ORIGINAL RESEARCH published: 22 March 2021 doi: 10.3389/fmicb.2021.645530 The P1 Protein of Watermelon mosaic virus Compromises the Activity as RNA Silencing Suppressor of the P25 Protein of Cucurbit yellow stunting disorder virus Maria Luisa Domingo-Calap 1,2, Ornela Chase 1, Mariona Estapé 1,3, Ana Beatriz Moreno 1 Edited by: and Juan José López-Moya 1,4* Rajarshi Kumar Gaur, Deen Dayal Upadhyay Gorakhpur 1 Centre for Research in Agricultural Genomics (CRAG), CSIC-IRTA-UAB-UB, Campus UAB Bellaterra, Barcelona, Spain, University, India 2 Instituto Valencia de Investigaciones Agrarias, IVIA, Valencia, Spain, 3 Universitair Medisch Centrum, UMC, Utrecht, Reviewed by: Netherlands, 4 Consejo Superior de Investigaciones Científicas (CSIC), Barcelona, Spain Chrisa Orfanidou, Aristotle University of Thessaloniki, Greece Mixed viral infections in plants involving a potyvirus and other unrelated virus often result Narayan Rishi, in synergistic effects, with significant increases in accumulation of the non-potyvirus Amity University, India partner, as in the case of melon plants infected by the potyvirus Watermelon mosaic virus *Correspondence: (WMV) and the crinivirus Cucurbit yellow stunting disorder virus (CYSDV). To further explore Juan José López-Moya juanjose.lopez@cragenomica.es the synergistic interaction between these two viruses, the activity of RNA silencing suppressors (RSSs) was addressed in transiently co-expressed combinations of Specialty section: heterologous viral products in Nicotiana benthamiana leaves. While the strong RSS activity This article was submitted to Virology, of WMV Helper Component Proteinase (HCPro) was unaltered, including no evident a section of the journal additive effects observed when co-expressed with the weaker CYSDV P25, an unexpected Frontiers in Microbiology negative effect of WMV P1 was found on the RSS activity of P25. Analysis of protein Received: 23 December 2020 Accepted: 02 March 2021 expression during the assays showed that the amount of P25 was not reduced when Published: 22 March 2021 co-expressed with P1. The detrimental action of P1 on the activity of P25 was dose- Citation: dependent, and the subcellular localization of fluorescently labeled variants of P1 and Domingo-Calap ML, Chase O, P25 when transiently co-expressed showed coincidences both in nucleus and cytoplasm. Estapé M, Moreno AB and López-Moya JJ (2021) The P1 Also, immunoprecipitation experiments showed interaction of tagged versions of the two Protein of Watermelon mosaic virus proteins. This novel interaction, not previously described in other combinations of Compromises the Activity as RNA Silencing Suppressor of the P25 potyviruses and criniviruses, might play a role in modulating the complexities of the Protein of Cucurbit yellow stunting response to multiple viral infections in susceptible plants. disorder virus. Front. Microbiol. 12:645530. Keywords: RNA silencing suppression, watermelon mosaic potyvirus, cucurbit yellow stunting disease crinivirus, doi: 10.3389/fmicb.2021.645530 plant virus mixed infection, virus pathogenesis in plants Frontiers in Microbiology | www.frontiersin.org 1 March 2021 | Volume 12 | Article 645530 Domingo-Calap et al. WMV Affects CYSDV Silencing Suppression INTRODUCTION characteristics of the genus (Revers and García, 2015; Valli et al., 2015; Gibbs et al., 2020), and a remarkable natural The simultaneous presence of two unrelated viruses in mixed- variability (Moreno et al., 2004; Desbiez et al., 2011; Verma infected plants can lead to different outcomes, including et al., 2020). CYSDV is a whitefly-transmitted crinivirus synergisms, antagonisms, and neutral interactions (Syller, 2012; (Abrahamian and Abou-Jawdah, 2014; Wintermantel et al., 2017), Syller and Grupa, 2016; Moreno and López-Moya, 2020). Despite and less widespread than WMV although lately it is becoming being a situation common in natural conditions, our knowledge an emergent problem together with other whitefly-transmitted of the interactions taking place in mixed infections is still rather viruses (Navas-Castillo et al., 2011, 2014). We have already limited, even for those combinations that cause plant diseases characterized the dynamic accumulation of these two partner with more than one etiological viral agent. Particularly unknown viruses in melon and explored how that influences their vector- is how the virus-virus interactions could influence pathogenicity mediated dissemination (Domingo-Calap et al., 2020), although and condition the ecology and evolution of viruses, even resulting many molecular details of their interaction remained unaddressed, in generation of new variants or shaping the genetic structure such as those dealing with RNA silencing processes. of viral populations (Tollenaere et al., 2016; Alcaide et al., 2020). To infect a host plant, viruses need to counteract its RNA Hence, a better knowledge of virus-virus interactions during silencing mechanism, considered an innate immune response mixed infections might be valuable for deploying efficient and (Voinnet, 2001; Baulcombe, 2004), by producing suppressor durable virus control strategies (Syller, 2012; Wu et al., 2019). proteins that target different steps of the pathway to block Although the outcome of a mixed infection is difficult to this antiviral response (Csorba et al., 2015). In CYSDV, the predict in general, synergistic interactions are often expected role of RSS is associated to P25 (Kataya et al., 2009), and in when one of the partners is a potyvirus, assuming that the WMV, we hypothesized that it might reside in HCPro, as this other unrelated virus would be “assisted” by the potyvirus. is the most common RSS in many other potyviruses (Valli Initially characterized for the potyvirus Potato virus Y and the et al., 2018). This assumption about WMV HCPro acting as potexvirus Potato virus X (Damirdagh and Ross, 1967; Vance, RSS was confirmed experimentally for the first time in the 1991), the interactions of potyviruses and unrelated viruses present study. produced outcomes remarkably coincidental in many cases To further explore virus-virus interactions in mixed infections (Taiwo et al., 2007; Zeng et al., 2007; Mascia et al., 2010). of WMV and CYSDV, we decided to focus on their RNA The identification of the potyviral Helper Component Proteinase silencing suppression machinery. In addition to the known (HCPro) as a candidate RNA silencing suppressor (RSS) RSSs, other viral gene products that might participate in the (Anandalakshmi et al., 1998; Kasschau and Carrington, 1998) activity have been selected. For instance, the rather variable provided a sort of mechanistic model to explain the outcome, P1 of potyviruses (Valli et al., 2007; Shan et al., 2015) that but the multifunctional nature of HCPro, including the has been considered a modulator of RSS in several viruses complexities of its activity as RSS (Lakatos et al., 2006; Valli (Fernández et al., 2013; Pasin et al., 2014) and the P22 of et al., 2018) makes specially challenging to reveal the underlying CYSDV, the gene product downstream of the P25 region in molecular aspects. Most of the interactions involving a potyvirus the RNA1, located in a position where other criniviruses encode and an unrelated virus have been described only partially, proteins involved in this function (Kreuze et al., 2005; Cañizares mainly attending to the macroscopic and visible outcomes, et al., 2008; Weinheimer et al., 2015; Kubota and Ng, 2016; likely leaving many unexplored molecular mechanisms. Indeed, Chen et al., 2019; Orfanidou et al., 2019). the simplistic view in which a potent RSS would always work In this study, thematically independent of our previous in a pro-viral direction for other viruses might not respond publication on the same mixed infection of WMV and CYSDV to the underlying complexities of these interactions. Interestingly, in melon (Domingo-Calap et al., 2020), we report an unexpected one remarkable exception to the potyvirus-assisted synergistic and dose-dependent negative effect of WMV P1 on the RNA interactions was reported in sweet potato crops, where the silencing suppression activity of CYSDV P25 when co-expressed potyvirus partners were benefited in co-infections with the in a transient assay in Nicotiana benthamiana, and discuss its crinivirus Sweet potato chlorotic stunt virus (SPCSV; Tairo et al., possible contribution to the complex virus-virus interactions 2005; Untiveros et al., 2007; Clark et al., 2012). For this exception, during mixed infections. a gene product different of HCPro, the P1N-PISPO, was associated to RSS activity in the potyvirus Sweet potato feathery mottle virus (SPFMV; Mingot et al., 2016; Untiveros et al., 2016). MATERIALS AND METHODS In the present work, we have considered the mixed infection of the potyvirus Watermelon mosaic virus (WMV) and the Plasmid Constructs crinivirus Cucurbit yellow stunting disorder virus (CYSDV). These Gene fragments corresponding to CYSDV P25 (639 nts), CYSDV two viruses belong to different taxonomic families, Potyviridae P22 (579 nts), WMV P1 (1,332 nts), and WMC HCPro (1,371 (Wylie et al., 2017) and Closteroviridae (Fuchs et al., 2020), nts) were RT-PCR-amplified using viral genomes extracted they are transmitted by different vectors, but they are commonly respectively from CYSDV (for P25 and P22) and WMV (for found together in melon and other cucurbits, causing high P1 and HCPro) infected plants, using Phusion High Fidelity production losses (Juarez et al., 2013). WMV is a widely spread PCR System (Thermo Sciences) and the specific primers shown aphid-transmitted potyvirus with the usual genomic and biological in Table 1. A cis construct spanning P1HCPro was also prepared Frontiers in Microbiology | www.frontiersin.org 2 March 2021 | Volume 12 | Article 645530 Domingo-Calap et al. WMV Affects CYSDV Silencing Suppression TABLE 1 | Sequence of primers used for cloning viral gene products. (corresponding to the CVYV P1b RSS) and negative (an empty vector named delta) controls kindly provided by Dr. A. Valli Gene product Sense1 Primer sequence2 (CNB-CSIC, Madrid, Spain), and essentially following previously WMV P1 Fw 5' CACCATGGCAACAATCATGTTTGGAG 3' described procedures (Giner et al., 2010; Mingot et al., 2016). Rv 5' TCAATAATGTTGAATATCTTCTATCTCC 3' For the combinations of different constructs, the OD was WMV HCPro Fw 5' CACCATGTCTCACACTCCAGAAG 3' adjusted to keep equal concentration of bacteria in the Rv 5' TCAACCAACCCTGTAAAACTTC 3' agroinfiltration solution. GFP fluorescence was observed under CYSDV P22 Fw 5' CACCATGCAGAGTGTTGGAGTAG 3' Rv 5' TCAAGGGATGGTGCCCATG 3' long-wavelength UV light (Black Ray model B 100AP, UV CYSDV P25 Fw 5' CACCATGGGAGAAGATTTACAAGAAC 3' products), and pictures were taken using a Nikon digital camera. Rv 5' CTACTCCAACACTCTGCATTC 3' 1 Sequence corresponding to the viral genome are considered Forward (Fw), while Quantitative RT-PCR complementary are Reverse (Rv). Total RNA was extracted from two leaf disks of agroinfiltrated Bold nucleotides correspond to 5' additions required for properly oriented cloning in N. benthamiana plants using TRIzol reagent (Invitrogen) 2 pENTR-TOPO. In the case of potyviral gene products, a methionine codon inserted in the forward primer for Helper Component Proteinase (HCPro) and sequences according to the provider’s instructions, including an additional complementary to stop codons added in the reverse dowstream primers of both P1 ethanol precipitation step to improve purity of RNA. Quality and HCPro are underlined. and concentration of RNA was estimated using a NanoDrop® spectrophotometer (ND-8000). After DNase treatment to using primers forward and reverse upstream P1 and downstream eliminate genomic DNA, about 1 μg of total RNA extracted HCPro, respectively. The amplified PCR products were purified from plant samples was used to produce cDNA with the High- and cloned into pENTRY D-TOPO GATEWAY expression system Capacity cDNA Reverse Transcription kit (Applied Biosystems™), (Invitrogen), resulting in the constructs pENTRY_CYSDV-P22, following protocols provided by the manufacturer. SYBRGreen pENTRY_CYSDV-P25, pENTRY_WMV-P1, pENTRY_ (Roche) was used to detect PCR products in a Light Cycler WMV-HCPro, and pENTRY_WMV-P1HCPro. Subsequently, 480 (Roche) equipment using triplicates of 100 ng of the the different viral genes were mobilized through LR recombination resulting single-stranded cDNA. Specific primers previously into the different destination plasmid vectors (Tanaka et al., described for GFP (Leckie and Neal Stewart, 2011) and ubiquitin 2011), including pGWB-702 (containing the 35S promoter and (Lacomme et al., 2003) sequences were used. Statistical analysis the Ω enhancer) for silencing suppression analysis; pGWB-742 was performed applying t-test to ∆Ct values using the program (containing 35S promoter and N-terminal phusion to EYFP) GraphPad Prism version 6.0. and pGWB-745 (same promoter and N-terminal phusion to ECFP) for subcellular localization; pGWB 715 (providing Protein Extract Preparations and Western N-terminal tag 3xHa) and pGWB 718 (providing N-terminal Blotting tag 4xMyc) for protein detection and co-immunoprecipitation Tagged versions of the different viral gene products were assays. For bimolecular fluorescence complementation (BiFC) constructed using pGW 715 and pGW 718 backbones, and assays (see below), the destination plasmid vectors pBiFC2 and mobilized to A. tumefaciens for agroinfiltration in N. benthamiana pBiFC3 were used (Azimzadeh et al., 2008; Ochoa et al., 2019). (see above). Samples (four leaf disks) collected were processed from mock or agroinfiltrated N. benthamiana plants were Agroinfiltration and Green Fluorescent collected and homogenized in 200 ul of extraction buffer Protein Imaging (20 mM Tris-HCl pH 7.5, 30 mM NaCl, 1 mM EDTA, 0.5% Nicotiana benthamiana plants were grown at 23–25°C with a NP-40, 2% b-mercaptoethanol). Cell debris were removed by photoperiod of 16 h of light and 8 h of darkness. Cultures centrifugation at 13,200 rpm at 4°C for 10 min, and an aliquot of Agrobacterium tumefaciens strain EHA105 carrying the (30 μl) of the supernatant were boiled in Laemmli’s sample different plasmids were grown overnight at 28°C, and cells buffer (250 mM Tris-HCl pH 7.5, 40% Glicerol, 8% SDS, 20% were resuspended to an equal OD600 (=0.3) in induction buffer b-mercaptoethanol). Samples were separated on 12% SDS-PAGE, (10 mM MES/NaOH, pH 5.6, 10 mM MgCl2, 150 μM transferred to Amersham Protran nitrocellulose blotting acetosyringone) for 3 h before agroinfiltration of patches in membrane and subjected to Western blot analysis. For detection, leaves of N. benthamiana plants at the 4–6-leaf growth stage. Anti-Myc Tag Antibody, clone 4A6 (Millipore) and Anti-Ha For co-infiltration, the A. tumefaciens cultures were adjusted (Sigma-Aldrich) were used followed by incubation with adequate to the same optical density at OD600 (=0.3) and mixed in secondary anti-mouse antibodies. The proteins were visualized induction buffer to be agroinfiltrated at the same time. by chemiluminescence (Super Signal West Femto, Thermo The identification of RNA silencing suppression activity was Scientifics) according to the manufacturer’s instructions using done by visual inspection of green fluorescent protein (GFP) a ChemiDoc imaging system (BioRad). fluorescence in agroinfiltrated leaves, comparing the different independent viral proteins P22, P25, P1, HCPro, and the cis Subcellular Localization and construct P1-HCPro when expressed transiently (see above) Co-localization through co-agroinfiltrated with the construct pBIN-GFP, using The coding gene products for WMV P1 and CYSDV P25 always in every leaf for comparison purposes both a positive proteins were inserted in the vectors pGWB742 (35S pro, Frontiers in Microbiology | www.frontiersin.org 3 March 2021 | Volume 12 | Article 645530 Domingo-Calap et al. WMV Affects CYSDV Silencing Suppression N-EYFP) and pGWB745 (35S pro, N-ECFP) respectively, (Figure 1A). The different constructs were tested individually generating constructs for expression of YFP-WMV-P1 and using the standard transient expression assay in N. benthamiana CFP-CYSDV-P25 fusion proteins. The transient expression leaves with GFP as reporter, and the corresponding CVYV of both products in N. benthamiana leaves was achieved P1b and delta constructs as positive and negative controls, co-agroinfiltrating the constructs with an additional plasmid following described procedures (Giner et al., 2010; Mingot for expression of the RSS P19 of TBSV, pBin-TBSV-P19 et al., 2016). In the experiments with individual gene products, (kindly provided by Dr. Montse Martin, CRAG, Barcelona, both WMV HCPro and CYSDV P25 exhibited activities as Spain). A confocal laser scanning Leica TCS SP5 (Leica RSSs at 3 and 5 dpa, lasting up to at least 7 dpa in the case Microsystems, Germany) microscope was used to observe of HCPro, while P1 and P22 did not show detectable GFP at the N. benthamiana epidermal cells at the adequate wavelengths any of the tested time points, indicating that they do not for each reporter. suppress local RNA silencing in the assay (Figure 1B). These results served to confirm the RSS activity of the P25 protein BiFC Assays in our CYSDV Spanish isolate, and to visually determine for Expression of fusion proteins with N- and C-fragments of the the first time the RSS activity of the HCPro protein of WMV, reporter YFP, denominated, respectively YFPN and YFPC was as it was expected attending to the antecedents for many other achieved in A. tumefaciens strain EHA105 carrying plasmid viruses in the same genus (Valli et al., 2018). Since P1 and for YFPC-WMV-P1, YFPN-WMV-P1, YFPC-CYSDV-P25, and HCpro are naturally expressed in cis as part of a larger YFPN-CYSDV-P25. Each construct and pBIN-TBSV-P19 were polyprotein, the construct P1-HCPro with the two gene products cultured separately and the cells were resuspended to an equal in cis was also tested, showing again a strong RSS activity, OD600 (=0.3). Equal volumes of the combinations YFPC- YFPN- indistinguishable of the activity exhibited by the WMV HCPro and pBIN-TBSV-P19 were mixed in induction buffer (10 mm alone (Figure 1B). MES/NaOH, pH 5.6, 10 mm MgCl2, 150 μm acetosyringone). To verify the correct expression of all viral products constructs, Nicotiana benthamiana plants at the 4–6-leaf stage were used MYC-tagged versions were agroinfiltrated and samples analyzed for agroinfiltration. At 3, 5, and 7 days post agroinfiltration by SDS-PAGE and Western blot (Figure 1C). (dpa), epidermal cells of agroinfiltrated leaves were observed for fluorescence emission under a confocal laser scanning microscope (Leica TCS SP5) at a wavelength of 514 nm. Combination of Heterologous Gene Products: Negative Effect of WMV P1 on the RSS Activity of CYSDV P25 Co-immunoprecipitation of Tagged To determine possible interactions between gene products of Proteins the two viruses considered, a set of experiments were designed For immunoprecipitation 50 ul of Anti-c-Myc agarose beads to compare the performance in assays of RSS activity of different (Sigma) were washed before adding the samples with Phosphate- combinations involving WMV P1 or HCPro, paired together Buffered Saline (PBS) 1x. Samples (about 1 g) of mock-, with CYSDV P22 or P25 (Figure 2A). In the combinations HA-WMV-P1, MYC-CYSDV-P25, or HA-WMV-P1 + including WMV HCPro as one of the partners, the high RSS MYC-CYSDV-P25 agroinfiltrated N. benthamiana leaves were activity remained apparently unaltered when comparing in the collected, ground in immunoprecipitation buffer (20 mM same leaf patches infiltrated with HCPro alone or co-expressed Tris-HCl pH 7.5, 30 mM NaCl, 1 mM EDTA, 0,5% NP-40, along with either P22 or P25, suggesting that the assay was 2% b-mercaptoethanol) and cleared by centrifugation at not sensible enough to detect an additive effect of P25 on 13,200 rpm for 10 min at 4°C. Supernatants of the different top of the very high activity exhibited by HCPro. However, lysates were added to samples of washed beads and incubated in the reciprocal combinations involving WMV P1, while its for 1 h at 4°C. After immunoprecipitation, beads were washed expression in the control with P22 remained non-functional three times with ice-cold PBS 1x for 1 min each. Input extracts as expected, a negative effect of the non-suppressor WMV P1 and eluates of immunoprecipitations were used for Western was observed on the RSS activity of the CYSDV P25 protein. blot analysis (see above). This unexpected result was consistently reproduced, always showing an obvious attenuation of the intensity of the GFP signal with respect to that observed when the suppressor was RESULTS expressed alone (a representative example is shown in the upper left photograph of Figure 2A). The same effect could Confirmation of RNA Silencing be observed along different time points during the experiment, Suppression Activity for Transiently as shown for 3 and 5 dpa, before the weak activity of P25 Expressed Viral Gene Products faded after 7 dpa (Figure 2B). To further confirm these Individual gene products from the viruses WMV and CYSDV observations, we performed relative qRT-PCR measuring the were selected for testing their activities, including already known expression levels of the GFP mRNA (Figure 2C), showing RSSs and others with potential modulator effects. For the that the negative effect was present as early as at 3 dpa, when potyvirus, P1 and HCPro proteins were tested, and in the visually only a weak RSS activity was observed in the patches crinivirus, we chose P25 and P22, both located in RNA1 co-agroinfiltrated with P1+P25 (Figure 2B, see below). Frontiers in Microbiology | www.frontiersin.org 4 March 2021 | Volume 12 | Article 645530 Domingo-Calap et al. WMV Affects CYSDV Silencing Suppression A B C FIGURE 1 | Confirmation of RNA silencing suppression (RSS) activity in individually expressed viral gene products of Watermelon mosaic virus (WMV) and Cucurbit yellow stunting disease virus (CYSDV). (A) Genome maps of WMV and CYSDV. Below the size rule in kilobases, the viral ssRNAs are shown as solid horizontal lines (10,035 nucleotides for WMV, and 9,123 and 7,976 for the RNA1 and RNA2 of the bipartite CYSDV, respectively). In the WMV genome, VPg is depicted as a solid circle at the 5' end, and the poly-A tail as An at the 3' end. Viral ORFs are depicted as boxes with the names of the mature gene products. The PIPO region is shown below the polyprotein of the potyvirus leading to the partially out-of-frame product P3N-PIPO, and the protease-specific cleavages sites are indicated by arrows above and matching symbols in the gene products responsible of the proteolytic process. The different frames are shown for the crinivirus gene products. (B) The left part of the panel shows schematically the organization of patches in the Nicotiana benthamiana leaves used to test RSS activity in co-agroinfiltration of the selected gene products with the reporter green fluorescent protein (GFP). The positions for positive and negative controls, corresponding to the P1b of Cucumber vein yellowing virus (CVYV) and an empty vector (delta), respectively, are also shown. Constructs for expression of the individual gene products and the P1-HCPro cis construct are indicated above the pictures of leaves. Pictures were taken at 5 days post agroinfiltration (dpa) under UV light. (C) A representative Western blot analysis of the N-terminus MYC-tagged gene products shown in the diagrams with their expected molecular weights shown in the table. A representative blot revealed after incubation with the indicated anti-MYC specific antibody and the corresponding anti-mouse, is shown with agroinfiltrated samples, collected at 3 and 5 dpa time points, as indicated, and a non-agroinfiltrated N. benthamiana control lane labeled as C. M lane shows the migration of pre-stained molecular weight markers (sizes in KDa on the left side). RbcL corresponds to the Ponceau red-stained blot showing the large subunit of Rubisco protein as loading control. Frontiers in Microbiology | www.frontiersin.org 5 March 2021 | Volume 12 | Article 645530 Domingo-Calap et al. WMV Affects CYSDV Silencing Suppression A B C D FIGURE 2 | Effect on RSS activity of the combination of heterologous selected gene products of WMV and CYSDV. (A) Schematic organization of patches in N. benthamiana leaves and comparison of effects on RSS activity of individual and combined gene products when co-agroinfiltrated with the reporter GFP. The positions for positive and negative controls, corresponding to the P1b of CVYV and an empty vector (delta), respectively, are also shown in the left half of every leaf. In the right side of the pictures and adjacent to the patches are depicted the constructs for expression of the individual gene products of WMV (P1 or HCPro) and of CYSDV (P25 or P22), with their corresponding combinations in the lower row. Pictures were taken at 5 dpa under UV light. (B) Time course evolution of RSS activity at 3, 5, and 7 dpa for the individual gene products WMV P1 (upper right patches), CYSDV P25 (central right patches), and their combination (lower right patches). Positive and negative controls as in A (patches in left side halves). (C) Quantification of GFP mRNA by qRT-PCR, relative to the reference gene ubiquitin, at 3 dpa, in patches agroinfiltrated with the constructs indicated below the bars. Mean values and SDs of three independent replicates are plotted, indicating statistically significant differences after t-test analysis (**indicate p < 0.05, values of p = 0.0013 for P25 vs. P1, and p = 0.0022 for P25 vs. P1+P25). (D) Absence of effect on RSS activity of CYSDV P25 when co-agroinfiltrated with CYSDV P22. Positive and negative controls as in Figure 1B (patches in left side half). Pictures were taken at 3, 5, and 7 dpa under UV light. To rule out an unspecific effect on CYSDV P25 caused was performed as described above, finding that the by co-expression of any other protein, we tested as an capacity of P25 to exhibit RSS activity was unaltered by the additional control if the co-expression of CYSDV P22 co-expression of P22 at the same 3 and 5 dpa time points could also affect the RSS activity of P25. The experiment (Figure 2D). Frontiers in Microbiology | www.frontiersin.org 6 March 2021 | Volume 12 | Article 645530 Domingo-Calap et al. WMV Affects CYSDV Silencing Suppression A B FIGURE 3 | Western blot analysis of selected N-terminus tagged proteins after transient expression, individually or combined. (A) Samples of N. benthamiana patches individually agroinfiltrated with MYC-P25 (left panel) and HA-P1 (right panel) constructs collected daily between 1 and 8 dpa are shown, besides a non- agroinfiltrated N. benthamiana control lane labeled as C. The blots are revealed after incubation with the corresponding anti-MYC or anti-HA specific antibodies. (B) Samples of patches co-agroinfiltrated with MYC-P25 and HA-P1 collected daily between 1 and 8 dpa are shown, besides a N. benthamiana control lane labeled as C, and revealed with anti-MYC (left panel) or anti-HA (right panel) specific antibodies. For both (A,B) lanes labeled with M show the migration of pre-stained molecular weight marker (sizes in KDa on the left side), and RbcL correspond to the Ponceau red-stained blots showing the large subunit of Rubisco protein as loading control. Dynamics of Protein Expression in Patches blot analysis with the corresponding specific antibodies is shown Agroinfiltrated With CYSDV P25 and WMV in Figure 3. In the patches agroinfiltrated individually P1, Both Individually and in Combination (Figure 3A), a steady increase of MYC-P25 expression was Epitope tagged versions of the two gene products were tested observed, probably reflecting its own RSS activity, reaching the for expression after agroinfiltration. Two different tags, MYC highest amount of detectable protein at the end of the sampling in the case of CYSDV P25 (MYC-P25) and HA in the case period (8 dpa), while HA-P1 expression apparently peaked as of WMV P1 (HA-P1), were chosen to allow independent early as 2 dpa, later showing a slight reduction followed by detection of each gene product in the co-agroinfiltrated patches, near constant levels until the last day sampled. In the case of and samples (pooled of three leaves from three independent the patches co-agroinfiltrated with MYC-P25 and HA-P1, the plants) were taken daily up to 8 dpa. Representative Western analysis also showed detection of both proteins along the Frontiers in Microbiology | www.frontiersin.org 7 March 2021 | Volume 12 | Article 645530 Domingo-Calap et al. WMV Affects CYSDV Silencing Suppression A B FIGURE 4 | Dose response of the presence of WMV P1 on the RSS activity of CYSDV P25. (A) Schematic organization of patches in N. benthamiana leaves co-agroinfiltrated with the reporter GFP. The same fixed concentration of P25 is used together with different amounts of P1 to reach the indicated ratios as shown in each picture, with positive and negative controls included in the left half of every leaf as in Figure 1B. Pictures were taken at 3 dpa under UV light. (B) Quantitative values showing inverse correlation of the ratio of CYSDV P25: WMV P1 and the relative copies of GFP mRNA measured by qRT-PCR with ubiquitin as reference gene. The graph shows the values for average and SD corresponding to three biological replicates per treatment. complete period, with a delay in the peak of HA-P1 occurring Subcellular Localization of WMV P1 and around day 4, and a very similar dynamic of steady accumulation CYSDV P25 in Nucleus and Cytoplasm in the case of MYC-P25 (Figure 3B). These results proved To investigate the subcellular localization of WMV P1 and that the reduced RSS activity of CYSDV P25 when co-expressed CYSDV P25 proteins, we cloned them into constructs fused with WMV P1 was not caused by lack of expression. to fluorescent markers using the plasmids pGWB742 (containing YFP for fusion to the N-terminus of the cloned protein) and Dose-Dependent Effect of the Presence of pGWB745 (for fusion to CFP, also in N-terminus). The constructs WMV on the RSS Activity of CYSDV P25 were transformed into A. tumefaciens strain EHA105 and To evaluate if the observed negative effect was correlated agroinfiltrated into N. benthamiana leaves. Confocal microscopy to the relative expression levels of the two viral products, examination showed that both fusion proteins, WMV P1 tagged an experiment of dose-response was designed. Using the with YFP and CYSDV P25 tagged with CFP, were located in same concentration of A. tumefaciens culture transformed the nucleus and the cytoplasm of the agroinfiltrated cells, and with the construct for expression of CYSDV P25, up to that they apparently co-localize in both compartments (Figure 5). three dilutions of the culture harboring the partner product WMV P1 were tested for their effects on the RSS activity. Interaction of WMV P1 and CYSDV P25 Assuming that the quantities of CYSDV P25 were kept To test if there was a direct interaction between WMV constant, the quantities of the partner WMV P1 were decreasing P1 and CYSDV P25 when co-expressed transiently in exponentially by a factor of 2, which correlated with a visible N. benthamiana, we performed BiFC and co-immunoprecipitation increase of GFP under UV light (Figure 4A), also detectable assays. As shown by confocal microscopy observations, the as a linear increase of mRNA levels corresponding to GFP split YFP fragments fused to WMV P1 and CYSDV P25 did (Figure 4B). These results indicated that the RSS activity of reconstitute a visible fluorescence with the appropriate filter, CYSDV P25 recovered when the relative amount of WMV indicating that the two proteins could interact in the cytoplasm P1 decreased. of the agroinfiltrated cells (Figure 6A). Frontiers in Microbiology | www.frontiersin.org 8 March 2021 | Volume 12 | Article 645530 Domingo-Calap et al. WMV Affects CYSDV Silencing Suppression to consider first the RSS function. Experiments were designed to transiently express the gene products known to participate in this function during individual infections, and then to combine them in order to find out possible interactions. In addition to known RSSs, we included other gene products that might modulate their activity in RNA silencing suppression. Following this strategy, an unexpected negative effect on the RSS activity of the P25 of CYSDV was observed when this viral product was expressed together with the P1 of WMV. To rule out a possible effect on the expression level of CYSDV P25 when co-expressed along with WMV P1, we have tested the amounts of tagged protein versions by Western blot analysis in agroinfiltrated patches. Compared with the individually expressed protein, we did not observed lack of expression in CYSDV P25 at different time points, therefore supporting a true affectation of the RSS activity. Interestingly, the dynamic of accumulation of tagged WMV P1 appeared to be altered in the co-agroinfiltrated samples, with a delayed peak compared with the individually expressed control. Unfortunately, the damage suffered after agroinfiltration precluded longer analysis, but it is tempting to speculate if these changes along this limited time might reflect somehow the peculiar dynamics mentioned to occur during FIGURE 5 | Subcellular localization of fluorescently labeled WMV P1 and mixed infections (Domingo-Calap et al., 2020). CYSDV P25 proteins. Confocal laser microscopy of N. benthamiana leaves agroinfiltrated with the constructs indicated schematically on the left: P1-YFP To our knowledge, this is the first description of an interaction (upper lane), P25-CFP (central lane) and with both constructs at the same between viral gene products of two unrelated plant viruses time (bottom lane). The images labeled with YFP correspond to the yellow that interfere on the RSS activity of one of them. Before color field, those labeled with CFP to the blue color field, and in the last speculating about the importance of this observation, a couple column the bright field is shown, the column. In the samples agroinfiltrated of previous considerations are cautionary needed: (i) the effect with individual constructs observations were also performed with the conditions for the two YFP and CFP, without detecting any cross fluorescence was observed in transient expression, not during viral infections; (not shown). Bar size 20 μm. and (ii) it was occurring in a different plant of the natural common hosts where the two viruses might co-exist. Thus, we cannot assume directly that our observations after transient Furthermore, when the same two tagged proteins with MYC expression could reflect exactly what occurs during co-infection and HA epitopes used in the previous time course analysis of the two viruses in a naturally infected cucurbit host. Indeed, (see Figure 3) were co-agroinfiltrated and tested for the localization and behavior of the selected gene products co-inmunoprecipitation, a product corresponding to HA-P1 expressed transiently in N. benthamiana might be quite different was precipitated along with the MYC-P25, indicating that indeed to what really happens during infections in cucurbits. In other the two proteins can interact (Figure 6B). words, could this negative interaction be occurring as well during WMV and CYSDV co-infection? Unfortunately, this question is difficult to address. First, adequate infectious clones DISCUSSION of CYSDV that could be manipulated for tagging gene products in plants are not yet available, being only reported a version Despite the common occurrence of multiple viral infections in capable to replicate in protoplasts (Owen et al., 2016). plants, in many cases our understanding of the interactions We attempted to use this tool for whitefly transmission assays occurring when two or more unrelated viruses share the same and to recreate mixed infections, unfortunately with no success plant is still incomplete (Moreno and López-Moya, 2020). As (unpublished data). Another limitation to directly study mixed an example, our recent analysis of melon plants co-infected infections of the two viruses derives from difficulties to infect by WMV and CYSDV revealed a complex scenario, with dynamic N. benthamiana, the model plant species, where the transient changes along the progress of the infections, that could even expression observations were performed: despite being a highly affect the transmissibility of the viruses by their insect vectors: susceptible plant for many viruses, including isolates of WMV briefly, the initial synergism and boost of CYSDV accumulation (Lecoq et al., 2011; Aragonés et al., 2019), CYSDV appears was later moderated and accompanied by a sort of recovery not to be able to infect and not even replicate in protoplasts phenotype (Domingo-Calap et al., 2020). Intrigued by this of this species (Owen et al., 2016). The alternative approach peculiar behavior, we have addressed if virus-virus interactions to test the activity of P25 in susceptible cucurbits previously between WMV and CYSDV might help to explain the outcome infected with WMV would require to knock-out the activity of the mixed infection. To start exploring at the molecular of WMV HCPro, a rather complex task, which could compromise level the interactions between the two partner viruses, we decided the infectivity of WMV or modify its pathogeneicity, as suggested Frontiers in Microbiology | www.frontiersin.org 9 March 2021 | Volume 12 | Article 645530 Domingo-Calap et al. WMV Affects CYSDV Silencing Suppression A B FIGURE 6 | Interaction of WMV P1 and CYSDV P25. (A) Schematic representation of bimolecular fluorescence complementation (BiFC) constructs with the split YFP fused to WMV P1 and CYSDV P25, and the observation using confocal laser microscopy of N. benthamiana leaves agroinfiltrated simultaneously with the two constructs. The picture YFP corresponds to the yellow color field and the same area is shown under bright field illumination. Control samples agroinfiltrated with individual constructs were analyzed without detecting any fluorescence (not shown). Bar size 20 μm. (B) Immunoprecipitation of viral protein variants tagged with MYC or HA, as indicated. Western blot analysis with anti-MYC and anti-HA antibodies, and Ponceau staining of the large subunit of Rubisco (RbcL) as control of loading, are shown for the input fractions and the corresponding immunoprecipitation samples, as indicated. by previous mutagenesis and variability studies performed with potyviruses in phloem has been shown in certain cases (Rajamäki other potyviruses (Torres-Barceló et al., 2008; Han et al., 2016). and Valkonen, 2003; Ion-Nagy et al., 2006). Also, another potyvirus Regarding localization in the plant, our knowledge on the of cucurbits, Zucchini yellow mosaic virus (ZYMV), showed a distribution of WMV and CYSDV during mixed infections is broad distribution in Zucchini when tagged with a visual marker also incomplete. Crinivirus are phloem-restricted viruses, and (Majer et al., 2017). Although, at this point, we cannot provide CYSDV distribution within the plant is particularly variable evidence for the presence of the two viruses co-infecting the (Marco et al., 2003). A different crinivirus of cucurbits has been same cells, there are sufficient antecedents to make this possibility recently tagged with GFP (Wei et al., 2018), but unfortunately plausible. Further studies will be required to verify if indeed constructing a similar tool for CYSDV is not feasible nowadays, WMV and CYSDV might coincide in certain cells, and also if as already mentioned. On the other hand, there are no specific their distribution is altered or not during mixed infections. studies on the distribution of WMV within different tissues and With respect to intracellular localization, the P1 of potyviruses cells in the plant, but comparing to other potyviruses it was was found in the cytoplasm associated to other viral products expected to invade more cell types (Kogovsek et al., 2011). As (Lehto et al., 1998), and also trafficking to the nucleolus as a further complication, the distribution of viruses in mixed and recently reported (Martinez et al., 2014). Our results are individual infections could be different, as it was shown for compatible with these localizations. However, no information instance in combinations of potyvirus and cucumovirus (Ryang is available regarding intracellular localization of CYSDV P25, et al., 2004; Mochizuki et al., 2016). Interestingly, in sweet potato and only limited data are reported in other criniviruses and plants co-infected by SPCSV and potyviruses, crinivirus for other gene products, such as those involved in cell-to-cell components were detected outside the phloem, in contrast with movement (Qiao et al., 2018). Again, further investigations its restricted phloem localization in single infections (Nome will be required to better understand if our observations of et al., 2007). Despite the lack of information about WMV, we can transiently expressed P25 reflect the intracellular localization still make an educated guess, considering that the presence of of this viral protein during the virus infection. Frontiers in Microbiology | www.frontiersin.org 10 March 2021 | Volume 12 | Article 645530 Domingo-Calap et al. WMV Affects CYSDV Silencing Suppression The function(s) played by the P1 of potyviruses has remained observation, we hope our work will stimulate further research elusive, and only recently some insights about its role(s) as to better understand if these kind of interactions form part modulator of essential activities during infection are being of the expected fine-tuning of RSS and other important functions revealed. As a first important point to consider, the P1 is a during mixed infections, and how it can contribute to virus remarkably variable product among potyviruses, what argues pathogenicity in the different situations. for its participation in host range determination, as it has been suggested by different authors (Valli et al., 2007; Revers and García, 2015; Cui and Wang, 2019; Nigam et al., 2019). Works DATA AVAILABILITY STATEMENT with Plum pox virus (PPV) showed that P1 is involved in replication and pathogenicity (Maliogka et al., 2012; Pasin et al., The original contributions presented in the study are included 2014). Concerning RSS related functions, it has been proposed in the article/supplementary material, further inquiries can that P1 might stimulate the activity of HCPro (Anandalakshmi be directed to the corresponding author. et al., 1998; Pruss et al., 2004; Rajamaki et al., 2005), but it is unclear if this stimulatory effect could be exerted on other RSSs, especially considering the importance of their expression in cis AUTHOR CONTRIBUTIONS (Fernández et al., 2013). Interestingly, partial truncation of P1 in PPV revealed an antagonistic role for P1 in self-processing with MD-C, OC, AM, and JL-M designed the research, analyzed a negative impact in local infection (Shan et al., 2018), but the data, composed figures, and wrote the manuscript. MD-C, again it is uncertain if similar effects can be expected as well OC, ME, AM, and JL-M performed the experiments. All authors in other viruses. Our finding here might provide further clues contributed to the article and approved the submitted version. to disentangle if the role(s) played by P1 are particularly relevant in the case of mixed infections. Indeed, although the interaction between CYSDV P25 and WMV P1 was revealed because it FUNDING affected the RSS function of the crinivirus protein, the changes in the dynamic of accumulation of P1 observed in our western Work in the author’s laboratory was financed by grants AGL2016- blot analysis might suggest an effect on the potyvirus infection. 75529-R and PID2019-105692RB-100 from Spanish Ministry It will be interesting to find out if this kind of interactions of Science and Innovation. MD-C was supported by FPI contract might occur as well in other combinations of potyviruses plus BES-2014-068970 from Ministry of Science and Innovation criniviruses. Many important crops are susceptible to criniviruses and FEDER. OC was supported by 2018 FI_B 00329 from (Tzanetakis et al., 2013; Abrahamian and Abou-Jawdah, 2014; AGAUR, Generalitat de Catalunya, and Fons Social Europeu. Fiallo-Olivé and Navas-Castillo, 2019; Ruiz Garcia and Janssen, AM was supported by European Union’s Horizon 2020 research 2020), and therefore co-infections with potyviruses are very and innovation programme under the Marie Skłodowska-Curie likely to occur. Particularly intriguing could be the case of grant agreement No 657527. We acknowledge financial support sweet potato, suffering strong synergism but in the opposite from the Spanish Ministry of Science and Innovation-State direction, with a boost of the potyviruses and other unrelated Research Agency (AEI), through the “Severo Ochoa Programme virus accumulation when co-infected by the crinivirus SPCSV for Centres of Excellence in R&D” SEV-2015-0533 and CEX2019- (Untiveros et al., 2007; Cuellar et al., 2015). As mentioned, the 000902-S, and from Generalitat de Catalunya CERCA Institution RSS of sweet potato-infecting potyviruses appears to differ from and support of the publication fee by the CSIC Open Access the usual activity of HCPro, with the function shifted to a Publication Support Initiative through its Unit of Information partially out-of-frame gene product P1N-PISPO produced after Resources for Research (URICI). polymerase slippage (Mingot et al., 2016; Untiveros et al., 2016). Finally, it should be noted that each one of the virus partners will be producing several proteins simultaneously during a ACKNOWLEDGMENTS mixed infection, at least 10 and 13 different mature products for the potyvirus and the crinivirus, respectively. Thus, our We want to thank our colleagues Montse Martin (CRAG) and analysis testing only a few heterologous products in combination Adrian Valli (CNB-CSIC, Madrid, Spain) for different constructs, of two by two elements is just a first attempt to start exploring and Ioannis Livieratos (Plant Virology Laboratory, CIHEAM- a presumably much richer landscape of interactions. As a novel MAICh, Chania, Greece) for the gift of CYSDV cloned materials. REFERENCES Anandalakshmi, R., Pruss, G. J., Ge, X., Marathe, R., Mallory, A. C., Smith, T. H., et al. (1998). A viral suppressor of gene silencing in plants. Proc. Natl. Abrahamian, P. E., and Abou-Jawdah, Y. (2014). Whitefly-transmitted criniviruses Acad. Sci. U. S. A. 95, 13079–13084. doi: 10.1073/pnas.95.22.13079 of cucurbits: current status and future prospects. Virusdisease 25, 26–38. Aragonés, V., Pérez-de-Castro, A., Cordero, T., Cebolla-Cornejo, J., López, C., doi: 10.1007/s13337-013-0173-9 Picó, B., et al. (2019). A watermelon mosaic virus clone tagged with the Alcaide, C., Rabadán, M. P., Moreno-Pérez, M. G., and Gómez, P. (2020). yellow visual maker phytoene synthase facilitates scoring infectivity in melon Implications of mixed viral infections on plant disease ecology and evolution. breeding programs. Eur. J. Plant Pathol. 153, 1317–1323. doi: 10.1007/ Adv. Virus Res. 106, 145–169. doi: 10.1016/bs.aivir.2020.02.001 s10658-018-01621-x Frontiers in Microbiology | www.frontiersin.org 11 March 2021 | Volume 12 | Article 645530 Domingo-Calap et al. WMV Affects CYSDV Silencing Suppression Azimzadeh, J., Nacry, P., Christodoulidou, A., Drevensek, S., Camilleri, C., Kataya, A. R. A., Suliman, M. N. S., Kalantidis, K., and Livieratos, I. C. (2009). Amiour, N., et al. (2008). Arabidopsis Tonneau1 proteins are essential for Cucurbit yellow stunting disorder virus p25 is a suppressor of post-transcriptional preprophase band formation and interact with centrin. Plant Cell 20, 2146–2159. gene silencing. Virus Res. 145, 48–53. doi: 10.1016/j.virusres.2009.06.010 doi: 10.1105/tpc.107.056812 Kogovsek, P., Kladnik, A., Mlakar, J., Znidaric, M. T., Dermastia, M., Ravnikar, M., Baulcombe, D. (2004). RNA silencing in plants. Nature 431, 356–363. doi: et al. (2011). Distribution of potato virus Y in potato plant organs, tissues, 10.1038/nature02874 and cells. Phytopathology 101, 1292–1300. doi: 10.1094/PHYTO-01-11-0020 Cañizares, M. C., Navas-Castillo, J., and Moriones, E. (2008). Multiple suppressors Kreuze, J. F., Savenkov, E. I., Cuellar, W., Li, X., and Valkonen, J. P. T. (2005). of RNA silencing encoded by both genomic RNAs of the crinivirus, tomato Viral class 1 RNase III involved in suppression of RNA silencing viral class chlorosis virus. Virology 379, 168–174. doi: 10.1016/j.virol.2008.06.020 1 RNase III involved in SUppression of RNA silencing. J. Virol. 79, 7227–7238. Chen, S., Sun, X., Shi, Y., Wei, Y., Han, X., Li, H., et al. (2019). Cucurbit doi: 10.1128/JVI.79.11.7227-7238.2005 chlorotic yellows virus p22 protein interacts with cucumber SKP1LB1 and Kubota, K., and Ng, J. C. K. (2016). Lettuce chlorosis virus P23 suppresses its F-box-like motif is crucial for silencing suppressor activity. Viruses 11:818. RNA silencing and induces local necrosis with increased severity at raised doi: 10.3390/v11090818 temperatures. Phytopathology 106, 653–662. doi: 10.1094/PHYTO-09-15-0219-R Clark, C. A., Davis, J. A., Abad, J. A., Cuellar, W. J., Fuentes, S., Kreuze, J. F., Lacomme, C., Hrubikova, K., and Hein, I. (2003). Enhancement of virus- et al. (2012). Sweetpotato viruses: 15 years of progress on understanding and managing complex diseases. Plant Dis. 96, 168–185. doi: 10.1094/ induced gene silencing through viral-based production of inverted-repeats. PDIS-07-11-0550 Plant J. 34, 543–553. doi: 10.1046/j.1365-313X.2003.01733.x Csorba, T., Kontra, L., and Burgyán, J. (2015). Viral silencing suppressors: Lakatos, L., Csorba, T., Pantaleo, V., Chapman, E. J., Carrington, J. C., Liu, Y. -P., tools forged to fine-tune host-pathogen coexistence. Virology 479–480, et al. (2006). Small RNA binding is a common strategy to suppress RNA 85–103. doi: 10.1016/j.virol.2015.02.028 silencing by several viral suppressors. EMBO J. 25, 2768–2780. doi: 10.1038/ Cuellar, W. J., Galvez, M., Fuentes, S., Tugume, J., and Kreuze, J. (2015). sj.emboj.7601164 Synergistic interactions of begomoviruses with sweet potato chlorotic stunt Leckie, B. M., and Neal Stewart, C. (2011). Agroinfiltration as a technique for virus (genus Crinivirus) in sweet potato (Ipomoea batatas L.). Mol. Plant rapid assays for evaluating candidate insect resistance transgenes in plants. Pathol. 16, 459–471. doi: 10.1111/mpp.12200 Plant Cell Rep. 30, 325–334. doi: 10.1007/s00299-010-0961-2 Cui, H., and Wang, A. (2019). The biological impact of the hypervariable Lecoq, H., Fabre, F., Joannon, B., Wipf-Scheibel, C., Chandeysson, C., Schoeny, A., N-terminal region of potyviral genomes. Annu. Rev. Virol. 6, 255–274. doi: et al. (2011). Search for factors involved in the rapid shift in watermelon 10.1146/annurev-virology-092818-015843 mosaic virus (WMV) populations in South-Eastern France. Virus Res. 159, Damirdagh, I. S., and Ross, A. F. (1967). A marked synergistic interaction of 115–123. doi: 10.1016/j.virusres.2011.05.004 potato viruses X and Y in inoculated leaves of tobacco. Virology 31, 296–307. Lehto, K., Pehu, E., Pehu, T., and Arbatova, J. (1998). Localization of the P1 doi: 10.1016/0042-6822(67)90174-2 protein of potato Y potyvirus in association with cytoplasmic inclusion Desbiez, C., Joannon, B., Wipf-Scheibel, C., Chandeysson, C., and Lecoq, H. bodies and in the cytoplasm of infected cells. J. Gen. Virol. 79, 2319–2323. (2011). Recombination in natural populations of watermelon mosaic virus: doi: 10.1099/0022-1317-79-10-2319 new agronomic threat or damp squib? J. Gen. Virol. 92, 1939–1948. doi: Majer, E., Llorente, B., Rodríguez-Concepción, M., and Daròs, J. A. (2017). 10.1099/vir.0.031401-0 Rewiring carotenoid biosynthesis in plants using a viral vector. Sci. Rep. 7, Domingo-Calap, M. L., Moreno, A. B., Díaz Pendón, J. A., Moreno, A., Fereres, A., 1–10. doi: 10.1038/srep41645 and López-Moya, J. J. (2020). Assessing the impact on virus transmission Maliogka, V. I., Salvador, B., Carbonell, A., Saenz, P., Leon, D. S., Oliveros, J. C., and insect vector behavior of a viral mixed infection in melon. Phytopathology et al. (2012). Virus variants with differences in the P1 protein coexist in a 110, 174–186. doi: 10.1094/PHYTO-04-19-0126-FI plum pox virus population and display particular host-dependent pathogenicity Fernández, F. T., González, I., Doblas, P., Rodríguez, C., Sahana, N., Kaur, H., features. Mol. Plant Pathol. 13, 877–886. doi: 10.1111/j.1364-3703.2012.00796.x et al. (2013). The influence of cis-acting P1 protein and translational elements Marco, C. F., Aguilar, J. M., Abad, J., Gómez-Guillamón, M. L., and Aranda, M. A. on the expression of potato virus Y helper-component proteinase (HCPro) (2003). Melon resistance to cucurbit yellow stunting disorder virus is in heterologous systems and its suppression of silencing activity. Mol. Plant characterized by reduced virus accumulation. Phytopathology 93, 844–852. Pathol. 14, 530–541. doi: 10.1111/mpp.12025 doi: 10.1094/PHYTO.2003.93.7.844 Fiallo-Olivé, E., and Navas-Castillo, J. (2019). Tomato chlorosis virus, an emergent Martinez, F., Daros, J. A., Martínez, F., Daròs, J.-A., Martinez, F., and Daros, J. A. plant virus still expanding its geographical and host ranges. Mol. Plant (2014). Tobacco etch virus protein P1 traffics to the nucleolus and associates Pathol. 20, 1307–1320. doi: 10.1111/mpp.12847 with the host 60S ribosomal subunits during infection. J. Virol. 88, 10725–10737. Fuchs, M., Bar-Joseph, M., Candresse, T., Maree, H. J., Martelli, G. P., Melzer, M. J., doi: 10.1128/JVI.00928-14 et al. (2020). ICTV virus taxonomy profile: Closteroviridae. J. Gen. Virol. Mascia, T., Cillo, F., Fanelli, V., Finetti-Sialer, M. M., De Stradis, A., Palukaitis, P., 101, 364–365. doi: 10.1099/jgv.0.001397 et al. (2010). Characterization of the interactions between cucumber mosaic Gibbs, A. J., Hajizadeh, M., Ohshima, K., and Jones, R. A. C. (2020). The virus and potato virus Y in mixed infections in tomato. Mol. Plant-Microbe potyviruses: an evolutionary synthesis is emerging. Viruses 12, 1–30. doi: Interact. 23, 1514–1524. doi: 10.1094/MPMI-03-10-0064 10.3390/v12020132 Mingot, A., Valli, A., Rodamilans, B., San León, D., Baulcombe, D. C., García, J. A., Giner, A., Lakatos, L., García-Chapa, M., López-Moya, J. J., and Burgyán, J. et al. (2016). The P1N-PISPO trans-frame gene of sweet potato feathery (2010). Viral protein inhibits RISC activity by argonaute binding through mottle potyvirus is produced during virus infection and functions as an conserved WG/GW motifs. PLoS Pathog. 6:e1000996. doi: 10.1371/journal. RNA silencing suppressor. J. Virol. 90, 3543–3557. doi: 10.1128/JVI.02360-15 ppat.1000996 Mochizuki, T., Nobuhara, S., Nishimura, M., Ryang, B. S., Naoe, M., Matsumoto, T., Han, J.-Y., Chung, J., Kim, J., Seo, E.-U., Kilcrease, J. P., Bauchan, G. R., et al. et al. (2016). The entry of cucumber mosaic virus into cucumber xylem (2016). Comparison of helper component-protease RNA silencing suppression is facilitated by co-infection with zucchini yellow mosaic virus. Arch. Virol. activity, subcellular localization, and aggregation of three Korean isolates 161, 2683–2692. doi: 10.1007/s00705-016-2970-0 of turnip mosaic virus. Virus Genes 52, 592–596. doi: 10.1007/s11262-016-1330-1 Moreno, A. B., and López-Moya, J. J. (2020). When viruses play team sports: Ion-Nagy, L., Lansac, M., Eyquard, J. P., Salvador, B., Garcia, J. A., Le Gall, O., mixed infections in plants. Phytopathology 110, 29–48. doi: 10.1094/ et al. (2006). PPV long-distance movement is occasionally permitted in PHYTO-07-19-0250-FI resistant apricot hosts. Virus Res. 120, 70–78. doi: 10.1016/j.virusres.2006.01.019 Moreno, I. M., Malpica, J. M., Diaz-Pendon, J. A., Moriones, E., Fraile, A., Juarez, M., Legua, P., Mengual, C. M., Kassem, M. A., Sempere, R. N., Gómez, P., and Garcia-Arenal, F. (2004). Variability and genetic structure of the population et al. (2013). Relative incidence, spatial distribution and genetic diversity of watermelon mosaic virus infecting melon in Spain. Virology 318, 451–460. of cucurbit viruses in eastern Spain. Ann. Appl. Biol. 162, 362–370. doi: doi: 10.1016/j.virol.2003.10.002 10.1111/aab.12029 Navas-Castillo, J., Fiallo-Olivé, E., and Sánchez-Campos, S. (2011). Emerging Kasschau, K. D., and Carrington, J. C. (1998). A counterdefensive strategy of virus diseases transmitted by whiteflies. Annu. Rev. Phytopathol. 49, 219–248. plant viruses. Cell 95, 461–470. doi: 10.1016/S0092-8674(00)81614-1 doi: 10.1146/annurev-phyto-072910-095235 Frontiers in Microbiology | www.frontiersin.org 12 March 2021 | Volume 12 | Article 645530 Domingo-Calap et al. WMV Affects CYSDV Silencing Suppression Navas-Castillo, J., López-Moya, J. J., and Aranda, M. A. (2014). Whitefly- Tollenaere, C., Susi, H., and Laine, A. L. (2016). Evolutionary and epidemiological transmitted RNA viruses that affect intensive vegetable production. Ann. implications of multiple infection in plants. Trends Plant Sci. 21, 80–90. Appl. Biol. 165, 155–171. doi: 10.1111/aab.12147 doi: 10.1016/j.tplants.2015.10.014 Nigam, D., LaTourrette, K., Souza, P. F. N., and Garcia-Ruiz, H. (2019). Genome- Torres-Barceló, C., Martín, S., Darós, J. A., and Elena, S. F. (2008). From wide variation in potyviruses. Front. Plant Sci. 10:1439. doi: 10.3389/ hypo- to hypersuppression: effect of amino acid substitutions on the RNA- fpls.2019.01439 silencing suppressor activity of the tobacco etch potyvirus HC-pro. Genetics Nome, C. F., Nome, S. F., Guzmán, F., Conci, L., and Laguna, I. G. (2007). 180, 1039–1049. doi: 10.1534/genetics.108.091363 Localization of sweet potato chlorotic stunt virus (SPCSV) in synergic Tzanetakis, I. E., Martin, R. R., and Wintermantel, W. M. (2013). Epidemiology infection with potyviruses in sweet potato. Biocell 31, 23–31. doi: 10.32604/ of criniviruses: an emerging problem in world agriculture. Front. Microbiol. biocell.2007.31.023 4:119. doi: 10.3389/fmicb.2013.00119 Ochoa, J., Valli, A., Martín-Trillo, M., Simón-Mateo, C., García, J. A., and Untiveros, M., Fuentes, S., and Salazar, L. F. (2007). Synergistic interaction of Rodamilans, B. (2019). Sterol isomerase HYDRA1 interacts with RNA silencing sweet potato chlorotic stunt virus (Crinivirus) with carla-, cucumo-, ipomo-, suppressor P1b and restricts potyviral infection. Plant Cell Environ. 42, and potyviruses infecting sweet potato. Plant Dis. 91, 669–676. doi: 10.1094/ 3015–3026. doi: 10.1111/pce.13610 PDIS-91-6-0669 Orfanidou, C. G., Mathioudakis, M. M., Katsarou, K., Livieratos, I., Katis, N., and Untiveros, M., Olspert, A., Artola, K., Firth, A. E., Kreuze, J. F., and Valkonen, J. P. T. Maliogka, V. I. (2019). Cucurbit chlorotic yellows virus p22 is a suppressor of (2016). A novel sweet potato potyvirus open reading frame (ORF) is expressed local RNA silencing. Arch. Virol. 164, 2747–2759. doi: 10.1007/s00705-019-04391-x via polymerase slippage and suppresses RNA silencing. Mol. Plant Pathol. Owen, C. A., Moukarzel, R., Huang, X., Kassem, M. A., Eliasco, E., Aranda, M. A., 17, 1111–1123. doi: 10.1111/mpp.12366 et al. (2016). In vitro synthesized RNA generated from cDNA clones of Valli, A. A., Gallo, A., Rodamilans, B., López-Moya, J. J., and García, J. A. both genomic components of cucurbit yellow stunting disorder virus replicates (2018). The HCPro from the Potyviridae family: an enviable multitasking in cucumber protoplasts. Viruses 8:170. doi: 10.3390/v8060170 helper component that every virus would like to have. Mol. Plant Pathol. Pasin, F., Simón-Mateo, C., and García, J. A. (2014). The hypervariable amino- 19, 744–763. doi: 10.1111/mpp.12553 terminus of P1 protease modulates potyviral replication and host defense Valli, A., García, J. A., and López-Moya, J. J. (2015). “Potyviridae” in responses. PLoS Pathog. 10:e1003985. doi: 10.1371/journal.ppat.1003985 eLS Encyclopedia of life sciences. Chichester, UK: John Wiley & Sons, Ltd, Pruss, G. J., Lawrence, C. B., Bass, T., Li, Q. Q., Bowman, L. H., and Vance, V. 1–10. (2004). The potyviral suppressor of RNA silencing confers enhanced resistance Valli, A., López-Moya, J. J., and García, J. A. (2007). Recombination and gene to multiple pathogens. Virology 320, 107–120. doi: 10.1016/j.virol.2003.11.027 duplication in the evolutionary diversification of P1 proteins in the family Qiao, W., Medina, V., Kuo, Y. W., and Falk, B. W. (2018). A distinct, non- Potyviridae. J. Gen. Virol. 88, 1016–1028. doi: 10.1099/vir.0.82402-0 virion plant virus movement protein encoded by a crinivirus essential for Vance, V. B. (1991). Replication of potato virus X RNA is altered in coinfections systemic infection. mBio 9, e02230–e02218. doi: 10.1128/mBio.02230-18 with potato virus Y. Virology 182, 486–494. doi: 10.1016/0042-6822(91)90589-4 Rajamaki, M. L., Kelloniemi, J., Alminaite, A., Kekarainen, T., Rabenstein, F., Verma, R. K., Mishra, M., Marwal, A., and Gaur, R. K. (2020). Identification, and Valkonen, J. P. (2005). A novel insertion site inside the potyvirus P1 genetic diversity and recombination analysis of watermelon mosaic virus cistron allows expression of heterologous proteins and suggests some P1 isolates. 3 Biotech 10:257. doi: 10.1007/s13205-020-02248-8 functions. Virology 342, 88–101. doi: 10.1016/j.virol.2005.07.019 Voinnet, O. (2001). RNA silencing as a plant immune system against viruses. Rajamäki, M.-L., and Valkonen, J. P. T. (2003). Localization of a potyvirus Trends Genet. 17, 449–459. doi: 10.1016/S0168-9525(01)02367-8 and the viral genome-linked protein in wild potato leaves at an early stage Wei, Y., Han, X., Wang, Z., Gu, Q., Li, H., Chen, L., et al. (2018). Development of systemic infection. Mol. Plant-Microbe Interact. 16, 25–34. doi: 10.1094/ of a GFP expression vector for cucurbit chlorotic yellows virus. Virol. J. MPMI.2003.16.1.25 15:93. doi: 10.1186/s12985-018-1004-9 Revers, F., and García, J. A. (2015). Molecular biology of potyviruses. Adv. Weinheimer, I., Jiu, Y., Rajamäki, M.-L., Matilainen, O., Kallijärvi, J., Cuellar, W. J., Virus Res. 92, 101–199. doi: 10.1016/bs.aivir.2014.11.006 et al. (2015). Suppression of RNAi by dsRNA-degrading RNaseIII enzymes Ruiz Garcia, L., and Janssen, D. (2020). Epidemiology and control of emerging of viruses in animals and plants. PLoS Pathog. 11:e1004711. doi: 10.1371/ criniviruses in bean. Virus Res. 280:197902. doi: 10.1016/j.virusres.2020.197902 journal.ppat.1004711 Ryang, B. S., Kobori, T., Matsumoto, T., Kosaka, Y., and Ohki, S. T. (2004). Wintermantel, W. M., Gilbertson, R. L., Natwick, E. T., and McCreight, J. D. Cucumber mosaic virus 2b protein compensates for restricted systemic spread (2017). Emergence and epidemiology of cucurbit yellow stunting disorder of potato virus Y in doubly infected tobacco. J. Gen. Virol. 85, 3405–3414. virus in the American desert southwest, and development of host doi: 10.1099/vir.0.80176-0 plant resistance in melon. Virus Res. 241, 213–219. doi: 10.1016/j. Shan, H., Pasin, F., Tzanetakis, I. E., Simón-Mateo, C., García, J. A., and virusres.2017.06.004 Rodamilans, B. (2018). Truncation of a P1 leader proteinase facilitates Wu, X., Valli, A., García, J. A., Zhou, X., and Cheng, X. (2019). The tug-of- potyvirus replication in a non-permissive host. Mol. Plant Pathol. 19, war between plants and viruses: great progress and many remaining questions. 1504–1510. doi: 10.1111/mpp.12640 Viruses 11:203. doi: 10.3390/v11030203 Shan, H., Pasin, F., Valli, A., Castillo, C., Rajulu, C., Carbonell, A., et al. Wylie, S. J., Adams, M., Chalam, C., Kreuze, J., López-Moya, J. J., Ohshima, K., (2015). The Potyviridae P1a leader protease contributes to host range specificity. et al. (2017). ICTV virus taxonomy profile: Potyviridae. J. Gen. Virol. 98, Virology 476, 264–270. doi: 10.1016/j.virol.2014.12.013 352–354. doi: 10.1099/jgv.0.000740 Syller, J. (2012). Facilitative and antagonistic interactions between plant viruses in Zeng, R., Liao, Q., Feng, J., Li, D., and Chen, J. (2007). Synergy between mixed infections. Mol. Plant Pathol. 13, 204–216. doi: 10.1111/j.1364-3703.2011.00734.x cucumber mosaic virus and zucchini yellow mosaic virus on cucurbitaceae Syller, J., and Grupa, A. (2016). Antagonistic within-host interactions between hosts tested by real-time reverse transcription-polymerase chain reaction. plant viruses: molecular basis and impact on viral and host fitness. Mol. Acta Biochim. Biophys. Sin. 39, 431–437. doi: 10.1111/j.1745-7270.2007.00292.x Plant Pathol. 17, 769–782. doi: 10.1111/mpp.12322 Tairo, F., Mukasa, S. B., Jones, R. A. C. C., Kullaya, A., Rubaihayo, P. R., and Conflict of Interest: The authors declare that the research was conducted in Valkonen, J. P. T. (2005). Unravelling the genetic diversity of the three main the absence of any commercial or financial relationships that could be construed viruses involved in sweet potato virus disease (SPVD), and its practical as a potential conflict of interest. implications. Mol. Plant Pathol. 6, 199–211. doi: 10.1111/j.1364-3703.2005.00267.x Taiwo, M. A., Kareem, K. T., Nsa, I. Y., and Hughes, J. D. (2007). Cowpea Copyright © 2021 Domingo-Calap, Chase, Estapé, Moreno and López-Moya. This viruses: effect of single and mixed infections on symptomatology and virus is an open-access article distributed under the terms of the Creative Commons concentration. Virol. J. 4:95. doi: 10.1186/1743-422X-4-95 Attribution License (CC BY). The use, distribution or reproduction in other forums Tanaka, Y., Nakamura, S., Kawamukai, M., Koizumi, N., and Nakagawa, T. is permitted, provided the original author(s) and the copyright owner(s) are credited (2011). Development of a series of gateway binary vectors possessing a and that the original publication in this journal is cited, in accordance with accepted tunicamycin resistance gene as a marker for the transformation of Arabidopsis academic practice. No use, distribution or reproduction is permitted which does not thaliana. Biosci. Biotechnol. Biochem. 75, 804–807. doi: 10.1271/bbb.110063 comply with these terms. Frontiers in Microbiology | www.frontiersin.org 13 March 2021 | Volume 12 | Article 645530