humans (Andersson & den Besten, 2019). More than 30 ity have been reported for some high-affinity gapmers after a single and 70% of patients treated with drisapersen and mipomersen, or few doses in mice (Hagedorn et al, 2013; Burdick et al, 2014). respectively, were found positive for ADA after 24 weeks of treat- The mechanisms underlying these sequence-specific acute toxicities ment. Recently, ADA plasma levels were shown to increase both in may be accumulation of RNase H-cleaved mRNA products and/or monkeys and humans, while no impact on efficacy and safety was protein interactions (Burel et al, 2016; Sewing et al, 2016; Shen reported (Bosgra et al, 2019; Yu et al, 2020). et al, 2019). While the screening for these acute toxicities previously Formulations based on nanoparticles administered IV may also relied on in vivo studies assessing levels of liver enzymes following induce infusion-related reactions (IRRs), e.g. hypersensitivity, IV administration in rodents, a growing number of predictive in evident as flu-like symptoms and even cardiac anaphylaxis silico (Hagedorn et al, 2013; Burdick et al, 2014) and in vitro models (Szebeni, 2018). Hence, before IV infusion of patisiran, patients are (Sewing et al, 2016; Dieckmann et al, 2018) have been established. required to be premedicated with IV antihistamines (H1/H2 block- Renal lesions are generally restricted to the proximal tubules and ers), IV corticosteroid and oral acetaminophen or paracetamol to appear only in animals treated with much higher ON doses than the suppress IRRs. Mild to moderate IRRs were observed in a phase III clinically relevant doses. No clinically significant renal dysfunction trial of patisiran in approximately 20% of the patients, who were all was reported in a large retrospective study of 2ʹ-MOE gapmer trials premedicated, the incidence of which decreased over time (Adams (Crooke et al, 2018). Renal toxicity was mostly regarded as accumu- et al, 2018). In contrast, premedication is not required before admin- lation-related toxicity and primarily sequence unspecific until more istration of ONs and GalNAc–siRNA conjugates. acute tubular lesions were reported with high-affinity ONs, e.g. LNAs (Engelhardt et al, 2015). Beyond the classical biomarkers for Thrombocytopenia renal injury, e.g. increased excretion of b2-microglobulin and kidney ON-associated thrombocytopenia is an occasional event that has been injury molecule-1, a predictive epidermal growth factor-based assay observed in rodents and NHPs, as well as in three recent clinical trials has recently been developed to exclude this type of nephrotoxic with unrelated PS-ONs [volanesorsen (FDA, 2018), inotersen (Benson candidates (Moisan et al, 2017). et al, 2018; Mathew & Wang, 2019) and drisapersen (EMA, 2016; Goemans et al, 2016)]. The exact underlying mechanisms of thrombo- cytopenia is still debated, and several immune and non-immune medi- Approved oligonucleotide-based therapeutics ated mechanisms have been proposed. Direct activation of platelets by PS-ONs through the binding to platelet receptors has been demon- Advances in therapeutic ON technology in recent decades provide a strated (Flierl et al, 2015; Sewing et al, 2017). In addition, a heparin- unique opportunity for addressing previously inaccessible drug ª 2021 The Authors EMBO Molecular Medicine 13: e13243 | 2021 13 of 23 EMBO Molecular Medicine Suzan M Hammond et al targets (Bennett et al, 2017). Since the approval of fomivirsen in vision loss compared with placebo controls (Gragoudas et al, 2004). 1998 by the FDA for treating cytomegalovirus (CMV) retinitis (Mar- Common to degenerative diseases, early treatment results in improved wick, 1998), 11 ON-based drugs have received marketing authorisa- therapeutic outcome (Gonzales CR & Group VISiONCT, 2005). tion to be used in humans, and two additional ON drugs have Several splice modifying ON-based drugs are approved to treat received positive opinion for marketing by the EMA (Table 3). Here, the paediatric disorders DMD and SMA, focussing on splice modifi- we discuss approved ON therapeutics according to their functional cation and targets tissues beyond liver. The first approved drug, i.e. modalities. eteplirsen (Exondys51), is a PMO-based splice-switching ASO that Fomivirsen (Vitravene) is a 21-mer PS DNA-based ON developed interacts specifically with DMD exon 51, and is used in DMD patients for treating CMV retinitis patients, especially those with acquired with dystrophin deletions amenable to exon 51 skipping (~14% of immunodeficiency syndrome (AIDS) (Vitravene Study G, 2002). patients) (Cirak et al, 2011). Dystrophin expression is limited mainly This first-generation ASO targets the human CMV major immediate- to skeletal and cardiac muscles, and eteplirsen is expected to be most early gene mRNA for RNAse H degradation (Geary et al, 2002). efficacious in skeletal muscle. However, conducive with all PMOs, Fomivirsen is delivered locally by IVT administration and hence high accumulation in the kidneys and rapid urine excretion is also does not require a delivery agent. While a second-generation 2ʹ- expected (Heemskerk et al, 2009). The approval of eteplirsen by the MOE-based gapmer sequence (ISS 13312) was in clinical develop- FDA was accompanied by controversy due to the trial design and dif- ment (Henry et al, 2001), Novartis discontinued development and ficulties in quantifying increased expression of dystrophin, which withdrew marketing (Wathion, 2002). The number of CMV retinitis leaves doubt on the efficacy of eteplirsen (Aartsma-Rus & Arecha- cases had decreased dramatically due to the development of highly vala-Gomeza, 2018). As a result, it was not approved by the EMA. active antiretroviral therapy. Nevertheless, fomivirsen was a success Strengthened by improved clinical trial designs, two additional PMO- and established ON therapies as viable for clinical development. based ASOs have recently been approved for DMD patients amen- RNase-dependent second-generation ASOs targeting the liver able for dystrophin exon 53 skipping, i.e. golodirsen and viltolarsen, have been approved for polyneuropathy of hereditary transthyretin- by the FDA, and both the FDA and Japanese Ministry of Health mediated amyloidosis (hATTR) (inotersen) as well as familial Labour and Welfare, respectively (Dhillon, 2020; Heo, 2020). chylomicronemia syndrome (FCS), hypertriglyceridemia and familial The only ON-based therapeutic approved for a neurological partial lipodystrophy (volanesorsen), and familial hypercholes- disease is nusinersen, used for the treatment of SMA (Aartsma-Rus, terolemia (mipomersen). The rare disease hATTR is linked to 2017; Finkel et al, 2017; Mercuri et al, 2018). Nusinersen targets the missense mutations in the TTR gene, which result in TTR protein alternatively spliced exon 7 of SMN2 pre-mRNA, increasing exon misfolding. The TTR protein is secreted into the blood and cerebral inclusion and producing a functional SMN protein. It is administered spinal fluid, and accumulation of amyloid deposits (both wild type directly to the cerebral spinal fluid surrounding the spinal cord by IT and mutant) in tissues causes polyneuropathy, multiorgan dysfunc- injection (Hache et al, 2016). IT administration directs uptake into tion and cardiomyopathy. Inotersen targets the hepatic expression of the CNS, allowing low doses and circumvention of liver metabolism both wild-type and mutant TTR mRNA. Patients treated with inot- and kidney excretion. Patients, especially young pre-symptomatic ersen display a reduction in serum TTR protein levels and enhanced patients, report extended survival and reaching motor milestones quality of life (Benson et al, 2018). Volanesorsen, although still over the expected natural history of the disease. Controversy related awaiting FDA approval at the time of writing this review, was to nusinersen is not over efficacy but rather the exceedingly high awarded EMA approval in May 2019. By targeting the 3ʹ UTR of cost, which has delayed approval and prevented marketing in coun- apolipoprotein C3 mRNA, volanesorsen reduces the levels of triglyc- tries with national health services (Starner & Gleason, 2019). erides and apolipoprotein C3, which represent two known risk The success of nusinersen has led to the use of ONs as person- factors for cardiovascular disease, while increasing the levels of low- alised medicines, exemplified in the development of milasen, which density and high-density lipoprotein cholesterol and apolipoprotein targets a mutation specific to a single patient with a form of Batten’s B in patients with FCS and hypertriglyceridemia (Graham et al, 2013; disease (Kim et al, 2019). In this case, the insertion of an SVA EMA, 2019). Mipomersen also targets apolipoprotein B-100 to reduce (SINE-VNTR-Alu) retrotransposon altered the splicing of the major circulating low-density lipoprotein cholesterol, which constitutes facilitator superfamily domain containing 8 (MFSD8) exon 6 into a another major risk factor for cardiovascular disease (Wong & Gold- cryptic splice-acceptor site. Clinicians followed the preclinical stud- berg, 2014). In contrast to inotersen and volanesorsen, mipomersen ies and trial designs from the nusinersen studies to accelerate the was given FDA approval, but EMA authorisation was denied due to FDA approval of the clinical study: milasen dosing was initiated safety concerns related to liver toxicity and severe cardiovascular 14 months after clinical diagnosis and just 4.5 months after identifi- events (EMA, 2012). It has since been discontinued by the FDA and cation of a therapeutic ASO. The patient’s rate of deterioration is only available through a restricted risk evaluation and mitigation meant that dosing had to be initiated as soon as possible; hence, the strategy. All three ON therapies are dosed by SC administration with- patient was dosed in parallel to toxicology studies in animals. out a delivery agent due to the natural uptake of ONs by the liver. In Although therapeutic efficacy in a single patient cannot be defined, 2004, the aptamer pegaptanib (Macugen) was approved by the FDA milasen reduced the frequency and duration of seizures and poten- for the prevention of the eye-related disorder age-related macular tially diminished the neurodegenerative decline. degeneration (Ng et al, 2006). Pegaptanib is a covalent conjugate of Two ON therapeutics based on RNAi, i.e. patisiran and givosiran, a highly modified single-stranded aptamer and two 20-kDa PEG were approved by the FDA in 2018 and 2019, respectively. Patisiran units. It binds with high specificity and affinity to the extracellular represents an important milestone, because it is the first marketed VEGF isoform 165 and blocks its neo-angiogenic activity (Ruckman drug based on siRNA, launched only 20 years after the discovery of et al, 1998). Patients dosed with pegaptanib demonstrated reduced the RNAi mechanism (Fire et al, 1998). Like inotersen, patisiran 14 of 23 EMBO Molecular Medicine 13: e13243 | 2021 ª 2021 The Authors Suzan M Hammond et al EMBO Molecular Medicine Table 3. Clinically approved oligonucleotides. Approval date Administration Drug name Disease Target ASO sequence 50 –30 route/target FDA EMA tissues RNaseH 26 August 29 July 1999 Fomivirsen Cytomegalovirus retinitis in CMV major dGs-dCs-dGs-dTs-dTs-dTs-dGs-dCs- IVT / eye 1998 (Vitravene) immunocompromised immediate-early dTs-dCs-dTs-dTs-dCs-dTs-dTs-dCs- patients gene mRNA dTs-dTs-dGs-dCs-dG 29 January refused Mipomersen Homozygous familial Apolipoprotein Gs*-mCs*-mCs*-Ts*-mCs*-dAs-dGs- SC / liver 2013 authorisation (Kynamro) hypercholesterolemia B-100 dTs-dmCs-dTs-dGs-dmCs-dTs-dTs- dmCs-Gs*-mCs*-As*-mCs*-mC* 05 October 05 July 2018 Inotersen Hereditary transthyretin Transthyretin mTs*-mCs*-mTs*-mTs*-Gs*-dGs-dTs- SC / liver 2018 (Tegsedi) amyloidosis dTs-dAs-dmCs-dAs-dTs-dGs-dAs-dAs- dAs-mTs*-mCs*-mCs*-mC*-30 Under 03 May 2019 Volanesorsen Familial chylomicronemia Apolipoprotein As*-Gs*-mCs*-Ts*-Ts*-dmCs-dTs- SC / liver review (Waylivra) syndrome, CIII dTs-dGs-dTs-dmCs-dmCs-dAs-dGs- hypertriglyceridemia and dmCs-Ts*-Ts*-Ts*-As*-T* familial partial lipodystrophy Splice modulation 01 June N/A Milasen Neuronal ceroid lipofuscinosis MFSD8 exon 6 As*-As*-Ts*-Gs*-Ts*-Ts*-As*-Gs*- IT / CNS 2019‡ 7, Batten’s disease Ts*-Gs*-mCs*-Ts*-Ts*-Gs*-Ts*-Ts*- Gs*-As*-Gs*-Gs*-Gs*-mC* 19 refused Eteplirsen Duchenne muscular dystrophy Dystrophin exon CTCCAACATCAAGGAAGATGGCATTTCTAG IV / skeletal September authorisation (Exondys51) 51 muscle 2016 12 Under review Golodirsen Duchenne muscular dystrophy Dystrophin exon GTTGCCTCCGGTTCTGAAGGTGTTC IV / skeletal December (Vyondys 53) 53 muscle 2019 August Under review Viltolarsen† Duchenne muscular dystrophy Dystrophin exon CCTCCGGTTCTGAAGGTGTTC IV / skeletal 2020 (Viltepso) 53 muscle 23 30 May 2017 Nusinersen Spinal muscular dystrophy Survival motor mTs*-mCs*-As*-mCs*-mTs*-mTs*- IT / CNS December (Spinraza) neuron 2 exon 7 mTs*-mCs*-As*-mTs*-As*-As*-mTs*- 2016 Gs*-mCs*-mTs*-Gs*-G* Aptamer 17 31 January Pegaptanib Age-related macular Vascular 40 kDa PEG-50 -CF-G^-G^-A-A-UF-CF- IVT / eye December 2006 (Macugen) degeneration endothelial A^-G^-UF-G^-A^-A^-UF-G^-CF-UF-UF- 2004 growth factor A^-UF-A^-CF-A^-UF-CF-CF-G^-30 -30 - dT-50 RNAi 10 August 27 August Patisiran Hereditary transthyretin Transthyretin 50 -G-U^-A-A-C^-C^-A-A-G-A-G-U^-A- IV / liver 2018 2018 (Onpattro) amyloidosis U^-U^-C^-C^-A-U^-dT-dT-30 30 -dT-dT-C-A-U^-U-G-G-U-U-C-U-C- A-U^-A-A-G-G-U-A-50 LNP formulated 20 02 March Givosiran Acute hepatic porphyria Aminolevulinate 50 -Cs^-As^-G^-A^-A^-A^-GF-A^-GF- SC / liver November 2020 (Givlaari) synthase 1 U^-GF-U^-CF-U^-CF-A^-U^-C^-U^- 2019 U^-A^-30 30 -Us^-Gs^-G^-UF-C^-UF-U^-UF-C^- UF-C^-AF-C^-AF-G^-AF-G^-UF-A^-GF- AsF-AsF-U^-50 GalNAc Conjugate 16 October Lumasiran Primary hyperoxaluria type 1 Hydroxiacid 50 -As^-Cs^-C^-U^-G^-A^-A^-AF-G^- SC / liver 2020¥ (Oxlumo) oxidase 1 UF-A^-G^-G^-A^-CF-CF-U^-UF-U^- A^-Us^-AsF-U^-30 30 -Gs^-As^-Cs^-U^-U^-U^-CF-A^-UF- CF-CF-U^-G^-G^-A^-A^-A^-U^-A^- U^-A^-50 GalNAc Conjugate ª 2021 The Authors EMBO Molecular Medicine 13: e13243 | 2021 15 of 23 EMBO Molecular Medicine Suzan M Hammond et al Table 3 (continued) Approval date Administration Drug name Disease Target ASO sequence 50 –30 route/target FDA EMA tissues 16 October Inclisiran Atherosclerotic cardiovascular Proprotein 50 -As^-CFs-As^-AF-AF-AF-G^-CF-A^-AF- SC / liver 2020¥ disease convertase A^-A^-C^-AF-G^-GF-U^-CF-U^-A^- subtilisin-kexin Gs^-As^-A^-30 type 9 30 -U^-G^-U^-U^-U^-U^-C^-G^-U^- U^-dT-U^-GF-U^-CF-C^-A^-G^-As^- Us^-C^-50 GalNAc Conjugate s, phosphorothioate linkage; *, 20 -MOE; d, 20 -deoxy; m, 5-methyl; F, 20 -F; ^, 20 -OMe; italicised, PMO; † Viltolarsen approval by Japanese Ministry of Health Labour and Welfare, 25 March 2020; ‡ Milasen approved by FDA for clinical testing only, ¥, lumasiran and inclisiran received positive opinion for marketing by the CHMP. inhibits hepatocyte expression of TTR in patients with hATTR completely changed the perspective for therapies targeting hepato- (Adams et al, 2018). Patisiran consists of siRNA directed against TTR cytes: in one stroke, this tissue is now accessible for treatment with mRNA formulated as LNPs, which are administered systemically by ONs. These examples of how delivery technologies can be used to IV infusion. The latest breakthrough is givosiran, which represents overcome delivery hurdles has provided the whole field with a new the first approved GalNAc-siRNA conjugate. Givosiran inhibits impetus that will accelerate discoveries for targeting of tissues hepatic synthesis of delta aminolevulinate synthase 1 (ALAS1) in beyond the liver. patients with acute hepatic porphyria (AHP), which is a rare inher- Design and manufacturing of efficient delivery systems is not the ited disease of haem biosynthesis (Sardh et al, 2019). Monthly only hurdle: the safety of these and their combination with ONs is subcutaneous administration of givosiran results in hepatocyte- also paramount. Testing ON safety has not been easy, primarily specific distribution and downregulation of elevated ALAS1 mRNA because many of these drugs have been developed to treat rare in the liver. diseases. This implies an abundance of preclinical models but Recently, two new liver-targeting GalNAc-siRNA drugs received limited clinical data. Being a whole new class of drugs, this makes positive opinion for marketing in Europe, i.e. lumasiran and incli- stakeholders wary of missing any step of the development. A strik- siran (Fitzgerald et al, 2017; McGregor et al, 2020). Lumasiran ing exception to this is the recent n-of-one clinical studies: the devel- targets hydroxyacid oxidase 1 (HAO1) for the treatment of primary opment of milasen (Kim et al, 2019) was achieved in record time, hyperoxaluria type 1 (PH1), which is a rare inherited disorder char- but it took a high risk/high reward gamble, relying on the safety of acterised by the overproduction of oxalate. Targeting HAO1 reduces IT administration of a chemistry already approved for nusinersen. the substrate needed for oxalate production in the liver (McGregor A likely leapfrog in the clinical application of therapeutic ONs et al, 2020). Inclisiran targets the proprotein convertase subtilisin– may come from the results of current clinical trial (NCT04023552; kexin type 9 (PCSK9) to reduce low-density lipoprotein (LDL) testing APO(a)-LRx, a GalNAc3-conjugated ASO) for the lowering of cholesterol. PCSK9 is a serine protease, which binds to the LDL lipoprotein (a) in cardiovascular disease. This trial includes 7,680 receptors to induce their lysosomal degradation. Therefore, silenc- patients and the large data set that will be generated is due to ing PCSK9 enhances the half-life of LDL receptors responsible for change in the landscape for these drugs. By then, many new deliv- cholesterol clearance (Fitzgerald et al, 2017). Inclisiran reduces ery technologies may have successfully been developed for other more than 50% LDL cholesterol levels in treated patients with mini- targets making this decade the era of ON therapeutics. mal side effects (Khvorova, 2017; Ray et al, 2020). Approval of Incli- siran will expand the indications for ONs to not only include rare Acknowledgements but also common diseases. This work was supported by funding from Cooperation of Science and Technol- ogy (COST) Action CA17103 (networking grant to V.A-G). V.A-G holds a Miguel Servet Fellowship from the ISCIII [grant reference CPII17/00004] that is part- Concluding comments and future perspectives funded by the European Regional Development Fund (ERDF/FEDER) and also acknowledges funding from Ikerbasque (Basque Foundation for Science). S.M.H In 1978, it was demonstrated that a 13-mer DNA-based ON binding is funded by the Medical Research Council and Muscular Dystrophy UK. A.A-R to Rous sarcoma virus RNA could inhibit protein expression in cell receives funding from amongst others the Duchenne Parent Project, Spieren culture (Zamecnik & Stephenson, 1978), but it was not until voor Spieren, the Prinses Beatrix Spierfonds, Duchenne UK and through Hori- 20 years later (1998) that the first ON-based therapeutic drug fomi- zon2020 project BIND. A.G and R.W.J.C are supported by several foundations versen was approved. By 2016, only two additional drugs (pegap- including the Algemene Nederlandse Vereniging ter Voorkoming van Blindheid, tanib and mipomersen) had been approved (Table 3) but since then Stichting Blinden-Penning, Landelijke Stichting voor Blinden en Slechtzienden, the development pace of ON-based drugs accelerated with 11 ON- Stichting Oogfonds Nederland, Stichting Macula Degeneratie Fonds, and based drugs currently approved (Aartsma-Rus & Corey, 2020). Yet, Stichting Retina Nederland Fonds (who contributed through UitZicht 2015-31 many of these drugs display limited efficacy (eteplirsen, golodirsen, and 2018-21), together with the Rotterdamse Stichting Blindenbelangen, viltolersen), and the more efficacious drugs take advantage of local Stichting Blindenhulp, Stichting tot Verbetering van het Lot der Blinden, Sticht- administration (nusinersen). However, GalNAc conjugation and the ing voor Ooglijders, and Stichting Dowilvo; as well as the Foundation Fighting LNP technology represent delivery breakthroughs that have Blindness USA, grant no. PPA-0517-0717-RAD. R.A.M.B is supported by 16 of 23 EMBO Molecular Medicine 13: e13243 | 2021 ª 2021 The Authors Suzan M Hammond et al EMBO Molecular Medicine Trento and are entitled to a share of royalties. S.M.H is an inventor on a patent Pending issues describing cell-penetrating peptides and is employed by Oxford Biomedica Plc, i A vast array of delivery systems could be used to deliver ONs; Oxford UK. Co-authors, R.A.M.B, G.G, S.A, L.R.D, S.K, V.A-G, S.E.B and A.T.G declare however, the majority target the liver or deliver throughout the no conflict of interests. body without specificity. Further advances are needed to enhance tissue-specific delivery. For more information ii Our understanding of ON-mediated toxicities has improved, and i www.clinicaltrials.gov many predictive in vitro tests have been developed to exclude toxic candidates early in development. Since some toxicities are ii https://www.ich.org/ sequence dependent, it will be important to implement toxicity iii https://www.ema.europa.eu screening early in the preclinical development of ONs. iv https://www.fda.gov iii Following the example of milasen, it is anticipated that bespoke v https://antisenserna.eu/ ON therapies will be developed for additional brain diseases. A process to guide this development is required. iv Very limited clinical data have been available for many therapeutic ONs, as most target rare disorders and have been tested in dozens References or, at best, a few hundred patients. However, this may be about to change thanks to new ON drugs targeting common disorders, such Aartsma-Rus A (2017) FDA approval of nusinersen for spinal muscular as hyperlipidaemia, which could produce clinical data from thou- atrophy makes 2016 the year of splice modulating oligonucleotides. sands of patients and further accelerate development of future therapeutic ONs. Nucleic Acid Ther 27: 67 – 69 Aartsma-Rus A, Arechavala-Gomeza V (2018) Why dystrophin quantification is key in the eteplirsen saga. Nat Rev Neurol 14: 454 – 456 Aartsma-Rus A, Corey DR (2020) The 10th oligonucleotide therapy approved: Hersenstichting Nederland Grant DR-2018-00253. G.G. is supported by Ministry golodirsen for duchenne muscular dystrophy. Nucleic Acid Ther 30: 67 – 70 of Research and Innovation in Romania/National Program 31N/2016/PN Achberger K, Probst C, Haderspeck J, Bolz S, Rogal J, Chuchuy J, Nikolova M, 16.22.02.05. S.A is supported by Project PTDC/BBB-BMD/6301/2014 (Fundaç~ ao Cora V, Antkowiak L, Haq W et al (2019) Merging organoid and organ-on- para a Ci^encia e a Tecnologia—MCTES, Portugal). L.R.D. is supported by a-chip technology to generate complex multi-layer tissue models in a Fundacion Ramo n Areces Grant XVII CN and Spanish Ministry of Science and human retina-on-a-chip platform. Elife 8: e46188 Innovation (MICINN, grant PID2019-105344RB-I00). T.L is supported by Esto- Adams D, Gonzalez-Duarte A, O’Riordan WD, Yang CC, Ueda M, Kristen AV, nian Research Council grant PSG226. S.K is supported by the Friedrich-Baur- Tournev I, Schmidt HH, Coelho T, Berk JL et al (2018) Patisiran, an RNAi Stiftung. C.F is funded by The Danish Council for Independent Research, Tech- therapeutic, for hereditary transthyretin amyloidosis. N Engl J Med 379: nology and Production Sciences (grant number DFF-4184-00422). W.vRM is 11 – 21 supported by ZonMw Programme Translational Research 2 [Project number Agrawal S, Kandimalla ER (2004) Role of Toll-like receptors in antisense and 446002002], Campaign Team Huntington and AFM Telethon [Project number siRNA [corrected]. Nat Biotechnol 22: 1533 – 1537 20577]. S.E.B is supported by the H2020 projects B-SMART, Grant number Akinc A, Querbes W, De S, Qin J, Frank-Kamenetsky M, Jayaprakash KN, 721058, and REFINE, Grant number 761104. A.T.G is supported by the Institut Jayaraman M, Rajeev KG, Cantley WL, Dorkin JR et al (2010) Targeted National de la sante et la recherche medicale (INSERM) and the Association delivery of RNAi therapeutics with endogenous and exogenous ligand- Monegasque contre les myopathies (AMM). L.E. is founded by the Association based mechanisms. Mol Ther 18: 1357 – 1364 Monegasque contre les myopathies (AMM). Akinc A, Zumbuehl A, Goldberg M, Leshchiner ES, Busini V, Hossain N, Bacallado SA, Nguyen DN, Fuller J, Alvarez R et al (2008) A combinatorial Conflict of interest library of lipid-like materials for delivery of RNAi therapeutics. Nat A.A-R discloses being employed by LUMC which has patents on exon skipping Biotechnol 26: 561 – 569 technology. As co-inventor of some of these patents, AAR is entitled to a share Alvarez-Erviti L, Seow Y, Yin H, Betts C, Lakhal S, Wood MJ (2011) Delivery of of royalties. AAR further discloses being ad hoc consultant for PTC Therapeu- siRNA to the mouse brain by systemic injection of targeted exosomes. Nat tics, Sarepta Therapeutics, Eisa Pharmaceuticals, WaVe Life Sciences, Alpha Biotechnol 29: 341 – 345 Anomeric, CRISPR Therapeutics, BioMarin Pharmaceuticals Inc., Global Guide- Ammala C, Drury 3rd WJ, Knerr L, Ahlstedt I, Stillemark-Billton P, Wennberg- point and GLG consultancy, Grunenthal and BioClinica, being a member of the Huldt C, Andersson EM, Valeur E, Jansson-Lofmark R, Janzen D et al (2018) Duchenne Network Steering Committee (BioMarin) and of the scientific advi- Targeted delivery of antisense oligonucleotides to pancreatic beta-cells. sory boards of ProQR and Philae Pharmaceuticals. Remuneration for these Science Adv 4: eaat3386 activities is paid to LUMC. LUMC also received speaker honoraria from PTC Andersson P, den Besten C (2019) CHAPTER 20 preclinical and clinical drug- Therapeutics and BioMarin Pharmaceuticals. A.G and R.W.J.C are inventors of metabolism, pharmacokinetics and safety of therapeutic oligonucleotides. several patents describing the use of antisense oligonucleotides for the treat- In Advances in nucleic acid therapeutics, Agrawal S, Gait MJ (eds), pp ment of inherited retinal diseases. C.F is ad hoc consultant for Lundbeck 474 – 531. London: The Royal Society of Chemistry Pharma A/S, Valby, DK. W.vR.M discloses being employed by LUMC which has Apter S, Hertz M, Rubinstein ZJ, Zissin R (1990) Gossypiboma in the early patents on exon skipping technology for brain disorders. As co-inventor of post-operative period: a diagnostic problem. Clin Radiol 42: 128 – 129 some of these patents WvRM is entitled to a share of royalties. T.L is a consul- Arechavala-Gomeza V, Khoo B, Aartsma-Rus A (2014) Splicing modulation tant for and has equity interests in Evox Therapeutics Ltd., Oxford, UK. L.E is therapy in the treatment of genetic diseases. Appl Clin Genet 7: an employee of SQY therapeutics developing tcDNA antisense oligonucleotides. 245 – 252 M.A.D and G.C are co-inventors of patent WO2016/151523 (RNA interference Aupy P, Echevarria L, Relizani K, Zarrouki F, Haeberli A, Komisarski M, mediated therapy for neurodegenerative diseases) filed by the University of Tensorer T, Jouvion G, Svinartchouk F, Garcia L et al (2020) Identifying and ª 2021 The Authors EMBO Molecular Medicine 13: e13243 | 2021 17 of 23 EMBO Molecular Medicine Suzan M Hammond et al avoiding tcDNA-ASO sequence-specific toxicity for the development of Chow MYT, Qiu Y, Lam JKW (2020) Inhaled RNA therapy: from promise to DMD exon 51 skipping therapy. Mol Ther Nucleic Acids 19: 371 – 383 reality. Trends Pharmacol Sci 41: 715 – 729 Barchet W, Wimmenauer V, Schlee M, Hartmann G (2008) Accessing the Cideciyan AV, Jacobson SG, Drack AV, Ho AC, Charng J, Garafalo AV, Roman AJ, therapeutic potential of immunostimulatory nucleic acids. Curr Opin Sumaroka A, Han IC, Hochstedler MD et al (2019) Effect of an intravitreal Immunol 20: 389 – 395 antisense oligonucleotide on vision in Leber congenital amaurosis due to Barile L, Vassalli G (2017) Exosomes: Therapy delivery tools and biomarkers of a photoreceptor cilium defect. Nat Med 25: 225 – 228 diseases. Pharmacol Ther 174: 63 – 78 Cirak S, Arechavala-Gomeza V, Guglieri M, Feng L, Torelli S, Anthony K, Abbs Bennett CF, Baker BF, Pham N, Swayze E, Geary RS (2017) Pharmacology of S, Garralda ME, Bourke J, Wells DJ et al (2011) Exon skipping and antisense drugs. Annu Rev Pharmacol Toxicol 57: 81 – 105 dystrophin restoration in patients with Duchenne muscular dystrophy Benson MD, Waddington-Cruz M, Berk JL, Polydefkis M, Dyck PJ, Wang AK, after systemic phosphorodiamidate morpholino oligomer treatment: an Plante-Bordeneuve V, Barroso FA, Merlini G, Obici L et al (2018) Inotersen open-label, phase 2, dose-escalation study. Lancet 378: 595 – 605 treatment for patients with hereditary transthyretin amyloidosis. N Engl J Cleal K, He L, Watson PD, Jones AT (2013) Endocytosis, intracellular traffic Med 379: 22 – 31 and fate of cell penetrating peptide based conjugates and nanoparticles. Betts CA, McClorey G, Healicon R, Hammond SM, Manzano R, Muses S, Ball Curr Pharm Des 19: 2878 – 2894 V, Godfrey C, Merritt TM, van Westering T et al (2019) Cmah-dystrophin Collin RW, den Hollander AI, van der Velde-Visser SD, Bennicelli J, Bennett J, deficient mdx mice display an accelerated cardiac phenotype that is Cremers FP (2012) Antisense oligonucleotide (AON)-based therapy for improved following peptide-PMO exon skipping treatment. Hum Mol Genet leber congenital amaurosis caused by a frequent mutation in CEP290. Mol 28: 396 – 406 Ther Nucleic Acids 1: e14 Biscans A, Caiazzi J, Davis S, McHugh N, Sousa J, Khvorova A (2020) The Crooke ST, Baker BF, Pham NC, Hughes SG, Kwoh TJ, Cai D, Tsimikas S, Geary chemical structure and phosphorothioate content of hydrophobically RS, Bhanot S (2018) The effects of 2’-O-methoxyethyl oligonucleotides on modified siRNAs impact extrahepatic distribution and efficacy. Nucleic renal function in humans. Nucleic Acid Ther 28: 10 – 22 Acids Res 48: 7665 – 7680 Crooke ST, Wang S, Vickers TA, Shen W, Liang XH (2017) Cellular uptake and Boisguerin P, Deshayes S, Gait MJ, O’Donovan L, Godfrey C, Betts CA, Wood trafficking of antisense oligonucleotides. Nat Biotechnol 35: 230 – 237 MJ, Lebleu B (2015) Delivery of therapeutic oligonucleotides with cell Curtis MA, Kam M, Nannmark U, Anderson MF, Axell MZ, Wikkelso C, Holtas penetrating peptides. Adv Drug Deliv Rev 87: 52 – 67 S, van Roon-Mom WM, Bjork-Eriksson T, Nordborg C et al (2007) Human Bosgra S, Sipkens J, de Kimpe S, den Besten C, Datson N, van Deutekom J neuroblasts migrate to the olfactory bulb via a lateral ventricular (2019) The pharmacokinetics of 2’-O-methyl phosphorothioate antisense extension. Science 315: 1243 – 1249 oligonucleotides: experiences from developing exon Skipping therapies for Debacker AJ, Voutila J, Catley M, Blakey D, Habib N (2020) Delivery of duchenne muscular dystrophy. Nucleic Acid Ther 29: 305 – 322 oligonucleotides to the liver with GalNAc: from research to registered Buijsen RAM, Toonen LJA, Gardiner SL, van Roon-Mom WMC (2019) Genetics, therapeutic drug. Mol Ther 28: 1759 – 1771 mechanisms, and therapeutic progress in polyglutamine spinocerebellar Dhillon S (2020) Viltolarsen: first approval. Drugs 80: 1027 – 1031 ataxias. Neurotherapeutics 16: 263 – 286 Dieckmann A, Hagedorn PH, Burki Y, Brugmann C, Berrera M, Ebeling M, Burdick AD, Sciabola S, Mantena SR, Hollingshead BD, Stanton R, Warneke JA, Singer T, Schuler F (2018) A sensitive in vitro approach to assess the Zeng M, Martsen E, Medvedev A, Makarov SS et al (2014) Sequence motifs hybridization-dependent toxic potential of high affinity gapmer associated with hepatotoxicity of locked nucleic acid–modified antisense oligonucleotides. Mol Ther Nucleic Acids 10: 45 – 54 oligonucleotides. Nucleic Acids Res 42: 4882 – 4891 Ding Y, Jiang Z, Saha K, Kim CS, Kim ST, Landis RF, Rotello VM (2014) Gold Burel SA, Hart CE, Cauntay P, Hsiao J, Machemer T, Katz M, Watt A, Bui HH, nanoparticles for nucleic acid delivery. Mol Ther 22: 1075 – 1083 Younis H, Sabripour M et al (2016) Hepatotoxicity of high affinity gapmer Dong Y, Love KT, Dorkin JR, Sirirungruang S, Zhang Y, Chen D, Bogorad RL, antisense oligonucleotides is mediated by RNase H1 dependent Yin H, Chen Y, Vegas AJ et al (2014) Lipopeptide nanoparticles for potent promiscuous reduction of very long pre-mRNA transcripts. Nucleic Acids and selective siRNA delivery in rodents and nonhuman primates. Proc Natl Res 44: 2093 – 2109 Acad Sci USA 111: 3955 – 3960 Burrer R, Neuman BW, Ting JP, Stein DA, Moulton HM, Iversen PL, Kuhn P, Du L, Kayali R, Bertoni C, Fike F, Hu H, Iversen PL, Gatti RA (2011) Arginine- Buchmeier MJ (2007) Antiviral effects of antisense morpholino oligomers rich cell-penetrating peptide dramatically enhances AMO-mediated ATM in murine coronavirus infection models. J Virol 81: 5637 – 5648 aberrant splicing correction and enables delivery to brain and cerebellum. Catuogno S, Esposito CL, De Franciscis V (2016) Aptamer-mediated targeted Hum Mol Genet 20: 3151 – 3160 delivery of therapeutics: an update. Pharmaceuticals 9: 69 Echevarria L, Aupy P, Relizani K, Bestetti T, Griffith G, Blandel F, Komisarski Catuogno S, Rienzo A, Di Vito A, Esposito CL, de Franciscis V (2015) Selective M, Haeberli A, Svinartchouk F, Garcia L et al (2019) Evaluating the impact delivery of therapeutic single strand antimiRs by aptamer-based of variable phosphorothioate content in tricyclo-DNA antisense conjugates. J Control Release 210: 147 – 159 oligonucleotides in a duchenne muscular dystrophy mouse model. Nucleic Cha W, Fan R, Miao Y, Zhou Y, Qin C, Shan X, Wan X, Li J (2017) Acid Ther 29: 148 – 160 Mesoporous silica nanoparticles as carriers for intracellular delivery of Eckstein F (2014) Phosphorothioates, essential components of therapeutic nucleic acids and subsequent therapeutic applications. Molecules oligonucleotides. Nucleic Acid Ther 24: 374 – 387 22: 782 Ellington AD, Szostak JW (1990) In vitro selection of RNA molecules that bind Chen S, Tam YYC, Lin PJC, Sung MMH, Tam YK, Cullis PR (2016) Influence of specific ligands. Nature 346: 818 – 822 particle size on the in vivo potency of lipid nanoparticle formulations of EMA (2012) Refusal of the marketing authorisation for Kynamro (mipomersen). siRNA. J Control Release 235: 236 – 244 https://www.ema.europa.eu/en/medicines/human/EPAR/kynamro Chi X, Gatti P, Papoian T (2017) Safety of antisense oligonucleotide and EMA (2016) Assessment Report: Kyndrisa EMA/439369/2016. https://www.ema. siRNA-based therapeutics. Drug Discov Today 22: 823 – 833 europa.eu/en/medicines/human/withdrawn-applications/kyndrisa 18 of 23 EMBO Molecular Medicine 13: e13243 | 2021 ª 2021 The Authors Suzan M Hammond et al EMBO Molecular Medicine EMA (2019) Volanesorsen: EU summary of product characteristics. https:// Geary RS, Baker BF, Crooke ST (2015) Clinical and preclinical www.ema.europa.eu/en/medicines/human/EPAR/waylivra pharmacokinetics and pharmacodynamics of mipomersen (kynamro((R))): Engelhardt JA, Fant P, Guionaud S, Henry SP, Leach MW, Louden C, Scicchitano a second-generation antisense oligonucleotide inhibitor of apolipoprotein MS, Weaver JL, Zabka TS, Frazier KS et al (2015) Scientific and regulatory B. Clin Pharmacokinet 54: 133 – 146 policy committee points-to-consider paper*: drug-induced vascular injury Geary RS, Henry SP, Grillone LR (2002) Fomivirsen: clinical pharmacology and associated with nonsmall molecule therapeutics in preclinical development: potential drug interactions. Clin Pharmacokinet 41: 255 – 260 part 2. Antisense oligonucleotides. Toxicol Pathol 43: 935 – 944 Geller BL, Li L, Martinez F, Sully E, Sturge CR, Daly SM, Pybus C, Greenberg Esposito CL, Nuzzo S, Kumar SA, Rienzo A, Lawrence CL, Pallini R, Shaw L, DE (2018) Morpholino oligomers tested in vitro, in biofilm and in vivo Alder JE, Ricci-Vitiani L, Catuogno S et al (2016) A combined microRNA- against multidrug-resistant Klebsiella pneumoniae. J Antimicrob Chemother based targeted therapeutic approach to eradicate glioblastoma stem-like 73: 1611 – 1619 cells. J Control Release 238: 43 – 57 Geller BL, Marshall-Batty K, Schnell FJ, McKnight MM, Iversen PL, Greenberg FDA (2018) Final Summary Minutes of the Endocrinologic and Metabolic DE (2013) Gene-silencing antisense oligomers inhibit acinetobacter growth Drugs Advisory Committee Meeting. https://www.fda.gov/media/113979/ in vitro and in vivo. J Infect Dis 208: 1553 – 1560 download Gilleron J, Querbes W, Zeigerer A, Borodovsky A, Marsico G, Schubert U, Fedorov Y, Anderson EM, Birmingham A, Reynolds A, Karpilow J, Robinson K, Manygoats K, Seifert S, Andree C, Stoter M et al (2013) Image-based Leake D, Marshall WS, Khvorova A (2006) Off-target effects by siRNA can analysis of lipid nanoparticle-mediated siRNA delivery, intracellular induce toxic phenotype. RNA 12: 1188 – 1196 trafficking and endosomal escape. Nat Biotechnol 31: 638 – 646 Felgner PL, Gadek TR, Holm M, Roman R, Chan HW, Wenz M, Northrop JP, Godfrey C, Desviat LR, Smedsrod B, Pietri-Rouxel F, Denti MA, Disterer P, Ringold GM, Danielsen M (1987) Lipofection: a highly efficient, lipid- Lorain S, Nogales-Gadea G, Sardone V, Anwar R et al (2017) Delivery is mediated DNA-transfection procedure. Proc Natl Acad Sci USA 84: key: lessons learnt from developing splice-switching antisense therapies. 7413 – 7417 EMBO Mol Med 9: 545 – 557 Finkel RS, Mercuri E, Darras BT, Connolly AM, Kuntz NL, Kirschner J, Chiriboga Goemans NM, Tulinius M, van den Hauwe M, Kroksmark AK, Buyse G, Wilson CA, Saito K, Servais L, Tizzano E et al (2017) Nusinersen versus sham RJ, van Deutekom JC, de Kimpe SJ, Lourbakos A, Campion G (2016) Long- control in infantile-onset spinal muscular atrophy. N Engl J Med 377: term efficacy, safety, and pharmacokinetics of drisapersen in duchenne 1723 – 1732 muscular dystrophy: results from an open-label extension study. PLoS One Fire A, Xu S, Montgomery MK, Kostas SA, Driver SE, Mello CC (1998) Potent 11: e0161955 and specific genetic interference by double-stranded RNA in Gonzales CR, Group VISiONCT (2005) Enhanced efficacy associated with early Caenorhabditis elegans. Nature 391: 806 – 811 treatment of neovascular age-related macular degeneration with Fitzgerald K, White S, Borodovsky A, Bettencourt BR, Strahs A, Clausen V, pegaptanib sodium: an exploratory analysis. Retina 25: 815 – 827 Wijngaard P, Horton JD, Taubel J, Brooks A et al (2017) A Highly durable Gragoudas ES, Adamis AP, Cunningham ET, Feinsod M, Guyer DR, Group RNAi therapeutic inhibitor of PCSK9. N Engl J Med 376: 41 – 51 VISiONCT (2004) Pegaptanib for neovascular age-related macular Flierl U, Nero TL, Lim B, Arthur JF, Yao Y, Jung SM, Gitz E, Pollitt AY, Zaldivia degeneration. N Engl J Med 351: 2805 – 2816 MT, Jandrot-Perrus M et al (2015) Phosphorothioate backbone Graham MJ, Lee RG, Bell 3rd TA, Fu W, Mullick AE, Alexander VJ, Singleton W, modifications of nucleotide-based drugs are potent platelet activators. Viney N, Geary R, Su J et al (2013) Antisense oligonucleotide inhibition of J Exp Med 212: 129 – 137 apolipoprotein C-III reduces plasma triglycerides in rodents, nonhuman Foged C, Nielsen HM (2008) Cell-penetrating peptides for drug delivery primates, and humans. Circ Res 112: 1479 – 1490 across membrane barriers. Exp Opin Drug Deliv 5: 105 – 117 Habrant D, Peuziat P, Colombani T, Dallet L, Gehin J, Goudeau E, Evrard B, Frazier KS (2015) Antisense oligonucleotide therapies: the promise and the Lambert O, Haudebourg T, Pitard B (2016) Design of ionizable lipids to challenges from a toxicologic pathologist’s perspective. Toxicol Pathol 43: overcome the limiting step of endosomal escape: application in the 78 – 89 intracellular delivery of mRNA, DNA, and siRNA. J Med Chem 59: Freitag F, Wagner E (2020) Optimizing synthetic nucleic acid and protein 3046 – 3062 nanocarriers: The chemical evolution approach. Adv Drug Deliv Rev 168: Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop 30 – 54 KM (2016) Intrathecal injections in children with spinal muscular atrophy: Friedman RC, Farh KK, Burge CB, Bartel DP (2009) Most mammalian mRNAs nusinersen clinical trial experience. J Child Neurol 31: 899 – 906 are conserved targets of microRNAs. Genome Res 19: 92 – 105 Hagedorn PH, Hansen BR, Koch T, Lindow M (2017) Managing the sequence- Fusser M, Overbye A, Pandya AD, Morch Y, Borgos SE, Kildal W, Snipstad S, specificity of antisense oligonucleotides in drug discovery. Nucleic Acids Sulheim E, Fleten KG, Askautrud HA et al (2019) Cabazitaxel-loaded Poly Res 45: 2262 – 2282 (2-ethylbutyl cyanoacrylate) nanoparticles improve treatment efficacy in a Hagedorn PH, Yakimov V, Ottosen S, Kammler S, Nielsen NF, Hog AM, patient derived breast cancer xenograft. J Control Release 293: 183 – 192 Hedtjarn M, Meldgaard M, Moller MR, Orum H et al (2013) Hepatotoxic Garanto A, Chung DC, Duijkers L, Corral-Serrano JC, Messchaert M, Xiao R, potential of therapeutic oligonucleotides can be predicted from their Bennett J, Vandenberghe LH, Collin RW (2016) In vitro and in vivo rescue sequence and modification pattern. Nucleic Acid Ther 23: 302 – 310 of aberrant splicing in CEP290-associated LCA by antisense Hammond SM, Hazell G, Shabanpoor F, Saleh AF, Bowerman M, Sleigh JN, oligonucleotide delivery. Hum Mol Genet 25: 2552 – 2563 Meijboom KE, Zhou H, Muntoni F, Talbot K et al (2016) Systemic Garanto A, Duijkers L, Collin RW (2015) Species-dependent splice recognition peptide-mediated oligonucleotide therapy improves long-term survival in of a cryptic exon resulting from a recurrent intronic CEP290 mutation spinal muscular atrophy. Proc Natl Acad Sci USA 113: 10962 – 10967 that causes congenital blindness. Int J Mol Sci 16: 5285 – 5298 Hanvey JC, Peffer NJ, Bisi JE, Thomson SA, Cadilla R, Josey JA, Ricca DJ, Geary RS (2009) Antisense oligonucleotide pharmacokinetics and metabolism. Hassman CF, Bonham MA, Au KG et al (1992) Antisense and antigene Expert Opin Drug Metab Toxicol 5: 381 – 391 properties of peptide nucleic acids. Science 258: 1481 – 1485 ª 2021 The Authors EMBO Molecular Medicine 13: e13243 | 2021 19 of 23 EMBO Molecular Medicine Suzan M Hammond et al Heemskerk HA, de Winter CL, de Kimpe SJ, van Kuik-Romeijn P, Heuvelmans Jayasena SD (1999) Aptamers: an emerging class of molecules that rival N, Platenburg GJ, van Ommen GJ, van Deutekom JC, Aartsma-Rus A (2009) antibodies in diagnostics. Clin Chem 45: 1628 – 1650 In vivo comparison of 2’-O-methyl phosphorothioate and morpholino Jeppesen DK, Fenix AM, Franklin JL, Higginbotham JN, Zhang Q, Zimmerman antisense oligonucleotides for Duchenne muscular dystrophy exon LJ, Liebler DC, Ping J, Liu Q, Evans R et al (2019) Reassessment of exosome skipping. J Gene Med 11: 257 – 266 composition. Cell 177: 428 – 445.e18 Heemskerk H, de Winter C, van Kuik P, Heuvelmans N, Sabatelli P, Rimessi Judge AD, Bola G, Lee AC, MacLachlan I (2006) Design of noninflammatory P, Braghetta P, van Ommen GJ, de Kimpe S, Ferlini A et al (2010) synthetic siRNA mediating potent gene silencing in vivo. Mol Ther 13: Preclinical PK and PD studies on 2’-O-methyl-phosphorothioate RNA 494 – 505 antisense oligonucleotides in the mdx mouse model. Mol Ther 18: Juliano RL, Wang L, Tavares F, Brown EG, James L, Ariyarathna Y, Ming X, 1210 – 1217 Mao C, Suto M (2018) Structure-activity relationships and cellular van der Helm MW, van der Meer AD, Eijkel JC, van den Berg A, Segerink LI mechanism of action of small molecules that enhance the delivery of (2016) Microfluidic organ-on-chip technology for blood-brain barrier oligonucleotides. Nucleic Acids Res 46: 1601 – 1613 research. Tissue Barriers 4: e1142493 Khvorova A (2017) Oligonucleotide therapeutics - a new class of cholesterol- Henry SP, Beattie G, Yeh G, Chappel A, Giclas P, Mortari A, Jagels MA, lowering drugs. N Engl J Med 376: 4 – 7 Kornbrust DJ, Levin AA (2002) Complement activation is responsible for Kim HJ, Huh D, Hamilton G, Ingber DE (2012) Human gut-on-a-chip acute toxicities in rhesus monkeys treated with a phosphorothioate inhabited by microbial flora that experiences intestinal peristalsis-like oligodeoxynucleotide. Int Immunopharmacol 2: 1657 – 1666 motions and flow. Lab Chip 12: 2165 – 2174 Henry SP, Giclas PC, Leeds J, Pangburn M, Auletta C, Levin AA, Kornbrust DJ Kim J, Hu C, Moufawad El Achkar C, Black LE, Douville J, Larson A, Pendergast MK, (1997a) Activation of the alternative pathway of complement by a Goldkind SF, Lee EA, Kuniholm A et al (2019) Patient-customized oligonucleotide phosphorothioate oligonucleotide: potential mechanism of action. therapy for a rare genetic disease. N Engl J Med 381: 1644 – 1652 J Pharmacol Exp Ther 281: 810 – 816 Klein AF, Varela MA, Arandel L, Holland A, Naouar N, Arzumanov A, Seoane D, Henry SP, Miner RC, Drew WL, Fitchett J, York-Defalco C, Rapp LM, Levin AA (2001) Revillod L, Bassez G, Ferry A et al (2019) Peptide-conjugated Antiviral activity and ocular kinetics of antisense oligonucleotides designed to oligonucleotides evoke long-lasting myotonic dystrophy correction in inhibit CMV replication. Invest Ophthalmol Vis Sci 42: 2646 – 2651 patient-derived cells and mice. J Clin Invest 129: 4739 – 4744 Henry SP, Narayanan P, Shen L, Bhanot S, Younis HS, Burel SA (2017) Assessment Kline JN, Krieg AM (2008) Toll-like receptor 9 activation with CpG of the effects of 2’-methoxyethyl antisense oligonucleotides on platelet count oligodeoxynucleotides for asthma therapy. Drug News Perspect 21: in cynomolgus nonhuman primates. Nucleic Acid Ther 27: 197 – 208 434 – 439 Henry SP, Novotny W, Leeds J, Auletta C, Kornbrust DJ (1997b) Inhibition of Koshkin AA, Singh SK, Nielsen P, Rajwanshi VK, Kumar R, Meldgaard M, Olsen coagulation by a phosphorothioate oligonucleotide. Antisense Nucleic Acid CE, Wengel J (1998) LNA (Locked Nucleic Acids): synthesis of the adenine, Drug Dev 7: 503 – 510 cytosine, guanine, 5-methylcytosine, thymine and uracil bicyclonucleoside Henry SP, Seguin R, Cavagnaro J, Berman C, Tepper J, Kornbrust D (2016) monomers, oligomerisation, and unprecedented nucleic acid recognition. Considerations for the characterization and interpretation of results Tetrahedron 54: 3607 – 3630 related to alternative complement activation in monkeys associated with Kozlu S, Caban S, Yerlikaya F, Fernandez-Megia E, Novoa-Carballal R, Riguera oligonucleotide-based therapeutics. Nucleic Acid Ther 26: 210 – 215 R, Yemisci M, Gursoy-Ozdemir Y, Dalkara T, Couvreur P et al (2014) An Heo YA (2020) Golodirsen: first approval. Drugs 80: 329 – 333 aquaporin 4 antisense oligonucleotide loaded, brain targeted den Hollander AI, Koenekoop RK, Yzer S, Lopez I, Arends ML, Voesenek KE, nanoparticulate system design. Pharmazie 69: 340 – 345 Zonneveld MN, Strom TM, Meitinger T, Brunner HG et al (2006) Mutations Krieg AM (1998) The CpG motif: implications for clinical immunology. in the CEP290 (NPHP6) gene are a frequent cause of Leber congenital BioDrugs 10: 341 – 346 amaurosis. Am J Hum Genet 79: 556 – 561 Krieg AM (2006) Therapeutic potential of Toll-like receptor 9 activation. Nat Hsu WH, Csaba N, Alexander C, Garcia-Fuentes M (2020) Polyphosphazenes Rev Drug Discov 5: 471 – 484 for the delivery of biopharmaceuticals. J Appl Polym Sci 137: 48688 Krieg AM (2007) Antiinfective applications of toll-like receptor 9 agonists. Proc Huh D, Matthews BD, Mammoto A, Montoya-Zavala M, Hsin HY, Ingber DE Am Thorac Soc 4: 289 – 294 (2010) Reconstituting organ-level lung functions on a chip. Science 328: Krieg AM, Davis HL (2001) Enhancing vaccines with immune stimulatory CpG 1662 – 1668 DNA. Curr Opin Mol Ther 3: 15 – 24 Jaax ME, Krauel K, Marschall T, Brandt S, Gansler J, Furll B, Appel B, Fischer S, Kulkarni JA, Witzigmann D, Leung J, van der Meel R, Zaifman J, Darjuan MM, Block S, Helm CA et al (2013) Complex formation with nucleic acids and Grisch-Chan HM, Thony B, Tam YYC, Cullis PR (2019) Fusion-dependent aptamers alters the antigenic properties of platelet factor 4. Blood 122: formation of lipid nanoparticles containing macromolecular payloads. 272 – 281 Nanoscale 11: 9023 – 9031 Janas MM, Schlegel MK, Harbison CE, Yilmaz VO, Jiang Y, Parmar R, Zlatev I, Lankveld DP, Van Loveren H, Baken KA, Vandebriel RJ (2010) In vitro testing Castoreno A, Xu H, Shulga-Morskaya S et al (2018) Selection of GalNAc- for direct immunotoxicity: state of the art. Methods Mol Biol 598: conjugated siRNAs with limited off-target-driven rat hepatotoxicity. Nat 401 – 423 Commun 9: 723 Lee HJ, Boado RJ, Braasch DA, Corey DR, Pardridge WM (2002) Imaging gene Jarver P, O’Donovan L, Gait MJ (2014) A chemical view of oligonucleotides for expression in the brain in vivo in a transgenic mouse model of exon skipping and related drug applications. Nucleic Acid Ther 24: 37 – 47 Huntington’s disease with an antisense radiopharmaceutical and drug- Jayaraman M, Ansell SM, Mui BL, Tam YK, Chen J, Du X, Butler D, Eltepu L, targeting technology. J Nucl Med 43: 948 – 956 Matsuda S, Narayanannair JK et al (2012) Maximizing the potency of Lee H, Kim DS, Ha SK, Choi I, Lee JM, Sung JH (2017) A pumpless multi- siRNA lipid nanoparticles for hepatic gene silencing in vivo. Angew Chem organ-on-a-chip (MOC) combined with a pharmacokinetic- 51: 8529 – 8533 pharmacodynamic (PK-PD) model. Biotechnol Bioeng 114: 432 – 443 20 of 23 EMBO Molecular Medicine 13: e13243 | 2021 ª 2021 The Authors Suzan M Hammond et al EMBO Molecular Medicine Lee KY, Mooney DJ (2012) Alginate: properties and biomedical applications. Mignani S, Shi X, Zablocka M, Majoral JP (2019) Dendrimer-enabled Prog Polym Sci 37: 106 – 126 therapeutic antisense delivery systems as innovation in medicine. Lee RT, Lin P, Lee YC (1984) New synthetic cluster ligands for galactose/N- Bioconjug Chem 30: 1938 – 1950 acetylgalactosamine-specific lectin of mammalian liver. Biochemistry 23: Miller JW, Urbinati CR, Teng-Umnuay P, Stenberg MG, Byrne BJ, Thornton CA, 4255 – 4261 Swanson MS (2000) Recruitment of human muscleblind proteins to (CUG) Lehto T, Ezzat K, Wood MJA, El Andaloussi S (2016) Peptides for nucleic acid (n) expansions associated with myotonic dystrophy. EMBO J 19: delivery. Adv Drug Deliv Rev 106: 172 – 182 4439 – 4448 Levin AA, Henry SP (2008) Toxicology of oligonucleotide therapeutics and Mitrpant C, Adams AM, Meloni PL, Muntoni F, Fletcher S, Wilton SD (2009) understanding the relevance of the toxicities. In Preclinical safety evaluation Rational design of antisense oligomers to induce dystrophin exon of biopharmaceuticals: a science-based approach to facilitating clinical trials, skipping. Mol Ther 17: 1418 – 1426 Cavagnaro JA (ed), pp 537 – 574. Hoboken, NJ: John Wiley & Sons Inc Moisan A, Gubler M, Zhang JD, Tessier Y, Dumong Erichsen K, Sewing S, Li JY, Ren YP, Yuan Y, Ji SM, Zhou SP, Wang LJ, Mou ZZ, Li L, Lu W, Zhou TY Gerard R, Avignon B, Huber S, Benmansour F et al (2017) Inhibition of EGF (2016) Preclinical PK/PD model for combined administration of erlotinib uptake by nephrotoxic antisense drugs in vitro and implications for and sunitinib in the treatment of A549 human NSCLC xenograft mice. preclinical safety profiling. Mol Ther Nucleic Acids 6: 89 – 105 Acta Pharmacol Sin 37: 930 – 940 Monia BP, Lesnik EA, Gonzalez C, Lima WF, McGee D, Guinosso CJ, Kawasaki Liang XH, Shen W, Sun H, Kinberger GA, Prakash TP, Nichols JG, Crooke ST AM, Cook PD, Freier SM (1993) Evaluation of 2’-modified oligonucleotides (2016a) Hsp90 protein interacts with phosphorothioate oligonucleotides containing 2’-deoxy gaps as antisense inhibitors of gene expression. J Biol containing hydrophobic 2’-modifications and enhances antisense activity. Chem 268: 14514 – 14522 Nucleic Acids Res 44: 3892 – 3907 Monteith DK, Henry SP, Howard RB, Flournoy S, Levin AA, Bennett CF, Crooke Liang XH, Shen W, Sun H, Migawa MT, Vickers TA, Crooke ST (2016b) ST (1997) Immune stimulation–a class effect of phosphorothioate Translation efficiency of mRNAs is increased by antisense oligonucleotides oligodeoxynucleotides in rodents. Anticancer Drug Des 12: 421 – 432 targeting upstream open reading frames. Nat Biotechnol 34: 875 – 880 Morgan E, Wupperfeld D, Morales D, Reich N (2019) Shape matters: gold Liang XH, Sun H, Shen W, Wang S, Yao J, Migawa MT, Bui HH, Damle SS, nanoparticle shape impacts the biological activity of siRNA delivery. Riney S, Graham MJ et al (2017) Antisense oligonucleotides targeting Bioconjug Chem 30: 853 – 860 translation inhibitory elements in 5’ UTRs can selectively increase protein Muller TD, Finan B, Bloom SR, D’Alessio D, Drucker DJ, Flatt PR, Fritsche A, levels. Nucleic Acids Res 45: 9528 – 9546 Gribble F, Grill HJ, Habener JF et al (2019) Glucagon-like peptide 1 (GLP-1). Lindow M, Vornlocher HP, Riley D, Kornbrust DJ, Burchard J, Whiteley LO, Mol Metab 30: 72 – 130 Kamens J, Thompson JD, Nochur S, Younis H et al (2012) Assessing Narayanan P, Shen L, Curtis BR, Bourdon MA, Nolan JP, Gupta S, Hoffmaster unintended hybridization-induced biological effects of oligonucleotides. C, Zhou F, Christian B, Schaubhut JL et al (2018) Investigation into the Nat Biotechnol 30: 920 – 923 mechanism(s) that leads to platelet decreases in Cynomolgus monkeys Malmsten M (2013) Inorganic nanomaterials as delivery systems for proteins, during administration of ISIS 104838, a 2’-MOE-modified antisense peptides, DNA, and siRNA. Curr Opin Colloid Interface Sci 18: 468 – 480 oligonucleotide. Toxicol Sci 164: 613 – 626 Marwick C (1998) First "antisense" drug will treat CMV retinitis. JAMA 280: 871 Negus SS, Banks ML (2018) Pharmacokinetic-pharmacodynamic (PKPD) Mathew V, Wang AK (2019) Inotersen: new promise for the treatment of analysis with drug discrimination. Curr Top Behav Neurosci 39: 245 – 259 hereditary transthyretin amyloidosis. Drug Design Dev Ther 13: Ng EW, Shima DT, Calias P, Cunningham Jr ET, Guyer DR, Adamis AP (2006) 1515 – 1525 Pegaptanib, a targeted anti-VEGF aptamer for ocular vascular disease. Nat Matsuda S, Keiser K, Nair JK, Charisse K, Manoharan RM, Kretschmer P, Peng Rev Drug Discov 5: 123 – 132 CG, Kelin AV, Kandasamy P, Willoughby JL et al (2015) siRNA conjugates Nielsen PE, Egholm M, Berg RH, Buchardt O (1991) Sequence-selective carrying sequentially assembled trivalent N-acetylgalactosamine linked recognition of DNA by strand displacement with a thymine-substituted through nucleosides elicit robust gene silencing in vivo in hepatocytes. polyamide. Science 254: 1497 – 1500 ACS Chem Biol 10: 1181 – 1187 Obika S, Nanbu D, Hari Y, Andoh J-I, Morio K-I, Doi T, Imanishi T (1998) McAleer CW, Pointon A, Long CJ, Brighton RL, Wilkin BD, Bridges LR, Stability and structural features of the duplexes containing nucleoside Narasimhan Sriram N, Fabre K, McDougall R, Muse VP et al (2019) On the analogues with a fixed N-type conformation, 20 -O, 40 -C- potential of in vitro organ-chip models to define temporal methyleneribonucleosides. Tetrahedron Lett 39: 5401 – 5404 pharmacokinetic-pharmacodynamic relationships. Sci Rep 9: 9619 Osborn MF, Coles AH, Biscans A, Haraszti RA, Roux L, Davis S, Ly S, Echeverria McGregor TL, Hunt KA, Yee E, Mason D, Nioi P, Ticau S, Pelosi M, Loken PR, D, Hassler MR, Godinho B et al (2019) Hydrophobicity drives the systemic Finer S, Lawlor DA et al (2020) Characterising a healthy adult with a rare distribution of lipid-conjugated siRNAs via lipid transport pathways. HAO1 knockout to support a therapeutic strategy for primary Nucleic Acids Res 47: 1070 – 1081 hyperoxaluria. Elife 9: e54363 Pardridge WM (2007) Blood-brain barrier delivery. Drug Discov Today 12: McNamara 2nd JO, Andrechek ER, Wang Y, Viles KD, Rempel RE, Gilboa E, 54 – 61 Sullenger BA, Giangrande PH (2006) Cell type-specific delivery of siRNAs Parfitt DA, Lane A, Ramsden CM, Carr AJ, Munro PM, Jovanovic K, Schwarz N, with aptamer-siRNA chimeras. Nat Biotechnol 24: 1005 – 1015 Kanuga N, Muthiah MN, Hull S et al (2016) Identification and correction van der Meer AD, van den Berg A (2012) Organs-on-chips: breaking the of mechanisms underlying inherited blindness in human iPSC-derived in vitro impasse. Integr Biol 4: 461 – 470 optic cups. Cell Stem Cell 18: 769 – 781 Mercuri E, Darras BT, Chiriboga CA, Day JW, Campbell C, Connolly AM, Pathan M, Fonseka P, Chitti SV, Kang T, Sanwlani R, Van Deun J, Hendrix A, Iannaccone ST, Kirschner J, Kuntz NL, Saito K et al (2018) Nusinersen versus Mathivanan S (2019) Vesiclepedia 2019: a compendium of RNA, proteins, sham control in later-onset spinal muscular atrophy. N Engl J Med 378: lipids and metabolites in extracellular vesicles. Nucleic Acids Res 47: 625 – 635 D516 – D519 ª 2021 The Authors EMBO Molecular Medicine 13: e13243 | 2021 21 of 23 EMBO Molecular Medicine Suzan M Hammond et al Peng Y, Zhu X, Qiu L (2016) Electroneutral composite polymersomes self- Seo J, Byun WY, Alisafaei F, Georgescu A, Yi YS, Massaro-Giordano M, Shenoy assembled by amphiphilic polyphosphazenes for effective miR-200c in vivo VB, Lee V, Bunya VY, Huh D (2019) Multiscale reverse engineering of the delivery to inhibit drug resistant lung cancer. Biomaterials 106: 1 – 12 human ocular surface. Nat Med 25: 1310 – 1318 Penichet ML, Kang YS, Pardridge WM, Morrison SL, Shin SU (1999) An Sewing S, Boess F, Moisan A, Bertinetti-Lapatki C, Minz T, Hedtjaern M, antibody-avidin fusion protein specific for the transferrin receptor serves Tessier Y, Schuler F, Singer T, Roth AB (2016) Establishment of a predictive as a delivery vehicle for effective brain targeting: initial applications in in vitro assay for assessment of the hepatotoxic potential of anti-HIV antisense drug delivery to the brain. J Immunol 163: 4421 – 4426 oligonucleotide drugs. PLoS One 11: e0159431 Pooga M, Langel U (2015) Classes of Cell-Penetrating Peptides. Methods Mol Sewing S, Roth AB, Winter M, Dieckmann A, Bertinetti-Lapatki C, Tessier Y, Biol 1324: 3 – 28 McGinnis C, Huber S, Koller E, Ploix C et al (2017) Assessing single- Prakash TP, Mullick AE, Lee RG, Yu J, Yeh ST, Low A, Chappell AE, Ostergaard stranded oligonucleotide drug-induced effects in vitro reveals key risk ME, Murray S, Gaus HJ et al (2019) Fatty acid conjugation enhances factors for thrombocytopenia. PLoS One 12: e0187574 potency of antisense oligonucleotides in muscle. Nucleic Acids Res 47: Shaffer C (2020) Mist begins to clear for lung delivery of RNA. Nat Biotechnol 6029 – 6044 38: 1110 – 1112 Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F (2013) Genome Sheehan JP, Lan HC (1998) Phosphorothioate oligonucleotides inhibit the engineering using the CRISPR-Cas9 system. Nat Protoc 8: 2281 – 2308 intrinsic tenase complex. Blood 92: 1617 – 1625 Ray KK, Wright RS, Kallend D, Koenig W, Leiter LA, Raal FJ, Bisch JA, Shen L, Engelhardt JA, Hung G, Yee J, Kikkawa R, Matson J, Tayefeh B, Richardson T, Jaros M, Wijngaard PLJ et al (2020) Two phase 3 trials of Machemer T, Giclas PC, Henry SP (2016) Effects of repeated complement inclisiran in patients with elevated LDL cholesterol. N Engl J Med 382: activation associated with chronic treatment of cynomolgus monkeys 1507 – 1519 with 2’-O-methoxyethyl modified antisense oligonucleotide. Nucleic Acid Renneberg D, Leumann CJ (2002) Watson-Crick base-pairing properties of Ther 26: 236 – 249 tricyclo-DNA. J Am Chem Soc 124: 5993 – 6002 Shen W, De Hoyos CL, Migawa MT, Vickers TA, Sun H, Low A, Bell 3rd TA, Rezvantalab S, Drude NI, Moraveji MK, Guvener N, Koons EK, Shi Y, Lammers Rahdar M, Mukhopadhyay S, Hart CE et al (2019) Chemical modification T, Kiessling F (2018) PLGA-based nanoparticles in cancer treatment. Front of PS-ASO therapeutics reduces cellular protein-binding and improves the Pharmacol 9: 1260 therapeutic index. Nat Biotechnol 37: 640 – 650 Rivera-Barahona A, Sanchez-Alcudia R, Viecelli HM, Rufenacht V, Perez B, Shi B, Keough E, Matter A, Leander K, Young S, Carlini E, Sachs AB, Tao W, Ugarte M, Haberle J, Thony B, Desviat LR (2015) Functional Abrams M, Howell B et al (2011) Biodistribution of small interfering RNA characterization of the spf/ash splicing variation in OTC deficiency of mice at the organ and cellular levels after lipid nanoparticle-mediated delivery. and man. PLoS One 10: e0122966 J Histochem Cytochem 59: 727 – 740 Roberts TC, Langer R, Wood MJA (2020) Advances in oligonucleotide drug Shinha K, Nihei W, Ono T, Nakazato R, Kimura H (2020) A pharmacokinetic– delivery. Nat Rev Drug Discov 19: 673 – 694 pharmacodynamic model based on multi-organ-on-a-chip for drug–drug Ruckman J, Green LS, Beeson J, Waugh S, Gillette WL, Henninger DD, interaction studies. Biomicrofluidics 14: 44108 Claesson-Welsh L, Janjic N (1998) 2’-Fluoropyrimidine RNA-based Singh NK, Singh NN, Androphy EJ, Singh RN (2006) Splicing of a critical exon aptamers to the 165-amino acid form of vascular endothelial growth of human Survival Motor Neuron is regulated by a unique silencer factor (VEGF165). Inhibition of receptor binding and VEGF-induced element located in the last intron. Mol Cell Biol 26: 1333 – 1346 vascular permeability through interactions requiring the exon 7-encoded Smulevitch SV, Simmons CG, Norton JC, Wise TW, Corey DR (1996) domain. J Biol Chem 273: 20556 – 20567 Enhancement of strand invasion by oligonucleotides through Rudin CM, Holmlund J, Fleming GF, Mani S, Stadler WM, Schumm P, Monia BP, manipulation of backbone charge. Nat Biotechnol 14: 1700 – 1704 Johnston JF, Geary R, Yu RZ et al (2001) Phase I Trial of ISIS 5132, an antisense Soldevilla MM, Meraviglia-Crivelli de Caso D, Menon AP, Pastor F (2018) oligonucleotide inhibitor of c-raf-1, administered by 24-hour weekly infusion Aptamer-iRNAs as therapeutics for cancer treatment. Pharmaceuticals to patients with advanced cancer. Clin Cancer Res 7: 1214 – 1220 11: 108 Sardh E, Harper P, Balwani M, Stein P, Rees D, Bissell DM, Desnick R, Parker C, Song E, Zhu P, Lee SK, Chowdhury D, Kussman S, Dykxhoorn DM, Feng Y, Phillips J, Bonkovsky HL et al (2019) Phase 1 trial of an RNA interference Palliser D, Weiner DB, Shankar P et al (2005) Antibody mediated in vivo therapy for acute intermittent porphyria. N Engl J Med 380: 549 – 558 delivery of small interfering RNAs via cell-surface receptors. Nat Biotechnol Schoch KM, Miller TM (2017) Antisense oligonucleotides: translation from 23: 709 – 717 mouse models to human neurodegenerative diseases. Neuron 94: Starner CI, Gleason PP (2019) Spinal muscular atrophy therapies: ICER 1056 – 1070 grounds the price to value conversation in facts. J Manage Care Special Schwartz AL, Rup D, Lodish HF (1980) Difficulties in the quantification of Pharm 25: 1306 – 1308 asialoglycoprotein receptors on the rat hepatocyte. J Biol Chem 255: Stein CA, Hansen JB, Lai J, Wu S, Voskresenskiy A, Hog A, Worm J, Hedtjarn M, 9033 – 9036 Souleimanian N, Miller P et al (2010) Efficient gene silencing by delivery Semple SC, Klimuk SK, Harasym TO, Dos Santos N, Ansell SM, Wong KF, of locked nucleic acid antisense oligonucleotides, unassisted by Maurer N, Stark H, Cullis PR, Hope MJ et al (2001) Efficient encapsulation transfection reagents. Nucleic Acids Res 38: e3 of antisense oligonucleotides in lipid vesicles using ionizable aminolipids: Stein H, Hausen P (1969) Enzyme from calf thymus degrading the RNA formation of novel small multilamellar vesicle structures. Biochim Biophys moiety of DNA-RNA Hybrids: effect on DNA-dependent RNA polymerase. Acta 1510: 152 – 166 Science 166: 393 – 395 Senn JJ, Burel S, Henry SP (2005) Non-CpG-containing antisense 2’- Steinbacher JL, Landry CC (2014) Adsorption and release of siRNA from methoxyethyl oligonucleotides activate a proinflammatory response porous silica. Langmuir 30: 4396 – 4405 independent of Toll-like receptor 9 or myeloid differentiation factor 88. J Sugo T, Terada M, Oikawa T, Miyata K, Nishimura S, Kenjo E, Ogasawara- Pharmacol Exp Ther 314: 972 – 979 Shimizu M, Makita Y, Imaichi S, Murata S et al (2016) Development of 22 of 23 EMBO Molecular Medicine 13: e13243 | 2021 ª 2021 The Authors Suzan M Hammond et al EMBO Molecular Medicine antibody-siRNA conjugate targeted to cardiac and skeletal muscles. J Wathion N (2002) Public Statement on Vitravene (fomivirsen). https://www.e Control Release 237: 1 – 13 ma.europa.eu/en/documents/public-statement/public-statement-vitravene- Suhr OB, Coelho T, Buades J, Pouget J, Conceicao I, Berk J, Schmidt H, fomivirsen-withdrawal-marketing-authorisation-european-union_en.pdf Waddington-Cruz M, Campistol JM, Bettencourt BR et al (2015) Efficacy Watts JK, Deleavey GF, Damha MJ (2008) Chemically modified siRNA: tools and safety of patisiran for familial amyloidotic polyneuropathy: a phase II and applications. Drug Discov Today 13: 842 – 855 multi-dose study. Orphanet J Rare Dis 10: 109 Westein E, van der Meer AD, Kuijpers MJ, Frimat JP, van den Berg A, Summerton J, Weller D (1997) Morpholino antisense oligomers: design, Heemskerk JW (2013) Atherosclerotic geometries exacerbate pathological preparation, and properties. Antisense Nucleic Acid Drug Dev 7: 187 – 195 thrombus formation poststenosis in a von Willebrand factor-dependent Szebeni J (2018) Mechanism of nanoparticle-induced hypersensitivity in pigs: manner. Proc Natl Acad Sci USA 110: 1357 – 1362 complement or not complement? Drug Discov Today 23: 487 – 492 Wiklander OPB, Brennan MA, Lotvall J, Breakefield XO, El Andaloussi S (2019) Taetz S, Nafee N, Beisner J, Piotrowska K, Baldes C, Murdter TE, Huwer H, Advances in therapeutic applications of extracellular vesicles. Sci Transl Schneider M, Schaefer UF, Klotz U et al (2009) The influence of chitosan Med 11: eaav8521 content in cationic chitosan/PLGA nanoparticles on the delivery efficiency Willms E, Cabanas C, Mager I, Wood MJA, Vader P (2018) Extracellular vesicle of antisense 2’-O-methyl-RNA directed against telomerase in lung cancer heterogeneity: subpopulations, isolation techniques, and diverse functions cells. Eur J Pharma Biopharm 72: 358 – 369 in cancer progression. Front Immunol 9: 738 Takahashi K, Tanabe K, Ohnuki M, Narita M, Ichisaka T, Tomoda K, Yamanaka Wong E, Goldberg T (2014) Mipomersen (kynamro): a novel antisense S (2007) Induction of pluripotent stem cells from adult human fibroblasts oligonucleotide inhibitor for the management of homozygous familial by defined factors. Cell 131: 861 – 872 hypercholesterolemia. P T 39: 119 – 122 Takahashi K, Yamanaka S (2006) Induction of pluripotent stem cells from Wu H, Lima WF, Zhang H, Fan A, Sun H, Crooke ST (2004) Determination of mouse embryonic and adult fibroblast cultures by defined factors. Cell the role of the human RNase H1 in the pharmacology of DNA-like 126: 663 – 676 antisense drugs. J Biol Chem 279: 17181 – 17189 Teasdale I (2019) Stimuli-responsive phosphorus-based polymers. Eur J Inorg Yang T, Fogarty B, LaForge B, Aziz S, Pham T, Lai L, Bai S (2017) Delivery of Chem 2019: 1445 – 1456 small interfering RNA to inhibit vascular endothelial growth factor in Thanki K, Zeng X, Justesen S, Tejlmann S, Falkenberg E, Van Driessche E, zebrafish using natural brain endothelia cell-secreted exosome Morck Nielsen H, Franzyk H, Foged C (2017) Engineering of small nanovesicles for the treatment of brain cancer. AAPS J 19: 475 – 486 interfering RNA-loaded lipidoid-poly(DL-lactic-co-glycolic acid) hybrid Yao YD, Sun TM, Huang SY, Dou S, Lin L, Chen JN, Ruan JB, Mao CQ, Yu FY, nanoparticles for highly efficient and safe gene silencing: A quality by Zeng MS et al (2012) Targeted delivery of PLK1-siRNA by ScFv suppresses design-based approach. Eur J Pharma Biopharma 120: 22 – 33 Her2+ breast cancer growth and metastasis. Sci Transl Med 4: 130ra148 Thomas GS, Cromwell WC, Ali S, Chin W, Flaim JD, Davidson M (2013) Younis HS, Vickers T, Levin AA, Henry SP (2006) CpG and Non-CpG Mipomersen, an apolipoprotein B synthesis inhibitor, reduces atherogenic oligodeoxynucleotides induce differential proinflammatory gene expression lipoproteins in patients with severe hypercholesterolemia at high profiles in liver and peripheral blood leukocytes in mice. J Immunotoxicol 3: cardiovascular risk: a randomized, double-blind, placebo-controlled trial. J 57 – 68 Am Coll Cardiol 62: 2178 – 2184 Yu AM, Choi YH, Tu MJ (2020) RNA drugs and RNA targets for small molecules: Tuerk C, Gold L (1990) Systematic evolution of ligands by exponential enrichment: principles, progress, and challenges. Pharmacol Rev 72: 862 – 898 RNA ligands to bacteriophage T4 DNA polymerase. Science 249: 505 – 510 Yu RZ, Lemonidis KM, Graham MJ, Matson JE, Crooke RM, Tribble DL, Wedel Vitravene Study G (2002) A randomized controlled clinical trial of intravitreous MK, Levin AA, Geary RS (2009) Cross-species comparison of in vivo PK/PD fomivirsen for treatment of newly diagnosed peripheral cytomegalovirus relationships for second-generation antisense oligonucleotides targeting retinitis in patients with AIDS. Am J Ophthalmol 133: 467 – 474 apolipoprotein B-100. Biochem Pharmacol 77: 910 – 919 Voit T, Topaloglu H, Straub V, Muntoni F, Deconinck N, Campion G, De Kimpe SJ, Zamecnik PC, Stephenson ML (1978) Inhibition of Rous sarcoma virus Eagle M, Guglieri M, Hood S et al (2014) Safety and efficacy of drisapersen for replication and cell transformation by a specific oligodeoxynucleotide. the treatment of Duchenne muscular dystrophy (DEMAND II): an exploratory, Proc Natl Acad Sci USA 75: 280 – 284 randomised, placebo-controlled phase 2 study. Lancet Neurol 13: 987 – 996 Zhang A, Uaesoontrachoon K, Shaughnessy C, Das JR, Rayavarapu S, Brown Vollmer J, Weeratna RD, Jurk M, Samulowitz U, McCluskie MJ, Payette P, KJ, Ray PE, Nagaraju K, van den Anker JN, Hoffman EP et al (2015) The use Davis HL, Schetter C, Krieg AM (2004) Oligodeoxynucleotides lacking CpG of urinary and kidney SILAM proteomics to monitor kidney response to dinucleotides mediate Toll-like receptor 9 dependent T helper type 2 high dose morpholino oligonucleotides in the mdx mouse. Toxicol Rep 2: biased immune stimulation. Immunology 113: 212 – 223 838 – 849 Wahlestedt C, Salmi P, Good L, Kela J, Johnsson T, Hokfelt T, Broberger C, Porreca F, Lai J, Ren K et al (2000) Potent and nontoxic antisense oligonucleotides License: This is an open access article under the containing locked nucleic acids. Proc Natl Acad Sci USA 97: 5633 – 5638 terms of the Creative Commons Attribution License, Wang S, Allen N, Prakash TP, Liang XH, Crooke ST (2019) Lipid conjugates which permits use, distribution and reproduction in enhance endosomal release of antisense oligonucleotides into cells. any medium, provided the original work is properly Nucleic Acid Ther 29: 245 – 255 cited. ª 2021 The Authors EMBO Molecular Medicine 13: e13243 | 2021 23 of 23